CN108949769B - Cotton bollworm ecdysone regulatory factor E78-C gene cDNA and application thereof - Google Patents

Abstract

A cotton bollworm ecdysone regulatory factor E78-C gene cDNA is cloned from cotton bollworm to obtain ecdysone inducing factor E78-C gene, a primer is designed for the cotton bollworm ecdysone inducing factor E78-C gene, the 658-th 1122 bit in SEQ ID NO.1 is selected as an E78-C target gene segment to synthesize dsRNA, the synthesized dsRNA is transmitted to a cotton bollworm body cavity in a microinjection mode, Green Fluorescent Protein (GFP) is used as a control group, and statistics is carried out on cotton bollworm egg laying amount after dsRNA injection, which shows that the cotton bollworm E78-C gene is used as an interference target gene to carry out injection interference on the cotton bollworm, and the transcriptional expression of the silent gene is carried out, so that the cotton bollworm ovary development is inhibited, the egg laying amount is reduced, and the population number is controlled; and the risk of generating resistance of pests is low, thereby providing a theoretical basis for creating novel biological pesticides and plant pest-resistant genetic engineering.

Description

Cotton bollworm ecdysone regulatory factor E78-C gene cDNA and application thereof

Technical Field

The invention relates to the field of insect growth and reproduction regulation and biotechnology, in particular to a cotton bollworm ecdysone regulatory factor E78-C gene cDNA and application thereof.

Background

BollwormHelicoverpa armigera(Hubner) is a worldwide distributed and omnivorous important agricultural pest, seriously harms various crops such as cotton, corn, wheat, tomatoes and the like, and causes huge economic loss. Transgenic Bt (Bacillus thuringiensist) The widespread use of cotton effectively controls the damage of bollworms, but the problem of resistance of bollworms to transgenic Bt cotton is also increasing dramatically, while the damage of bollworms to other non-transgenic crops is also increasing year by yearA play. Thus, with the continued development of society, there is an urgent need for new pest control methods in combination with or in place of Bt crops to achieve sustainable development of modern agriculture.

RNA interference (RNAi), an important gene silencing means discovered in recent years, specifically degrades mRNA of a corresponding sequence with high efficiency by using Double-stranded RNA (dsRNA), and has been widely used in the fields of gene function exploration and gene therapy because the expression of a specific gene can be specifically inhibited by using the RNAi technology. At present, the technology becomes a new pest control means in the field of plant protection, and the technology utilizes the insect self gene fragment to inhibit the expression of key genes in the growth and development or biochemical metabolism of an insect body through RNAi so as to control the pest damage. In 2007, there is a literature disclosing the use of transgenic technology to express dsRNA of target pest lethal gene for controlling pests (Baum et al, 2007. Control of microbial insect pest damage RNA interference. Nat. Biotechnol. 25, 1322. 1326; Mao et al, 2007. Silencing a cotton bollworm P450 mongoygene by Plant-mediated RNAi expression of microbial genes larval of gossypol. Nat Biotechnol. 25(11): 1307. 1313.) and 2017. in 2017, there is a scientific finding that combining a juvenile hormone binding protein jraveniingbinding protein (JHBP) with Bt toxin can better Control Helicoverpa armigera (Ni et al, 2017. Next genetic coding: Biotechnol. J. Biotechnol. 1219. J. Biotechnol. 15). The RNAi technology has wide development prospect in the field of agricultural plant protection and control by virtue of the advantages of insect resistance specificity, no killing effect on non-target organisms and no toxicity or harm to the environment. The key problem of realizing effective control of pests based on RNAi is to screen target genes with pest specificity and obvious inhibition effect on the growth and development of the pests.

The insect hormone is a key field of pesticide research and development, is different from the traditional pesticide acting on a nervous system, has low action toxicity, less pollution and small influence on natural enemies and beneficial organisms, is beneficial to sustainable agricultural development, is beneficial to pollution-free green food production and is beneficial to human health.

Juvenile hormone and ecdysone of insects are important hormones in the bodies of insects, and play an important role in regulation and control of various behaviors of insects such as metamorphosis, development, reproduction, diapause, clustering and mating. E78 is an ecdysone-inducing gene, which is an ecdysone-inducing transcription early gene and has important effects on insect reproduction and embryonic development (Russell et al, 1996. The Drosophila Eip78C gene is not video but has a roll in regulating chromosome genes, Genetics,144, 159. 170.). In the aspect of agricultural pest control, scientists find and construct dsRNA cotton capable of expressing hormone-related target genes, and the cotton bollworm can obviously inhibit the growth and reproductive capacity of the cotton bollworm after eating by comparing transgenic cotton with non-transgenic cotton (Xiong et al, 2013. Silencing the HaHR3 gene by transgenic plant-mediated RNAi to discard)Helicoverpa armigeraExpression. Int J Biol Sci, 9(4): 370-. The research shows that the feasibility of preventing and controlling agricultural pests by the RNAi technology shows good prospect. Because juvenile hormone and ecdysone of insects are specific to insects, the target of the insects is safe aiming at the action path of hormone, and the novel pesticide is developed based on the path and has great potential when being applied to the prevention and the treatment of the insects.

Disclosure of Invention

The technical problem to be solved by the invention is to provide a cotton bollworm ecdysone regulatory factor E78-C gene cDNA and application thereof, so as to solve the defects in the background technology.

The technical problem solved by the invention is realized by adopting the following technical scheme:

the cotton bollworm ecdysone regulatory factor E78-C gene cDNA comprises a nucleotide sequence shown as SEQ ID NO.1, an amino acid sequence shown as SEQ ID NO.2 and a target gene sequence shown as SEQ ID NO.3, and the specific sequences are as follows:

SEQ ID NO.1

atggacgtgt ggagcggtcg acccgcgtcc tgcgttcgcg caccgtcgcc cctcgccata 60

gagcccggcg acaattttgc gctcacgttc ttcgacagca aagagcaagc gccgccgacg 120

ctgccgaaac aagatcctct acaatacact gtagaaagta gtaactcaac cacagttaac 180

aagactgcaa gcccttgcaa ggtgtgcggt gataaagcct ctggctatca ctacggcgtc 240

acgtcatgcg agggatgcaa ggggttcttt cgccgcagca tccagaagca gattgaatac 300

cgttgcctcc gtgacggcaa gtgtcttgtt atcagactga acagaaatcg ttgccagttc 360

tgcagattca aaaagtgtct agcagttggc atgagccgtg actccgtgag atacggccga 420

gtccccaagc gtccccgaga agccgtcgtc gccgaagtga agttagagcc ggccgctgcc 480

tacgccgcta acgtcgaggt gatcccgccg cccgaagcca tggagacgga gcccgcgcgc 540

ccggagatgt ccagcgagga gctggtgaag ctgatcacga cagcgcaccg caagaccaac 600

acctacacgg aggagctgca tgtgccactg ccgcgcgacg tctacatgcg aatccatgac 660

gactctgaag gcagtggcgg cgaggacgtg gcgtcgtcga gcactgacgc cgtgaccgac 720

atgcggtcta tgctgtggca cagattcgcg cagcaaatga ctcccgccat ccctctagtg 780

gtcgagttcg ccaagcgact gcccggcttc ttcagcctcc cgcaagatga ccatcttatc 840

ctcattaagc aagggttctt cgaagtctgg ctgactcgtg tgaccgacca ctctactcag 900

gagtgcatca tgttcgagaa tggcactaca tttacctatc aggagctgat ggtgatgtat 960

gatcaaccat ttgcgacggc actgatgacg tacatttgga aaattctgag gatgcagatc 1020

accgaggaag agatggcctt gtacaccagc accctgctga tgtgcccgca ccgcgtcggc 1080

ctcagcaccc ccgaccgcat cagtggtctg cagcaaacct tgaacgacgc actcataaat 1140

aacatgataa ccagcggagg tggtcctgag gcgacagcca ttgcccgcgc gcgctacgaa 1200

gccttcgctg cggccaggaa cgaagtccgc ctcataggcg cccgacatca cgttcttctc 1260

tcgtatcctc gagaacgctg gccacgcctg ttgctgcctg atctgttcat agagatattt 1320

gatattccga ggtacgaaga tcagactgaa gcagttgcgg cggcgtcgac ttcggcggtg 1380

actacgtcga cggcggtggt tgtggcgccg gtcgctcagt cctcccaatc ccctcactcc 1440

tctcaaactc ctcaggtccc gcagcggggc tag

SEQ ID NO.2

mdvwsgrpas cvrapsplai epgdnfaltf fdskeqappt lpkqdplqyt vessnsttvn 60

ktaspckvcg dkasgyhygv tscegckgff rrsiqkqiey rclrdgkclv irlnrnrcqf 120

crfkkclavg msrdsvrygr vpkrpreavv aevklepaaa yaanvevipp peametepar180

pemsseelvk littahrktn tyteelhvpl prdvymrihd dsegsggedv assstdavtd 240

mrsmlwhrfa qqmtpaiplv vefakrlpgf fslpqddhli likqgffevw ltrvtdhstq 300

ecimfengtt ftyqelmvmy dqpfatalmt yiwkilrmqi teeemalyts tllmcphrvg 360

lstpdrisgl qqtlndalin nmitsgggpe ataiararye afaaarnevr ligarhhvll 420

syprerwprl llpdlfieif dipryedqte avaaastsav ttstavvvap vaqssqsphs 480

sqtpqvpqrg *

SEQ ID NO.3

taatacgactcactataggggacgactctgaaggcagtggcggcgaggacgtggcgtcgtcgagcactgacgccgtgaccgacatgcggtctatgctgtggcacagattcgcgcagcaaatgactcccgccatccctctagtggtcgagttcgccaagcgactgcccggcttcttcagcctcccgcaagatgaccatcttatcctcattaagcaagggttcttcgaagtctggctgactcgtgtgaccgaccactctactcaggagtgcatcatgttcgagaatggcactacatttacctatcaggagctgatggtgatgtatgatcaaccatttgcgacggcactgatgacgtacatttggaaaattctgaggatgcagatcaccgaggaagagatggccttgtacaccagcaccctgctgatgtgcccgcaccgcgtcggcctcagcacccccgaccgcatcagtggtctgcagcaaaccttgaacgacgcaccctatagtgagtcgtatta 。

the cDNA cloning method of cotton bollworm ecdysone regulatory factor E78-C gene includes the following steps:

(1) extracting female cotton bollworm RNA, reverse transcribing to synthesize cDNA, and comparing and analyzing the cDNA to determine the cDNA sequence of E78-C gene;

(2) designing a specific primer of the E78-C gene according to the cDNA sequence of the cotton bollworm E78-C gene obtained in the step (1), wherein the specific forward primer sequence is shown as SEQ ID NO.4, and the specific reverse primer sequence is shown as SEQ ID NO. 5:

SEQ ID NO.4：TAATACGACTCACTATAGGG GACGACTCTGAAGGCAGTG

SEQ ID NO.5：TAATACGACTCACTATAGGG TGCGTCGTTCAAGGTTTG

(3) carrying out PCR amplification by using the cDNA of the cotton bollworm E78-C gene obtained in the step (1) as a template and the specific primer in the step (2) to obtain a PCR product;

(4) purifying the PCR product obtained in the step (3), recovering a target fragment, connecting the purified PCR product to a PGM-T blunt carrier to obtain a recombinant carrier, finally transforming the recombinant carrier into a competent cell, and screening positive clones containing the target fragment;

(5) and (4) carrying out sequence determination on the positive clone containing the target fragment screened in the step (4) to obtain the cDNA of the cotton bollworm E78-C gene.

The invention also provides application of the cotton bollworm E78-C gene in the aspect of RNAi mediated pest control, wherein RNAi mediation is to synthesize dsRNA by a target gene fragment with a nucleotide sequence shown as SEQ ID NO. 3.

The RNAi mediates delivery of dsRNA synthesized in vitro by microinjection.

The injection volume of the dsRNA is 2 mu l, the injection concentration is 5 mu g/mu l, and the injection position is the outermost side of an internode membrane between the 7 th section and the 8 th section of the abdomen of the cotton bollworm.

The cotton bollworm is a female cotton bollworm with the age of 1 day.

The invention clones and obtains ecdysone induction factor E78-C gene from cotton bollworm for the first time, designs primer for ecdysone induction factor E78-C gene of cotton bollworm, selects 658-1122 bit in SEQ ID NO.1 as E78-C target gene segment to synthesize dsRNA, then transfers the synthesized dsRNA to body cavity of cotton bollworm by microinjection method, takes Green Fluorescent Protein (GFP) as contrast group, counts egg laying amount of cotton bollworm after dsRNA injection, results show that: the E78-C gene can regulate the development and egg laying amount of cotton bollworm ovary.

Has the advantages that: the invention takes the cotton bollworm E78-C gene as an interference target gene for the first time, carries out injection interference on the cotton bollworm, silences the transcription expression of the gene, thereby inhibiting the development of the ovary of the cotton bollworm, reducing the egg laying amount and further controlling the population quantity of the cotton bollworm; the research foundation is good, the prospect is high, the risk of generating resistance of pests is low, and the theoretical foundation is provided for creating novel biological insecticides and plant pest-resistant genetic engineering.

Drawings

FIG. 1 is a diagram showing the distribution of the functional domains of the Helicoverpa armigera E78-C gene in the preferred embodiment of the present invention.

FIG. 2 is a schematic diagram showing the interference efficiency of Heliothis armigera injected dsRNA on its target gene in the best embodiment of the present invention.

FIG. 3 is a schematic diagram of the development of the ovary of Heliothis armigera injected with dsRNA of E78-C gene in the best embodiment of the present invention.

FIG. 4 is a diagram showing the egg laying amount of Helicoverpa armigera injected with dsRNA derived from E78-C gene in the preferred embodiment of the present invention.

FIG. 1 shows the following notations: the hexagons represent conserved domain C2H2 zinc fingers, and the pentagons represent DNA binding domains.

Detailed Description

In order to make the technical means, the creation characteristics, the achievement purposes and the effects of the invention easy to understand, the invention is further explained below by combining the specific drawings.

In the following examples, insect sources were tested: collecting cotton bollworm eggs in a Hebei corridor, continuously feeding the cotton bollworm eggs in a laboratory for multiple generations by using artificial feed, and incubating the cotton bollworm eggs in an artificial climate box at the temperature of 26 ℃ and the relative humidity of 70%;

feeding conditions are as follows: feeding the cotton bollworm artificial feed at the temperature of 25 ℃, the relative humidity of 40-50% and the illumination of 14:10(L: D);

the experimental methods used are conventional methods unless otherwise specified; materials, reagents and the like used in examples are commercially available unless otherwise specified; the apparatus used in the experimental implementation was a conventional apparatus used in molecular biology laboratories.

Example 1 obtaining cDNA sequence of Cotton bollworm E78-C Gene

1. Extraction of Total RNA from Cotton bollworm

TRIzol utilization of insect Total RNA^®The RNA separation and extraction reagent (TIANGEN company) is carried out under the condition of no RNase, and the specific extraction steps are as follows:

(1) cleaning a glass homogenizer, air-drying, tightly wrapping with tinfoil, sterilizing in a high-temperature dry-heat sterilization pot, taking out, and cooling to room temperature for later use;

(2) taking 50-100 mg of fresh cotton bollworm tissues, adding the fresh cotton bollworm tissues into a glass homogenizer precooled by liquid nitrogen, and quickly adding 1 ml of Trizol into the glass homogenizer^®Fully grinding the reagent;

(3) transferring the ground homogenate into a 1.5 ml centrifuge tube without the RNase by using a gun head without the RNase for centrifugal treatment, and standing for 3-5 min in ice bath at the temperature of 4 ℃; the rotating speed of a centrifugal tube is 12000 rpm, and the centrifugation time is 15 min;

(4) transferring the supernatant centrifuged in the step (3) to a new RNase-free 1.5 ml centrifuge tube, adding 0.2 ml chloroform, vortexing for 15 s, centrifuging, and standing at room temperature for 5min at 4 ℃; the rotating speed of a centrifugal tube is 12000 rpm, and the centrifugation time is 10 min;

(5) sucking 400 mu l of the supernatant centrifuged in the step (4), transferring the supernatant into a new RNA enzyme-free 1.5 ml centrifuge tube, adding 200 mu l of chloroform, carrying out vortex oscillation for 30 s, centrifuging, standing at room temperature for 5min, and keeping the temperature at 4 ℃; the rotating speed of a centrifugal tube is 12000 rpm, and the centrifugation time is 10 min;

(6) sucking the supernatant centrifuged in the step (5) by using a 200-microliter RNA-free enzyme gun head, transferring the supernatant into a new RNA-free 1.5 ml centrifuge tube, adding isopropanol with the same volume, slowly adding absolute ethanol with the volume 0.5 times that of the supernatant, uniformly mixing, transferring the obtained solution and the precipitate into an adsorption column RNA spin column, and standing for 10 min;

(7) placing the adsorption column filled with the solution and the precipitate in the step (6) into a collecting pipe for centrifugal treatment at 4 ℃, wherein the centrifugal rotation speed of the collecting pipe is 12000 rpm, and after 3 min of centrifugation, discarding waste liquid in the collecting pipe, and placing the adsorption column back into the collecting pipe;

(8) adding 500 μ l deproteinized solution RW1 into adsorption column, centrifuging at 4 deg.C at 12000 rpm for 2 min, and discarding waste liquid;

(9) adding 80 μ l DNase I working solution into the center of the adsorption column, and standing at room temperature for 15 min;

(10) adding 500 μ l deproteinized solution RW1 into the adsorption column again, centrifuging at 4 deg.C, 12000 rpm for 30-60 s, discarding the waste liquid, and placing the adsorption column back into the collection tube;

(11) adding 500 μ l RNA rinsing solution RW into adsorption column, standing at room temperature for 2 min at 4 deg.C, placing adsorption column containing RNA rinsing solution RW into collection tube, centrifuging at 12000 rpm for 1 min, and discarding waste liquid;

(12) adding 500 μ l RNA rinsing solution RW into the adsorption column, standing at room temperature for 2 min at 4 deg.C, placing the adsorption column containing RNA rinsing solution RW into a collection tube, centrifuging at 12000 rpm for 1 min, and discarding the waste liquid; placing the adsorption column into a collecting pipe for centrifugal treatment at 4 ℃, wherein the centrifugal rotation speed is 12000 rpm, and allowing the adsorption column to be separated for 2 min to remove excessive ethanol; then placing the collecting pipe on a super-clean workbench for 10-20min to thoroughly dry the residual rinsing liquid in the adsorption column;

(13) transferring the adsorption column completely dried in the step (12) into a new RNase-Free centrifuge tube, and then suspending and dropwise adding 30-50 mu l of RN into the middle part of the adsorption columnase-Free ddH₂O (determined according to the amount of RNA), standing at room temperature for 2 min, and centrifuging at 12000 rpm for 2 min to obtain RNA solution;

(14) diluting 1 μ l of the RNA solution obtained in step (13) to 10 μ l, wherein 5 μ l of the RNA extract integrity obtained in step (13) is detected by agarose gel electrophoresis, 5 μ l of the RNA extract quality obtained in step (13) is detected by a NanoDrop instrument, and the rest of the RNA is used for cDNA synthesis;

2. synthesis of first Strand cDNA

Synthesizing cotton bollworm cDNA according to the instruction of a first strand synthesis kit for removing genome cDNA by a TIANGEN Fast kit one-step method, storing the synthesized cotton bollworm cDNA in a refrigerator at the temperature of-20 ℃ or-70 ℃, and diluting by a plurality of times as required before use;

3. cloning of target genes

(a) According to the result of the laboratory cotton bollworm transcriptome database, performing preliminary analysis on the transcriptome data by using a bioinformatics method to screen the cotton bollworm E78-C gene, and then obtaining the cDNA sequence of the cotton bollworm E78-C gene by sequence alignment analysis, wherein the cDNA sequence is shown as SEQ ID NO. 1;

(b) translating the nucleotide sequence by using online protein translation software ExPASY-Translate tool according to the cDNA sequence of the cotton bollworm E78-C gene, wherein the amino acid sequence is shown as SEQ ID NO. 2;

(c) according to the cDNA sequence of the cotton bollworm E78-C gene, a specific primer with a T7 promoter is designed by using Premier 5.0 software, and the designed specific primer sequence is as follows:

forward primer SEQ id No. 4: TAATACGACTCACTATAGGG GACGACTCTGAAGGCAGTG

Reverse primer SEQ ID No. 5: TAATACGACTCACTATAGGG TGCGTCGTTCAAGGTTTG

(d) The cDNA of the cotton bollworm E78-C gene is taken as a template, and PCR amplification is carried out by adopting high-fidelity DNA polymerase, wherein the PCR reaction system is as follows (the total volume is 25 mu l): 1 mu l of cDNA template with the concentration of 400 ng/mu l, 0.5 mu l of upstream primer and downstream primer with the concentration of 10 mu M, 0.5 mu l of dNTP (10 mu M), 5 Xbuffer 5 mu l, 0.5 mu l of DNA polymerase and 17 mu l of enucleated enzyme water;

the PCR reaction conditions were as follows: pre-denaturation at 98 deg.C for 5 min; denaturation at 98 ℃ for 10 s, annealing at 58 ℃ for 30 s, and extension at 72 ℃ for 30 s for 35 cycles; extending for 5min at the temperature of 72 ℃, and storing at the temperature of 4 ℃ to obtain a PCR product;

(e) detecting the PCR product obtained in the step (e) by adopting 1% agarose gel electrophoresis, cutting off the gel block at the position of the amplified target zone by using a blade, putting the gel block into a sterile centrifugal tube, and recovering and purifying by using a gel recovery kit (Axygen), wherein the specific recovery and purification process refers to the kit specification;

(f) connecting the PCR product purified in the step (e) to a PGM-T blunt carrier, obtaining a recombinant carrier at room temperature for 25 min, and then transforming the recombinant carrier into competent cells, wherein the specific operations are as follows:

keeping a plurality of centrifuge tubes, adding 50 μ l of Trans1-T1 competent cells (holo-type gold) into each 1.5 ml centrifuge tube, adding recombinant vector, placing on ice for 30 min, water bath at 42 deg.C for 90 s, and placing on ice again for 2 min; then respectively adding 600-800 mul of LB liquid culture solution into each 1.5 ml centrifuge tube, shaking the bacteria at 37 ℃, rotating at 200 rpm for 2h, sucking 100 mul of bacteria solution into 1 per thousand AMP LB solid culture medium after shaking the bacteria, and culturing overnight at 37 ℃; selecting a single colony in a 1.5 ml centrifuge tube, adding 300-;

the PCR of the bacterial liquid was carried out by using the universal M13 primer, and the PCR reaction system of the bacterial liquid (total volume 20. mu.l) was as follows: bacterial solution 1. mu.l, Taqmix 10. mu.l, front primer 1. mu.l, rear primer 1. mu.l, Taq enzyme 0.25. mu.l, ddH₂O8 mu l; sequencing the product of the PCR reaction of the bacterial liquid, wherein the sequencing result is shown as SEQ ID NO. 3;

adding the correct strain into a fresh LB culture medium containing ampicillin to shake bacteria again according to a sequencing result to obtain a fresh bacterial liquid, and carrying out plasmid extraction to obtain a plasmid with a target gene fragment;

example 2 preparation and Synthesis of Cotton bollworm E78-C Gene dsRNA template

I. Preparation of cotton bollworm E78-C gene dsRNA template

(i) Carrying out PCR amplification by taking a plasmid with a target gene fragment as a template, wherein the reaction system of the PCR is 50 mu l, the reaction conditions are consistent with those of the PCR amplification, 1 mu l of the amplified PCR product is taken, 4 mu l of nuclease-free water is added for dilution, and then the length of the PCR fragment is detected by using 1% agarose gel;

(ii) (ii) purifying the PCR product in the step (i) by using a DNA product purification kit, adding 1 mul of purified product into 4 mul of RNase-free water for dilution, and then measuring the unicity and concentration of the purified product by using 1% agarose gel and a trace ultraviolet spectrophotometer;

II. Synthetic dsRNA

Using T7 RiboMAX^TMThe Express RNAi System kit is used for in vitro transcription synthesis of recovered DNA and comprises the following specific steps:

(firstly), placing the reagent 2 XNTP buffer Mix on ice to be slowly melted, centrifuging the reagent to the bottom of a tube after melting, and placing T7 RNA polymerase at-20 ℃;

(② mixing the reagents according to the following proportion:

mixing, centrifuging instantly, and placing in metal bath at 37 deg.C for 4 hr;

(iii) removing DNA and ssRNA, adding the following reagents according to the proportion:

mixing, flicking the tube bottom, centrifuging instantly, placing into metal bath at 37 deg.C for 30 min, adding EDTA reagent 1 μ l, and placing in metal bath at 65 deg.C for 5min to stop reaction;

(iv) applying dsRNA (50. mu.l) to be purified to RN-freeH of enzyme A₂O is metered to 200 mul to obtain solution to be purified (the system can be expanded in equal proportion according to actual needs);

(fifth) adding a phenol-chloroform mixed solvent (phenol: chloroform: isoamylol = 25:24:1) with the same volume (200 mul) into the solution to be purified in the step (fourth), gently mixing the mixture, and centrifuging the mixture for 15 min at the temperature of 4 ℃ in a centrifuge (12000 rpm, 4 ℃);

taking the upper layer solution after the centrifugation in the step (fifth), adding equal volume of chloroform (200 mu l), gently mixing, and centrifuging at the temperature of 4 ℃ for 15 min at a centrifuge (12000 rpm, 4 ℃);

(seventhly) adding 1/10 volumes (20 mu l) of 3M sodium acetate (pH 5.2) and 2.5 volumes (500 mu l) of 100% ethanol to the upper water phase obtained after the centrifugation in the step (sixthly), storing at the temperature of minus 20 ℃ for storage, after gentle and uniform mixing, standing at the temperature of minus 20 ℃ for precipitation overnight to obtain a primary acidic solution;

(viii) centrifuging the primary acidic solution obtained in step (viii) at 4 ℃ for 30 min at 12000 rpm at 4 ℃;

(ninthly) after the centrifugation in the step (eight), depositing colloidal white transparent precipitate on the bottom or the side wall of a centrifuge tube, discarding the supernatant (which can be carefully sucked by a 200 mul RNAse-free gun head to prevent the precipitate from being sucked out together), adding 80% ethanol (stored at minus 20 ℃) into the colloidal white transparent precipitate, gently mixing the mixture, washing the precipitate, and standing the mixture at room temperature for 10 min to obtain a secondary acid solution;

(r) centrifuging the secondary acidic solution obtained in the step (ninthly) for 5min at 7500 rpm and 4 ℃ in a centrifuge at the temperature of 4 ℃ to obtain a centrifugate;

(⑪) slowly sucking out ethanol in the centrifugate in the step (r) (paying attention to not suck out the precipitate), slowly sucking out ethanol by using a 10-microliter pipette gun when residual liquid of the precipitate is approached, then opening the centrifuge tube and putting the centrifuge tube into a clean bench for drying for 10 min until the ethanol is completely volatilized;

(⑫) after the ethanol in step (⑪) is completely volatilized, 10. mu.l of RNase-free H is added into the centrifuge tube₂O flicking the bottom of the tube to dissolve the precipitate sufficiently uniformly in RNase-free H₂O, synthesizing dsRNA;

(⑬) 1. mu.l of the solubilized dsRNA product was diluted in 9. mu.l of DEPC H₂In O, taking one part, detecting the purity and quality of the synthesized dsRNA by using 1% agarose gel, taking one part, detecting the concentration of the dsRNA by using a NanoPhotometer micro spectrophotometer, and storing the rest in a refrigerator at the temperature of 80 ℃ below zero for later use;

meanwhile, a dsRNA solution of GFP (Green Fluorescent protein) is synthesized and purified as a negative control in the above way, and the sequences of upstream and downstream primers used in the PCR amplification of the GFP fragment are dsGFP-T7F (shown as SEQ ID NO. 6) and dsGFP-T7R (shown as SEQ ID NO. 7), respectively;

SEQ ID NO.6 TAATACGACTCACTATAGGAAGGGCGAGGAGCTGTTCACCG

SEQ ID NO.7 TAATACGACTCACTATAGGCAGCAGGACCATGTGATCGCGC

example 3 screening of dsRNA having E78-C Gene fragment for inhibition of Helicoverpa armigera ovarian development and oviposition

1. Microinjection of Helicoverpa armigera E78-C gene dsRNA

Selecting cotton bollworm female worms with uniform eclosion 1d and consistent health status, setting a dsRNA control group for injecting GFP and a dsRNA experimental group for injecting E78-C, and using CO for the cotton bollworm female worms before injection₂Anaesthetizing, then injecting dsRNA synthesized in vitro into the body cavity of the cotton bollworm along the abdominal internode membrane of the third last segment by using a micro-injector, wherein the injection amount of the dsRNA is 2 mu l, the injection concentration is 5 mu g/mu l, each group is injected with 90 heads, and 3 biological repetitions are set; after injection, female cotton bollworms are placed in circular plastic boxes with the diameter of 8cm and the height of 10 cm for breeding, absorbent cotton gauze covers each plastic box, 10% of honey water is adopted to soak absorbent cotton and place the absorbent cotton on the gauze to supply nutrition for the female cotton bollworms, the gauze is replaced every day, the number of eggs laid on the gauze and cotton balls is counted, and 3 female cotton bollworms are placed in each plastic box;

2. detection of Cotton bollworm E78-C gene silencing effect

Sampling every 24 h within 0-96h after dsRNA injection for gene silencing effect detection, and setting 3 biological repeats by taking 4 heads from a control group and an experimental group respectively; dissecting female bollworm abdomenTaking total RNA of adipose tissue and carrying out reverse transcription on the total RNA to form cDNA, and detecting the expression quantity change condition of a target gene by using a qRT-PCR technology so as toß-actinAs a reference gene, the cDNA differences of the sample are corrected, and the sequences of the primers are as follows:

ß-actin-F- CTGGGACGATATGGAGAA

ß-actin-R- CGAACATGATCTGTGTCA

E78-C-F- CGCCGAAGTGAAGTTAGAGC

E78-C-R-GGATTCGCATGTAGACGTCG

the detection results show that the maximum silencing effect of 89.9% (P = 0.002) occurs 72 h after the E78-C dsRNA is injected, and the silencing effect can be maintained for at least 24 h thereafter, as shown in fig. 2;

3. observation of development condition of female cotton bollworm ovaries after dsRNA injection

After dsRNA injection, 10 cotton bollworm females of the treatment group and the control group are randomly selected and dissected to obtain ovaries, and as shown in figure 3, the development of the ovaries of the E78-C dsRNA treatment group is obviously inhibited;

4. statistics of female cotton bollworm oviposition after dsRNA injection

As shown in FIG. 4, the statistics of egg laying amount show that the egg laying amount of the experimental group of the cotton bollworm injected with E78-C dsRNA is 558 heads, is remarkably lower than that of the 789 heads (P <0.05) of the control group injected with GFP dsRNA, and effectively inhibits the cotton bollworm from laying eggs.

Sequence listing

<110> university of agriculture in Jiangxi

<120> cotton bollworm ecdysone regulatory factor E78-C gene cDNA and application thereof

<160> 5

<210> 1

<211> 1473

<212> DNA

<213> Helicoverpa armigera E78-C Gene nucleotide sequence

<400> 1

atggacgtgt ggagcggtcg acccgcgtcc tgcgttcgcg caccgtcgcc cctcgccata 60

gagcccggcg acaattttgc gctcacgttc ttcgacagca aagagcaagc gccgccgacg 120

ctgccgaaac aagatcctct acaatacact gtagaaagta gtaactcaac cacagttaac 180

aagactgcaa gcccttgcaa ggtgtgcggt gataaagcct ctggctatca ctacggcgtc 240

acgtcatgcg agggatgcaa ggggttcttt cgccgcagca tccagaagca gattgaatac 300

cgttgcctcc gtgacggcaa gtgtcttgtt atcagactga acagaaatcg ttgccagttc 360

tgcagattca aaaagtgtct agcagttggc atgagccgtg actccgtgag atacggccga 420

gtccccaagc gtccccgaga agccgtcgtc gccgaagtga agttagagcc ggccgctgcc 480

tacgccgcta acgtcgaggt gatcccgccg cccgaagcca tggagacgga gcccgcgcgc 540

ccggagatgt ccagcgagga gctggtgaag ctgatcacga cagcgcaccg caagaccaac 600

acctacacgg aggagctgca tgtgccactg ccgcgcgacg tctacatgcg aatccatgac 660

gactctgaag gcagtggcgg cgaggacgtg gcgtcgtcga gcactgacgc cgtgaccgac 720

atgcggtcta tgctgtggca cagattcgcg cagcaaatga ctcccgccat ccctctagtg 780

gtcgagttcg ccaagcgact gcccggcttc ttcagcctcc cgcaagatga ccatcttatc 840

ctcattaagc aagggttctt cgaagtctgg ctgactcgtg tgaccgacca ctctactcag 900

gagtgcatca tgttcgagaa tggcactaca tttacctatc aggagctgat ggtgatgtat 960

gatcaaccat ttgcgacggc actgatgacg tacatttgga aaattctgag gatgcagatc 1020

accgaggaag agatggcctt gtacaccagc accctgctga tgtgcccgca ccgcgtcggc 1080

ctcagcaccc ccgaccgcat cagtggtctg cagcaaacct tgaacgacgc actcataaat 1140

aacatgataa ccagcggagg tggtcctgag gcgacagcca ttgcccgcgc gcgctacgaa 1200

gccttcgctg cggccaggaa cgaagtccgc ctcataggcg cccgacatca cgttcttctc 1260

tcgtatcctc gagaacgctg gccacgcctg ttgctgcctg atctgttcat agagatattt 1320

gatattccga ggtacgaaga tcagactgaa gcagttgcgg cggcgtcgac ttcggcggtg 1380

actacgtcga cggcggtggt tgtggcgccg gtcgctcagt cctcccaatc ccctcactcc 1440

tctcaaactc ctcaggtccc gcagcggggc tag

<210> 2

<211> 490

<212> Helicoverpa armigera E78-C Gene amino acid sequence

<400> 2

mdvwsgrpas cvrapsplai epgdnfaltf fdskeqappt lpkqdplqyt vessnsttvn 60

ktaspckvcg dkasgyhygv tscegckgff rrsiqkqiey rclrdgkclv irlnrnrcqf 120

crfkkclavg msrdsvrygr vpkrpreavv aevklepaaa yaanvevipp peametepar180

pemsseelvk littahrktn tyteelhvpl prdvymrihd dsegsggedv assstdavtd 240

mrsmlwhrfa qqmtpaiplv vefakrlpgf fslpqddhli likqgffevw ltrvtdhstq 300

ecimfengtt ftyqelmvmy dqpfatalmt yiwkilrmqi teeemalyts tllmcphrvg 360

lstpdrisgl qqtlndalin nmitsgggpe ataiararye afaaarnevr ligarhhvll 420

syprerwprl llpdlfieif dipryedqte avaaastsav ttstavvvap vaqssqsphs 480

sqtpqvpqrg *

<210>3

<211> 514

<212> E78C-dsRNA target gene sequence

<220>

<221> upstream T7 promoter

<222> (1)…(20)

<220>

<221> downstream T7 promoter

<222> (495)…(514)

<400> 3

taatacgactcactataggggacgactctgaaggcagtggcggcgaggacgtggcgtcgtcgagcactgacgccgt

gaccgacatgcggtctatgctgtggcacagattcgcgcagcaaatgactcccgccatccctctagtggtcgagttc

gccaagcgactgcccggcttcttcagcctcccgcaagatgaccatcttatcctcattaagcaagggttcttcgaag

tctggctgactcgtgtgaccgaccactctactcaggagtgcatcatgttcgagaatggcactacatttacctatca

ggagctgatggtgatgtatgatcaaccatttgcgacggcactgatgacgtacatttggaaaattctgaggatgcag

atcaccgaggaagagatggccttgtacaccagcaccctgctgatgtgcccgcaccgcgtcggcctcagcacccccg

accgcatcagtggtctgcagcaaaccttgaacgacgcaccctatagtgagtcgtatta

Claims (10)

1. The cotton bollworm ecdysone regulatory factor E78-C gene cDNA is characterized in that the nucleotide sequence is shown as SEQ ID NO.1, and the specific sequence is as follows:

SEQ ID NO.1

atggacgtgt ggagcggtcg acccgcgtcc tgcgttcgcg caccgtcgcc cctcgccata 60

gagcccggcg acaattttgc gctcacgttc ttcgacagca aagagcaagc gccgccgacg 120

ctgccgaaac aagatcctct acaatacact gtagaaagta gtaactcaac cacagttaac 180

aagactgcaa gcccttgcaa ggtgtgcggt gataaagcct ctggctatca ctacggcgtc 240

acgtcatgcg agggatgcaa ggggttcttt cgccgcagca tccagaagca gattgaatac 300

cgttgcctcc gtgacggcaa gtgtcttgtt atcagactga acagaaatcg ttgccagttc 360

tgcagattca aaaagtgtct agcagttggc atgagccgtg actccgtgag atacggccga 420

gtccccaagc gtccccgaga agccgtcgtc gccgaagtga agttagagcc ggccgctgcc 480

tacgccgcta acgtcgaggt gatcccgccg cccgaagcca tggagacgga gcccgcgcgc 540

ccggagatgt ccagcgagga gctggtgaag ctgatcacga cagcgcaccg caagaccaac 600

acctacacgg aggagctgca tgtgccactg ccgcgcgacg tctacatgcg aatccatgac 660

gactctgaag gcagtggcgg cgaggacgtg gcgtcgtcga gcactgacgc cgtgaccgac 720

atgcggtcta tgctgtggca cagattcgcg cagcaaatga ctcccgccat ccctctagtg 780

gtcgagttcg ccaagcgact gcccggcttc ttcagcctcc cgcaagatga ccatcttatc 840

ctcattaagc aagggttctt cgaagtctgg ctgactcgtg tgaccgacca ctctactcag 900

gagtgcatca tgttcgagaa tggcactaca tttacctatc aggagctgat ggtgatgtat 960

gatcaaccat ttgcgacggc actgatgacg tacatttgga aaattctgag gatgcagatc 1020

accgaggaag agatggcctt gtacaccagc accctgctga tgtgcccgca ccgcgtcggc 1080

ctcagcaccc ccgaccgcat cagtggtctg cagcaaacct tgaacgacgc actcataaat 1140

aacatgataa ccagcggagg tggtcctgag gcgacagcca ttgcccgcgc gcgctacgaa 1200

gccttcgctg cggccaggaa cgaagtccgc ctcataggcg cccgacatca cgttcttctc 1260

tcgtatcctc gagaacgctg gccacgcctg ttgctgcctg atctgttcat agagatattt 1320

gatattccga ggtacgaaga tcagactgaa gcagttgcgg cggcgtcgac ttcggcggtg 1380

actacgtcga cggcggtggt tgtggcgccg gtcgctcagt cctcccaatc ccctcactcc 1440

tctcaaactc ctcaggtccc gcagcggggc tag。

2. the cDNA cloning method of the cotton bollworm ecdysone regulatory factor E78-C gene according to claim 1, characterized in that the concrete steps are as follows:

(1) extracting female cotton bollworm RNA, reverse transcribing to synthesize cDNA, and comparing and analyzing the cDNA to determine the cDNA sequence of E78-C gene;

(2) designing a specific primer of the E78-C gene according to the cDNA sequence of the cotton bollworm E78-C gene obtained in the step (1), wherein the specific forward primer sequence is shown as SEQ ID NO.4, and the specific reverse primer sequence is shown as SEQ ID NO. 5:

SEQ ID NO.4：TAATACGACTCACTATAGGG GACGACTCTGAAGGCAGTG

SEQ ID NO.5：TAATACGACTCACTATAGGG TGCGTCGTTCAAGGTTTG；

(3) carrying out PCR amplification by using the cDNA of the cotton bollworm E78-C gene obtained in the step (1) as a template and the specific primer in the step (2) to obtain a PCR product;

(4) purifying the PCR product obtained in the step (3), recovering a target fragment, connecting the purified PCR product to a PGM-T blunt carrier to obtain a recombinant carrier, finally transforming the recombinant carrier into a competent cell, and screening positive clones containing the target fragment;

(5) and (5) carrying out sequence determination on the positive clone containing the target fragment in the step (4) to obtain a target gene sequence shown as SEQ ID NO. 3.

3. The use of the cotton bollworm ecdysone regulatory factor E78-C gene cDNA according to claim 1, which is characterized in that the cDNA is applied to:

1) reducing the egg laying amount of the cotton bollworms;

2) preparing the product for reducing the egg laying amount of the cotton bollworms.

4. The use of the cDNA of the ecdysone regulatory factor E78-C gene of Heliothis armigera according to claim 3, wherein RNAi is used to mediate the reduction of the egg laying amount of Heliothis armigera.

5. The application of the cotton bollworm ecdysone regulatory factor E78-C gene cDNA according to claim 4, wherein the RNAi mediates the synthesis of dsRNA with a target gene fragment with a nucleotide sequence shown as SEQ ID number 3.

6. The use of the cotton bollworm ecdysone regulatory factor E78-C gene cDNA according to claim 5, wherein the RNAi mediates the delivery of dsRNA synthesized in vitro by microinjection.

7. According to claimThe use of the ecdysone regulatory factor E78-C gene cDNA of Heliothis armigera of claim 6, which is characterized in that T7 RiboMAX is adopted^TMThe Express RNAi System kit synthesizes dsRNA by in vitro transcription of recovered DNA.

8. The use of the cotton bollworm ecdysone regulatory factor E78-C gene cDNA according to claim 6, wherein the injection volume of the dsRNA is 2 μ l, and the injection concentration is 5 μ g/μ l.

9. The use of the cDNA of the ecdysone regulatory factor E78-C gene of Heliothis armigera according to claim 6, wherein the injection site is the outermost layer of the internode membrane between the 7 th and 8 th abdominal sections of Heliothis armigera.

10. The use of the cotton bollworm ecdysone regulatory factor E78-C gene cDNA according to claim 6, wherein the cotton bollworm subjected to RNAi-mediated injection is a 1-day-old female cotton bollworm.

Images