CN106754948A - Brown paddy plant hopper NlMLP genes, encoding proteins and its application - Google Patents
Brown paddy plant hopper NlMLP genes, encoding proteins and its application Download PDFInfo
- Publication number
- CN106754948A CN106754948A CN201710061215.8A CN201710061215A CN106754948A CN 106754948 A CN106754948 A CN 106754948A CN 201710061215 A CN201710061215 A CN 201710061215A CN 106754948 A CN106754948 A CN 106754948A
- Authority
- CN
- China
- Prior art keywords
- plant hopper
- paddy plant
- brown paddy
- nlmlp
- ser
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N57/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
- A01N57/10—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds
- A01N57/16—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds containing heterocyclic radicals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Insects & Arthropods (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Toxicology (AREA)
- Genetics & Genomics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Agronomy & Crop Science (AREA)
- Pest Control & Pesticides (AREA)
- Plant Pathology (AREA)
- Engineering & Computer Science (AREA)
- Dentistry (AREA)
- Wood Science & Technology (AREA)
- Environmental Sciences (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a brown paddy plant hopper saliva body of gland secretorNlMLPAnd its application after being suppressed in paddy rice brown planthopper resistant.The brown paddy plant hopper saliva body of gland secretorNlMLPGlobal cDNA sequence is as shown in SEQ ID No.1.NlMLPDsRNA brown paddy plant hopper is entered by microinjection, makeNlMLPGene expression amount reduction, brown paddy plant hopper takes food for influence, causes brown paddy plant hopper survival rate to decline.The stabilization expression in rice plants bodyNlMLPDsRNA, after brown paddy plant hopper takes food the paddy rice,NlMLPThe expression quantity reduction of gene, causes brown paddy plant hopper worm to reduce again, and brown paddy plant hopper survival rate declines.Explanation of the inventionNlMLPThe preventing and treating important role of the brown paddy plant hopper in the research of paddy rice brown planthopper resistant and agricultural production is suppressed after expressing.
Description
Technical field
The present invention relates to biological technical field.Specifically related to brown paddy plant hopper NlMLP genes and its dsRNA and for the gene
Application of the RNA interference in terms of brown paddy plant hopper is controlled.
Background technology
Brown paddy plant hopper (BPH；Nilaparvata lugens), category Homoptera Delphacidae (Homoptera；
Delphacidae), it is primary insect on China and many Asian countries paddy rice.Brown paddy plant hopper has remote habit of migrating, and is single
Feeding habits insect, can only take food and raise up seed on paddy rice and common wild-rice.The sucking mouth parts of brown paddy plant hopper can be pierced into plant
In object, phloem sap is sucked.Brown paddy plant hopper not only only takes food phloem sap, causes coup injury, and brown paddy plant hopper to be
The medium that grass-like bushy stunt and tingia dwarf wilt are propagated, so as to cause indirect injury.Brown paddy plant hopper take food tillering stage before paddy rice,
The reduction of paddy rice spike number and Number of kernels can be caused；Brown paddy plant hopper takes food the paddy rice in maturity period, and the number of ripe grain can be caused to reduce,
Weight saving.When paddy rice endangers serious by brown paddy plant hopper, paddy rice Large Scale Death can be caused, the phenomenon for " plant hopper baked wheaten cake " occur, from
And No kernels or seeds are gathered, as in a year of scarcity.Before very early, although brown paddy plant hopper is sporadicly broken out, it is exactly catastrophic (Suenaga＆ once to occur
Nakatsuka,1958；Miyashita,1963).From after 1970, brown paddy plant hopper is frequently broken out in some tropic countries.2000
The frequency and scale of whole Asia paddy rice place of production brown paddy plant hopper outburst afterwards gradually expand (Catindig et al., 2009).According to
Statistics is between 2005 to 2007 years, China per have more than every year 25000000 hectares of rice terraces outburst brown paddy plant hopper disasters (Qiu et al.,
2012).Brown paddy plant hopper about causes 10 to 15 hundred million kilograms of rice yield to reduce every year, equivalent to the economic loss of billions of units.
Generally use insecticide at present to control brown paddy plant hopper, but as a large amount of of insecticide use, cause brown paddy plant hopper to generate
The resistance to the action of a drug, such as go out must lice, carbofuran puts out pine, in addition synthesis pyrethrins (Nagata, 1982；Lakshmi et
al.,2010).And spray insecticide, it is not only harmful to people and animals, also result in serious environmental pollution.Therefore, actively develop brown
Scientific and effective control is implemented in the research and application of plant hopper biological prevention, the harm of the brown paddy plant hopper occurred to China and the whole world
System, and ensure that China's grain security and Environmental security are significant.
RNA interference (RNA interference, RNAi) refers to that the induction homologous mRNA of double chain RNA mediate is efficiently specific
The phenomenon of degraded.Since discovery, develop rapidly, as gene functional research a effective tool, at present also in insect base
Because of extensive use in research.The dsRNA of external synthesis is expelled to using microinjection instrument in the hemolymph of insect or specific
The method at position be referred to as microinjection.Microinjection is at present using one of most common introduction method (Ober and
Jockusch,2006).Microinjection has the advantage that injection volume is accurately controlled, and can specifically observe specific gene expression
Influence after amount reduction to single head brown paddy plant hopper, has very big help in the theoretical research to gene function.Genetically modified plants method
Refer to allow plant to give expression to the hair fastener ring RNA (hairpin RNA) containing target species by transgenic technology, insect's food-taking is planted
The siRNA (small interfering RNA, siRNA) that dsRNA or degraded are produced is taken in while thing, so as in elder brother
RNAi effects are reached in polypide.At present, adopting said method be related to bollworm and corn beetle (Baum et a1.,
Etc. 2007) harmful organism is successfully reported.Among the RNAi of mediated plant, because the gene of harmful organism is autotelic
Selection is inserted among plant, and according to basepairing rule, the target of this dsRNA has specificity, to non-target gene
Or biology is safe.Therefore, excavate and identify new brown paddy plant hopper functional specific gene and its dsRNA, using transgenosis
Technology cultivates brown planthopper resistant new varieties, for ensureing that China's grain security and Environmental security have great importance.
The content of the invention
It is an object of the present invention to provide a kind of cDNA sequence and protein sequence of the NlMLP genes cloned from brown paddy plant hopper
Row.By microinjection and the RNAi silence brown paddy plant hopper NlMLP genes of mediated plant, cause the reduction of brown paddy plant hopper survival rate.
The present invention is achieved through the following technical solutions：
The present invention provides a kind of brown paddy plant hopper NlMLP genes, and the nucleotides sequence of the cDNA of the NlMLP genes is classified as SEQ ID
Shown in NO.1.
The present invention also provides a kind of albumen of brown paddy plant hopper NlMLP gene codes, and the amino acid sequence of the encoding proteins is
Shown in SEQ ID NO.2.
The present invention also designs a kind of dsRNA of brown paddy plant hopper gene, and sequence can reach specially as shown in SEQ ID NO.1
The double-stranded RNA that the nucleotides of the nucleotides and its reverse complementary sequence that suppress NlMLP gene expression effects is constituted.
Preferably, the dsRNA of described brown paddy plant hopper NlMLP genes, contains the nucleotide sequence shown in SEQ ID NO.3.
The present invention also provides recombinant expression carrier, transgenic cell line, restructuring containing above-mentioned RNA molecule or DNA molecular
Bacterium or expression cassette.
The present invention also protects the application of above-mentioned RNA molecule or DNA molecular in product is prepared, and the purposes of the product is as follows
(1)-(3) application in any one：
1) product of preventing and treating brown paddy plant hopper or preparation preventing and treating brown paddy plant hopper；
2) reduce brown paddy plant hopper survival rate or prepare the product for reducing brown paddy plant hopper survival rate；
3) suppress brown paddy plant hopper gene NlMLP gene expressions or prepare the product for suppressing brown paddy plant hopper NlMLP gene expressions.
Further, application of the present invention is that dsRNA is imported into brown paddy plant hopper, so as to realize preventing and treating brown paddy plant hopper, is reduced brown
The expression of plant hopper survival rate or suppression brown paddy plant hopper NlMLP genes.
Preferably, the mode of the importing is microinjection, and dsRNA is injected into brown paddy plant hopper body, then makes brown paddy plant hopper
Take food.
Preferably, the mode of the importing is, in plant interior expression RNAi carrier, then to take food brown paddy plant hopper.
The present invention provides a kind of method of the plant for suppressing brown paddy plant hopper growth and survival, including：
1) plant cell is converted with polynucleotides；The polynucleotides contain the RNAi carrier of brown paddy plant hopper NlMLP genes；
2) Plant cell regeneration that will be converted is plant；
3) cultivate the plant of regeneration and replicated above-mentioned polynucleotides.
Wherein described plant is paddy rice.
ORF sequences according to NlMLP genes, have selected the fragment of about 500bp carries out the structure of RNAi carrier.By overlapping
It is the fragment that introne both sides are complementary 500bp sequences that the method for PCR is constructed middle, the fragment is added be connected into after A through
In the PCXUN carriers of XcmI digestions.After sequence verification is errorless, resulting vehicle is the RNAi carrier of NlMLP genes, and its electricity is turned
In entering Agrobacterium EHA105.Using agrobcterium-mediated transformation, by the normal rice variety Kasalath of vector introduction
In, finally obtain 30 plants of positive plant.Brown paddy plant hopper has been carried out for the positive plant of homozygosis and taken food phenotypic evaluation, as a result table with T2
Bright, brown paddy plant hopper takes food rear worm weight and survival rate and all reduces.
The above-mentioned introne for preparing NlMLP gene RNAi carriers is PDK, and amplimer is：
PdkP3F：CTCGAGGAATTCGGTACCCC
PdkP4R：TTCGAACCCAATTTCCCAACTG
Expanding the primer of the terminal sequence of PDK intrones two is：
PdkP3F：CTCGAGGAATTCGGTACCCC
PdkP4R：TTCGAACCCAATTTCCCAACTG
R1F：CTACAGCAGTGTCTTCAGCCAG
P3RR2R：
GGGGTACCGAATTCCTCGAGAGCCGATGTATTTCCTGTAGATP4FR2R：
CAGTTGGGAAATTGGGTTCGAAAGCCGATGTATTTCCTGTAGAT。
The positive beneficial technique effect that the present invention has：
1st, the present invention is domestic and international first public brown paddy plant hopper NlMLP gene nucleotide series.At present on its suppression expression
And the function that brown paddy plant hopper grows can be significantly affected have no relevant report.
2nd, it is demonstrated experimentally that the present invention has obtained the cDNA sequence of brown paddy plant hopper NlMLP genes, using microinjection dsRNA's
RNAi technology, silence brown paddy plant hopper NlMLP genes cause brown paddy plant hopper to produce lethal effect, and extension over time, survival rate is more next
It is lower；The products such as the dsRNA and its corresponding expression cassette, recombinant vector or recombinant bacterium of the obvious gene are in brown paddy plant hopper prevention and control field
There is important application value.
3rd, a kind of RNAi carrier for brown paddy plant hopper NlMLP genes is constructed, it is demonstrated experimentally that the carrier is transferred into brown paddy plant hopper
In host rice plant, after brown paddy plant hopper takes food transfer-gen plant, NlMLP expression quantity reduction, the survival rate of brown paddy plant hopper lowers, explanation
The RNAi carrier of NlMLP is to suppressing brown paddy plant hopper survival important role.The present invention is significant to cultivating pest-resistant plant,
There is good application prospect, to reducing Pesticide use, maintain the ecological balance and sustainable development to have great application value.
Brief description of the drawings
Fig. 1 is the clone of NlMLP genes.
Fig. 2 is the agarose gel electrophoresis figure of dsMLP and dsGFP.
Fig. 3 is NlMLP gene relative expression quantity analysis after microinjection.
After brown paddy plant hopper injection, sampling, the expression quantity of NlMLP genes in Real-time PCR Analysis brown paddy plant hopper body daily.With brown
Plant hopper actin genes are internal reference.CK is the brown paddy plant hopper do not injected, and dsGFP is the brown paddy plant hopper for injecting dsGFP, and D1-D6 is injection
The brown paddy plant hopper of dsMLP different number of days.* represents P<0.01, up to pole significant difference.
Fig. 4 is brown paddy plant hopper survival rate and worm weightening analysis after microinjection.
A：Brown paddy plant hopper is placed on paddy rice after microinjection, daily the survival rate of statistics brown paddy plant hopper.
B：Brown paddy plant hopper after injection, treats that it turns into adult, weighs worm weightening of the female adult in three days.
Fig. 5 is that NlMLP RNAi carriers build schematic diagram.
Fig. 6 takes food the analysis of wild type WT and NlMLP RNAi plant phenotypes for brown paddy plant hopper.
A：RNAi fragment expressions amount analysis in wild type WT and NlMLP RNAi plant.
B：It is brown to fly after brown paddy plant hopper takes food transfer-gen plant parent's WT and NlMLP RNAi transfer-gen plants SG33-2 for a long time
NlMLP expression analysis in lice body.Two age brown paddy plant hoppers take food on different paddy rice, odd number day sampling, Real-time PCR Analysis
The expression quantity of NlMLP genes in brown paddy plant hopper body, actin is internal reference.
C：It is brown to fly after brown paddy plant hopper takes food transfer-gen plant parent's WT and NlMLP RNAi transfer-gen plants SG33-2 for a long time
Lice survival rate analysis.
D：After brown paddy plant hopper takes food transfer-gen plant parent's WT and NlMLP RNAi transfer-gen plants SG33-2 for a long time, ten days
Brown paddy plant hopper worm weight analysis afterwards.
Specific embodiment
Following embodiment further illustrates present disclosure, but should not be construed limitation of the present invention.Not
In the case of spirit of the invention and essence, the modification or replacement made to the inventive method, step or condition belong to this
The scope of invention.
If not specializing, the conventional meanses that technological means used is well known to those skilled in the art in embodiment.
Material used, reagent etc. in following embodiments, it is unless otherwise specified, commercially available.
Brown paddy plant hopper used in following examples, raises in genetic research institute of Wuhan University, is grown on rice varieties TN1.Raise
Support 26 ± 2 DEG C of temperature.
【Embodiment 1】The clone of brown paddy plant hopper NlMLP genes
20 brown paddy plant hoppers of bion 1 are taken, total serum IgE is extracted, and be reversed to cDNA.By the primers, use
The F μ Ll RACE kits of TaKaRa companies 5 ' and 3 ', obtain the end of candidate gene 5 ' and 3 ' end sequences, it is determined that candidate
The transcription initiation site and termination site of gene, and it is spliced into the full length cDNA sequence of the gene.According to full length cDNA sequence weight
New synthetic primer MLP-F, MLP-R, amplification obtain the full-length cDNA of NlMLP, predict ORF, its ORF sequence such as sequence table SEQ ID
(Fig. 1) shown in NO.1.
MLP-F：ATGAGGTGTTTCTCAGTTATCGC
MLP-R：TCAGTAGTATCCACCAAAACCA
【Embodiment 2】DsRNA (dsMLP) for silence brown paddy plant hopper NlMLP genes and the green fluorescence for compareing
The preparation of Protein G FP genes dsGFP
1. as template, with MU-F, MU-R enters performing PCR amplification to the cDNA for being obtained with embodiment 1 for primer, obtains PCR amplifications
Product.
MU-F (forward primer):
TAATACGACTCACTATAGGGAGAAGCCGATGTATTTCCTGTAGAT
MU-R (reverse primer)：
TAATACGACTCACTATAGGGAGACTACAGCAGTGTCTTCAGCCAG
The region of underscore mark is t7 rna polymerase promoter sequence.
2., with the existing plasmid containing GFP in laboratory as template, with dsGFP-F, dsGFP-R enters performing PCR amplification for primer,
Obtain pcr amplification product.
DsGFP-F (forward primer)：TAATACGACTCACTATAGGGCGGACT
DsGFP-R (reverse primer)：TAATACGACTCACTATAGGGCGATGC
The region of underscore mark is t7 rna polymerase promoter sequence.
3., by amplified production, reclaim, plus A, connecting pMD18-T (TAKARA) carrier, positive colony send sequencing.Obtain correct
Clone, with the cloned plasmids as template, is equally expanded with above-mentioned primer, amplified production purifying, concentration, makes its concentration be 1 μ g/ μ
L, the product is the template of dsRNA synthesis.
4. each 1 μ of μ L, ATP, CTP, GTP, UTP (100mM) of Transcription buffer 10 are added in the following proportions
L, 1.25 μ L, T7RNA Polymerase of RNase inhibitor 1 μ L, template 1.5 μ g, DEPC H2O is settled to 49 μ L.Flick mixed
It is even, brief centrifugation.It is put into PCR, program is 37 DEG C, 4h；75 DEG C, 5min；16 DEG C of preservations.Suction out 1 μ L, detected through gel electrophoresis,
Continue next step operation after detecting purpose band.
The μ L of 5.10 × Reaction buffer, 6 I 2 0.5 μ L, DEPC H2O of μ L, RNase of μ L, DNase 1.5, it is fully mixed
Even, brief centrifugation is put into 37 DEG C, 30min in PCR instrument.Take out afterwards and add EDTA (Fementas) 1 μ L, continue to put back to PCR instrument
In 65 DEG C, 5min terminating reactions.1 μ L are suctioned out, 10 times, 2 μ L detected through gel electrophoresis, 2 μ L NANOdrop ultraviolet spectrometry light are diluted
Degree meter detectable concentration.If test strip is very single bright band, as shown in figure 1, and OD260/280 1.8-2.0 it
Between, then illustrate that dsRNA mass is good, can carry out next step：RNA phenol chloroforms.
6. conventional phenol chloroform, removes isolating protein, and dsRNA is transferred into 5 μ g/ μ L according to concentration, and often the μ L of pipe 10 are dispensed,
It is put into -80 DEG C of preservations.
【Embodiment 3】The microinjection of dsMLP and dsRNA and effect detection
1. brown paddy plant hopper prepares：30 female adults are taken, 10 male worms after 24h, take out adult in having the cup of TN1 young plants.Treat
Hatching, is four age nymphs after 20d, and injection is used.
2. flat board prepares：The agar powder for weighing 1.5g is added in 100ml water, is boiled, and is poured into glass dish, treats that it coagulates
Gu it is standby.
3. inject：Similar insect 5-8 of growing way is taken in test tube, CO is passed through2Anesthesia 20s, should not be opposite when being passed through CO2
Insect is blown, it is to avoid insect disorderly flies to cause collsion damage.Insect is fallen again on 1.5% agar powder flat board, belly is upward.With
The microinjection instruments of Nanoliter 2010 are injected according to specification.Injection position is between preceding mesothorax.Injection volume is 46nl
(5μg/μL)。
4. after brown paddy plant hopper injection dsRNA, the daystart sampling from after injection, daily sampling three is sampled six days, while
Brown paddy plant hopper do not inject and injection dsGFP is taken as control, verifies that gene expression amount changes with RT-PCR.
Concrete operations are as follows：After sampling, RNA (with reference to 2.1.2) is carried, with the PrimeScript RT reagent of TAKARA
Kit with gDNA Eraser (article No. RR047A) is inverted to specifications, obtains inversion product.To invert what is obtained
CDNA takes 5 μ L, and 10 times are diluted with TE, and real-time quantitative PCR is carried out by following operation.PCR is reacted in CFX96TouchTM Real-
Carried out on Time PCR Detection System (Bio-Rad) instrument, it then follows following reaction system：DNase/RNase-
Free ddH2The μ L of 2.9 4 μ L, Primers (5mM) of μ L, 2 × Supermix of O, 0.6 μ L, cDNA templates 0.5.Reaction condition：95
(55-65 DEG C) annealing of 2min, 95 DEG C of denaturation 5-10s, TM of DEG C predegeneration extends 30s, the circulation of two steps 40, last 65 after repeating
DEG C -95 DEG C, often step increase by 0.5 DEG C, 5s does solubility curve to determine the specificity of amplified production.
First different primers are done with 55-65 DEG C of grads PCR and determines that most suitable annealing elongating temperature (rises peak morning, solubility curve is special
It is different), take PCR primer dilution 106Afterwards as first gradient, then 10 times of dilutions, 3 gradients again, are generally made with this four templates
Standard curve screens quantitative primer of the amplification efficiency primer high as gene.Each sample does 3 technologies and repeats, each
Plate PCR does amplification efficiency.Result is analyzed using Bio-Rad CFX Manager, and its solubility curve, QC (matter are analyzed first
Control) etc., number of non-compliances evidence is removed, gene expression analysis software carries Gene Study functions for (1+E)-ΔΔCtAlgorithm Analysis.
Reference gene actin primers：
Actin-F：GACAGGATGCAGAAGGAAATCA
Actin-R：GACTCGTCGTACTCCTGCTTTG
The quantitative primers of NlMLP：
QMU-F：GTCAGGAACTTTGCCAGACGC
QMU-R：CGGGAAGCAGCACTCCACAT
5. shown in result accompanying drawing 3, the experimental group of microinjection dsMLP, with the brown paddy plant hopper and injection dsGFP do not injected
Control group is compared, and from injection first day, the relative expression quantity of NlMLP genes was significantly reduced in brown paddy plant hopper body, up to less than 10%,
There is pole significant difference (P compared with the control<0.01).Result shows, saliva in brown paddy plant hopper body can be caused by microinjection dsMLP
The RNAi effects of liquid glandular secretion NlMLP genes, cause gene expression amount substantially to reduce.
【Embodiment 4】Brown paddy plant hopper Phenotypic examination after microinjection
Brown paddy plant hopper survival experiment：Three groups of brown paddy plant hopper point, does not inject, and injects dsGFP, injects dsMLP, treats that it is answered after injection
Soviet Union, puts back on paddy rice.Ten cephalonts are done every time, is repeated 5 times.Result as shown in Figure 4 A, injects the survival rate one of brown paddy plant hopper after dsMLP
The straight brown paddy plant hopper for being less than injection dsGFP and not injecting.And when the tenth day, the brown paddy plant hopper for injecting dsMLP is almost complete
Die, the survival of injection dsGFP and the brown paddy plant hopper at least also 40% do not injected.
The weightening experiment of brown paddy plant hopper worm：Put back on paddy rice after brown paddy plant hopper injection, treat that it is sprouted wings, brown by emergence in first day flies
Lice, single head is weighed, and is then placed in tying up in the wax bag on paddy rice young plant, after three days, removes the brown paddy plant hopper of survival, is weighed again,
The difference of weight, is designated as worm weightening twice.Ten cephalonts are done every time, is repeated 5 times.As shown in Figure 4 B, to firm emergence brown paddy plant hopper in 72h
Worm weightening be analyzed, find after injection dsMLP, worm weightening is significantly reduced, and injects dsGFP and not having substantially of not injecting
It is variant.Result shows, after injection dsMLP, due to the expression quantity reduction of the gene, causes brown paddy plant hopper to take food and is affected, and enters
And influence the survival rate of brown paddy plant hopper.
【Embodiment 5】The structure of brown paddy plant hopper NlMLP gene RNAi carriers
1. fragment amplification：With high-fidelity enzyme KOD Plus Neo (TOYOBO), and primer PdkP3F and PdkP4R, template is
PKANNIBAL plasmids containing PDK intrones, amplification PDK intrones 814bp.Continue to use high-fidelity enzyme KOD Plus Neo, draw
To R1F/P3RR2R, R1F/P4FR2R expands the plasmid containing NlMLP to thing respectively, obtains distinguishing with the terminal sequence of PDK intrones two
Two fragments of identical, fragment 1 and 2, size is 500bp or so.
PdkP3F：CTCGAGGAATTCGGTACCCC
PdkP4R：TTCGAACCCAATTTCCCAACTG
R1F：CTACAGCAGTGTCTTCAGCCAG
P3RR2R：GGGGTACCGAATTCCTCGAGAGCCGATGTATTTCCTGTAGAT
P4FR2R：CAGTTGGGAAATTGGGTTCGAAAGCCGATGTATTTCCTGTAGAT
2. fragment is overlapped：
The first round reacts：Successively to adding following reagent in 200 μ L centrifuge tubes：10 × buffer 5 μ L, 25mM MgSO4
3 μ L, 2mM dNTPs 5 μ L, the μ L of fragment 1 (50ng) 1, fragment 2 (50ng)
1 μ L, fragment 3 (50ng PDK intron) 1 μ L, ddH20 34μL；PCR programs are 94 DEG C, 2min；98 DEG C of 10s,
50 DEG C of 60s, 68 DEG C of 45s, 10 circulations.
Second wheel reaction：5 μ L, the 25mM MgSO of μ L, 10 × buffer of above-mentioned Mix 504The μ L of 3 μ L, 2mM dNTPs 5,
3 μ L, KOD Plus Neo of primer R1F (10 μM) 2 μ L, ddH20 29μL；PCR programs are 94 DEG C, 2min；98 DEG C of 10s, 55 DEG C
30s, 68 DEG C of 1min, 18 circulations.
3. after the completion of reacting, take 2 μ L and enter row agarose gel electrophoresis detection.The fragment of gel extraction purpose size, about
It is 1.8kb, because KOD PLUS NEU amplified fragments end does not have A tails, therefore carrier is connected after A need to be added.
4.PCXUN carriers are reclaimed with Xcm I digestions, can form T ends, are connected overnight with above-mentioned plus 16 DEG C of A products.Turn
Change, choose monoclonal, Bam HI digestion verification Insert Fragment sizes, size is that the fragment of 2kb or so send company to be sequenced, such as Fig. 5.
5. correct vector plasmid will be sequenced agrobacterium strains EHA105 is transferred to by conventional electricity shifting method.
【Embodiment 6】Functional verification after NlMLP suppression
1. agriculture bacillus mediated NlMLP RNAi transfer-gen plants are obtained
Genetic transforming method (Hiei etc., 1994, Efficient mediated using Agrobacterium EHA105
transformation of rice(Oryza sativa L.)mediated by Agrobacterium and sequence
analysis of the boundaries of the T-DNA.Plant Journal 6:271-282) by above-mentioned NlMLP
RNAi carrier imports the common rice kind Kasalath of brown paddy plant hopper perception.
2. brown paddy plant hopper takes food phenotype checking after NlMLP RNAi transfer-gen plants
NlMLP RNAi conversion carriers obtain 30 plants of positive transgenic plant.After harvesting seed, with T2 for homozygous plants
(SG33-2) phenotypic evaluation is carried out, the expression to RNAi carrier section in transfer-gen plant first carries out quantitative PCR detection, primer
It is Q1-F, Q1-R, internal reference is paddy rice actin, and primer is Osactin-F, Osactin-R.Result as shown in Figure 6A, NlMLP
RNAi fragments are largely accumulated in plant.
RNAi-F：AGGGCTACGACTATTCAA
RNAi-R：AGGGTGCTGCTCATCT
Osactin-F：GATCACTGCCTTGGCTCCTA
Osactin-R：GTACTCAGCCTTGGCAATCC
The two age brown paddy plant hoppers of bion 1 are placed on WT (kasa) and SG33-2, are taken food for a long time.Odd number day sampling, daily 5
Head, carries RNA, reversion, quantifies.Result as shown in Figure 6B, when brown paddy plant hopper persistently takes food transfer-gen plant, takes food SG33-2's
The internal NlMLP expression quantity of brown paddy plant hopper itself is lower than taking food the expression quantity of the brown paddy plant hopper of wild type WT.
The two age brown paddy plant hopper 20 of bion I takes food WT (kasa) and SG33-2 respectively, by the survival rate of number of days insect, weight
It is multiple five times.Result as shown in Figure 6 C, due to the reduction of NlMLP expression quantity, have impact on taking food for brown paddy plant hopper, it was arrived at the 7th day
The survival rate of the 10th day is significantly reduced.
The two age brown paddy plant hopper Long-term breedings of bion I after ten days, claim its worm weight, every time on WT (kasa) and SG33-2
10.Three repetitions.As shown in Figure 6 D, brown paddy plant hopper takes food transfer-gen plant to result for a long time, and the worm weight of brown paddy plant hopper is also reduced.These
All existence of the explanation NlMLP to brown paddy plant hopper has very important effect.
SEQUENCE LISTING
<110>Wuhan University
<120>Brown paddy plant hopper NlMLP genes, encoding proteins and its application
<160> 16
<170> PatentIn version 3.3
<210> 1
<211> 2187
<212> DNA
<213>Brown paddy plant hopper NlMLP genes
<400> 1
atgaggtgtt tctcagttat cgcactcctt gctgcatgca tttctgctgc aacatgcatg 60
agctatggaa gttatggtgg cgccgctgca gcctatgaag ctacagctgg agctgcccag 120
cagtatggca tggaacagtc ccagtcccaa tacagcgcaa gtcagcagga atcatcatca 180
tcatccagct atgaatctac agaatacgat tatgctgcag gtgccaccag tggttatgtt 240
ggtcaatctg ctcaagctgc aggagctgct tatggtgctg ccactggcgc tggttatggt 300
gtcgctggcg ctggttatgg tgctgctgaa gctgcttatg gtgccgctta tggcagttcg 360
gcttatggag ctagtatggc cagtggagcc tcaaactacg ctgccgcatc ctcctccaaa 420
ttcagctccg cttcgtcaat ggctgcctct tcagcttcat ctagcgccgc catgtcagcc 480
tctgcctctt cctatcaggc cagcctcgac tactacccaa aactcagaac tattcctttc 540
ttcaacaacg tcttccaggc catgtcttgt gatgacatct catcttacag cagcctctgg 600
accagcaact tcaacgttca aagcaccttg accagcatgt tccaaagcaa ctccctgttt 660
aagagctact tgagttgtgc caccggtatg agcttctcaa gcttccaagg tgccgaattc 720
tctagagttt gctctgcctt ctcatcgaac aagggtgctt ttgtcggact cgtcaggaac 780
tttgccagac gcggttacat ctacaaatcc agcttcgcta cctctctttt gtcctacaca 840
caatccacag agatgtggag tgctgcttcc cgtttctctt cattctccaa catgcagact 900
tggtcacagt gtggaatcaa cgctttcttc cagcacaagg cttacaggag ttatatcatg 960
aatttctgtg gtgttcaatc ctgggacgaa actgctattt caagaaccct ttccggatac 1020
ttcagatcta acccagtcgc aacctcattg ttcttcagac atcttctcct caacagggtg 1080
agctcatcat gctcgttcca gcagtacgcc gctttgaacc aacagtcgta catggctacc 1140
agaagctcca gctttgccta ctacggaggt ttctacaatg ccttccaaca atcatcatcg 1200
tcatcgtcat acgccagaac acaaagcatg tcatcttctt catcatcatc aatgagctct 1260
tcctcctcat cttactctgc ctcaaggtca taccaatcag tccagcagta ctacagctcc 1320
accctctacc agagcagcct cttccgtgga tgcttcgaac ttcaatccgt tgacacctcc 1380
aaacaagccg gtttctacag cagtgtcttc agccagggct acgactattc aagcaacttc 1440
ggaacctgct tccaagatgc ctactaccgt aaatacttgt tggcatgcac tggatattac 1500
ggcgaataca acgctcagat gagcagcacc ctcttctctt acgcccagca gcatccagga 1560
ttcttcgcca ggagtaccag gctttatgct agaaacggtg ctttcttctc atcacaaatt 1620
ggaaaaatgt tcgtggacca gaattccaac tttttcttct cacagcaggt ccaacagtac 1680
cgttcgcaat tcttgagcgt ccaagcttgg aattcatttg gactggccaa tctcttccaa 1740
tgtcgttact accaacgtaa aatctgcagc ttcttcggat tctcttccta caactaccat 1800
caagtgtcca atgcgtttat ctcactcttc aataccaact tctctggagg tcttcttgct 1860
ttgagacatt tgatctacag gaaatacatc ggctcttcct tcaacgtcca ggcctaccgc 1920
agtctaagaa gctacagtta tgccagctct ctggcctaca gctgtccatt ctactcgcag 1980
tggtctagct actgcagttc cttctcacag agatcgcagt tcagtcgctc agctgcctcc 2040
agtcgctcgg cttacatgca gcagcagcag tcagcttcta gctcaagcac cagctcctac 2100
caggctggtg cccagtcggc agctgctgga tacgctgctc agtcgggata cgctggtgga 2160
gcctctggtt ttggtggata ctactga 2187
<210> 2
<211> 728
<212> PRT
<213>The albumen of brown paddy plant hopper NlMLP gene codes
<400> 2
Met Arg Cys Phe Ser Val Ile Ala Leu Leu Ala Ala Cys Ile Ser Ala
1 5 10 15
Ala Thr Cys Met Ser Tyr Gly Ser Tyr Gly Gly Ala Ala Ala Ala Tyr
20 25 30
Glu Ala Thr Ala Gly Ala Ala Gln Gln Tyr Gly Met Glu Gln Ser Gln
35 40 45
Ser Gln Tyr Ser Ala Ser Gln Gln Glu Ser Ser Ser Ser Ser Ser Tyr
50 55 60
Glu Ser Thr Glu Tyr Asp Tyr Ala Ala Gly Ala Thr Ser Gly Tyr Val
65 70 75 80
Gly Gln Ser Ala Gln Ala Ala Gly Ala Ala Tyr Gly Ala Ala Thr Gly
85 90 95
Ala Gly Tyr Gly Val Ala Gly Ala Gly Tyr Gly Ala Ala Glu Ala Ala
100 105 110
Tyr Gly Ala Ala Tyr Gly Ser Ser Ala Tyr Gly Ala Ser Met Ala Ser
115 120 125
Gly Ala Ser Asn Tyr Ala Ala Ala Ser Ser Ser Lys Phe Ser Ser Ala
130 135 140
Ser Ser Met Ala Ala Ser Ser Ala Ser Ser Ser Ala Ala Met Ser Ala
145 150 155 160
Ser Ala Ser Ser Tyr Gln Ala Ser Leu Asp Tyr Tyr Pro Lys Leu Arg
165 170 175
Thr Ile Pro Phe Phe Asn Asn Val Phe Gln Ala Met Ser Cys Asp Asp
180 185 190
Ile Ser Ser Tyr Ser Ser Leu Trp Thr Ser Asn Phe Asn Val Gln Ser
195 200 205
Thr Leu Thr Ser Met Phe Gln Ser Asn Ser Leu Phe Lys Ser Tyr Leu
210 215 220
Ser Cys Ala Thr Gly Met Ser Phe Ser Ser Phe Gln Gly Ala Glu Phe
225 230 235 240
Ser Arg Val Cys Ser Ala Phe Ser Ser Asn Lys Gly Ala Phe Val Gly
245 250 255
Leu Val Arg Asn Phe Ala Arg Arg Gly Tyr Ile Tyr Lys Ser Ser Phe
260 265 270
Ala Thr Ser Leu Leu Ser Tyr Thr Gln Ser Thr Glu Met Trp Ser Ala
275 280 285
Ala Ser Arg Phe Ser Ser Phe Ser Asn Met Gln Thr Trp Ser Gln Cys
290 295 300
Gly Ile Asn Ala Phe Phe Gln His Lys Ala Tyr Arg Ser Tyr Ile Met
305 310 315 320
Asn Phe Cys Gly Val Gln Ser Trp Asp Glu Thr Ala Ile Ser Arg Thr
325 330 335
Leu Ser Gly Tyr Phe Arg Ser Asn Pro Val Ala Thr Ser Leu Phe Phe
340 345 350
Arg His Leu Leu Leu Asn Arg Val Ser Ser Ser Cys Ser Phe Gln Gln
355 360 365
Tyr Ala Ala Leu Asn Gln Gln Ser Tyr Met Ala Thr Arg Ser Ser Ser
370 375 380
Phe Ala Tyr Tyr Gly Gly Phe Tyr Asn Ala Phe Gln Gln Ser Ser Ser
385 390 395 400
Ser Ser Ser Tyr Ala Arg Thr Gln Ser Met Ser Ser Ser Ser Ser Ser
405 410 415
Ser Met Ser Ser Ser Ser Ser Ser Tyr Ser Ala Ser Arg Ser Tyr Gln
420 425 430
Ser Val Gln Gln Tyr Tyr Ser Ser Thr Leu Tyr Gln Ser Ser Leu Phe
435 440 445
Arg Gly Cys Phe Glu Leu Gln Ser Val Asp Thr Ser Lys Gln Ala Gly
450 455 460
Phe Tyr Ser Ser Val Phe Ser Gln Gly Tyr Asp Tyr Ser Ser Asn Phe
465 470 475 480
Gly Thr Cys Phe Gln Asp Ala Tyr Tyr Arg Lys Tyr Leu Leu Ala Cys
485 490 495
Thr Gly Tyr Tyr Gly Glu Tyr Asn Ala Gln Met Ser Ser Thr Leu Phe
500 505 510
Ser Tyr Ala Gln Gln His Pro Gly Phe Phe Ala Arg Ser Thr Arg Leu
515 520 525
Tyr Ala Arg Asn Gly Ala Phe Phe Ser Ser Gln Ile Gly Lys Met Phe
530 535 540
Val Asp Gln Asn Ser Asn Phe Phe Phe Ser Gln Gln Val Gln Gln Tyr
545 550 555 560
Arg Ser Gln Phe Leu Ser Val Gln Ala Trp Asn Ser Phe Gly Leu Ala
565 570 575
Asn Leu Phe Gln Cys Arg Tyr Tyr Gln Arg Lys Ile Cys Ser Phe Phe
580 585 590
Gly Phe Ser Ser Tyr Asn Tyr His Gln Val Ser Asn Ala Phe Ile Ser
595 600 605
Leu Phe Asn Thr Asn Phe Ser Gly Gly Leu Leu Ala Leu Arg His Leu
610 615 620
Ile Tyr Arg Lys Tyr Ile Gly Ser Ser Phe Asn Val Gln Ala Tyr Arg
625 630 635 640
Ser Leu Arg Ser Tyr Ser Tyr Ala Ser Ser Leu Ala Tyr Ser Cys Pro
645 650 655
Phe Tyr Ser Gln Trp Ser Ser Tyr Cys Ser Ser Phe Ser Gln Arg Ser
660 665 670
Gln Phe Ser Arg Ser Ala Ala Ser Ser Arg Ser Ala Tyr Met Gln Gln
675 680 685
Gln Gln Ser Ala Ser Ser Ser Ser Thr Ser Ser Tyr Gln Ala Gly Ala
690 695 700
Gln Ser Ala Ala Ala Gly Tyr Ala Ala Gln Ser Gly Tyr Ala Gly Gly
705 710 715 720
Ala Ser Gly Phe Gly Gly Tyr Tyr
725
<210> 3
<211> 500
<212> RNA
<213>Brown paddy plant hopper NlMLP genes
<400> 3
agccgaugua uuuccuguag aucaaauguc ucaaagcaag aagaccucca gagaaguugg 60
uauugaagag ugagauaaac gcauuggaca cuugauggua guuguaggaa gagaauccga 120
agaagcugca gauuuuacgu ugguaguaac gacauuggaa gagauuggcc aguccaaaug 180
aauuccaagc uuggacgcuc aagaauugcg aacgguacug uuggaccugc ugugagaaga 240
aaaaguugga auucuggucc acgaacauuu uuccaauuug ugaugagaag aaagcaccgu 300
uucuagcgua aagccuggua cuccuggcga agaauccugg augcugcugg gcguaagaga 360
agagggugcu gcucaucuga gcguuguauu cgccguaaua uccagugcau gccaacaagu 420
auuuacggua guaggcaucu uggaagcagg uuccgaaguu gcuugaauag ucguagcccu 480
ggcugaagac acugcuguag 500
<210> 4
<211> 23
<212> DNA
<213>Artificial sequence
<400> 4
atgaggtgtt tctcagttat cgc 23
<210> 5
<211> 22
<212> DNA
<213>Artificial sequence
<400> 5
tcagtagtat ccaccaaaac ca 22
<210> 6
<211> 45
<212> DNA
<213>Artificial sequence
<400> 6
taatacgact cactataggg agaagccgat gtatttcctg tagat 45
<210> 7
<211> 45
<212> DNA
<213>Artificial sequence
<400> 7
taatacgact cactataggg agactacagc agtgtcttca gccag 45
<210> 8
<211> 26
<212> DNA
<213>Artificial sequence
<400> 8
taatacgact cactataggg cggact 26
<210> 9
<211> 26
<212> DNA
<213>Artificial sequence
<400> 9
taatacgact cactataggg cgatgc 26
<210> 10
<211> 21
<212> DNA
<213>Artificial sequence
<400> 10
gtcaggaact ttgccagacg c 21
<210> 11
<211> 20
<212> DNA
<213>Artificial sequence
<400> 11
cgggaagcag cactccacat 20
<210> 12
<211> 22
<212> DNA
<213>Artificial sequence
<400> 12
gacaggatgc agaaggaaat ca 22
<210> 13
<211> 22
<212> DNA
<213>Artificial sequence
<400> 13
gactcgtcgt actcctgctt tg 22
<210> 14
<211> 18
<212> DNA
<213>Artificial sequence
<400> 14
agggctacga ctattcaa 18
<210> 15
<211> 16
<212> DNA
<213>Artificial sequence
<400> 15
agggtgctgc tcatct 16
<210> 16
<211> 20
<212> DNA
<213>Artificial sequence
<400> 16
gatcactgcc ttggctccta 20
<210> 17
<211> 20
<212> DNA
<213>Artificial sequence
<400> 17
gtactcagcc ttggcaatcc 20
Claims (7)
1. a kind of brown paddy plant hopper NlMLP genes, it is characterised in that nucleotide sequence is as shown in SEQ ID NO.1.
2. a kind of albumen of brown paddy plant hopper NlMLP gene codes as claimed in claim 1, it is characterised in that amino acid sequence is such as
Shown in SEQ ID NO.2.
3. a kind of dsRNA of brown paddy plant hopper NlMLP genes as claimed in claim 1, it is characterised in that by SEQ ID NO.1 institutes
Show any one section in the sequence nucleotides that can reach the nucleotides and its reverse complementary sequence that suppress NlMLP gene expression effects
Composition.
4. the dsRNA of brown paddy plant hopper NlMLP genes according to claim 3, it is characterised in that nucleotide sequence such as SEQ ID
Shown in NO.3.
5. product is being prepared containing the RNA molecule described in the DNA molecular described in claim 1 or claim 3,4 any one
In application, the purposes of the product is as follows（1）-（3）Shown in any one：
1）Preventing and treating brown paddy plant hopper prepares the product for preventing and treating brown paddy plant hopper；
2）Reduce brown paddy plant hopper survival rate or prepare the product for reducing brown paddy plant hopper survival rate；
3）Suppress brown paddy plant hopper gene NlMLP gene expressions or prepare the product for suppressing brown paddy plant hopper NlMLP gene expressions.
6. application of the RNA interference of a kind of brown paddy plant hopper NlMLP genes as claimed in claim 1 in terms of brown paddy plant hopper is controlled.
7. application according to claim 6, it is characterised in that the protein sequence based on the nucleic acid and its coding is used for agricultural chemicals
Research and development and biological control brown paddy plant hopper.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710061215.8A CN106754948B (en) | 2017-01-25 | 2017-01-25 | Nilaparvata lugens NlMLP gene, encoding protein and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710061215.8A CN106754948B (en) | 2017-01-25 | 2017-01-25 | Nilaparvata lugens NlMLP gene, encoding protein and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106754948A true CN106754948A (en) | 2017-05-31 |
| CN106754948B CN106754948B (en) | 2020-03-10 |
Family
ID=58941994
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710061215.8A Active CN106754948B (en) | 2017-01-25 | 2017-01-25 | Nilaparvata lugens NlMLP gene, encoding protein and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106754948B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107988244A (en) * | 2017-11-12 | 2018-05-04 | 中国计量大学 | Brown paddy plant hopper existence relevant ATPSb genes, encoding proteins and its application |
| CN108504748A (en) * | 2018-04-13 | 2018-09-07 | 湖北省农业科学院粮食作物研究所 | The method that screening MicroRNAs acts on rice resistance adaptability in brown paddy plant hopper |
| CN109468336A (en) * | 2018-12-07 | 2019-03-15 | 中国水稻研究所 | Brown paddy plant hopper protein phosphatase gene NlPP1, albumen and its dsRNA and application |
| CN109666675A (en) * | 2018-11-21 | 2019-04-23 | 中国计量大学 | Brown paddy plant hopper NlAtg3 gene, coding albumen and its application |
| CN113337503A (en) * | 2021-04-09 | 2021-09-03 | 广东省农业科学院植物保护研究所 | Application of brown planthopper NLSP7 as target spot in prevention and treatment of brown planthopper |
| CN113846073A (en) * | 2021-09-03 | 2021-12-28 | 广东省农业科学院植物保护研究所 | Nilaparvata lugens NlLIPH gene and application thereof |
-
2017
- 2017-01-25 CN CN201710061215.8A patent/CN106754948B/en active Active
Non-Patent Citations (4)
| Title |
|---|
| HAI-JIAN HUANG ET AL.: "Screening and Functional Analyses of Nilaparvata lugens Salivary Proteome", 《JOURNAL OF PROTEOME RESEARCH》 * |
| HASEGAWA T ET AL.: "salivary sheath protein [Nilaparvata lugens]，GenBank: BAP87097.1", 《GENBANK》 * |
| SHANGGUAN,X ET AL.: "Nilaparvata lugens mucin-like protein (MLP) mRNA, complete cds，GenBank: KY348750.1", 《GENBANK》 * |
| XINXIN SHANGGUAN ET AL.: "A Mucin-Like Protein of Planthopper Is Required for Feeding and Induces Immunity Response in Plants", 《PLANT PHYSIOLOGY》 * |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107988244A (en) * | 2017-11-12 | 2018-05-04 | 中国计量大学 | Brown paddy plant hopper existence relevant ATPSb genes, encoding proteins and its application |
| CN107988244B (en) * | 2017-11-12 | 2020-09-15 | 中国计量大学 | ATPSb gene related to survival of brown planthopper, encoded protein and application thereof |
| CN108504748A (en) * | 2018-04-13 | 2018-09-07 | 湖北省农业科学院粮食作物研究所 | The method that screening MicroRNAs acts on rice resistance adaptability in brown paddy plant hopper |
| CN109666675A (en) * | 2018-11-21 | 2019-04-23 | 中国计量大学 | Brown paddy plant hopper NlAtg3 gene, coding albumen and its application |
| CN109666675B (en) * | 2018-11-21 | 2022-12-02 | 中国计量大学 | Nilaparvata lugens NlAtg3 gene, encoding protein and application thereof |
| CN109468336A (en) * | 2018-12-07 | 2019-03-15 | 中国水稻研究所 | Brown paddy plant hopper protein phosphatase gene NlPP1, albumen and its dsRNA and application |
| CN109468336B (en) * | 2018-12-07 | 2021-06-04 | 中国水稻研究所 | Brown planthopper protein phosphate gene NlPP1, protein, dsRNA (double-stranded ribonucleic acid) thereof and application |
| CN113337503A (en) * | 2021-04-09 | 2021-09-03 | 广东省农业科学院植物保护研究所 | Application of brown planthopper NLSP7 as target spot in prevention and treatment of brown planthopper |
| CN113337503B (en) * | 2021-04-09 | 2022-11-22 | 广东省农业科学院植物保护研究所 | Application of brown planthopper NLSP7 as target spot in prevention and treatment of brown planthopper |
| CN113846073A (en) * | 2021-09-03 | 2021-12-28 | 广东省农业科学院植物保护研究所 | Nilaparvata lugens NlLIPH gene and application thereof |
| CN113846073B (en) * | 2021-09-03 | 2023-03-24 | 广东省农业科学院植物保护研究所 | Nilaparvata lugens NlLIPH gene and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106754948B (en) | 2020-03-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106754948A (en) | Brown paddy plant hopper NlMLP genes, encoding proteins and its application | |
| CN103201385A (en) | Down-regulating gene expression in insect pests | |
| CN103687951A (en) | Plants resistant to insect pests | |
| CN103183732B (en) | Cotton Gh FPP1 protein as well as coding gene and application thereof | |
| CN116375839B (en) | Toxic effect protein and application thereof in wheat disease-resistant breeding | |
| CN110117320A (en) | Cotton GhCAL-D07 gene is promoting the application in flowering of plant | |
| CN108610427A (en) | Migratory locusts diapause hormone gene and its application in regulating and controlling Insect Diapause | |
| Liu et al. | Analyses of MiRNA functions in maize using a newly developed ZMBJ-CMV-2bN81-STTM vector | |
| CN110078804A (en) | A kind of protein and its gene improving plant and the resistance to Low nitrogen stress ability of microorganism | |
| CN110819635B (en) | Application of HAN homologous gene of leguminous plant in regulating and controlling number of root nodules of leguminous plant | |
| CN113248586B (en) | Application of brown planthopper PIB14 protein and coding gene thereof in regulation and control of plant brown planthopper resistance | |
| CN109837291A (en) | A kind of method and its special DNA fragment improving plant resistance to insect using RNA perturbation technique | |
| CN109879947A (en) | 2 gene of moso bamboo transcription factor PheDof and application | |
| CN109610009A (en) | A kind of tobacco disease resistance poison controlling gene screening technique and application | |
| CN116286724B (en) | Lectin receptor protein TaLecRLK2 and encoding gene and application thereof | |
| CN114349835B (en) | GhREM protein and application of encoding gene thereof in regulating and controlling cotton aphid resistance | |
| CN111704659A (en) | Root-knot nematode RALF protein, coding gene and application thereof | |
| CN108864264B (en) | Corn OXS2a gene, and encoding protein and application thereof | |
| US8575427B2 (en) | Chorismate mutase gene from the potato cyst nematode Globodera rostochiensis | |
| CN109234290B (en) | Brassica napus BnKAT2 gene and promoter and application thereof | |
| CN108949769B (en) | Cotton bollworm ecdysone regulatory factor E78-C gene cDNA and application thereof | |
| CN104120134B (en) | The application in cultivating resistance of reverse transgenic plant of the GsHSFB2b albumen | |
| CN102586259A (en) | Chilo venosatus walker ecdysis regulation transcription factor cDNA and cloning method and recombinant application thereof | |
| CN104450739B (en) | A kind of paddy rice source anti insect related gene OsHR1 and coded product thereof and application | |
| CN113912698B (en) | Pc-CD protein of Caesalpinia aphelenchoides, coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |