CN111034736B

CN111034736B - Insecticidal composition and application thereof

Info

Publication number: CN111034736B
Application number: CN201911279300.7A
Authority: CN
Inventors: 吴华; 张敏; 冯俊涛; 马志卿
Original assignee: Northwest A&F University
Current assignee: Northwest A&F University
Priority date: 2019-12-13
Filing date: 2019-12-13
Publication date: 2021-04-06
Anticipated expiration: 2039-12-13
Also published as: CN111034736A

Abstract

The invention discloses an insecticidal composition and application thereof, wherein the insecticidal composition comprises an insecticidal gene sequence and athomin, and the gene sequence is shown as SEQ ID NO: 1, or at least comprises SEQ ID NO: 1, and a gene sequence with 90% identity to the sequence shown in 1; the gene sequence is shown as SEQ ID NO: 1, or at least comprises SEQ ID NO: 1, and a gene sequence with 90% identity to the sequence shown in 1; the gene sequence is shown as SEQ ID NO: 1, or at least comprises SEQ ID NO: 1, and (b) 1, wherein the sequences are 90% identical. Introducing into the test insect body by microinjection for 24h, and performing horse radish LC₂₀The mortality rates of the fumigation treatment for 72 hours respectively reach 85.56 percent, 67.78 percent and 58.89 percent, which are obviously higher than those of the horseradish hormone LC₂₀The single fumigation treatment has obvious lethal effect. Feeding dsRNAcet I, dsRNAcet II, dsRNAcet III and athomin LC₂₀The prevention effect of the corn elephant is obviously improved by the combined fumigation treatment, and the dosage of AITC is reduced.

Description

Insecticidal composition and application thereof

Technical Field

The invention relates to the technical field of biology, and particularly relates to an insecticidal composition and application thereof.

Background

Elephant of corn (Sitophilus zeamais) belongs to Coleoptera (Coleoptera) weevil (Curculionidae), is an important initial pest in storage and is classified as a head destructive grain storage pest. The most widely used in the prevention and treatment of storage pests are methyl bromide and aluminum phosphide, the methyl bromide is forbidden in developing countries, and aluminum phosphide products are easy to cause poisoning casualty accidents in the prevention and treatment of grain storage pests due to high toxicity and high risk.

The horseradish (Armoracia rusticana) is a plant in the genus of Cruciferae and the genus of horseradish, and the main volatile component of the horseradish is allyl isothiocyanate (allyl isothiocyanate) which is used as a biological source fumigant, so that the horseradish has the characteristics of low toxicity, easy degradation and the like, and has a good control effect on grain storage pests. Wuhua et al (2007) adopts a erlenmeyer flask method to determine the biological activity of AITC on 4 storage pests such as corn elephant, red-mimosa-thee, ips typographus and dry fish booklice, and the result shows that the AITC essential oil has higher biological activity on four storage pests.

RNA interference (RNAi) technology utilizes double-stranded RNA to efficiently and specifically degrade homologous mRNA in cells so as to block the expression of target genes, and enable the cells to have a phenotype of target gene deletion. RNAi has become the effective tool of target identification and identification of insecticide at present, namely reduce and predict target gene transcription level through RNAi, determine the insect body to the sensibility change of insecticide thus confirm the target site of insecticide, can reduce the dosage at the same time, improve the lethal effects of the pest in the production practice.

Cytochrome C Oxidase (COX) is a terminal metallomembrane protease on the electron transport chain of the inner mitochondrial membrane and aerobic bacterial membrane of eukaryotes, is responsible for the electron transport function of cytochrome C to oxygen molecules, and is a key regulatory site for the oxidative capacity of mitochondria. Consists of three core subunits (COX I, II, III) and ten small subunits.

Disclosure of Invention

The invention aims to provide the effect of synthesizing dsRNA (double-stranded ribonucleic acid) and combining the dsRNA with athomin fumigation (AITC) in pest control according to the design gene segments of three core subunits (COXI, COXII and COXIII) of cytochrome C Oxidase (COX).

An insecticidal composition comprises an insecticidal gene sequence and athomin, wherein the gene sequence is shown as SEQ ID NO: 1, or at least comprises SEQ ID NO: 1, and (b) 1, wherein the sequences are 90% identical.

Optionally, the primer for synthesizing the insecticidal gene sequence comprises SEQ ID NO: 2 and the upstream primer shown in SEQ ID NO: 3, or a reverse primer as shown in the figure.

Optionally, the insecticidal gene sequence is a gene fragment designed according to a zearals cytochrome C oxidase core subunit I gene (NCBI reference sequence: NC-030764.1: 1323) -2864) in an NCBI database.

An insecticidal composition comprises an insecticidal gene sequence and athomin, wherein the gene sequence is shown as SEQ ID NO: 4, or at least comprises SEQ ID NO: 4, and (b) 4, wherein the sequences are 90% identical.

Optionally, the primer for synthesizing the insecticidal gene sequence comprises SEQ ID NO: 5 and the upstream primer shown in SEQ ID NO: 6.

Optionally, the insecticidal gene sequence is a gene fragment designed according to a zearals cytochrome C oxidase core subunit ii gene (GENBANK accession number: KX783028) in the NCBI database.

An insecticidal composition comprises an insecticidal gene sequence and athomin, wherein the gene sequence is shown as SEQ ID NO: 7, or at least comprises SEQ ID NO: 7, which is 90% identical to the sequence shown in figure 7.

Optionally, the primer for synthesizing the insecticidal gene sequence comprises SEQ ID NO: 8 and the upstream primer shown in SEQ ID NO: 9 as shown in the figure.

The insecticidal gene sequence is a gene fragment designed according to a zearals cytochrome C oxidase core subunit III gene (NCBI reference sequence: NC-030764.1: 4574-5365) in an NCBI database.

The application of the insecticidal composition provided by the invention in preparing pesticides for preventing and treating elephantopus zeamais; preferably, the insecticidal gene sequence is used by injection or feeding; the athomin is applied by fumigation, and the fumigation concentration is 3.997 mu L/L.

Tests prove that the death rates of 18-day-old larva of the elephant corn are 85.56%, 67.78% and 58.89% respectively after the injected larva bodies are fumigated by the Athomin (AITC), and are obviously higher than those of the athomin LC₂₀The single fumigation treatment has remarkable lethal effect and shows the phenotypic change of head blackening and death

Drawings

FIG. 1: agarose gel detection of SEQ ID NO: 1 sequence length;

FIG. 2: SEQ ID NO: 1, injecting dsRNA corresponding to the dsRNA into 18-day larva of a elephant corn for 24h, 36h and 48h to influence the transcription of cytochrome C oxidase subunit I gene (COXI), and injecting dsGFP in a control group;

FIG. 3: SEQ ID NO: 1, change of mortality rate of 18-day insect larvae of the ostrinia nubilalis after 24h, 36h and 48h injection of dsRNA corresponding to the dsRNA;

FIG. 4: SEQ ID NO: 1, injecting dsRNA to the 18-day-old larva of the elephant, and injecting 0.75% NaCl to the control group. A. B and C are that after the 18-day-old larvae of the experimental group of the maize weevils are injected with dsRNA, the larvae turn black from the head to the whole body, D, E and F are that after the 18-day-old larvae of the experimental group of the maize weevils are injected with dsRNA, the larvae successfully pupate, and then the pupae turn black from the head to the whole body, G, H and I are that after the 18-day-old larvae of the experimental group of the maize weevils are injected with dsRNA, the pupae successfully eclosion, and then the adult bodies of the successfully eclosion turn yellow from milk white, and the mouthparts and antennae of the head turn black; J. k and L are that the larvae successfully pupate and successfully emerge after injecting 0.75% NaCl into the 18-day larva of the control group of the elephant corn;

FIG. 5: agarose gel detection of SEQ ID NO: 4, the length of the sequence;

FIG. 6: SEQ ID NO: 4, injecting dsRNA corresponding to the 4 th into 18-day larva of the elephant corn for 24h, 36h and 48h to influence the transcription of cytochrome C oxidase subunit II gene (COXII), and injecting dsGFP in a control group;

FIG. 7: SEQ ID NO: 4 change of mortality rate of 18-day insect larvae of the Sipunculus zeamais after 24h, 36h and 48h of dsRNA injection;

FIG. 8: SEQ ID NO: 4, injecting dsRNA corresponding to the dsRNA into the 18-day larva of the elephant, wherein the control group is injected with 0.75% NaCl; A. b and C are that after the 18-day-old larvae of the experimental group of the maize weevils are injected with dsRNA, the larvae turn black from the head to the whole body, D, E and F are that after the 18-day-old larvae of the experimental group of the maize weevils are injected with dsRNA, the larvae successfully pupate, and then the pupae turn black from the head to the whole body, G, H and I are that after the 18-day-old larvae of the experimental group of the maize weevils are injected with dsRNA, the pupae successfully eclosion, and then the adult bodies of the successfully eclosion turn yellow from milk white, and the mouthparts, tentacles and wings of the head turn black; J. k and L are that the larvae successfully pupate and successfully emerge after injecting 0.75% NaCl into the 18-day larva of the control group of the elephant corn;

FIG. 9: agarose gel detection of SEQ ID NO: 7, the length of the sequence;

FIG. 10: SEQ ID NO: 7, injecting dsRNA corresponding to the male weevil 18-day larva for 24h, 36h and 48h, and then carrying out transcription influence on cytochrome C oxidase subunit III gene (COX III), wherein the control group is injected with dsGFP;

FIG. 11: SEQ ID NO: 7 change of mortality rate after injecting the Sipunculus zeamais 18-day larva for 24h, 36h and 48 h;

FIG. 12: SEQ ID NO: 7, injecting dsRNA corresponding to the male weevil for 18-day larva growth and development, and injecting 0.75% NaCl in a control group; A. b and C are that after the 18-day-old larvae of the experimental group of the maize weevils are injected with dsRNA, the larvae turn black from the head to the whole body, D, E and F are that after the 18-day-old larvae of the experimental group of the maize weevils are injected with dsRNA, the larvae successfully pupate, and then the pupae turns yellow, and then the larvae turn black from the head, G, H and I are that after the 18-day-old larvae of the experimental group of the maize weevils are injected with dsRNA, the pupae successfully eclosion, and then the successfully eclosion adult larvae turn yellow from milky white, and the mouth organs, tentacles and wings of the head turn black; J. k and L are that the larvae successfully pupate and successfully emerge after injecting 0.75% NaCl into the 18-day larva of the control group of the elephant corn;

FIG. 13: zebra mays 18-day-old larvae without any treatment (CK) at 24h, 48h and 72h phenotypes (A, B and C) and injected with 0.75% NaCl at 24h, 48h and 72h phenotypes (D, E and F) as controls;

FIG. 14: SEQ ID NO: 1 dsRNA injection of Pediculus comatus 18-day-old larvae at 24h, 48h and 72h of phenotype (A, B and C), and 24h after injection of Horseradish LC₂₀Phenotypes after 24h, 48h and 72h fumigation (D, E and F);

FIG. 15: CK. Control group, Horseradish LC₂₀Fumigating treatment, injecting SEQ ID NO: 1 corresponding dsRNA and athomin LC₂₀Fumigation treatment + injection of SEQ ID NO: 1 corresponding to 24h, 48h and 72 h;

FIG. 16: SEQ ID NO: 2 dsRNA injection of Pediculus zeanus 18 day insect larvae of 24h, 48h and 72h phenotype (A, B and C), and 24h injection followed by athomin LC₂₀Phenotypes after 24h, 48h and 72h fumigation (D, E and F);

FIG. 17: CK. Control group, Horseradish LC₂₀Fumigating treatment, injecting SEQ ID NO: 2 corresponding dsRNA and Horseradish LC₂₀Fumigation treatment + injection of SEQ ID NO: 2 mortality at 24h, 48h and 72 h;

FIG. 18: SEQ ID NO: 3 dsRNA injection of Pectenopharyngodon comatus 18-day larvae phenotypes at 24h, 48h and 72h (A, B and C), and 24h after injection, horseradish hormone LC₂₀Phenotypes after 24h, 48h and 72h fumigation (D, E and F);

FIG. 19: CK. Control group, Horseradish LC₂₀Fumigating treatment, injecting SEQ ID NO: 3 corresponding dsRNA and athomin LC₂₀Fumigation treatment + injection of SEQ ID NO: 3 corresponding dsRNA had mortality rates at 24h, 48h and 72 h.

Detailed Description

The invention provides a cytochrome C oxidase subunit I gene (COXI) of a maize weevil, a reference sequence (NC-030764.1: 1323-2864) Open Reading Frame (ORF) of the COXI gene is searched in an NCBI database, and the open reading frame is further sequenced through PCR amplification to obtain the length of the COXI gene of the maize weevil with 1542 bp. Designing an upstream primer SEQ ID NO: 2 and the downstream primer SEQ ID NO: 3, obtaining the nucleotide sequence of SEQ ID NO: 1, which contains a T7 promoter. dsRNA was further synthesized using T7RiboMAX Express RNAi System kit.

The invention provides a corn elephant cytochrome C oxidase subunit II gene (COXII), which is searched in an NCBI database for the GENBANK accession number: KX783028, the Open Reading Frame (ORF) was obtained, and the length was 684bp by further sequencing by RACE-PCR amplification. Designing an upstream primer SEQ ID NO: 5 and downstream primer SEQ ID NO: 6, obtaining the nucleotide sequence of SEQ ID NO: 4, which contains the T7 promoter. dsRNA was further synthesized using T7RiboMAX Express RNAi System kit.

The invention provides a cytochrome C oxidase subunit III gene (COXIII) of a maize elephant, a reference sequence (NC-030764.1: 4574-5365) Open Reading Frame (ORF) of the COXIII gene is searched in an NCBI database, and the length of the COXIII gene is 792bp through RACE-PCR amplification one-step sequencing. Designing an upstream primer SEQ ID NO: 8 and the downstream primer SEQ ID NO: 9, obtaining the nucleotide sequence of SEQ ID NO: 7 which contains the T7 promoter. dsRNA was further synthesized using T7RiboMAX Express RNAi System kit.

SEQ ID NO: 1. SEQ ID NO: 2 and SEQ ID NO: 3, the application of the synthesized dsRNA in pest control by combining with the Athomin (AITC): injecting the synthetic dsRNA into a body cavity of a 18-day old larva of a Sipunculus zeamais from the fourth to last or five internodes of the lateral abdomen by using a microinjector and injecting the dsRNA24hFollowed by Horseradish LC₂₀And (4) carrying out fumigation, and counting the mortality after 24h, 48h and 72h, wherein the result shows that the nucleotide sequence shown in SEQ ID NO: 1. SEQ ID NO: 2 and SEQ ID NO: 3 after the dsRNA injected polypide is fumigated by the Athomin (AITC), the death rates of 18-day larva of the elephant corn are 85.56%, 67.78% and 58.89% which are obviously higher than those of the athomin LC₂₀The lethal effect is significant with a single fumigation treatment, and a phenotypic change of blacking and death of the head occurs.

Example 1: fumigation activity of Athomin (AITC) on 18-day larvae of Zephycus zeanus

Selecting healthy and active 18-day larvae of Pectes zearales with consistent size, dividing the larvae into three biological repetitions, measuring the toxicity of the HRP on the Pectes zearales larvae by setting 6 concentration gradients, and finally obtaining LC of the larvae₂₀The virulence regression equation was 3.997 μ L/L, and Y ═ 5.05X-4.425.

Example 2: obtaining of maize elephant first strand cDNA

Extracting total RNA of the elephant larva of corn: selecting a group of healthy 18-day larva of Zea mays, extracting total RNA by using an RNAprep Pure polysaccharide polyphenol plant total RNA extraction kit, and using PrimeScript^TMThe 1st Strand cDNA Synthesis Kit (Takara) Kit was used for reverse transcription to synthesize cDNA.

Example 3: dsRNA synthesis based on cytochrome C oxidase core subunit ORF of zearales zearals

design of dsRNA primers: based on the ORF sequences of COXI (NC-030764.1: 1323) -2864), COXII (GENBANK accession number: KX783028) and COXIII (NC-030764.1: 4574) -5365), dsRNA primers were designed at the E-RNAi site, and the upstream primer sequences thereof were: SEQ ID NO: 2 and SEQ ID NO: 3. SEQ ID NO: 5; the downstream primer sequences are respectively as follows: SEQ ID NO: 6. SEQ ID NO: 8 and SEQ ID NO: 9. all primers were synthesized by Okkensheng Biotech limited.

dsRNA synthesis: and (2) synthesizing dsRNA products by using the two pairs of primers respectively, purifying by using a general DNA purification recovery kit (Tiangen), synthesizing dsRNA in vitro by using a T7Ribomax Express RNAi System kit, determining the concentration of the dsRNA by using a Nanodrop2000(Thermo scientific) nucleic acid concentration determinator, determining the unicity and the integrity by using 1.0% agarose gel, and determining the sequence of SEQ ID NO: 1. SEQ ID NO: 2 and SEQ ID NO: 3 PCR run of synthetic dsRNA FIGS. 1, 5 and 9.

Example 4: DsRNAcet I lethal Otophorus zearales larvae of cytochrome C oxidase core subunit I

Cytochrome C oxidase core subunit i dsrnacotx i injection: 100ng of dsRNA synthesized on the basis of COXI (NC-030764.1: 1323-2864) was injected into the 18-day old corn weevil at the penultimate ventral or five internode membranes using a Drummond microinjector for a total of 3 biological replicates, 30 per group. The same amount of dsGFP was injected into the control group, and the injected Ctenopharyngodon idellus larvae were raised in a constant temperature biochemical incubator at 28 ℃.

Phenotypical observation of weevil larvae after dsRNA injection: the 18-day larva group of the elephant corn successfully pupates 48h after 0.75% NaCl injection and successfully eclosion 72h (figure 4J, K, L), while the larva and the pupal head become black after dsRNAOX I injection, adult wings and antennal parts become black and die (figures 4C, F and I), and the death rate reaches 75.6% (figure 3).

Detecting the gene silencing efficiency of cytochrome C oxidase core subunit I: the larvae injected with dsRNACIOX I were sampled at 24h, 36h and 48h, 3 biological replicates, 3 replicates each, frozen in liquid nitrogen, extracted for total RNA of the test insects using RNAprep Pure polysaccharide polyphenol plant total RNA extraction kit, and PrimeScript was used^TMAfter reverse transcription of RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara), TB Green was used^TMPremix Ex Taq^TMII (Tli RNaseH plus) kit, using an instrument CFX96Touch (BIO-RAD) to perform RT-qPCR experiment, the cytochrome C oxidase core subunit I gene silencing efficiency can reach 56.6 percent (figure 2).

Example 5: DsRNACIOX II lethal Otophilus zearales larvae of cytochrome C oxidase core subunit II

Cytochrome C oxidase core subunit iidsrnacetii injection: 50ng of dsRNA synthesized on the basis of COX II (GENBANK accession number: KX783028) was injected into the 18-day old corn elephant at the penultimate ventral penultimate internode membrane using a Drummond microinjector, 3 biological replicates, 30 in each group. The same amount of dsGFP was injected into the control group, and the injected Ctenopharyngodon larvae were raised in a constant temperature biochemical incubator at 28 ℃.

Phenotypical observation of weevil larvae after dsRNA injection: the 18-day larva group of the elephant corn successfully pupates 48h after 0.75% NaCl injection and successfully eclosion 72h (figure 8J, K, L), the larva and the pupal head become black after dsRNAOX II injection, adult wings and antennal parts become black and die (figures 8C, F and I), and the death rate reaches 71.88% (figure 7).

Detecting the gene silencing efficiency of cytochrome C oxidase core subunit II: the larvae injected with dsRNACIOX II were sampled at 24h, 36h and 48h, 3 biological replicates were obtained, 3 replicates were frozen in liquid nitrogen, total RNA of the test insects was extracted using RNAprep Pure polysaccharide polyphenol plant total RNA extraction kit, PrimeScript was used^TMAfter reverse transcription of RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara), TB Green was used^TMPremix Ex Taq^TMII (Tli RNaseH plus) kit, and an RT-qPCR experiment is carried out by using an instrument CFX96Touch (BIO-RAD), and the measured gene silencing efficiency of the cytochrome C oxidase core subunit II can reach 95.2 percent (figure 6).

Example 6: DsRNAcet III lethal Otophilus zearales larvae of cytochrome C oxidase core subunit III

Cytochrome C oxidase core subunit iii dsrnacotx iii injection: 50ng of a dsRNA synthesized on the basis of COX III (NC-030764.1: 4574) -5365 was injected into the 18-day old Zebra of the side ventral penultimate internode using a Drummond microinjector for a total of 3 biological replicates, 30 per group. The same amount of dsGFP was injected into the control group, and the injected Ctenopharyngodon idellus larvae were raised in a constant temperature biochemical incubator at 28 ℃.

Phenotypical observation of weevil larvae after dsRNA injection: the 18-day larva group of the elephant corn successfully pupates 48h after 0.75% NaCl injection and successfully emerges 72h after (FIG. 12J, K, L), while the larva, the head of the pupa becomes black and the adult wings and the tentacle parts become black and die after dsRNAOX III injection (FIGS. 12C, F and I), and the death rate reaches 82.2% (FIG. 10).

Detecting the gene silencing efficiency of cytochrome C oxidase core subunit III: the larvae injected with dsRNAOX III were sampled at 24h, 36h and 48h, 3 biological replicates, 3 replicates each, frozen in liquid nitrogen, extracted for total RNA of the test insects using RNAprep Pure polysaccharide polyphenol plant total RNA extraction kit, and PrimeScript was used^TMAfter reverse transcription of RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara), TB Green was used^TMPremix Ex Taq^TMII (Tli RNaseH plus) kit, an instrument CFX96Touch (BIO-RAD) is used for carrying out RT-qPCR experiments, and the cytochrome C oxidase core subunit III gene silencing efficiency can reach 84.6 percent (shown in figure 11).

Example 7 dsRNA feeding Cytopterus zeae adults of cytochrome C oxidase core subunit

The test insects are subjected to starvation treatment for 24 hours before RNAi feeding. The corn weevil test insects are fed by oatmeal. And immersing the oatmeal into the diluted dsRNA solution for 10s, taking out the oatmeal, and naturally drying. Taking oatmeal treated by dsRNA COX I or dsRNA COX II or dsRNA COX III as a feeding material to feed weevil adults, changing the oatmeal once every 24h to retreat the oatmeal, transferring test insects after feeding for 4 days, continuously feeding the oatmeal without treatment for 1 day, setting 3 times of treatment for each treatment, and repeating 50 times of test insects and 2g of oatmeal for each treatment. The RNase-free water treated group was blank control group. The breeding conditions are that the humidity is 75 +/-5%, the temperature is 28 +/-1 ℃, and the illumination period is L/D: 12h/12 h. After the experiment, the death and spawning of the adults were counted and shown in table 1.

TABLE 1

Table 1 shows the death and oviposition of five-day-old weevil adults after 5 days of feeding dsRNAOX I or dsRNAOX II or dsRNAOX III and dsRNAGFP. Therefore, the gene sequence can obviously kill the zearals and obviously reduce the number of eggs laid and the number of eggs hatched, and the highest death rate of 60.67 percent can be caused; the minimum hatching rate of 35.56 percent can be realized, and the control effect on the maize weevils is obvious.

Example 8: dsRNACIOX I injection of cytochrome C oxidase core subunit I in combination with athomin LC₂₀Lethal effect of fumigation on larva of elephant corn

Cytochrome C oxidase core subunit i dsrnacotx i injection: 100ng of dsRNA synthesized on the basis of COXI (NC-030764.1: 1323-2864) was injected into the 18-day old corn weevil at the penultimate or five internode membranes of the lateral abdomen of the larva using a Drummond microinjector for a total of 3 biological replicates, 30 per group. Injecting the same amount of 0.75% NaCl into the control group, and feeding the injected Ctenopharyngodon idellus larvae in a constant-temperature biochemical incubator at 28 ℃.

See FIGS. 13-15 for results:

phenotype observation of maize weevil larvae after cytochrome C oxidase core subunit i dsrnacotx i injection: the 18-day larva of the elephant corn pupates successfully pupate after 48 hours of 0.75% NaCl injection and successfully eclose after 72 hours, while the larva and the head of the pupa become black after dsRNACIOX I injection, the adult wings and the tentacles become black and die, and the 72-hour death rate reaches 75.6%.

Cytochrome C oxidase core subunit IdsRNACIOX I injection combined with athomin LC₂₀Lethal effect of fumigation on corn weevil larvae: after 24h and 48h of fumigation after injection, the mortality rate of the combined action reaches 56.67 percent and 78.89 percent, which are obviously higher than that of a control group and CK which are singly used by athomin LC₂₀Fumigation and injection with dsRNAOX I alone.

Example 9: cytochrome C oxidase core subunit IIdsRNACIOX II injection combined with athomin LC₂₀Lethal effect of fumigation on larva of elephant corn

Cytochrome C oxidase core subunit iidsrnacetii injection: 50ng of dsRNA synthesized on the basis of COX II (GENBANK accession number: KX783028) was injected into the 18-day old larva of Zedoids at the penultimate abdominal fourth or fifth internode membrane using a Drummond microinjector, 3 biological replicates, 30 in each group. Injecting the same amount of 0.75% NaCl into the control group, and feeding the injected Ctenopharyngodon idellus larvae in a constant-temperature biochemical incubator at 28 ℃.

See FIGS. 16-17 for results:

phenotype observation of maize weevil larvae after cytochrome C oxidase core subunit iidsrnacotx ii injection: the 18-day larva group of the elephant corn successfully pupates after 48 hours of 0.75% NaCl injection, successfully eclosion occurs after 72 hours, the larva and the head of the pupa become black after dsRNAOX II injection, the adult wing and the antennal part become black and die, and the 72-hour death rate reaches 71.88%.

Cytochrome C oxidase core subunit IIdsRNACIOX II injection combined with athomin LC₂₀Lethal effect of fumigation on corn weevil larvae: after 24h and 48h of fumigation after injection, the mortality rate of the combined action reaches 42.22 percent and 60 percent, which are obviously higher than that of a control group and CK which use the horse radish LC alone₂₀Fumigation and injection with dsRNAOX II alone

Example 10: dsRNACIOX III injection of cytochrome C oxidase core subunit III in combination with athomin LC₂₀Lethal effect of fumigation on larva of elephant corn

Cytochrome C oxidase core subunit iii dsrnacotx iii injection: 50ng of a dsRNA synthesized on the basis of COX III (NC-030764.1: 4574) -5365 was injected into the 18-day old corn elephant at the penultimate internode membrane of the lateral abdomen of the larva using a Drummond microinjector, 3 biological replicates, 30 in each group. Injecting the same amount of 0.75% NaCl into the control group, and feeding the injected Ctenopharyngodon idellus larvae in a constant-temperature biochemical incubator at 28 ℃.

The results are shown in FIGS. 18-19:

phenotypic observation of maize weevil larvae after cytochrome C oxidase core subunit iii dsrnacotx iii injection: the 18-day larva group of the elephant corn successfully pupates 48h after 0.75% NaCl is injected, successfully eclosion is carried out 72h after the injection, the larva and the head of the pupa become black after dsRNAOX III is injected, the adult wing and the antennal part become black and die, and the death rate reaches 71.88% (figure 18).

Cytochrome C oxidase core subunit III dsRNACIOX III injection combined with athomin LC₂₀Lethal effect of fumigation on corn weevil larvae: after 48h and 72h of fumigation after injection, the mortality rate of the combined effect reaches 41.11%, 58.89%, significantly higher than control group, CK and separate use of HRP LC₂₀And (4) a fumigation treatment group.

Example 11: the dsRNA of cytochrome C oxidase core subunit is combined with the athomin LC after being fed to the imago of the elephant corn₂₀Fumigating

The test insects are subjected to starvation treatment for 24 hours before RNAi feeding. The corn weevil imagoes are fed with oatmeal. And immersing the oatmeal into the diluted dsRNA solution for 10s, taking out the oatmeal, and naturally drying. Feeding weevil adults with oatmeal treated by dsRNA COXI or dsRNA COXII or dsRNA COXIII as feeding material, changing the oatmeal every 24h for retreating, feeding for 4 days, transferring the test insects, feeding with untreated oatmeal for 1 day, and placing weevil larvae fed with dsRNA in HRACIN LC₂₀And (4) fumigating treatment. Each treatment was set to 3 replicates, each replicate 50 worms tested and 2g oatmeal. The RNase-free water treated group was blank control group. The breeding conditions are that the humidity is 75 +/-5%, the temperature is 28 +/-1 ℃, and the illumination period is L/D: 12h/12 h. After the experiment, the death and spawning of the adults were counted, as shown in Table 2.

TABLE 2

Table 2 shows the death and oviposition of five-day-old weevil adults after 5 days of fumigation with dsRNAOX I or dsRNAOX II or dsRNAOX III in combination with horseradish peroxidase. As can be seen, the gene sequence can obviously kill the zearals maydis, and obviously reduce the number of eggs laid and the number of eggs hatched, and can lead to 84% of death rate at most; the minimum hatching rate can be 24 percent, and the control effect on the maize weevils is obvious.

Although the invention has been described in detail in the foregoing by way of general description, specific embodiments and experiments with activity, it will be apparent to those skilled in the art that modifications and improvements can be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Nucleotide sequence list electronic file

<110> northwest agriculture and forestry science and technology university

<120> an insecticidal composition and uses thereof

<160>9

<210>1

<211>493

<212>dsRNA

<213> elephant of corn

<220> insecticidal Gene sequences

<400>

TCCTGGATCATTAATTGGAAATGATCAAATTTACAATACTATTGTTACAGCTCACGCATTCATTATGATTTTCTTTATGGTGATGCCTATTATGATTGGAGGTTTCGGAAACTGGTTAGTCCCACTAATGCTAGGAGCCCCAGATATGGCATTCCCACGATTAAACAATATGAGTTTCTGGTTACTCCCTCCATCATTAATTCTTTTATTAATGAGTAGTTTCATTGAAAAAGGTGCCGGAACAGGATGGACTGTTTATCCCCCATTATCCTCAAATATTGCACACGAAGGAGCCTCTGTTGATTTAGCAATTTTTAGTCTTCATATGGCAGGTATTTCATCTATTCTTGGAGCTATTAATTTTATTTCTACTACTTATAATATGCGCCCCTCCGGTATGTTATCAGATCGAATGACTTTATTTATTTGGGCAGTTAGTATTACAGCCATTCTTCTTTTACTTAGTTTACCTGTTTTAGCTGGAGCAATCACT

<210>2

<211>43

<212>dsRNA

<213> elephant of corn

<220> dsRNA upstream primer

<400>

taatacgactcactatagggTCCTGGATCATTAATTGGAAATG

<210>3

<211>43

<212>dsRNA

<213> elephant of corn

<220> dsRNA downstream primer

<400>

taatacgactcactatagggAGTGATTGCTCCAGCTAAAACAG

<210>4

<211>500

<212>dsRNA

<213> elephant of corn

<220> insecticidal Gene sequences

<400>

CAAGATAGCGCCTCACCTTTAATGGAACATCTTACATTATTTCATGACCATACTATTTTAATCTTAATTTTAATTACAATTTTAGTTAGCCAAATGCTATTAAGCATGTTATTAAATAAACTCTCACACCGATTTTTACTTGAAGGTCAATTAATTGAAACTATTTGGACTATTCTACCTGCTATTATTCTTATTTTAATTGCCTTACCCTCACTTCGATTATTATACATTCTAGACGAAATTAATAACCCTTCTATTACTATTAAAATTATCGGACATCAATGGTATTGGTCATATGAATATTCTGATTATAAAAATATTGAATTTGATTCCTATATGATTCCTACCAAAGAACTTAACTCTTTTAATTTTCGTCTCCTAGAAGTAGATAATCGAACTCCTTTTCCTTATAAAACTCAAATTCGACTCTTAGTTACGTCTGCAGATGTAATTCATTCTTGGACAGTACCAAGTATGGGAATTAAAATTGATAGCACCCC

<210>5

<211>43

<212>dsRNA

<213> elephant of corn

<220> dsRNA upstream primer

<400>

taatacgactcactatagggCAAGATAGCGCCTCACCTTTAAT

<210>6

<211>44

<212>dsRNA

<213> elephant of corn

<220> dsRNA downstream primer

<400>

taatacgactcactatagggGGGGTGCTATCAATTTTAATTCCC

<210>7

<211>411

<212>dsRNA

<213> elephant of corn

<220> insecticidal Gene sequences

<400>

TATGTATCAATGGTGGCGAGATATTATTCGAGAGGGAACCTTCCAAGGATTACATACTTTAAAAGTAACTATGGGTCTTCGTTGGGGAATGATTTTATTCATTACATCAGAAGTATTTTTTTTTCTTGGATTTTTTTGGAGTTTCTTTCATGCTAGTTTATCCCCAAGTATTGAAATTGGTTTAGAATGGCCTCCTAAGGGAATTTTTACCTTTAATCCCCTAGAAATTCCACTATTAAATACCTTAATTCTTATTTCATCAGGTTTAACTATTTCATGGTCACACCATGCAATTATGGAAAATAATTATACCCAATCCTTTCAAAGCCTTTTAATTACTGTAATTTTAGGTTTATATTTTTCCTTTCTTCAAAGTTATGAATATTACCAAGCCCCATTCTCTATTAGTGA

<210>8

<211>41

<212>dsRNA

<213> elephant of corn

<220> dsRNA upstream primer

<400>

taatacgactcactatagggTATGTATCAATGGTGGCGAGA

<210>9

<211>41

<212>dsRNA

<213> elephant of corn

<220> dsRNA downstream primer

<400>

taatacgactcactatagggCACTAATAGAGAATGGGGCTT

Claims

1. An insecticidal composition, which is characterized by comprising an insecticidal gene sequence and athomin, wherein the gene sequence is shown as SEQ ID NO: 1, or at least comprises SEQ ID NO: 1, and (b) 1, wherein the sequences are 90% identical.

2. The insecticidal composition of claim 1, wherein primers synthesizing said insecticidal gene sequence comprise SEQ ID NO: 2 and the upstream primer shown in SEQ ID NO: 3, or a reverse primer as shown in the figure.

3. The insecticidal composition of claim 1, wherein said insecticidal gene sequence is based on a gene fragment designed from the cytochrome C oxidase core subunit I gene of Zea mays (NCBI reference sequence: NC-030764.1: 1323) -2864 in NCBI database.

4. An insecticidal composition, which is characterized by comprising an insecticidal gene sequence and athomin, wherein the gene sequence is shown as SEQ ID NO: 4, or at least comprises SEQ ID NO: 4, and (b) 4, wherein the sequences are 90% identical.

5. The insecticidal composition of claim 4, wherein primers synthesizing said insecticidal gene sequence comprise the amino acid sequence of SEQ ID NO: 5 and the upstream primer shown in SEQ ID NO: 6.

6. The insecticidal composition of claim 4 wherein said insecticidal gene sequence is a gene fragment designed from the zearals zeamais cytochrome C oxidase core subunit ii gene (GENBANK accession No.: KX783028) in the NCBI database.

7. An insecticidal composition, which is characterized by comprising an insecticidal gene sequence and athomin, wherein the gene sequence is shown as SEQ ID NO: 7, or at least comprises the amino acid sequence shown in SEQ ID NO: 7, which is 90% identical to the sequence shown in figure 7.

8. The insecticidal composition of claim 7, wherein primers synthesizing said insecticidal gene sequence comprise SEQ ID NO: 8 and the upstream primer shown in SEQ ID NO: 9 as shown in the figure.

9. The insecticidal composition of claim 7, wherein said insecticidal gene sequence is a gene fragment designed from the cytochrome C oxidase core subunit III gene of Zea mays (NCBI reference sequence: NC-030764.1: 4574) -5365) in NCBI database.

10. Use of an insecticidal composition according to any one of claims 1 to 9 for the preparation of a pesticide for controlling zearals; the insecticidal gene sequence is used by an injection method or a feeding method; the athomin is applied by fumigation, and the fumigation concentration is 3.997 mu L/L.