CN108949769A - A kind of cotton bollworm molt hormone regulating and controlling factor E78-C gene cDNA and its application - Google Patents

Abstract

A kind of cotton bollworm molt hormone regulating and controlling factor E78-C gene cDNA, clone obtains moulting hormone inducible factor E78-C gene from bollworm, and to the moulting hormone inducible factor E78-C gene design primer of bollworm, 658-1122 synthesize dsRNA as E78-C target gene segment in selection SEQ ID NO.1, the dsRNA of synthesis is transmitted to the body cavity of bollworm by microinjection mode again, as a control group with green fluorescent protein (GFP), bollworm egg laying amount after statistics injection dsRNA shows using bollworm E78-C gene as interference target gene, injection interference is carried out to bollworm, the transcriptional expression of cryptiogene, to inhibit the bollworm development of ovary, reduce egg laying amount, and then control its population quantity；And the risk of pest generation resistance is low, provides fundamental basis for initiative new bio insecticide and engineering of insect-resistant plant.

Description

A kind of cotton bollworm molt hormone regulating and controlling factor E78-C gene cDNA and its application

Technical field

The present invention relates to insect growth genital regulating and field of biotechnology more particularly to a kind of cotton bollworm molt hormone tune Control factor E78-C gene cDNA and its application.

Background technique

Bollworm Helicoverpa armigera (H ü bner) is the worldwide distribution of one kind, polyphagous Important Agricultural evil Worm seriously endangers the various crops such as cotton, corn, wheat, tomato, to cause huge economic loss.Transgenosis Bt The extensive use of (Bacillus thuringiensist) cotton is effectively controlled the harm of bollworm, but bollworm is to turning The resistance problem of Bt cotton is also increasing significantly, and bollworm is to the harm of other non-transgenic crops also year by year at the same time Aggravation.Therefore, with the continuous development of society, there is an urgent need to have, new insect pest control method is combined or substitution Bt crop is to realize The sustainable development of modern agriculture.

It is a kind of important gene silencing means in the past few years found, the skill that RNA, which interferes (RNA interference, RNAi), Art passes through double-stranded RNA (dsRNA, Double-stranded RNA, double stranded RNA) efficient selective degradation corresponding sequence MRNA, due to use RNAi technology can specificity inhibit specific gene expression, therefore the technology have been widely used for explore base Because of function and field of gene.The technology has become new control of insect means in plant protection field at present, which utilizes elder brother Worm autogene segment by the expression of key gene in growth and development in RNAi inhibition insect bodies or biochemical metabolism, and then is controlled Pest damage processed.In 2007, existing document disclosed the dsRNA using transgenic technology expression target pest lethal gene to control Pest (Baum et al., 2007.Control of coleopteran insect pests through RNA processed interference.Nat.Biotechnol.25,1322-1326；Mao et al.,2007.Silencing a cotton bollworm P450monooxygenase gene by plant-mediated RNAi impairs larval Tolerance of gossypol.Nat Biotechnol.25 (11): 1307-1313.), having within 2017 scientist to find will Interfere JH binding protein juvenile hormone binding protein (JHBP) can be more in conjunction with Bt toxin Bollworm (Ni et al., 2017.Next-generation transgenic cotton:pyramiding is prevented and treated well RNAi and Bt counters insect resistance.Plant Biotechnol J.15(9):1204-1213.)。 RNAi technology by its pest-resistant specificity, to non-target organism without lethal effect and the advantage nontoxic to environment, in agricultural Plant protection prevention and control field has vast potential for future development.And realize that based on the critical issue that RNAi pest effectively controls be screening pest Specificity and the target gene for having obvious inhibiting effect to its growth and development.

The physiology courses such as growth and development, husking, metamorphosis, diapause, reproduction, the polytypism of insect and behavior reaction etc. are equal It is be unable to do without the participation of hormone, insect hormone has become a major fields of insecticide research and development, is different from traditional role In the insecticide of nervous system, effect toxicity is low, pollutes less, is small on natural enemy and beneficial organism influence, facilitates sustainable agriculture The development of industry, be conducive to pollution-free green food production, be beneficial to man health.

The juvenile hormone of insect and moulting hormone are the intracorporal important hormones of insect, the metamorphosis of insect, development, reproduction and Important regulating and controlling effect is played in a variety of behaviors such as diapause, cluster, mating.E78 is a kind of moulting hormone induced gene, it is Moulting hormone inducible transcription early gene, reproduction and embryonic development to insect play a significant role (Russell et al., 1996.The Drosophila Eip78C gene is not vital but has a role in regulating chromosome puffs.Genetics,144,159-170.).In terms of agricultural insect pests control, scientist has found and constructs The dsRNA cotton that hormone associated target gene can be expressed, is compared by transgene cotton and non-transgenic cotton, and bollworm takes Growth and fecundity (Xiong et al., the 2013.Silencing the of bollworm can significantly be inhibited after food HaHR3 gene by transgenic plant-mediated RNAi to disrupt Helicoverpa armigera development.Int J Biol Sci,9(4):370-381；Tian et al.,2015.Transgenic cotton plants expressing double-stranded RNAs target HMG-CoA reductase(HMGR)gene inhibits the growth,development and survival of cotton bollworms.Int J Biol Sci,11(11):1296-1305).This shows good research shows that prevent and treat the feasibility of agricultural pests by RNAi technology Prospect it is visible.Since the juvenile hormone and moulting hormone of insect are that insect is distinctive, therefore is used as evil for hormonal action approach The target of worm is comparatively safe, and novel insecticide is researched and developed based on the approach, and the prevention and treatment applied to pest has very big potentiality.

Summary of the invention

Technical problem solved by the invention is to provide a kind of cotton bollworm molt hormone regulating and controlling factor E78-C gene cDNA And its application, to solve the disadvantage in above-mentioned background technique.

Technical problem solved by the invention is realized using following technical scheme:

Cotton bollworm molt hormone regulating and controlling factor E78-C gene cDNA, including the nucleotides sequence as shown in SEQ ID NO.1 Column, the amino acid sequence as shown in SEQ ID NO.2 and the target gene sequence as shown in SEQ ID NO.3, particular sequence is such as Under:

SEQ ID NO.1

SEQ ID NO.2

SEQ ID NO.3

taatacgactcactataggggacgactctgaaggcagtggcggcgaggacgtggcgtcgtcgagcactgacgccgtg accgacatgcggtctatgctgtggcacagattcgcgcagcaaatgactcccgccatccctctagtggtcgagttcgc caagcgactgcccggcttcttcagcctcccgcaagatgaccatcttatcctcattaagcaagggttcttcgaagtct ggctgactcgtgtgaccgaccactctactcaggagtgcatcatgttcgagaatggcactacatttacctatcaggag ctgatggtgatgtatgatcaaccatttgcgacggcactgatgacgtacatttggaaaattctgaggatgcagatcac cgaggaagagatggccttgtacaccagcaccctgctgatgtgcccgcaccgcgtcggcctcagcacccccgaccgca tcagtggtctgcagcaaaccttgaacgacgcaccctatagtgagtcgtatta。

The cDNA clone method of cotton bollworm molt hormone regulating and controlling factor E78-C gene, the specific steps are as follows:

(1) bollworm female adult total serum IgE is extracted, then reverse transcription synthesizes cDNA, and is compared cDNA with determination The cDNA sequence of bollworm E78-C gene；

(2) specificity of the cDNA sequence of the bollworm E78-C gene obtained according to step (1), design E78-C gene is drawn Object, specific forward primer sequence is as shown in SEQ ID NO.4, and specific reverse primers sequence is as shown in SEQ ID NO.5:

SEQ ID NO.4:TAATACGACTCACTATAGGG GACGACTCTGAAGGCAGTG

SEQ ID NO.5:TAATACGACTCACTATAGGG TGCGTCGTTCAAGGTTTG

(3) cDNA of the bollworm E78-C gene obtained using step (1) is template, with specificity described in step (2) Primer carries out PCR amplification, obtains PCR product；

(4) purification step (3) resulting PCR product recycles target fragment, then PCR product after purification is connected to On PGM-T blunt carrier, recombinant vector is obtained, finally converts recombinant vector to competent cell, screening contains target fragment Positive colony；

(5) sequencing is carried out to positive colony of the screening containing target fragment in step (4), obtains bollworm E78-C gene CDNA.

The present invention also provides a kind of bollworm E78-C genes to apply in terms of the control of insect that RNAi is mediated, the RNAi It is that target gene segment shown in SEQ ID NO.3 synthesizes dsRNA that mediation, which is with nucleotides sequence column,.

The RNAi mediation is transmitted in a manner of the dsRNA that microinjection synthesizes in vitro.

The volume injected of the dsRNA is 2 μ l, and injection concentration is 5 μ g/ μ l, and injection site is abdomen Section 7 of bollworm The outermost of coria between Section 8.

The bollworm is 1 age in days bollworm female adult.

Clone obtains moulting hormone inducible factor E78-C gene to the present invention from bollworm for the first time, and sloughs off to bollworm Skin hormone induction factor E78-C gene design primer chooses in SEQ ID NO.1 658-1122 as E78-C target base Because segment synthesizes dsRNA, then the dsRNA of synthesis is transmitted to the body cavity of bollworm, by micro-injection method with green fluorescence As a control group, statistics injects the bollworm egg laying amount after dsRNA to albumen (GFP), the results showed that the controllable cotton of E78-C gene The development of ovary of earworm and egg laying amount.

The utility model has the advantages that the present invention injects bollworm for the first time using bollworm E78-C gene as interference target gene Interference, the transcriptional expression of cryptiogene reduce egg laying amount, and then control its population quantity to inhibit the bollworm development of ovary； Research foundation is good, perspective height, and the risk of pest generation resistance is low, for initiative new bio insecticide and Insect-Resistance Gene of Plant Engineering is provided fundamental basis.

Detailed description of the invention

Fig. 1 is the functional domain distribution schematic diagram of the bollworm E78-C gene in highly preferred embodiment of the present invention.

Fig. 2 is the jamming effectiveness signal that the bollworm in highly preferred embodiment of the present invention injects dsRNA to its target gene Figure.

Fig. 3 is that the injection in highly preferred embodiment of the present invention has the bollworm development of ovary of E78-C gene dsRNA to illustrate Figure.

Fig. 4 has the bollworm egg laying amount schematic diagram of E78-C gene dsRNA for the injection in highly preferred embodiment of the present invention.

Attached drawing 1 marks: hexagon indicates conserved domain C2H2 zinc fingers, pentagon representation DNA binding domain.

Specific embodiment

In order to be easy to understand the technical means, the creative features, the aims and the efficiencies achieved by the present invention, tie below Conjunction is specifically illustrating, and the present invention is further explained.

In the following embodiments, selected insect source: bollworm eggs are collected in Langfang in Hebei Province, and continuous multi-generation uses in laboratory Man-made feeds raising, bollworm eggs are hatched in growth cabinet, and temperature is 26 DEG C, relative humidity 70%；

Rearing conditions: temperature is 25 DEG C, relative humidity 40%-50%, and illumination is 14:10 (L:D), feeds bollworm people Work feed；

Used experimental method is conventional method unless otherwise specified；Material used in embodiment, reagent etc., It is commercially available unless otherwise specified；Instrument used in test implementation is Molecular Biology Lab's routine Instrument.

The cDNA sequence of the acquisition bollworm E78-C gene of embodiment 1

1, bollworm total serum IgE is extracted

Insect total serum IgE utilizesRNA separation and Extraction reagent (TIANGEN company) under the conditions of no RNA enzyme into Row, specific extraction step are as follows:

(1) glass homogenizer is cleaned and is wrapped up tightly after drying with tinfoil, be then placed in sterilizing in high temperature hot air sterilization pot, It takes out and is cooled to room temperature for use after the completion；

(2) it takes fresh bollworm to organize 50~100mg, is added to the glass homogenizer for having used Liquid nitrogen precooler, rapidly 1ml is added into glass homogenizerReagent is fully ground；

(3) ground homogenate is transferred in the 1.5ml centrifuge tube of no RNA enzyme with the pipette tips of no RNA enzyme carry out from The heart processing after, ice bath stand 3~5min, 4 DEG C of temperature；Centrifuge tube revolving speed 12000rpm, centrifugation time 15min；

(4) supernatant after centrifugation in step (3) is transferred in new no RNA enzyme 1.5ml centrifuge tube, 0.2ml is added Chloroform, vortex 15s stand 5min after carrying out centrifugal treating at room temperature, and 4 DEG C of temperature；Centrifuge tube revolving speed 12000rpm, when centrifugation Between 10min；

(5) supernatant after centrifugation in step (4) is drawn into the 1.5ml centrifuge tube that 400 μ l are transferred to new no RNA enzyme In, 200 μ l chloroforms are added, whirlpool shakes 30s, after carrying out centrifugal treating, it is placed at room temperature for 5min, 4 DEG C of temperature；Centrifuge tube revolving speed 12000rpm, centrifugation time 10min；

(6) using 200 μ l without the supernatant after centrifugation in RNA enzyme pipette tips aspiration step (5), and supernatant is transferred to In the new 1.5ml centrifuge tube without RNA enzyme, isometric isopropanol is added, is slowly added to the anhydrous of 0.5 times of supernatant volume Ethyl alcohol mixes, and then obtained solution and precipitating are transferred to together in adsorption column RNA spin column, stands 10min；

(7) step (6) are put into collecting pipe equipped with the adsorption column of solution and precipitating and carry out centrifugal treating, 4 DEG C of temperature, collected After pipe centrifugal rotational speed 12000rpm, centrifugation time 3min, the waste liquid in collecting pipe is discarded, adsorption column is put back in collecting pipe；

(8) it is added into adsorption column after 500 μ l protein liquid removal RW1 and carries out centrifugal treating, 4 DEG C of temperature, centrifugal rotational speed After 12000rpm, centrifugation time 2min, waste liquid is abandoned；

(9) the DNase I working solution of 80 μ l is added to adsorption column center, is placed at room temperature for 15min；

(10) it is added again into adsorption column after 500 μ l protein liquid removal RW1 and carries out centrifugal treating, 4 DEG C of temperature, centrifugal rotational speed 12000rpm, centrifugation time 30-60s abandon waste liquid, then adsorption column are put back in collecting pipe；

(11) 500 μ l RNA rinsing liquid RW are added into adsorption column, is stored at room temperature 2min, 4 DEG C of temperature, will be floated equipped with RNA The adsorption column of washing lotion RW is put into collecting pipe and carries out centrifugal treating, and centrifugal rotational speed 12000rpm after being centrifuged 1min, abandons waste liquid；

(12) 500 μ l RNA rinsing liquid RW are added into adsorption column again, is stored at room temperature 2min, 4 DEG C of temperature, will be equipped with The adsorption column of RNA rinsing liquid RW is put into collecting pipe and carries out centrifugal treating, and centrifugal rotational speed 12000rpm after being centrifuged 1min, abandons waste liquid； Again at 4 DEG C of temperature, preceding adsorption column being put into collecting pipe and carries out centrifugal treating, centrifugal rotational speed 12000rpm is empty from 2min, with Remove unnecessary alcohol；Collecting pipe is then put in superclean bench 10-20min, thoroughly to dry rinsing remaining in adsorption column Liquid；

(13) adsorption column thoroughly dried in step (12) is transferred in a new RNase-Free centrifuge tube, and inhaled backward 30-50 μ l RNase-Free ddH is vacantly added dropwise in the intermediate position of attached column₂O (depending on RNA amount), after being placed at room temperature for 2min Centrifugal treating is carried out, centrifugal rotational speed 12000rpm is centrifuged 2min, obtains RNA solution；

(14) 1 μ l step (13) resulting RNA solution is taken to be diluted to 10 μ l, wherein 5 μ l are detected with agarose gel electrophoresis The integrality that gained RNA is extracted in step (13), the matter that the middle gained RNA of 5 μ l NanoDrop instrument detecting step (13) is extracted Amount, remaining RNA are used for the synthesis of cDNA；

2, the first chain cDNA is synthesized

According to TIANGEN Fast King one-step method except the specification of the first chain of genome cDNA synthetic agent box synthesizes cotton Earworm cDNA, and the bollworm cDNA after synthesis is stored in -20 DEG C or -70 DEG C of refrigerator, using it is preceding dilute on demand it is several Times；

3, target gene is cloned

(a) according to laboratory bollworm transcript profile database as a result, using bioinformatics method to transcript profile data Preliminary analysis is carried out, to screen bollworm E78-C gene, then by sequence alignment analysis, obtains bollworm E78-C gene CDNA sequence, as shown in SEQ ID NO.1；

(b) according to the cDNA sequence of bollworm E78-C gene, online protein translation software ExPASy- is utilized Translate tool translates nucleotide sequence, and the sequence of amino acid is as shown in SEQ ID NO.2；

(c) according to the cDNA sequence of bollworm E78-C gene, using 5.0 software design of Premier with T7 promoter The specific primer sequence of specific primer, design is as follows:

Forward primer SEQ ID NO.4:TAATACGACTCACTATAGGG GACGACTCTGAAGGCAGTG

Reverse primer SEQ ID NO.5:TAATACGACTCACTATAGGG TGCGTCGTTCAAGGTTTG

(d) using the cDNA of bollworm E78-C gene as template, PCR amplification is carried out using high-fidelity DNA polymerase, PCR is anti- Answer system following (25 μ l of total volume): concentration is the 1 μ l of cDNA template of 400ng/ μ l, and concentration is that 10 μM of upstream and downstream primer is each 0.5 0.5 μ l, 5 × Buffer5 μ l, DNA polymerase of μ l, dNTP (10 μM), 0.5 μ l and remove 17 μ l of nuclease water；

PCR reaction condition is as follows: 98 DEG C of initial denaturation 5min of temperature；98 DEG C of denaturation 10s of temperature, temperature 58 DEG C of annealing 30s, temperature 72 DEG C of extension 30s are spent, totally 35 circulations；Extend 5min under the conditions of 72 DEG C of temperature, is saved at 4 DEG C of temperature, obtain PCR product；

(e) gained PCR product in step (e) is detected using 1% agarose gel electrophoresis, then cuts expansion with blade The blob of viscose of the object tape position of increasing is put into sterile centrifuge tube, using plastic recovery kit (Axygen) recovery purifying, Specific recovery purifying process is referring to kit specification；

(f) PCR product in step (e) after purification is connected on PGM-T blunt carrier, room temperature 25min must be recombinated Carrier then converts recombinant vector to competent cell, and specific operation is as follows:

50 μ l Trans1-T1 competent cell (full formulas are added in each 1.5ml centrifuge tube in the multiple centrifuge tubes of indwelling King Company), recombinant vector is added, places 30min on ice, after 42 DEG C of water-bath 90s of temperature, places 2min on ice again； It is then separately added into the LB liquid medium of 600 μ l-800 μ l in each 1.5ml centrifuge tube, 37 DEG C of temperature, shakes bacterium revolving speed 200rpm shakes bacterium time 2h, after shaking bacterium, 100 μ l bacterium solutions is drawn into 1 ‰ AMP LB solid mediums, in 37 DEG C of conditions of temperature Lower overnight incubation；Picking individual colonies have the 1 ‰ AMP LB Liquid Cultures of 300-500 μ l in the centrifuge tube of 1.5ml, in centrifuge tube Base, shakes bacterium revolving speed 200rpm by 37 DEG C of temperature, shakes bacterium time 3-6h, observes growing state；

Bacterium solution PCR is carried out with general M13 primer, bacterium solution PCR reaction system (20 μ l of total volume) is as follows: 1 μ l of bacterium solution, Taqmix10 μ l, 1 μ l of preceding primer, 1 μ l of rear primer, 0.25 μ l of Taq enzyme, ddH₂O 8μl；And to the product after bacterium solution PCR reaction It is sequenced, sequencing result is as shown in SEQ ID NO.3；

According to sequencing result, fresh LB of the correct bacterial strain addition containing ammonia benzyl antibiotic is shaken into bacterium again, is obtained Fresh bacterium solution is obtained, plasmid is carried out and extracts the plasmid to obtain and have target gene segment；

The preparation and synthesis of 2 bollworm E78-C gene dsRNA template of embodiment

I, bollworm E78-C gene dsRNA template is prepared

(i) PCR amplification is carried out by template of the plasmid with target gene segment, the reaction system of PCR is 50 μ l, reaction Condition is consistent with above-mentioned PCR amplification, and the 1 μ l of PCR product after taking amplification, the nuclease-free water that 4 μ l are added is diluted, and then makes The length of PCR fragment is detected with the Ago-Gel that concentration is 1%；

(ii) PCR product in step (i) is carried out after purification using DNA product purification kit, then the production for taking 1 μ l to purify Being diluted without RNA enzyme water for 4 μ l is added in object, the Ago-Gel and micro uv-spectrophotometric for the use of concentration being then 1% The unicity and concentration of meter measurement product after purification；

II, synthesis dsRNA

Using T7RiboMAX^TMSynthesis is transcribed in vitro in the DNA of recycling by Express RNAi System kit, specific to walk It is rapid as follows:

(1.) reagent 2 × NTP buffer Mix is put in and is slowly melted on ice, reagent is centrifuged to tube bottom after thawing, T7 rna polymerase is put in -20 DEG C；

(2.) reagent is mixed in the following proportions:

After mixing, brief centrifugation, the 4h in being put into the metal bath that temperature is 37 DEG C；

(3.) DNA and ssRNA is removed, following reagent is proportionally added:

It mixes well, flicks tube bottom, after brief centrifugation, be put into 30min in the metal bath that temperature is 37 DEG C, add EDTA 1 μ l of reagent places 5min in the metal bath that temperature is 65 DEG C and terminates reaction；

(4.) by the dsRNA that need to be purified (~50 μ l) H of no RNA enzyme₂O be settled to 200 μ l obtain solution to be purified (can root Expand system according to actual needs equal proportion)；

(5.) in the solution to be purified of step (4.), isometric (~200 μ l) the phenol chloroform mixed solvent of addition (phenol: Chloroform: isoamyl alcohol=25:24:1), it mixes gently, is centrifuged (12000rpm, 4 DEG C) 15min in the case where temperature is 4 DEG C of centrifuge；

(6.) upper solution after taking step (5.) to be centrifuged, is added isometric chloroform (200 μ l), mixes gently, in temperature To be centrifuged (12000rpm, 4 DEG C) 15min under 4 DEG C of centrifuges；

(7.) take step (6.) be centrifuged after upper strata aqueous phase, be added 1/10 volume (20 μ l) 3M sodium acetate (pH 5.2) and 100% ethyl alcohol (- 20 DEG C storage) of 2.5 times of volumes (500 μ l), it is mild mix be placed on -20 DEG C staticly settle overnight once Acid solution；

(8.) acid solution obtained by step (7.) is centrifuged in the case where temperature is 4 DEG C of centrifuge (12000rpm, 4℃)30min；

(9.) after step (8.) centrifugation, transparent heavy be deposited on of gummy white is centrifuged bottom of the tube or side wall, abandoning supernatant (for Prevent precipitating to be sucked out together, can carefully be drawn with 200 pipette tips of the μ l without RNA enzyme), it is added in the transparent precipitating of gummy white 80% ethyl alcohol (- 20 DEG C of storages) mixes gently, and washing precipitating is stored at room temperature 10min, obtains secondary acid solution；

(10.) the resulting secondary acid solution of step (9.) is centrifuged in the case where temperature is 4 DEG C of centrifuge (7500rpm, 4 DEG C) 5min, obtains centrifugate；

Ethyl alcohol in step (10.) in centrifugate is slowly sucked out and (is careful not to that precipitating is sucked out), in close precipitating Residual liquid when be slowly sucked out using 10 μ l liquid-transfering guns, then centrifuge tube is uncapped, and it is dry to be put into superclean bench, 10min all volatilizees to ethyl alcohol；

To stepAll after volatilization, 10 μ l are added without RNA enzyme H in centrifuge tube in middle ethyl alcohol₂O flicks tube bottom, The full and uniform H for being dissolved in no RNA enzyme will be precipitated₂In O, dsRNA is synthesized；

The dsRNA product dilution for taking 1 μ l to dissolve is in 9 μ l DEPC H₂In O, take it is a with 1% Ago-Gel The purity and quality for detecting the dsRNA of synthesis take a dense with NanoPhotometer micro-spectrophotometer detection dsRNA Degree, it is spare that remaining is stored in -80 DEG C of refrigerators；

It synthesizes in a manner mentioned above simultaneously and purifies the dsRNA for obtaining GFP (Green Fluorescent Protein) For solution as negative control, the upstream and downstream primer sequence that when GFP segment PCR amplification uses is respectively dsGFP-T7F (such as SEQ ID Shown in NO.6), dsGFP-T7R (as shown in SEQ ID NO.7)；

SEQ ID NO.6TAATACGACTCACTATAGGAAGGGCGAGGAGCTGTTCACCG

SEQ ID NO.7TAATACGACTCACTATAGGCAGCAGGACCATGTGATCGCGC

The screening of embodiment 3 has the dsRNA of E78-C genetic fragment to inhibit the bollworm development of ovary and oviposition

1, microinjection bollworm E78-C gene dsRNA

Choose emergence 1d size is uniform, the consistent bollworm female adult of health status, the dsRNA control of setting injection GFP Group and the dsRNA experimental group for injecting E78-C, by bollworm female adult CO before injection₂Then anesthesia utilizes micro syringe by body The dsRNA of outer synthesis is injected to the body cavity of bollworm along the abdomen coria of section third from the bottom, and the injection volume of dsRNA is 2 μ l, Injection concentration is 5 μ g/ μ l, every group injection 90,3 biology is arranged and repeat；After injection, bollworm female adult is put in directly Diameter is 8cm, is highly raising in the round plastic box of 10cm, and each plastics box cover has degreasing cotton gauze, using 10% bee Mulse, which soaks absorbent cotton to be put on gauze, supplies nutrition for bollworm female adult, changes gauze daily, and count on gauze and cotton balls Oviposition number, put 3 bollworm female adults in each plastic casing；

2, bollworm E78-C Gene silencing efficacy is detected

After dsRNA injection in 0-96h, Gene silencing efficacy detection is carried out every sampling for 24 hours, control group and experimental group are each 4 are taken, 3 biology are set and are repeated；Bollworm female adult abdomen is dissected, the total serum IgE of fatty body tissue is taken and reverse transcription is at cDNA, Using the expression quantity situation of change of qRT-PCR technology testing goal gene, using β-actin as reference gene calibration samples cDNA Difference, primer sequence used is as follows:

β-actin-F-CTGGGACGATATGGAGAA

β-actin-R-CGAACATGATCTGTGTCA

E78-C-F-CGCCGAAGTGAAGTTAGAGC

E78-C-R-GGATTCGCATGTAGACGTCG

Testing result shows maximum silencing efficiency occur after E78-C dsRNA injects 72h and reach 89.9% (P= 0.002), and the silencing efficiency can maintain at least for 24 hours, as shown in Figure 2 behind；

3, bollworm female worm's ovum nest developmental state is observed after injecting dsRNA

After injecting dsRNA, bollworm female adult each 10 for selecting processing group and control group at random dissect ovary, such as Fig. 3 Shown, the E78-C dsRNA processing group development of ovary is obviously suppressed；

4, bollworm female adult oviposition situation counts after injecting dsRNA

As shown in figure 4, finding by the statistics to egg laying amount, the oviposition of the bollworm experimental group of E78-C dsRNA is injected Amount is 558, significantly lower than 789 (P < 0.05) of the control group of injection GFP dsRNA, effectively inhibits bollworm oviposition.

Sequence table

<110>Agricultural University Of Jiangxi

<120>cotton bollworm molt hormone regulating and controlling factor E78-C gene cDNA and its application

<141> 2018-07-24

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1473

<212> DNA

<213>bollworm Helicoverpa armigera E78-C gene nucleotide series ()

<400> 1

atggacgtgt ggagcggtcg acccgcgtcc tgcgttcgcg caccgtcgcc cctcgccata 60

gagcccggcg acaattttgc gctcacgttc ttcgacagca aagagcaagc gccgccgacg 120

ctgccgaaac aagatcctct acaatacact gtagaaagta gtaactcaac cacagttaac 180

aagactgcaa gcccttgcaa ggtgtgcggt gataaagcct ctggctatca ctacggcgtc 240

acgtcatgcg agggatgcaa ggggttcttt cgccgcagca tccagaagca gattgaatac 300

cgttgcctcc gtgacggcaa gtgtcttgtt atcagactga acagaaatcg ttgccagttc 360

tgcagattca aaaagtgtct agcagttggc atgagccgtg actccgtgag atacggccga 420

gtccccaagc gtccccgaga agccgtcgtc gccgaagtga agttagagcc ggccgctgcc 480

tacgccgcta acgtcgaggt gatcccgccg cccgaagcca tggagacgga gcccgcgcgc 540

ccggagatgt ccagcgagga gctggtgaag ctgatcacga cagcgcaccg caagaccaac 600

acctacacgg aggagctgca tgtgccactg ccgcgcgacg tctacatgcg aatccatgac 660

gactctgaag gcagtggcgg cgaggacgtg gcgtcgtcga gcactgacgc cgtgaccgac 720

atgcggtcta tgctgtggca cagattcgcg cagcaaatga ctcccgccat ccctctagtg 780

gtcgagttcg ccaagcgact gcccggcttc ttcagcctcc cgcaagatga ccatcttatc 840

ctcattaagc aagggttctt cgaagtctgg ctgactcgtg tgaccgacca ctctactcag 900

gagtgcatca tgttcgagaa tggcactaca tttacctatc aggagctgat ggtgatgtat 960

gatcaaccat ttgcgacggc actgatgacg tacatttgga aaattctgag gatgcagatc 1020

accgaggaag agatggcctt gtacaccagc accctgctga tgtgcccgca ccgcgtcggc 1080

ctcagcaccc ccgaccgcat cagtggtctg cagcaaacct tgaacgacgc actcataaat 1140

aacatgataa ccagcggagg tggtcctgag gcgacagcca ttgcccgcgc gcgctacgaa 1200

gccttcgctg cggccaggaa cgaagtccgc ctcataggcg cccgacatca cgttcttctc 1260

tcgtatcctc gagaacgctg gccacgcctg ttgctgcctg atctgttcat agagatattt 1320

gatattccga ggtacgaaga tcagactgaa gcagttgcgg cggcgtcgac ttcggcggtg 1380

actacgtcga cggcggtggt tgtggcgccg gtcgctcagt cctcccaatc ccctcactcc 1440

tctcaaactc ctcaggtccc gcagcggggc tag 1473

<210> 2

<211> 490

<212>bollworm Helicoverpa armigera E78-C gene amino acid sequence

<400> 2

mdvwsgrpas cvrapsplai epgdnfaltf fdskeqappt lpkqdplqyt vessnsttvn 60

ktaspckvcg dkasgyhygv tscegckgff rrsiqkqiey rclrdgkclv irlnrnrcqf 120

crfkkclavg msrdsvrygr vpkrpreavv aevklepaaa yaanvevipp peametepar 180

pemsseelvk littahrktn tyteelhvpl prdvymrihd dsegsggedv assstdavtd 240

mrsmlwhrfa qqmtpaiplv vefakrlpgf fslpqddhli likqgffevw ltrvtdhstq 300

ecimfengtt ftyqelmvmy dqpfatalmt yiwkilrmqi teeemalyts tllmcphrvg 360

lstpdrisgl qqtlndalin nmitsgggpe ataiararye afaaarnevr ligarhhvll 420

syprerwprl llpdlfieif dipryedqte avaaastsav ttstavvvap vaqssqsphs 480

sqtpqvpqrg 490

<210> 3

<211> 514

<212>E78C-dsRNA target gene sequence

<220>

<221>upstream T7 promoter

<222> (1…20)

<220>

<221>downstream T7 promoter

<222> (495…514)

<400> 3

taatacgact cactataggg gacgactctg aaggcagtgg cggcgaggac gtggcgtcgt 60

cgagcactga cgccgtgacc gacatgcggt ctatgctgtg gcacagattc gcgcagcaaa 120

tgactcccgc catccctcta gtggtcgagt tcgccaagcg actgcccggc ttcttcagcc 180

tcccgcaaga tgaccatctt atcctcatta agcaagggtt cttcgaagtc tggctgactc 240

gtgtgaccga ccactctact caggagtgca tcatgttcga gaatggcact acatttacct 300

atcaggagct gatggtgatg tatgatcaac catttgcgac ggcactgatg acgtacattt 360

ggaaaattct gaggatgcag atcaccgagg aagagatggc cttgtacacc agcaccctgc 420

tgatgtgccc gcaccgcgtc ggcctcagca cccccgaccg catcagtggt ctgcagcaaa 480

ccttgaacga cgcaccctat agtgagtcgt atta 514

Claims (10)

1. a kind of cotton bollworm molt hormone regulating and controlling factor E78-C gene cDNA, which is characterized in that including such as SEQ ID NO.1 institute Nucleotide sequence, the amino acid sequence as shown in SEQ ID NO.2 and the target gene sequence as shown in SEQ ID NO.3 shown Column, particular sequence are as follows:

SEQ ID NO.1

SEQ ID NO.2

SEQ ID NO.3

taatacgactcactataggggacgactctgaaggcagtggcggcgaggacgtggcgtcgtcgagcactgacgc cgtgaccgacatgcggtctatgctgtggcacagattcgcgcagcaaatgactcccgccatccctctagtggtcgagt tcgccaagcgactgcccggcttcttcagcctcccgcaagatgaccatcttatcctcattaagcaagggttcttcgaa gtctggctgactcgtgtgaccgaccactctactcaggagtgcatcatgttcgagaatggcactacatttacctatca ggagctgatggtgatgtatgatcaaccatttgcgacggcactgatgacgtacatttggaaaattctgaggatgcaga tcaccgaggaagagatggccttgtacaccagcaccctgctgatgtgcccgcaccgcgtcggcctcagcacccccgac cgcatcagtggtctgcagcaaaccttgaacgacgcaccctatagtgagtcgtatta。

2. a kind of cDNA clone method of cotton bollworm molt hormone regulating and controlling factor E78-C gene as described in claim 1, special Sign is, the specific steps are as follows:

(1) bollworm female adult total serum IgE is extracted, then reverse transcription synthesizes cDNA, and is compared cDNA to determine cotton boll The cDNA sequence of worm E78-C gene；

(2) cDNA sequence of the bollworm E78-C gene obtained according to step (1) designs the specific primer of E78-C gene, Specific forward primer sequence is as shown in SEQ ID NO.4, and specific reverse primers sequence is as shown in SEQ ID NO.5:

SEQ ID NO.4:TAATACGACTCACTATAGGG GACGACTCTGAAGGCAGTG

SEQ ID NO.5:TAATACGACTCACTATAGGG TGCGTCGTTCAAGGTTTG；

(3) cDNA of the bollworm E78-C gene obtained using step (1) is template, with specific primer described in step (2) PCR amplification is carried out, PCR product is obtained；

(4) purification step (3) resulting PCR product recycles target fragment, then PCR product after purification is connected to PGM-T On blunt carrier, recombinant vector is obtained, finally converts recombinant vector to competent cell, screens the positive containing target fragment Clone；

(5) sequencing is carried out to the positive colony in step (4) containing target fragment, obtains the cotton bollworm molt hormone regulating and controlling factor E78-C gene cDNA.

3. a kind of cotton bollworm molt hormone regulating and controlling factor E78-C gene cDNA as described in claim 1, which is characterized in that answer For:

1) regulate and control insect growth；

2) product for regulating and controlling insect growth is prepared；

3) pest control；

4) preparation is used for the product of pest control；

5) insect spawning amount is reduced；

6) product for reducing insect spawning amount is prepared.

4. a kind of cotton bollworm molt hormone regulating and controlling factor E78-C gene cDNA according to claim 3, which is characterized in that It is applied to pest control using mediating in RNAi.

5. a kind of cotton bollworm molt hormone regulating and controlling factor E78-C gene cDNA according to claim 4, which is characterized in that It is that target gene segment shown in SEQ ID NO.3 synthesizes dsRNA that the RNAi mediation, which is with nucleotides sequence column,.

6. a kind of cotton bollworm molt hormone regulating and controlling factor E78-C gene cDNA according to claim 5, which is characterized in that The RNAi mediation is transmitted in a manner of the dsRNA that microinjection synthesizes in vitro.

7. a kind of cotton bollworm molt hormone regulating and controlling factor E78-C gene cDNA according to claim 6, which is characterized in that Using T7 RiboMAX^TMSynthesis dsRNA is transcribed in vitro in the DNA of recycling by Express RNAi System kit.

8. a kind of cotton bollworm molt hormone regulating and controlling factor E78-C gene cDNA according to claim 6, which is characterized in that The volume injected of the dsRNA is 2 μ l, and injection concentration is 5 μ g/ μ l.

9. a kind of cotton bollworm molt hormone regulating and controlling factor E78-C gene cDNA according to claim 6, which is characterized in that The injection site is the outermost of coria between abdomen Section 7 of bollworm and Section 8.

10. a kind of cotton bollworm molt hormone regulating and controlling factor E78-C gene cDNA according to claim 6, which is characterized in that It is 1 age in days bollworm female adult that the RNAi, which mediates the bollworm of injection,.