CN111073895B

CN111073895B - Gene APX1 for enhancing plant resistance to lepidoptera pests and application thereof

Info

Publication number: CN111073895B
Application number: CN201911361654.6A
Authority: CN
Inventors: 李培金; 陈红亿; 陶珍; 王传宏; 陈晨
Original assignee: Anhui Agricultural University AHAU
Current assignee: Anhui Agricultural University AHAU
Priority date: 2019-12-26
Filing date: 2019-12-26
Publication date: 2020-11-20
Anticipated expiration: 2039-12-26
Also published as: CN111073895A

Abstract

The invention discloses a gene APX1 for enhancing plant resistance to lepidoptera pests and application thereof, wherein the gene has a nucleotide sequence shown as SEQ ID NO.1 or a gene sequence with higher homology with the nucleotide sequence, an encoded amino acid sequence is shown as SEQ ID NO.2, the gene belongs to an RNA 5' cap binding protein gene, the gene mutant can effectively inhibit the growth and development of plutella xylostella and has a poisoning effect, in addition, arabidopsis thaliana is used as a model plant, and the insect-resistant gene has good colinearity with homologous genes of other crops, and has higher research and application values. The invention provides important gene resources for the development of natural insect-resistant strains of crops such as rape and corn.

Description

Gene APX1 for enhancing plant resistance to lepidoptera pests and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a gene APX1 for enhancing plant resistance to lepidoptera pests and application thereof.

Background

In agricultural production, pests are one of the important causes affecting crop yield and quality, and cause great economic loss to farmers every year. Lepidoptera includes two kinds of insects, i.e., moth and butterfly, and belongs to the subclass pteroidea and holomorphia. This order is the 2 nd largest order of the Insecta, second only to the Coleoptera. The distribution range is very wide, and the tropical varieties are most abundant. Most kinds of larvae are harmful to various cultivated plants, and those with larger body form usually eat leaves or bore branches completely. Smaller patients tend to suffer from leaf curl, leaf ornamentation, scabbling, silking and netting, or food intake by digging into plant tissues. The adult insects mostly take nectar and the like as supplementary nutrition, or the mouth organs are degraded and are not taken for eating, so that direct harm is not caused generally. At present, the prevention and control of crop pests mainly depend on chemical pesticides, but the chemical pesticides have pungent odor and have serious threats to the environment and human health, so that the natural insecticidal materials mined from natural resources are increasingly valued by people. As is well known, BT protein is a biological pesticide and can effectively kill lepidoptera pests such as diamondback moth and the like, and the BT protein is widely applied, but a plurality of researches find that various lepidoptera pests have drug resistance to BT and weaken the control effect on the pests, so that a new pest-resistant mode is urgently needed to be found. The natural insect-resistant gene is searched in plants, and the method has important theoretical and practical significance for developing novel natural insect-resistant line crops.

Disclosure of Invention

The invention aims to provide a gene APX1 for enhancing plant resistance to lepidoptera pests and application thereof aiming at the defects of the existing research, provides a new material for biological control of the lepidoptera pests, and provides a theoretical basis and gene resources for developing crop strains resistant to the lepidoptera pests.

The invention is realized by the following technical scheme:

a gene APX1 for enhancing resistance of plant to lepidopteran pest, said gene comprising:

(I) a nucleotide sequence shown as SEQ ID NO. 1; or

(II) a complementary sequence of the nucleotide sequence shown as SEQ ID NO. 1; or

(III) a sequence which encodes the same protein as the nucleotide sequence of (I) or (II) but which differs from the nucleotide sequence of (I) or (II) due to the degeneracy of the genetic code; or

(IV) a homologous gene sequence which is obtained by replacing, deleting or adding one or more nucleotide sequences in the nucleotide sequence of (I) or (II) and has the same or similar function with the nucleotide sequence of (I) or (II).

The nucleotide sequence shown as SEQ ID NO.1 is Arabidopsis APX1 gene obtained by cloning from Arabidopsis plants, the CDS has a total length of 666bp, the amino acid sequence is shown as SEQ ID NO.2, and the gene can be directly cloned from crops and can also be obtained by artificial synthesis.

The protein coded by the APX1 gene has an amino acid sequence shown in SEQ ID NO.2 and totally codes 221 amino acids.

An expression vector which is a recombinant plasmid into which the above recombinant gene is inserted and which uses a microbial cell or a plant cell as a host cell.

A transformant which is a microorganism or a plant cell containing the above expression vector or having the above gene APX1 integrated therein.

The application of the gene APX1 for enhancing the plant resistance to lepidoptera pests in enhancing the plant resistance to lepidoptera pests is disclosed, wherein an APX1 mutant is insect resistance caused by invisible mutation, and in the breeding process, a CRISPR knockout technology is utilized or a haplotype with a loss function is screened from a natural type to obtain an insect-resistant variety, so that the purpose of enhancing the plant resistance to lepidoptera pests is achieved.

As a further optimization scheme of the invention, the plants comprise important economic crops such as rape, corn, rice, sorghum and the like, and the aim is to promote, test and develop new insect-resistant strains and provide novel insect-resistant materials for the important economic crops.

Compared with the prior art, the invention has the following advantages: the invention provides a gene APX1 for enhancing plant resistance to lepidoptera pests and application thereof, wherein the gene APX1 codes an RNA 5' cap binding protein, through bioassay tests of an Arabidopsis APX1 gene mutant, namely, a wild type Arabidopsis and an APX1 gene mutant of a diamondback moth of the lepidoptera pests are fed forcibly, and experimental results show that after the Arabidopsis APX1 gene mutant is eaten, the death rate of the diamondback moth larvae is increased remarkably, the weight is reduced remarkably, the pupation rate is reduced remarkably, and the enzyme activity of related detoxifying enzymes is increased remarkably; in addition, the mutant has a remarkable repelling effect on diamondback moths. The novel insect-resistant material is developed and obtained based on the novel function of the Arabidopsis APX1 gene, the pollution of chemical pesticides to the environment and the poison of human bodies are avoided, the insect-resistant material belongs to the insect killing function caused by recessive gene mutation, and novel insect-resistant strains can be developed in different crops by using technologies such as CRISPR gene knockout and the like.

Drawings

FIG. 1 is an APX1 CDS full-length amplification electrophoretogram, wherein, Lane 2 is APX1 gene fragment, M is Marker (Trans 2K);

FIG. 2 is a bar graph showing the results of the expression level of APX1 gene in mutant APX 1-1;

FIG. 3 shows the statistics of the mortality (3a), body weight (3b) and pupation rate (3c) of plutella xylostella by forced feeding;

FIG. 4 shows the results of detecting the enzymatic activity (4a) of glutathione-S transferase (GST) and the enzymatic activity (4b) of cytochrome C450(CYP450) by forcing plutella xylostella to eat.

FIG. 5 shows the results of experiments on selective feeding of Arabidopsis thaliana wild type and APX1 mutant by Plutella xylostella.

Detailed Description

Example 1

1. Material

The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used therein are commercially available products unless otherwise specified.

2. Method of producing a composite material

2.1 cloning of Arabidopsis thaliana APX1 Gene

2.1.1 using wild Col-0 variety of Arabidopsis as material, extracting RNA, and reverse transcribing the extracted total RNA to synthesize the first strand cDNA as the template for PCR amplification.

2.1.2 with designed specific primers:

APX1-F：(5'>GGTTGAAGGATTTTG<3')

APX1-R：(5'>ATTGTGGGAGGATGGTGCC<3')

and (3) carrying out amplification to obtain a gene fragment of 666bp (the electrophoresis result is shown in figure 1), connecting the gene fragment to a T cloning vector PEASY-T5 simple vector to obtain T5-APX1, transforming the T5-APX1 into escherichia coli, picking positive clones and sequencing, wherein the sequencing result is consistent with the prediction result, and obtaining the nucleotide sequence shown in SEQ ID No. 1.

2.2 Arabidopsis thaliana mutant Gene identification and Gene function

2.2.1 obtaining Arabidopsis thaliana APX1 gene mutant by ordering independent T-DNA insertion mutant seed number (PL32) from Nottingham Arabidopsis thaliana seed Center (Stock Center) in England according to APX1 gene sequence, synthesizing identification primer according to T-DNA primer identification method provided by TAIR website:

Salk_131503(PL32)：

LP:5'>AAAATTTGATTCCCGTTCGTC<3'

RP:5'>AAAATTTGATTCCCGTTCGTC<3'

LBb1.3:5'>ATTTTGCCGATTTCGGAAC<3'

the T-DNA insertion mutant seed number (PL32) can be inserted into exon 4 of APX1 gene to cause the functional deletion of APX1 gene by analyzing the sequencing result of flanking sequence. The RT-PCR results showed that the expression level of the gene was significantly down-regulated in the mutant (FIG. 2).

2.2.2 wild type col and APX1 gene mutant which grow for two weeks under long sunshine are used for forcedly feeding plutella xylostella which just enters the overeating period, and the survival condition, the weight and the pupation condition of the plutella xylostella are counted, the result is shown in figure 3, and the plutella xylostella fed with the APX1 gene mutant has the survival condition, and the weight, the pupation and other indexes which are obviously lower than those of a control group from the forced feeding experimental result of figure 3. Therefore, the arabidopsis APX1 mutant can obviously inhibit the growth and development of diamondback moth and has a poisoning function.

2.3 detection of enzyme Activity of related detoxification enzymes

2.3.1 glutathione-S transferase (GST) assay

And forcibly feeding arabidopsis wild type col and APX1 gene mutants to the brassica chinensis, sampling the brassica chinensis moths after 24 hours, and detecting the activity of GST detoxification enzymes. The enzyme activity detection method is completed by adopting a kit method of Nanjing to build glutathione-S transferase (GSH-TS) of Biotechnology Limited.

The results are shown in fig. 4a, after the arabidopsis APX1 gene mutant is eaten, the GST enzyme activity is obviously up-regulated.

2.3.2 cytochrome P450(CYP450) assay

And forcibly feeding arabidopsis wild type and col and APX1 gene mutants to the pickles, sampling the diamondback moths after 24 hours, and detecting the activity of the CYP450 detoxification enzymes. The enzyme activity detection method is completed by adopting a cytochrome P450(CYP450) enzyme-linked reagent kit method of Beijing Huatai Biotechnology Limited.

The result is shown in fig. 4b, after the arabidopsis APX1 gene mutant is eaten, the CYP450 enzyme activity is obviously up-regulated.

2.3.2 Arabidopsis APX1 mutant repellency test for diamondback moth

As shown in fig. 5, the odor emitted by arabidopsis wild type and APX1 mutant was enriched using a repelling test instrument, and then diamondback moth larvae were inserted in the middle of the instrument and selected according to the direction of odor as the air pump aspirates air.

The results are shown in figure 5, and the number of larvae in plutella xylostella selection of arabidopsis wild type was significantly higher than those in selection of APX1 mutant over time. It was concluded that the APX1 mutant had a repellent effect on diamondback moths.

3. Conclusion

After eating the arabidopsis APX1 gene mutant, the weight, pupation and eclosion rate of the diamondback moth are obviously reduced, which shows that the APX1 gene mutant material can obviously inhibit the growth and development of the lepidoptera pest diamondback moth, and the enzyme activities and the death rates of two kinds of detoxification enzymes GST and CYP450 are obviously increased, which shows that the APX1 gene mutant has a poisoning function on the diamondback moth. In addition, the mutant APX1-1 has a repellent effect on diamondback moths.

The embodiments described herein are merely illustrative, and those skilled in the art can make various modifications to the described embodiments, for example, a method for obtaining a line material with insect-resistant performance by knocking out APX1 homologous gene in commercial crops such as rape, corn, rice and sorghum by using CRISPR and the like based on the arabidopsis APX1 gene mutant material is within the protection scope of the present invention.

Claims

1. The application of the gene APX1 in enhancing the ability of plants to resist lepidoptera pests is characterized in that the plants are Arabidopsis thaliana, the lepidoptera pests are diamondback moths, and the gene is as follows:

(I) a nucleotide sequence shown as SEQ ID NO. 1; or

(III) a sequence which encodes the same protein as the nucleotide sequence of (I) or (II) but which differs from the nucleotide sequence of (I) or (II) due to the degeneracy of the genetic code.

2. The use of the gene APX1 in enhancing the resistance of plants to lepidopteran pests according to claim 1, wherein the protein encoded by the gene APX1 is an amino acid sequence shown as SEQ ID NO.2, and the total number of the encoded protein is 221 amino acids.

3. The application of the gene APX1 in enhancing the plant resistance to lepidopteran pests according to claim 1, wherein APX1 mutant is insect resistance caused by recessive mutation, and an insect-resistant variety is obtained by using CRISPR (clustered regularly interspaced short palindromic repeats) knockout technology in a breeding process.