CN111073895B - Gene APX1 for enhancing plant resistance to lepidoptera pests and application thereof - Google Patents
Gene APX1 for enhancing plant resistance to lepidoptera pests and application thereof Download PDFInfo
- Publication number
- CN111073895B CN111073895B CN201911361654.6A CN201911361654A CN111073895B CN 111073895 B CN111073895 B CN 111073895B CN 201911361654 A CN201911361654 A CN 201911361654A CN 111073895 B CN111073895 B CN 111073895B
- Authority
- CN
- China
- Prior art keywords
- gene
- apx1
- nucleotide sequence
- seq
- mutant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 101150000280 APX1 gene Proteins 0.000 title claims abstract description 35
- 241000607479 Yersinia pestis Species 0.000 title claims abstract description 23
- 241000255777 Lepidoptera Species 0.000 title claims abstract description 17
- 230000002708 enhancing effect Effects 0.000 title claims abstract description 13
- -1 pplication Species 0.000 title abstract description 6
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 27
- 241000196324 Embryophyta Species 0.000 claims abstract description 20
- 241000238631 Hexapoda Species 0.000 claims abstract description 17
- 239000002773 nucleotide Substances 0.000 claims abstract description 14
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 14
- 241000219195 Arabidopsis thaliana Species 0.000 claims abstract description 5
- 125000003275 alpha amino acid group Chemical group 0.000 claims abstract description 4
- 238000000034 method Methods 0.000 claims description 9
- 102000004169 proteins and genes Human genes 0.000 claims description 7
- 241000500441 Plutellidae Species 0.000 claims description 5
- 238000005516 engineering process Methods 0.000 claims description 3
- 150000001413 amino acids Chemical class 0.000 claims description 2
- 238000009395 breeding Methods 0.000 claims description 2
- 230000001488 breeding effect Effects 0.000 claims description 2
- 230000000295 complement effect Effects 0.000 claims description 2
- 230000002068 genetic effect Effects 0.000 claims description 2
- 230000035772 mutation Effects 0.000 claims description 2
- 230000008569 process Effects 0.000 claims description 2
- 241000500437 Plutella xylostella Species 0.000 abstract description 17
- 238000011161 development Methods 0.000 abstract description 4
- 240000008042 Zea mays Species 0.000 abstract description 3
- 235000005824 Zea mays ssp. parviglumis Nutrition 0.000 abstract description 3
- 235000002017 Zea mays subsp mays Nutrition 0.000 abstract description 3
- 235000005822 corn Nutrition 0.000 abstract description 3
- 230000000607 poisoning effect Effects 0.000 abstract description 3
- 238000011160 research Methods 0.000 abstract description 3
- 108091000106 RNA cap binding Proteins 0.000 abstract description 2
- 230000000694 effects Effects 0.000 description 12
- 102000004190 Enzymes Human genes 0.000 description 11
- 108090000790 Enzymes Proteins 0.000 description 11
- 239000000463 material Substances 0.000 description 11
- 108700006445 Arabidopsis APX1 Proteins 0.000 description 10
- 102000005720 Glutathione transferase Human genes 0.000 description 8
- 108010070675 Glutathione transferase Proteins 0.000 description 8
- 241000219194 Arabidopsis Species 0.000 description 7
- 230000019617 pupation Effects 0.000 description 5
- 238000001784 detoxification Methods 0.000 description 4
- 239000000575 pesticide Substances 0.000 description 4
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 3
- 108091033409 CRISPR Proteins 0.000 description 3
- 238000010354 CRISPR gene editing Methods 0.000 description 3
- 101150034064 col gene Proteins 0.000 description 3
- 238000001514 detection method Methods 0.000 description 3
- 239000012634 fragment Substances 0.000 description 3
- 230000001105 regulatory effect Effects 0.000 description 3
- 238000012163 sequencing technique Methods 0.000 description 3
- 239000000126 substance Substances 0.000 description 3
- 238000012360 testing method Methods 0.000 description 3
- 101100379375 Arabidopsis thaliana APX1 gene Proteins 0.000 description 2
- 244000221633 Brassica rapa subsp chinensis Species 0.000 description 2
- 235000010149 Brassica rapa subsp chinensis Nutrition 0.000 description 2
- 108010015742 Cytochrome P-450 Enzyme System Proteins 0.000 description 2
- 102000003849 Cytochrome P450 Human genes 0.000 description 2
- 240000007594 Oryza sativa Species 0.000 description 2
- 235000007164 Oryza sativa Nutrition 0.000 description 2
- 240000006394 Sorghum bicolor Species 0.000 description 2
- 235000011684 Sorghum saccharatum Nutrition 0.000 description 2
- 230000003321 amplification Effects 0.000 description 2
- 238000003556 assay Methods 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 238000010367 cloning Methods 0.000 description 2
- 230000018109 developmental process Effects 0.000 description 2
- 235000005686 eating Nutrition 0.000 description 2
- 238000001962 electrophoresis Methods 0.000 description 2
- 230000002255 enzymatic effect Effects 0.000 description 2
- 239000013604 expression vector Substances 0.000 description 2
- 238000003780 insertion Methods 0.000 description 2
- 230000037431 insertion Effects 0.000 description 2
- 238000003199 nucleic acid amplification method Methods 0.000 description 2
- 231100000572 poisoning Toxicity 0.000 description 2
- 239000013615 primer Substances 0.000 description 2
- 230000002940 repellent Effects 0.000 description 2
- 239000005871 repellent Substances 0.000 description 2
- 230000001846 repelling effect Effects 0.000 description 2
- 235000009566 rice Nutrition 0.000 description 2
- 238000005070 sampling Methods 0.000 description 2
- 230000004083 survival effect Effects 0.000 description 2
- 241000254173 Coleoptera Species 0.000 description 1
- 102000018832 Cytochromes Human genes 0.000 description 1
- 108010052832 Cytochromes Proteins 0.000 description 1
- 239000003155 DNA primer Substances 0.000 description 1
- 102100037373 DNA-(apurinic or apyrimidinic site) endonuclease Human genes 0.000 description 1
- 206010059866 Drug resistance Diseases 0.000 description 1
- 241000588724 Escherichia coli Species 0.000 description 1
- 206010064571 Gene mutation Diseases 0.000 description 1
- 206010020710 Hyperphagia Diseases 0.000 description 1
- 241000500891 Insecta Species 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 238000012408 PCR amplification Methods 0.000 description 1
- 102000028391 RNA cap binding Human genes 0.000 description 1
- 102000052708 Recessive Genes Human genes 0.000 description 1
- 108700005079 Recessive Genes Proteins 0.000 description 1
- 238000012271 agricultural production Methods 0.000 description 1
- 238000004166 bioassay Methods 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 230000037396 body weight Effects 0.000 description 1
- 239000013599 cloning vector Substances 0.000 description 1
- 239000002299 complementary DNA Substances 0.000 description 1
- 239000002131 composite material Substances 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000012217 deletion Methods 0.000 description 1
- 230000037430 deletion Effects 0.000 description 1
- 238000009826 distribution Methods 0.000 description 1
- 230000032669 eclosion Effects 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 230000037406 food intake Effects 0.000 description 1
- 235000012631 food intake Nutrition 0.000 description 1
- 238000003209 gene knockout Methods 0.000 description 1
- 238000010353 genetic engineering Methods 0.000 description 1
- 102000054766 genetic haplotypes Human genes 0.000 description 1
- 230000036541 health Effects 0.000 description 1
- 230000000749 insecticidal effect Effects 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 230000000813 microbial effect Effects 0.000 description 1
- 244000005700 microbiome Species 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 235000016709 nutrition Nutrition 0.000 description 1
- 230000035764 nutrition Effects 0.000 description 1
- 238000005457 optimization Methods 0.000 description 1
- 235000020830 overeating Nutrition 0.000 description 1
- 235000021110 pickles Nutrition 0.000 description 1
- 239000013612 plasmid Substances 0.000 description 1
- 239000002574 poison Substances 0.000 description 1
- 231100000614 poison Toxicity 0.000 description 1
- 230000002265 prevention Effects 0.000 description 1
- 238000003757 reverse transcription PCR Methods 0.000 description 1
- 238000003786 synthesis reaction Methods 0.000 description 1
- 230000002194 synthesizing effect Effects 0.000 description 1
- 230000001131 transforming effect Effects 0.000 description 1
- 239000013598 vector Substances 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Botany (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a gene APX1 for enhancing plant resistance to lepidoptera pests and application thereof, wherein the gene has a nucleotide sequence shown as SEQ ID NO.1 or a gene sequence with higher homology with the nucleotide sequence, an encoded amino acid sequence is shown as SEQ ID NO.2, the gene belongs to an RNA 5' cap binding protein gene, the gene mutant can effectively inhibit the growth and development of plutella xylostella and has a poisoning effect, in addition, arabidopsis thaliana is used as a model plant, and the insect-resistant gene has good colinearity with homologous genes of other crops, and has higher research and application values. The invention provides important gene resources for the development of natural insect-resistant strains of crops such as rape and corn.
Description
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a gene APX1 for enhancing plant resistance to lepidoptera pests and application thereof.
Background
In agricultural production, pests are one of the important causes affecting crop yield and quality, and cause great economic loss to farmers every year. Lepidoptera includes two kinds of insects, i.e., moth and butterfly, and belongs to the subclass pteroidea and holomorphia. This order is the 2 nd largest order of the Insecta, second only to the Coleoptera. The distribution range is very wide, and the tropical varieties are most abundant. Most kinds of larvae are harmful to various cultivated plants, and those with larger body form usually eat leaves or bore branches completely. Smaller patients tend to suffer from leaf curl, leaf ornamentation, scabbling, silking and netting, or food intake by digging into plant tissues. The adult insects mostly take nectar and the like as supplementary nutrition, or the mouth organs are degraded and are not taken for eating, so that direct harm is not caused generally. At present, the prevention and control of crop pests mainly depend on chemical pesticides, but the chemical pesticides have pungent odor and have serious threats to the environment and human health, so that the natural insecticidal materials mined from natural resources are increasingly valued by people. As is well known, BT protein is a biological pesticide and can effectively kill lepidoptera pests such as diamondback moth and the like, and the BT protein is widely applied, but a plurality of researches find that various lepidoptera pests have drug resistance to BT and weaken the control effect on the pests, so that a new pest-resistant mode is urgently needed to be found. The natural insect-resistant gene is searched in plants, and the method has important theoretical and practical significance for developing novel natural insect-resistant line crops.
Disclosure of Invention
The invention aims to provide a gene APX1 for enhancing plant resistance to lepidoptera pests and application thereof aiming at the defects of the existing research, provides a new material for biological control of the lepidoptera pests, and provides a theoretical basis and gene resources for developing crop strains resistant to the lepidoptera pests.
The invention is realized by the following technical scheme:
a gene APX1 for enhancing resistance of plant to lepidopteran pest, said gene comprising:
(I) a nucleotide sequence shown as SEQ ID NO. 1; or
(II) a complementary sequence of the nucleotide sequence shown as SEQ ID NO. 1; or
(III) a sequence which encodes the same protein as the nucleotide sequence of (I) or (II) but which differs from the nucleotide sequence of (I) or (II) due to the degeneracy of the genetic code; or
(IV) a homologous gene sequence which is obtained by replacing, deleting or adding one or more nucleotide sequences in the nucleotide sequence of (I) or (II) and has the same or similar function with the nucleotide sequence of (I) or (II).
The nucleotide sequence shown as SEQ ID NO.1 is Arabidopsis APX1 gene obtained by cloning from Arabidopsis plants, the CDS has a total length of 666bp, the amino acid sequence is shown as SEQ ID NO.2, and the gene can be directly cloned from crops and can also be obtained by artificial synthesis.
The protein coded by the APX1 gene has an amino acid sequence shown in SEQ ID NO.2 and totally codes 221 amino acids.
An expression vector which is a recombinant plasmid into which the above recombinant gene is inserted and which uses a microbial cell or a plant cell as a host cell.
A transformant which is a microorganism or a plant cell containing the above expression vector or having the above gene APX1 integrated therein.
The application of the gene APX1 for enhancing the plant resistance to lepidoptera pests in enhancing the plant resistance to lepidoptera pests is disclosed, wherein an APX1 mutant is insect resistance caused by invisible mutation, and in the breeding process, a CRISPR knockout technology is utilized or a haplotype with a loss function is screened from a natural type to obtain an insect-resistant variety, so that the purpose of enhancing the plant resistance to lepidoptera pests is achieved.
As a further optimization scheme of the invention, the plants comprise important economic crops such as rape, corn, rice, sorghum and the like, and the aim is to promote, test and develop new insect-resistant strains and provide novel insect-resistant materials for the important economic crops.
Compared with the prior art, the invention has the following advantages: the invention provides a gene APX1 for enhancing plant resistance to lepidoptera pests and application thereof, wherein the gene APX1 codes an RNA 5' cap binding protein, through bioassay tests of an Arabidopsis APX1 gene mutant, namely, a wild type Arabidopsis and an APX1 gene mutant of a diamondback moth of the lepidoptera pests are fed forcibly, and experimental results show that after the Arabidopsis APX1 gene mutant is eaten, the death rate of the diamondback moth larvae is increased remarkably, the weight is reduced remarkably, the pupation rate is reduced remarkably, and the enzyme activity of related detoxifying enzymes is increased remarkably; in addition, the mutant has a remarkable repelling effect on diamondback moths. The novel insect-resistant material is developed and obtained based on the novel function of the Arabidopsis APX1 gene, the pollution of chemical pesticides to the environment and the poison of human bodies are avoided, the insect-resistant material belongs to the insect killing function caused by recessive gene mutation, and novel insect-resistant strains can be developed in different crops by using technologies such as CRISPR gene knockout and the like.
Drawings
FIG. 1 is an APX1 CDS full-length amplification electrophoretogram, wherein, Lane 2 is APX1 gene fragment, M is Marker (Trans 2K);
FIG. 2 is a bar graph showing the results of the expression level of APX1 gene in mutant APX 1-1;
FIG. 3 shows the statistics of the mortality (3a), body weight (3b) and pupation rate (3c) of plutella xylostella by forced feeding;
FIG. 4 shows the results of detecting the enzymatic activity (4a) of glutathione-S transferase (GST) and the enzymatic activity (4b) of cytochrome C450(CYP450) by forcing plutella xylostella to eat.
FIG. 5 shows the results of experiments on selective feeding of Arabidopsis thaliana wild type and APX1 mutant by Plutella xylostella.
Detailed Description
Example 1
1. Material
The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used therein are commercially available products unless otherwise specified.
2. Method of producing a composite material
2.1 cloning of Arabidopsis thaliana APX1 Gene
2.1.1 using wild Col-0 variety of Arabidopsis as material, extracting RNA, and reverse transcribing the extracted total RNA to synthesize the first strand cDNA as the template for PCR amplification.
2.1.2 with designed specific primers:
APX1-F:(5'>GGTTGAAGGATTTTG<3')
APX1-R:(5'>ATTGTGGGAGGATGGTGCC<3')
and (3) carrying out amplification to obtain a gene fragment of 666bp (the electrophoresis result is shown in figure 1), connecting the gene fragment to a T cloning vector PEASY-T5 simple vector to obtain T5-APX1, transforming the T5-APX1 into escherichia coli, picking positive clones and sequencing, wherein the sequencing result is consistent with the prediction result, and obtaining the nucleotide sequence shown in SEQ ID No. 1.
2.2 Arabidopsis thaliana mutant Gene identification and Gene function
2.2.1 obtaining Arabidopsis thaliana APX1 gene mutant by ordering independent T-DNA insertion mutant seed number (PL32) from Nottingham Arabidopsis thaliana seed Center (Stock Center) in England according to APX1 gene sequence, synthesizing identification primer according to T-DNA primer identification method provided by TAIR website:
Salk_131503(PL32):
LP:5'>AAAATTTGATTCCCGTTCGTC<3'
RP:5'>AAAATTTGATTCCCGTTCGTC<3'
LBb1.3:5'>ATTTTGCCGATTTCGGAAC<3'
the T-DNA insertion mutant seed number (PL32) can be inserted into exon 4 of APX1 gene to cause the functional deletion of APX1 gene by analyzing the sequencing result of flanking sequence. The RT-PCR results showed that the expression level of the gene was significantly down-regulated in the mutant (FIG. 2).
2.2.2 wild type col and APX1 gene mutant which grow for two weeks under long sunshine are used for forcedly feeding plutella xylostella which just enters the overeating period, and the survival condition, the weight and the pupation condition of the plutella xylostella are counted, the result is shown in figure 3, and the plutella xylostella fed with the APX1 gene mutant has the survival condition, and the weight, the pupation and other indexes which are obviously lower than those of a control group from the forced feeding experimental result of figure 3. Therefore, the arabidopsis APX1 mutant can obviously inhibit the growth and development of diamondback moth and has a poisoning function.
2.3 detection of enzyme Activity of related detoxification enzymes
2.3.1 glutathione-S transferase (GST) assay
And forcibly feeding arabidopsis wild type col and APX1 gene mutants to the brassica chinensis, sampling the brassica chinensis moths after 24 hours, and detecting the activity of GST detoxification enzymes. The enzyme activity detection method is completed by adopting a kit method of Nanjing to build glutathione-S transferase (GSH-TS) of Biotechnology Limited.
The results are shown in fig. 4a, after the arabidopsis APX1 gene mutant is eaten, the GST enzyme activity is obviously up-regulated.
2.3.2 cytochrome P450(CYP450) assay
And forcibly feeding arabidopsis wild type and col and APX1 gene mutants to the pickles, sampling the diamondback moths after 24 hours, and detecting the activity of the CYP450 detoxification enzymes. The enzyme activity detection method is completed by adopting a cytochrome P450(CYP450) enzyme-linked reagent kit method of Beijing Huatai Biotechnology Limited.
The result is shown in fig. 4b, after the arabidopsis APX1 gene mutant is eaten, the CYP450 enzyme activity is obviously up-regulated.
2.3.2 Arabidopsis APX1 mutant repellency test for diamondback moth
As shown in fig. 5, the odor emitted by arabidopsis wild type and APX1 mutant was enriched using a repelling test instrument, and then diamondback moth larvae were inserted in the middle of the instrument and selected according to the direction of odor as the air pump aspirates air.
The results are shown in figure 5, and the number of larvae in plutella xylostella selection of arabidopsis wild type was significantly higher than those in selection of APX1 mutant over time. It was concluded that the APX1 mutant had a repellent effect on diamondback moths.
3. Conclusion
After eating the arabidopsis APX1 gene mutant, the weight, pupation and eclosion rate of the diamondback moth are obviously reduced, which shows that the APX1 gene mutant material can obviously inhibit the growth and development of the lepidoptera pest diamondback moth, and the enzyme activities and the death rates of two kinds of detoxification enzymes GST and CYP450 are obviously increased, which shows that the APX1 gene mutant has a poisoning function on the diamondback moth. In addition, the mutant APX1-1 has a repellent effect on diamondback moths.
The embodiments described herein are merely illustrative, and those skilled in the art can make various modifications to the described embodiments, for example, a method for obtaining a line material with insect-resistant performance by knocking out APX1 homologous gene in commercial crops such as rape, corn, rice and sorghum by using CRISPR and the like based on the arabidopsis APX1 gene mutant material is within the protection scope of the present invention.
Claims (3)
1. The application of the gene APX1 in enhancing the ability of plants to resist lepidoptera pests is characterized in that the plants are Arabidopsis thaliana, the lepidoptera pests are diamondback moths, and the gene is as follows:
(I) a nucleotide sequence shown as SEQ ID NO. 1; or
(II) a complementary sequence of the nucleotide sequence shown as SEQ ID NO. 1; or
(III) a sequence which encodes the same protein as the nucleotide sequence of (I) or (II) but which differs from the nucleotide sequence of (I) or (II) due to the degeneracy of the genetic code.
2. The use of the gene APX1 in enhancing the resistance of plants to lepidopteran pests according to claim 1, wherein the protein encoded by the gene APX1 is an amino acid sequence shown as SEQ ID NO.2, and the total number of the encoded protein is 221 amino acids.
3. The application of the gene APX1 in enhancing the plant resistance to lepidopteran pests according to claim 1, wherein APX1 mutant is insect resistance caused by recessive mutation, and an insect-resistant variety is obtained by using CRISPR (clustered regularly interspaced short palindromic repeats) knockout technology in a breeding process.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201911361654.6A CN111073895B (en) | 2019-12-26 | 2019-12-26 | Gene APX1 for enhancing plant resistance to lepidoptera pests and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201911361654.6A CN111073895B (en) | 2019-12-26 | 2019-12-26 | Gene APX1 for enhancing plant resistance to lepidoptera pests and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN111073895A CN111073895A (en) | 2020-04-28 |
CN111073895B true CN111073895B (en) | 2020-11-20 |
Family
ID=70317900
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201911361654.6A Active CN111073895B (en) | 2019-12-26 | 2019-12-26 | Gene APX1 for enhancing plant resistance to lepidoptera pests and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN111073895B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112175967B (en) * | 2020-10-10 | 2021-10-29 | 安徽农业大学 | PEN1 gene for enhancing plant resistance to lepidoptera pests and application thereof |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1134981A (en) * | 1995-12-28 | 1996-11-06 | 中国农业科学院生物技术研究中心 | Expressive carrier with coded insect-killing protein fusion gene, and transfer gene plant |
WO2002081696A2 (en) * | 2001-04-06 | 2002-10-17 | Syngenta Participations Ag | Oryza sativa nuclear cap binding protein 80 |
WO2011017288A1 (en) * | 2009-08-05 | 2011-02-10 | Chromocell Corporation | Improved plants, microbes, and organisms |
CN102250923A (en) * | 2010-05-19 | 2011-11-23 | 复旦大学 | cryIAc gene having high lepidopteran pest resistance and application thereof in sugarcane |
CN103819549A (en) * | 2014-02-28 | 2014-05-28 | 中国科学院植物研究所 | Applications of rice protein and coding gene thereof in regulation and control of plant drought resistance |
-
2019
- 2019-12-26 CN CN201911361654.6A patent/CN111073895B/en active Active
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1134981A (en) * | 1995-12-28 | 1996-11-06 | 中国农业科学院生物技术研究中心 | Expressive carrier with coded insect-killing protein fusion gene, and transfer gene plant |
WO2002081696A2 (en) * | 2001-04-06 | 2002-10-17 | Syngenta Participations Ag | Oryza sativa nuclear cap binding protein 80 |
WO2011017288A1 (en) * | 2009-08-05 | 2011-02-10 | Chromocell Corporation | Improved plants, microbes, and organisms |
CN102250923A (en) * | 2010-05-19 | 2011-11-23 | 复旦大学 | cryIAc gene having high lepidopteran pest resistance and application thereof in sugarcane |
CN103819549A (en) * | 2014-02-28 | 2014-05-28 | 中国科学院植物研究所 | Applications of rice protein and coding gene thereof in regulation and control of plant drought resistance |
Non-Patent Citations (2)
Title |
---|
"Arabidopsis thaliana eukaryotic cap-binding protein (At5g18110) mRNA, complete cds,ACCESSION:AY114562.1";Tripp,M. et al.;《Genbank》;20020610;第1-2页 * |
"Defciency of the eIF4E isoform nCBP limits the cell-to-cell movement of a plant virus encoding triple-gene-block proteins in Arabidopsis thaliana";Takuya Keima et al.;《Scientific Reports》;20170106;第7卷;第1-13页 * |
Also Published As
Publication number | Publication date |
---|---|
CN111073895A (en) | 2020-04-28 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN103421816B (en) | Killing gene and purposes thereof | |
AU2017360212B2 (en) | Insecticidal protein combination, and insect resistance management method for same | |
AU2014350744C1 (en) | Method for controlling pests | |
CN102972426B (en) | Pest control method | |
CN104610440B (en) | Applications of the ABC transporter gene ABCH1 and its specific dsRNA in diamondback moth preventing and treating and Bt resistance managements | |
CN103719136A (en) | Pest control method | |
CN103718895A (en) | Method for controlling injurious insects | |
CN103718896A (en) | Method for controlling pests | |
CN101505589A (en) | Insect resistant transgenic turf grass | |
CN102972243A (en) | Method for controlling pests | |
CN104286014B (en) | The purposes of insecticidal proteins | |
CN111073895B (en) | Gene APX1 for enhancing plant resistance to lepidoptera pests and application thereof | |
CN103734169B (en) | The method of Control pests | |
CN111034736B (en) | Insecticidal composition and application thereof | |
CN106701792A (en) | Artificially synthesized insecticidal gene with high toxicity on lepidoptera pests and application | |
CN112175967B (en) | PEN1 gene for enhancing plant resistance to lepidoptera pests and application thereof | |
CN115806996A (en) | Ecdysone receptor EcR gene of tomato leaf miner and application of ecdysone receptor EcR gene in prevention and control of tomato leaf miner | |
CN114438118A (en) | Method for efficiently expressing Bt protein Cry56Aa1 in rice and corn to resist spodoptera frugiperda | |
CN104604924B (en) | The purposes of insecticidal proteins | |
CN102972428B (en) | Method for controlling pests | |
CN116828979A (en) | Tomato plants with improved insect resistance | |
Hameed et al. | Biosafety assessment of locally developed transgenic sugarcane. | |
CN114438120B (en) | Plant endogenous gene and protein for influencing feeding of lepidopteran insects | |
CN114524867B (en) | Plant endogenous gene and protein for influencing feeding of lepidopteran insects | |
CN116497034B (en) | Insect-resistant protein and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |