CN113337503A

CN113337503A - Application of brown planthopper NLSP7 as target spot in prevention and treatment of brown planthopper

Info

Publication number: CN113337503A
Application number: CN202110380480.9A
Authority: CN
Inventors: 张振飞; 袁龙宇; 巩固
Original assignee: Plant Protection Research Institute Guangdong Academy of Agricultural Sciences
Current assignee: Plant Protection Research Institute Guangdong Academy of Agricultural Sciences
Priority date: 2021-04-09
Filing date: 2021-04-09
Publication date: 2021-09-03
Anticipated expiration: 2041-04-09
Also published as: CN113337503B

Abstract

The invention relates to the technical field of biology, and discloses application of Nilaparvata lugens NLSP7 as a target spot in prevention and treatment of Nilaparvata lugens. The invention discloses the application of the Nilaparvata lugens NLSP7 as a target spot in prevention and control of Nilaparvata lugens for the first time, and the feeding behavior and the feeding amount of the Nilaparvata lugens can be influenced by silencing NLSP7 gene, so that the Nilaparvata lugens generate a food refusing effect, and the purpose of prevention and control of the Nilaparvata lugens is achieved. The invention discloses application of brown planthopper NLSP7 as a target spot in improving the content of rice malt flavone for the first time, and the content of the malt flavone in rice (especially rice with high malt flavone content) can be improved by silencing NLSP7 gene.

Description

Application of brown planthopper NLSP7 as target spot in prevention and treatment of brown planthopper

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of brown planthopper NLSP7 as a target spot in prevention and treatment of brown planthopper.

Background

Brown planthopper (Nilaparvata lugens (Stal)) belongs to the family Hemiptera planthopper (Hemiptera: Delphacidae), is a rice pest which can migrate to the fly in a long distance, has strong adaptability to the environment, is the leading pest (Sogawa,1982; velusamy et al, 1986). Brown planthopper was selected singly for host plants and fed and laid eggs only on rice or wild rice (Dyck et al, 1979; hong dawn et al, 2007; Wang et al, 2008). The brown planthopper mainly impairs the phloem sap of the host rice to seriously affect the growth and development of the rice, a salivary sheath formed when the brown planthopper eats can block vascular bundles, the brown planthopper secretes a large amount of honeydew after eating, and the honeydew contains a large amount of amino acid and sugar, so that the host rice can be infected with bacteria (such as Lichufeng and the like, 2019), and the rice seriously damaged by the brown planthopper can cause paralysis and lodging, cause the phenomenon of rice louse burning, and cause serious yield reduction and even absolute harvest of paddy rice in a large field. Meanwhile, besides the influence of the brown planthopper on rice plants, the brown planthopper also can be used as a medium to transmit rice virus diseases such as grassy bushy stunt and odontoblast stunt, and the rice virus diseases can bring disastrous consequences to the yield of rice production (Hibino, 1996; reverie et al, 2003). Beginning in the 80 s of the 20 th century, the brown planthopper occurrence area in China is about 1330-2000 ten thousand hm²Approximately one half of the area of rice planted in China, causing serious loss to the rice production in China (Li Ru Toze et al, 1996), and brown planthopper harms the rice in China for nearly thirty years, and has three main characteristics: increased outbreak frequency, expanded hazard range, and increased hazard level (Roc et al, 2013).

RNAi, RNA interference, refers to a phenomenon in which double-stranded RNA (dsrna) induces silencing of target gene mRNA, which in turn affects normal physiological activities of target organisms. RNAi studies began in 1995, after Guo et al, Connell university, performed both sense and antisense RNA interference in experiments on nematode Caenorhabditis elegans, and found that either sense or antisense RNA caused the downregulation of Parl gene expression by nematode Caenorhabditis elegans (Guo et al, 1995). In 1998, to reveal the appearance of the phenomenon, Fire, Washington-Carnaid institute, Fire, et al, injected purified single-stranded RNA into the nematode Caenorhabditis elegans and found only weak inhibitory effect, and injected purified dsRNA into the nematode Caenorhabditis elegans and found that the purified dsRNA could have strong inhibitory effect on the expression of the related gene, thereby confirming that the inhibition of parl gene expression by sense RNA in Guo and Kemphues experiments is due to trace dsRNA contamination, which leads the experimental results to disagreement with theory, and becomes the earliest RNAi phenomenon (Fire et al, 1998). So far, RNAi technology has been widely applied to various fields (Belles, 2010) related to insect research, such as verification of insect gene function, pest control, prevention and control, new pesticide development targets, and the like (Tianhong Kong et al, 2012; Wang Hui Dong et al, 2012) due to the characteristics of simple and convenient operation, relatively low cost, and more importantly, specificity and high efficiency of RNAi technology.

Currently, the technology of interference tests on insects by using RNAi means is mature, and the field of RNAi technology in insect-related research mainly focuses on gene function, RNAi induction of transgenic insect-resistant plants, and beneficial insect disease control (Baum et al, 2007; tianan et al, 2009; Chen et al, 2010; Hunter et al, 2010; Yao et al, 2010), and the main means for introducing into the insect body are three, namely feeding, injection and tissue culture, and the optimal introduction method needs to be selected according to different experimental requirements. For example, the test for silencing the salivary protein C002 of the Aphis pisum (Acyrthospongoisum) is the first test for researching the function of the salivary protein of the piercing-sucking insect, and the experiments show that the food intake of the Aphis pisum and the C002 salivary protein have important relationship (Mutti et al, 2006). Jirui (2013) found that after silencing salivary protein Nl1860 by RNA interference technology, honeydew amount is significantly reduced, mortality is significantly increased, and the like. On the other hand, however, there are limitations to the use of RNA interference for the study of salivary proteins, such as some insect genes that occur only in certain age, in certain period or in certain tissues of the insect; biological tissues such as tobacco hornworm (Manduca sextai) and silkworm (Bombyx mori) other than hemolymph are difficult to be gene silenced (Eleftherianos et al, 2007; Miller et al, 2008; Huanghui Xiao, 2016); on the other hand, some sialoprotein genes are indispensable parts for normal development of insects, and if RNA interference is carried out on the genes, the insects die rapidly, and the subsequent effect of the genes on feeding of the insects is difficult to test.

Disclosure of Invention

The first aspect of the invention aims to provide application of Nilaparvata lugens NLSP7 as a target point in prevention and control of Nilaparvata lugens.

The second aspect of the invention aims to provide application of brown planthopper NLSP7 as a target spot in improving the content of rice tricin.

In a third aspect, the invention provides a dsRNA.

The fourth aspect of the present invention is directed to a gene encoding the dsRNA of the third aspect.

It is an object of a fifth aspect of the invention to provide a recombinant expression vector, a recombinant microorganism or a transgenic cell line comprising the dsRNA of the third aspect and/or the coding gene of the fourth aspect.

It is an object of a sixth aspect of the present invention to provide a medicament.

The seventh aspect of the invention aims to provide the application of the medicament of the sixth aspect in controlling brown planthopper.

An eighth aspect of the present invention is to provide a use of the drug of the sixth aspect in increasing the content of rice tricin.

The ninth aspect of the invention aims to provide application of the transgenic rice containing the dsRNA of the third aspect and/or the coding gene of the fourth aspect in controlling brown planthopper.

The tenth aspect of the present invention is directed to provide a transgenic rice plant containing the dsRNA of the third aspect and/or the coding gene of the fourth aspect, for increasing the content of tricin in rice.

An eleventh aspect of the present invention is directed to a method for controlling brown planthopper and/or increasing the content of rice malflavone.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

in the first aspect of the invention, the application of the brown planthopper NLSP7 as a target point in controlling the brown planthopper is provided.

Preferably, the nucleotide sequence of NLSP7 is shown as SEQ ID NO. 3.

In the second aspect of the invention, the application of brown planthopper NLSP7 as a target point in improving the content of rice malflavone is provided.

Preferably, the nucleotide sequence of NLSP7 is shown as SEQ ID NO. 3.

Preferably, the rice is high-malted rice, and the high-malted rice is rice with malted content more than or equal to 24 ng/g; further Rathu Heenati (RH) rice.

In a third aspect of the invention, there is provided a dsRNA, wherein the nucleotide sequence of one strand of the dsRNA has at least 80% homology with the nucleotide sequence shown in SE Q ID NO.10 (the sequence of SEQ ID NO.10 is AGGCAAGAGCAAGAGGCGATCAAGGGAGAGA ATCGTGTATGCACAGCCTCCTCCAACCCCAGTCATCATCCAAGGTGCTGCTCCATACAAC TATGACAACAGAGGCTACTATGACAACAGGCCTTACCCTGGAGATGGTCGCGGATATTAT GACGCCAACGGTGTCTGGATCAATGGAGGCTACAATGGACCTTACCCCAATAATGGTCC AGTGGTTGTCTACCCCAATAATGGTCCTTATGTGCAGCCTACCTATGGACCACAGGTTGT CTACTA).

Preferably, the nucleotide sequence of one strand of the dsRNA has at least 95% homology with the nucleotide sequence shown in SEQ ID NO. 10.

The nucleotide sequence of one strand of the dsRNA is shown as SEQ ID NO. 10.

In a fourth aspect of the invention, there is provided a gene encoding the dsRNA of the third aspect.

Preferably, the nucleotide sequence of the coding gene of the dsRNA is as follows: CGGCTATAACTTCTGCATCTGCCT CATCCAGTGTTTTAATGGATGTACCACAGGAAGTCTATATCTATATGGGCTGCTCCATACA ACTATGACTACAGAGGTACTATGACAACAGTCCTTACCCTGGAGATGGTCGCGGATATTA TGACGCCAACGGTGTCTGGATCAATGGAGGCTACAATGGACCTTACCCCAATAATGGTC CAGTGGTTGTCTACCCCAATAATGGTCCTTATGTGCAGCCTACCTATGGACCACAGGTTG TCTAAAT (SEQ ID NO. 11).

In a fifth aspect of the invention there is provided a recombinant expression vector, a recombinant microorganism or a transgenic cell line comprising the dsRNA of the third aspect and/or the coding gene of the fourth aspect.

In a sixth aspect of the present invention, there is provided a pharmaceutical preparation comprising the active ingredient of any one of (1) to (3):

(1) a dsRNA of the third aspect;

(2) a gene encoding the fourth aspect;

(3) the recombinant expression vector, recombinant microorganism or transgenic cell line of the fifth aspect.

In a seventh aspect of the invention, there is provided the use of the medicament of the sixth aspect for controlling brown planthopper.

In an eighth aspect of the present invention, there is provided a use of the drug of the sixth aspect for increasing the content of rice tricin.

In a ninth aspect of the invention, the invention provides application of transgenic rice containing the dsRNA of the third aspect and/or the coding gene of the fourth aspect in controlling brown planthopper.

In a tenth aspect of the invention, there is provided a transgenic rice plant comprising the dsRNA of the third aspect and/or the coding gene of the fourth aspect for use in increasing the content of tricin in rice.

In the eleventh aspect of the invention, the dsRNA of the third aspect is introduced into the brown planthopper.

Preferably, the mode of introduction is injection and/or feeding.

The invention has the beneficial effects that:

the invention discloses the application of the Nilaparvata lugens NLSP7 as a target spot in prevention and control of Nilaparvata lugens for the first time, and the feeding behavior and the feeding amount of the Nilaparvata lugens can be influenced by silencing NLSP7 gene, so that the Nilaparvata lugens generate a food refusing effect, and the purpose of prevention and control of the Nilaparvata lugens is achieved.

The invention discloses application of brown planthopper NLSP7 as a target spot in improving rice malt flavone content for the first time, and the content of malt flavone in rice (especially rice with the malt flavone content more than or equal to 24 ng/g) can be improved by silencing NLSP7 gene.

Drawings

FIG. 1 is a graph of the expression amount of a sialoprotein gene NLSP7 in different stages and tissues of brown planthopper: wherein A is an expression quantity diagram of brown planthopper NLSP7 of different ages (1L, 2L, 3L, 4L and 5L respectively represent 1 st, 2 nd, 3 rd, 4 th and 5 th nymph, 1D, 3D, 5D, 7D, 9D, 11D, 13D and 15D respectively represent 1, 3, 5, 7, 9, 11, 13 and 15 days after eclosion); b is a graph of the expression quantity of NLSP7 in different tissues of brown planthopper (Hd, Sg, Ov, Mg, Lg and Fb respectively represent head, salivary gland, ovary, midgut, foot and fat body).

Figure 2 is a graph of the expression of the sialoprotein gene NLSP7 in brown planthopper after microinjection of dsRNA, indicating p < 0.01.

Fig. 3 is a statistical graph of wave patterns of brown planthopper feeding behavior detection: wherein A is a wave pattern statistical chart of TN1 rice eaten by brown planthopper in different treatments; b is a wave pattern statistical chart of RH rice eaten by brown planthoppers subjected to different treatments; c is a wave pattern statistical chart of the artificial wheat flavone phagemid taken from the brown planthopper subjected to different treatments; d is a wave pattern statistical chart of the artificial bursa of the brown planthopper subjected to different treatments; different letters indicate significant differences (p < 0.05).

FIG. 4 is a graph of the measurement of the feeding hole of the brown planthopper feeding rice and the artificial feeding capsule in different treatments: wherein A is a plot of the number of feeding holes of RH and TN1 rice which are fed by brown planthopper treated differently; b is a feeding hole number graph of the brown planthopper which is treated differently and feeds different artificial feeding sacs; different letters indicate significant differences (p < 0.05).

FIG. 5 is a plot of honeydew levels and the resulting body weights of the differently treated Nilaparvata lugens after feeding on different rice plants: wherein A is a honeydew plot of the brown planthopper subjected to different treatments after eating different paddy rice; b is an acquired weight chart of the brown planthopper subjected to different treatments after eating different paddy rice; c is a weight chart obtained after the brown planthopper subjected to different treatments eats different artificial feeding sacs; different letters indicate significant differences (p < 0.05).

FIG. 6 is a graph of the effect of brown planthopper on the content of tricin in different rice plants: wherein A is an in vivo NLSP27 expression quantity chart of RH and TN1 population brown planthoppers after respectively eating TN1 rice variety and RH rice variety for 3 days; b is a wheat flavone content diagram of roots, stems and leaves of different rice (rice RH, rice TN 1); c is a content chart of the agriflavone of the overground parts of the rice after the brown planthopper which is treated by different treatments eats the rice TN 1; d is a content chart of the agrofolavone of the overground parts of the rice after the brown planthopper subjected to different treatments eats the RH of the rice; p <0.01, p < 0.05, different letters indicate significant differences (p < 0.05).

Detailed Description

The present invention will be described in further detail with reference to the following specific embodiments and accompanying drawings.

It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. The various chemicals used in the examples are commercially available.

The brown planthopper used in the following examples was raised at 27 + -0.5 ℃ at a plant protection institute of agricultural academy of sciences, Guangdong province, and grown on a rice variety Rathu Heenati (RH) having a high content of isoflavones (the content of isoflavones equals to 24ng/g fresh weight of rice) and a rice variety Taichung Native 1(TN1) having a low content of isoflavones (the content of isoflavones equals to 10.11ng/g fresh weight of rice), respectively.

Example 1 cloning of Nilaparvata lugens NLSP7 Gene

Taking 30 RH rice to feed brown planthopper for multiple generations, extracting total RNA, and extracting the total RNA of the female adult brown planthopper by adopting a Trizol method, wherein the specific operations are as follows:

1) the brown planthopper samples were individually placed in grinding tubes, snap frozen in liquid nitrogen, added 100 μ LTrizol reagent and immediately ground well on ice.

2) Adding 900 μ L Trizol reagent, blowing, cleaning residual brown planthopper tissue on grinding rod, mixing well, and standing at room temperature for 5 min.

3) Add 200. mu.L of Trichloromethane (chloroform), shake rapidly for 15s, and stand at room temperature for 20 min.

4) Centrifuge at 12,222g for 15min at 4 ℃.

5) The supernatant was aspirated, 500. mu.L of Dimethylcarbinol (isopropanol) was added thereto, rapidly shaken for 15 seconds, and allowed to stand at room temperature for 20 min.

6) Centrifuge at 12,222g for 15min at 4 ℃.

7) The supernatant was discarded and the precipitate was washed with 400. mu.L of 75% Ethanol (Ethanol).

8) Centrifuge at 7,555g for 5min at 4 ℃.

9) The supernatant was aspirated off, the precipitate was air-dried in a clean bench, and 40. mu.L of DEPC (diethylpyrocarbonate) was added to dissolve the precipitate with water.

10) RNA was snap frozen in liquid nitrogen for 5s and stored in a-80 ℃ freezer.

The concentration and purity of the extracted total RNA were measured at a wavelength of 280nm using a NanoDrop spectrophotometer.

mu.L of total RNA samples were used for detection by 1% agarose gel electrophoresis at 160V 500mA for 30 min. And (3) analyzing an electrophoresis result: two bands (28s and 18s) can be clearly observed on the electrophoresis gel, no diffusion phenomenon exists, and no band larger than 28s exists, so that the electrophoresis gel can be used for subsequent experiments.

The RNA was inverted to the full cDNA sequence, and the Total RNA extracted in the previous step was reverse transcribed to cDNA according to the procedure of the Takara PrimeScript RT reagent Kit with gDNA Eraser (cDNA RT reagent Kit http:// www.takara.com.cn) first strand cDNA Synthesis Kit instructions. The specific operation steps are as follows:

1) removal of genomic DNA from RNA: sequentially adding the corresponding volume of components (shown in Table 1) into 0.2ml of an RNase-free EP tube (ice operation), mixing uniformly, and placing on a dry thermostat at 42 ℃ for reaction for 2 min;

TABLE 1 genomic DNA removal System

2) Reverse transcription reaction (first strand cDNA synthesis): the components and volumes shown in table 2 were added to the above reaction solution in this order (on ice operation);

TABLE 2 first Strand cDNA Synthesis addition System

3) And (3) uniformly mixing the systems, and placing the mixture in a PCR instrument for the next reaction. The program of the PCR machine was set to: at 37 ℃ for 20 min; 85 ℃ for 5 s. After the PCR reaction was completed, the reaction solution (cDNA template) was stored in a refrigerator at-20 ℃.

Obtaining the 5 'end and 3' end sequences of NLSP7 gene by race technology, determining the transcription start site and termination site of NLSP7 gene, and splicing the full-length cDNA sequence of NLSP7 gene. Primers NLSP7-F1(ATGAGGGCTGCCCTGATT, SEQ ID NO.1) and NLSP 27-R1 (TAGACAACCTGTGGTCCA, SEQ ID NO.2) are designed according to the full-length cDNA sequence of the NLSP7 gene obtained by splicing, and the complete sequence of the NLSP7 gene (the sequence of the NLSP7 gene is ATGAGGGCTGCCCTGATTCTTCTCATCGTAT CTGCCATCATTATTGATTCGGCCATGGCAGGCCCCAAATCGAAGAAAGGCAAGAGCAAG AGGCGATCAAGGGAGAGAATCGTGTATGCACAGCCTCCTCCAACCCCAGTCATCATCCA AGGTGCTGCTCCATACAACTATGACAACAGAGGCTACTATGACAACAGGCCTTACCCTG GAGATGGTCGCGGATATTATGACGCCAACGGTGTCTGGATCAATGGAGGCTACAATGGA CCTTACCCCAATAATGGTCCAGTGGTTGTCTACCCCAATAATGGTCCTTATGTGCAGCCTA CCTATGGACCACAGGTTGTCTACTAGA, SEQ ID NO.3) is obtained by amplification by taking the cDNA sequence obtained by inversion as a template.

Example 2 NLSP7 Gene of different tissues and different ages in Nilaparvata lugens

The brown planthopper short-wing female imagoes subcultured on the rice variety RH are dissected under a body type microscope by using tweezers and an insect needle in a clean environment for 6 different tissues (including fat bodies, heads, feet, midgut, ovaries and salivary glands), and each treatment is repeated for 3 times. Total RNA of each tissue was extracted, and after reverse transcription into first-strand cDNA (the method was the same as in example 1), the total RNA was detected by the fluorescent quantitative PCR technique using a quantitative reagent from Roche, and the composition of the fluorescent quantitative PCR reaction solution is shown in Table 3.

TABLE 3 Components of fluorescent quantitative PCR reaction solution

The reaction solution was dispensed into 3 wells of 384-well plates, and about 10. mu.L of each well was dispensed.

PCR reaction procedure: setting the temperature at 94 ℃ for 5min in a pre-denaturation stage; ② the reaction stage is set to 95 ℃ for 5s and 60 ℃ for 20s, and 35 cycles are operated; and setting the temperature at 4 ℃ for preservation in the finishing stage. The fluorescent quantitative PCR instrument used was ROCH LightCycler480TMreal-time System (Roch, USA). Quantitative data is analyzed and derived by software carried by a LightCycler480 instrument, and the derived data is a Ct value. The brown planthopper actin gene (GenBank: EU179848) is selected as an internal reference, and finally a dissolution curve is generated (65 ℃ to 95 ℃).

After the reaction was completed, the Ct value was introduced into an Excel sheet and 2 was used^-△△CtThe method is to compare with actin gene and calculate the relative expression of each gene. The results are shown in FIG. 1 as B: NLSP7 is expressed in the salivary gland of brown planthopper to the highest extent, and then head, and is expressed in fat body to a small extent, and is expressed in midgut, foot and ovary to a very low extent (almost none).

Total RNAs of different instars of brown planthoppers subcultured on rice variety RH (1-5 instars nymphs and short-wing female

brown planthoppers

1, 3, 5, 7, 9, 11, 13 and 15d after eclosion) were extracted respectively, and after reverse transcription to cDNA of the first strand (the specific method is the same as example 1), detection was performed by using a quantitative PCR technique using a quantitative reagent from roche (the specific method is the same as the measurement of NLSP7 gene expression levels in different tissues), and the results are shown in fig. 1 a: NLSP7 has extremely low (almost no) expression in 1-5-year-old nymphs, and has different degrees of expression in the adult stage: wherein the expression level of NLSP7 gene in the short-wing female brown planthopper at 7, 9 and 11d after eclosion is higher than that in other periods, the expression level is highest at 9d after eclosion, and then the expression level is gradually reduced.

Internal reference gene actin primer:

Actin-F:ATGAAACCGTCTACAACTCG(SEQ ID NO.8)；

Actin-R：GCATCCTGTCGGCAATAC(SEQ ID NO.9)；

the quantitative primer of NLSP7 is NLSP7-F3, NLSP 7-R3:

NLSP27-F3：AAGAAAGGCAAGAGCAAG(SEQ ID NO.12)；

NLSP27-R3：GTAGGCTGCACATAAGGA(SEQ ID NO.13)。

EXAMPLE 3 preparation of dsRNA

1) PCR was carried out using the entire cDNA sequence obtained by inversion in example 1 as a template and NLSP7-F2 and NLSP7-R2 as primers, and the PCR amplification system was as shown in Table 4, and the PCR reaction sequence was as follows: firstly, pre-denaturation is carried out for 5min at 95 ℃; ② 35 cycles are carried out under the conditions of 95 ℃ for 30s, 57 ℃ for 30s and 72 ℃ for 40 s; extension for 10min at 72 ℃; finally, the PCR amplification product 1 is obtained and stored in a refrigerator at 4 ℃.

TABLE 4 PCR reaction System

NLSP7-F2：ATGAGGGCTGCCCTGATT(SEQ ID NO.4)；

NLSP7-R2：TAGACAACCTGTGGTCCA(SEQ ID NO.5)；

The underlined region is the T7 RNA polymerase promoter sequence.

2) Carrying out PCR amplification by using a plasmid (GenBank: ACY56286) containing green fluorescent protein GFP as a template and GFP-F and GFP-R as primers to obtain a PCR amplification product 2, wherein a PCR reaction system is shown in Table 5, and a PCR reaction program comprises the following steps: firstly, pre-denaturation is carried out for 5min at 95 ℃; ② 35 cycles are carried out under the conditions of 95 ℃ for 30s, 57 ℃ for 30s and 72 ℃ for 40 s; extension for 10min at 72 ℃; finally, the PCR amplification product 2 is obtained and stored in a refrigerator at 4 ℃.

TABLE 5 PCR reaction System

GFP-F：AAGGGCGAGGAGCTGTTCACCG(SEQ ID NO.6)；

GFP-R：CAGCAGGACCATGTGATCGCGC(SEQ ID NO.7)。

3) The amplification products 1 and 2 were recovered separately, A was added, followed by pMD18-T (TAKARA) vector, and the positive clones were sequenced. The correct clone was obtained, the plasmid of this clone was used as a template, amplified with the same primers as described above, and the amplification product was purified and concentrated to a concentration of l ug/uL, which was a template for dsRNA synthesis (dsNLSP7, dsGFP).

4) Synthesis of dsRNA

a) Cross PCR

The cross PCR comprises A reaction and B reaction, wherein the system of the A reaction is shown in Table 6, the system of the B reaction is shown in Table 7, and the PCR reaction program comprises the following steps: setting the temperature at 94 ℃ for 5min in a pre-denaturation stage; ② the reaction stage is set to 94 ℃ for 30s, 57 ℃ for 30s and 72 ℃ for 1min, and 35 cycles are operated; ③ at the end stage, the temperature is 72 ℃, the extension time is 10min, and the product is preserved at 4 ℃. The amplification products were detected by electrophoresis on a 1% agarose gel (agarose gel) programmed at 150V 500mA for 30 min.

TABLE 6A reaction System

T7_NLSP7-F2：GGATCCTAATACGACTCACTATAGGTCGGCCATGGCAGGCCCCAA (SEQ ID NO.14)；

NLSP7-R2：TAGACAACCTGTGGTCCA(SEQ ID NO.5)；

T7_GFP-F：GGATCCTAATACGACTCACTATAGGAAGGGCGAGGAGCTGTTCACCG (SEQ ID NO.15)；

GFP-R: CAGCAGGACCATGTGATCGCGC (SEQ ID NO. 7); the underlined region is the T7 RNA polymerase promoter sequence.

TABLE 7B reaction System

NLSP7-F2：TCGGCCATGGCAGGCCCCAA(SEQ ID NO.4)；

T7_NLSP7-R2：GGATCCTAATACGACTCACTATAGGTAGACAACCTGTGGTCCA(SEQ ID NO.16)；

GFP-F：AAGGGCGAGGAGCTGTTCACCG(SEQ ID NO.6)；

T7_GFP-R：GGATCCTAATACGACTCACTATAGGCAGCAGGACCATGTGATCGCGC (SEQ ID NO.17)；

The underlined region is the T7 RNA polymerase promoter sequence.

b) Transcription of ssRNA

Preheating RiboMAX at 37 DEG C^TMExpressT 72 × buffer, and mixing by turning upside down; the system shown in Table 8 was added to each 0.2mL RNase-free centrifuge tube, gently mixed, and incubated in 37 ℃ constant temperature water bath for 4 h.

TABLE 8 ssRNA transcription System

c) Mixing the reverse transcription products of the reaction A and the reaction product of the reaction B respectively, putting the mixture into a constant-temperature water bath kettle at 70 ℃ for water bath for 10min, standing the mixture at room temperature for 20min, adding 2 mu of LRQ1 RNase-Free DNase and 2 mu of RNase A solution diluted by 200 times into the mixture, and carrying out water bath in the constant-temperature water bath kettle at 37 ℃ for 30 min.

5) And (5) purifying the dsRNA.

Adding 4.4 μ L3M sodium acetate (pH5.2) and 110 μ L95% ethanol, respectively, blowing, mixing, and standing on ice for 5 min. Centrifuge at 14,000rpm for 10min and discard the supernatant. The pellet was washed with 0.5mL of 70% glacial ethanol, centrifuged at 14,000rpm for 10min, and the supernatant was discarded. Drying in a clean bench for 15min, adding 50 μ L of EPC (diethylpyrocarbonate) water to dissolve the precipitate.

Detection by electrophoresis on a 1% agarose gel (agarose gel) was performed at 150V 500mA for 30 min. The concentration of dsRNA was determined spectrophotometrically at 280 nm. dsRNA (dsNLSP7 (nucleotide sequence of one strand is shown in SEQ ID NO. 10)) and dsGFP (nucleotide sequence of one strand is AAAGGAGAAGAACTTTTCACTGGAGTTGTTCCAATTCTTGTTGAATTAGATGGTGATGTT AATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAAC TTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCA CTACTTTCGCCTATGGTGTTCAATGCTTTTCAAGATACCCAGATCATATGAAACGGCATGA CTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGA TGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATA GAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTG GAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAAT CAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACC ATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTCTACCAGACAACCATTACC TGTCCACACAATCTGTCCTTTCGAAAGACCCCAACGAAAAGAGAGACCACATGGTCCTT CTT, SEQ ID NO.18) are adjusted to 5ug/uL and packed in 10uL tubes according to concentration, and the tubes are stored at-80 ℃.

EXAMPLE 4 microinjection and Effect detection of dsRNA

1. Preparing brown planthopper: 30 RH rice were subcultured and used for injection.

2. Plate preparation: 1.5g of agar powder is weighed, added to 100mL of water, boiled and poured into a glass plate until it solidifies for use.

3. And (3) injection: taking 10 heads of insects with similar growth vigor in a test tube, and introducing C0₂Anaesthesia for 20s, and C0 was added₂The insect is not required to blow, so that collision and damage caused by flying of the insects are avoided. The worms were then poured onto 1.5% agar powder plates with the abdomen facing up. The injections were performed using a Nanoliter 2010 microinjector according to the instructions, with dsRNA (dsNLSP7) injected at a position between the anterior and medial sternums and at a volume of 10uL (5 ug/uL).

4. After the brown planthopper was injected with dsRNA, sampling was performed from the first day after injection, three samples were taken every day for three days, and at the same time, brown planthopper was used as a control for which no injection was performed and the injection of the same amount (10uL) of dsGFP (treated with dsNLSP7) at a concentration of 5ug/uL, and the change in gene expression was confirmed by RT-PCR.

The specific operation is as follows: after sampling, RNA was extracted (see 2.1.2), and inverted using the PrimeScript RT reagent Kit of TAKARA with gDNA Eraser (cat. No. RR047A) as described in the specification to obtain an inverted product. The inverted cDNA was diluted 10-fold with 5uL, and real-time quantitative PCR was performed as follows. The PCR reaction was carried out on a CFX96touch TM Real-Time PCR Detection System (Bio-Rad) instrument following the reaction System DNase/RNase-Free ddH₂O 2.9uL，2× Supermix 4uL，Primers(5mM)0.6uL，cDNA template 0.5uL, reaction conditions: pre-denaturation at 95 ℃ for 2min, denaturation at 95 ℃ for 10s, annealing and extension at 55-65 ℃ for 30s, repeating the last two steps for 30 cycles, finally increasing the temperature at 65-95 ℃ by 0.5 ℃ in each step, and drawing a dissolution curve for 5s to determine the specificity of the amplified product. Each sample is subjected to 3 technical repetitions, quantitative data is analyzed and derived by software carried by a LightCycler480 instrument, and the derived data is a Ct value. The brown planthopper actin gene (GenBank: EU179848) is selected as an internal reference, and finally a dissolution curve is generated (65 ℃ to 95 ℃). After the reaction was completed, the Ct value was introduced into an Excel sheet and 2 was used^-△△CtThe method is to compare with actin gene and calculate the relative expression of each gene.

Internal reference gene actin primer:

Actin-F:ATGAAACCGTCTACAACTCG(SEQ ID NO.8)；

Actin-R：GCATCCTGTCGGCAATAC(SEQ ID NO.9)；

the quantitative primer of NLSP7 is NLSP7-F3, NLSP 7-R3:

NLSP27-F3：AAGAAAGGCAAGAGCAAG(SEQ ID NO.12)；

NLSP27-R3：GTAGGCTGCACATAAGGA(SEQ ID NO.13)。

the results are shown in FIG. 2: compared with a control group injected with dsGFP, an experimental group injected with dsNLSP7 in a microinjection way has the advantages that the relative expression quantity of NLSP7 gene in brown planthopper is obviously reduced from the first day of injection and is lower than 10%, and the difference is extremely obvious compared with the control (P is less than 0.01); the result shows that dsNLSP7 can cause RNAi effect of saliva gland secretion NLSP7 gene of brown planthopper in vivo by microinjection, and the gene expression amount is obviously reduced.

Example 5 detection of Nilaparvata lugens feeding behavior following microinjection of dsRNA

The piercing-sucking potential technology (EPG) is a method commonly used for evaluating the real-time feeding behavior of the brown planthopper at present, and the judgment standard of the piercing-sucking potential technology is mainly a wave pattern reflected when the brown planthopper feeds. Firstly, selecting the short-wing imagoes of brown planthoppers bred by RH rice subculture for eclosion one day, and respectively setting the following four treatments, dsNLSP 7: injection of NLSP7 dsRNA; dsGFP: injecting GFP dsRNA; control: without injection treatment, 50 beetles were treated each. After treatment, the rice was placed on RH rice and recovered for 3 days, and the surviving brown planthopper was subjected to subsequent experiments.

Brown planthopper feeding behavior experiment 1: the piercing-sucking potential technology (EPG) is a method commonly used for evaluating the real-time feeding behavior of the brown planthopper at present, and the judgment standard of the piercing-sucking potential technology is mainly a wave pattern reflected when the brown planthopper feeds. Brown planthoppers (one day large female short-winged adults) were fed only for 1 hour on filter paper before the EPG experiments were performed. CO for brown planthopper₂Anesthesia was 20s (Zhang et al 2015). EPG is divided into two electrodes, insect electrode and plant electrode, only select the big female short-wing adult of day that just exuviates from the insect rearing cage, then fix brown planthopper through Insect Negative Pressure Fixing Device (INPFD). Connecting one end of a gold wire of an EPG probe (3 cm in length and 12.5um in diameter) to an amplifier, and connecting the other end of the gold wire to a brown planthopper back plate through conductive silver adhesive; plant electrodes (10 cm long and 2 mm diameter) were then inserted into the RH or TN1 plant potting soil to create another part of the electrical circuit. Prior to the start of the experiment, the insect electrodes were starved for 30 minutes and placed on rice plants. All EPG experiments were recorded in one climate controlled room under continuous lighting for 6 hours. EPG data for six consecutive hours from the start of food intake were analyzed using EPG style + software (university of waggning agriculture, 2012). The artificial diet system was made of a transparent, open cylindrical plastic tube (3 cm diameter, 2 cm height) with a double layer sealing film (DLP) (PM-996; Bemis, Oshkosh, Wis., USA) covering one end of the container. The experimental treatment included two different concentrations of tricin-containing sucrose solutions (tricin concentrations in sucrose solution of 100mg/L and 0mg/L, respectively) as controls. One end of the copper wire is embedded into the solution, and the other end is wrapped on the electrode. Insect electrodes and experimental control conditions reference the electrical osmometry profile of the plants. The main wave patterns are arranged according to the feeding sequence of brown planthoppers, and comprise NP (non-piercing behavior) which is the first to start, PP (path wave, N1+ N2+ N3 which starts piercing, prepares to secrete saliva and moves a mouth needle and moves outside cells), N4-a (moves in rice phloem cells), N4-b (feeds in phloem sieve tubes) and N5 (feeds in xylem and mainly absorbs water). According to the wave pattern chart recorded by the oscillograph, the wave pattern duration of 5 feeding processes generated by each brown planthopper in 6h is calculated, and the result is shown in the graph3, showing:

in fig. 3, when three kinds of RH rice with higher flavone content are taken by the brown planthopper in the A, B different treated RH populations, NP wave is obviously increased, N4a and N4b waves are obviously reduced, which shows that after the interference of the NLSP7 gene of the brown planthopper, the wheat flavone has obvious food refusal effect on the brown planthopper, the probe-resistant time of the brown planthopper is not increased and is obviously higher than that of a control group, and compared with TN1 rice which is taken by the brown planthopper treated differently, the influence of the wheat flavone content on the food taking behavior of the brown planthopper is obvious. In FIG. 3, C shows that there is no difference in the treatment of Nilaparvata lugens when feeding on the tricin-free sucrose solution; in contrast, in fig. 3D, when the sucrose solution containing 100mg/L of tricin was taken, the spy wave (pp) was significantly increased, and the feeding wave (N4) was significantly decreased, which is probably due to a slight difference in the range of action of brown planthopper limited by artificial feeding sac compared to RH rice.

NP mode: the waveform shows that the silent time of the brown planthopper female imagoes which are not stabbed is increased, and when the brown planthopper female imagoes which are silenced NLSP7 (injected with dsNLSP7) eat different paddy rice RH and TN1, the total time of the oral needles which do not eat is obviously longer than that of a Control group and a Control group (CK, the same below) which are injected with dsGFP, which indicates that the brown planthopper female imagoes cannot stably eat on phloem.

A PP wave mode: the waveform represents the length of time spent by the brown planthopper females in probing for finding a suitable feeding site, and the total length of the oral needle probing of the brown planthopper females silent NLSP7 when they feed rice RH is significantly longer than that of the Control group injected with dsGFP and the Control group not injected with dsGFP. Similarly, when rice TN1 was eaten, the results were the same as when rice RH was eaten, indicating that the number of times of searching for phloem by puncturing epidermal cells and mesophyll cells of plants with a stylet was increased. The PP waveform indicates that NLSP7 can affect the probing behavior of brown planthopper.

N4-a wave form: the waveform indicates that brown planthopper secretes saliva during feeding on rice phloem. In this waveform, the brown planthopper females silent NLSP7 had a significantly shorter total intracellular activity duration than the dsGFP-injected Control group and the non-injected Control group when they took rice RH, while they had a longer intracellular activity duration than the dsGFP-injected Control group and the non-injected Control group when they took rice TN 1. The N4-a wave pattern indicates that NLSP7 can influence the salivary secretion behavior of brown planthopper.

N4-b wave form: the waveform indicates that brown planthopper normally feeds on rice phloem. The total length of normal feeding of the brown planthopper females silencing NLSP7 when feeding different rice RH and TN1 is obviously lower than that of the Control group injected with dsGFP and the Control group not injected with dsGFP. The N4-b wave pattern indicates that NLSP7 can affect the feeding behavior of the phloem of brown planthopper.

N5 wave form: the waveform indicates the time when the brown planthopper eats at the xylem of rice, mainly eating water. The total time of the N5 waveform was significantly longer than that of the dsGFP-injected Control group and the non-injected Control group when the nilaparvata lugens female silenced NLSP7 in the waveform eaten rice TN 1. On rice RH, however, there were essentially no changes in the three experimental groups. The NLSP7 can influence the feeding behavior of the brown planthopper on xylem, the appearance of different rice is different, the brown planthopper is related to different wheat flavone contents, and the brown planthopper eating RH rice is in an unpierced state most of the time.

Brown planthopper feeding behavior experiment 2: to further verify the influence of the silent NLSP7 gene spliceosome on the feeding of the brown planthopper, the number of the feeding traces at the fixed position in 1d of the brown planthopper is counted. Firstly, selecting the short-wing imagoes of brown planthoppers bred by RH rice subculture for eclosion one day, and respectively setting the following four treatments, dsNLSP 7: injection of dsNLSP 7; dsGFP: injection of dsGFP; control: without injection treatment, 50 beetles were treated each. After treatment, the rice was placed on RH rice and recovered for 3 days, and the surviving brown planthopper was subjected to subsequent experiments.

Laying the surviving female short-wing adults of the rice on single plants of RH, TN1 rice and artificial bursa (0mg/L, 50mg/L and 100mg/L), removing brown planthopper after 24h, shearing off the overground part of the rice with scissors, soaking for 12h with eosin Y, taking out after 12h, placing under a stereoscope to observe a food taking mark, and directly observing a food taking hole of the artificial bursa under the stereoscope, and counting data, wherein the result is shown in figure 4: in the graph of fig. 4, the feeding holes of RH rice fed by brown planthoppers injected with dsNLSP7 at A are significantly higher than the number of the feeding holes of the brown planthoppers in the dsGFP group and the Control group, while the feeding holes of the three brown planthoppers treated at TN1 are not different; in the figure 4, the group B dsNLSP7 is obviously different from the group dsGFP and the group Control when eating the artificial bursa containing 50mg/L of the wheat flavone and the artificial bursa containing 100mg/L of the wheat flavone, the eating hole has the trend of rising along with the rising of the concentration of the wheat flavone, and the eating hole has no difference with the artificial bursa without the wheat flavone, which shows that the concentration of the wheat flavone is in a highly positive correlation and interaction relationship with the NLSP7 gene.

Example 6 Nilaparvata lugens feed intake following microinjection of dsRNA

For piercing-sucking insects such as brown planthopper, the feeding amount is closely related to the injurious ability, and the amount of honeydew secretion is usually used for measuring the injurious ability. Firstly, selecting the short-wing imagoes of brown planthoppers bred by RH rice subculture for eclosion one day, and respectively setting the following four treatments, namely dsNlSP 27: injection of dsNlSP 27; dsGFP: injection of dsGFP; control: without injection treatment, 50 beetles were treated each. After treatment, the rice was placed on RH rice and recovered for 3 days, and the surviving brown planthopper was subjected to subsequent experiments.

Selecting and respectively connecting the surviving RH population brown planthoppers to a Parafilm folded small bag which is bound at the positions of TN1 and RH rice stalks and weighed by a ten-thousandth balance in advance, taking the rice for 24 hours, taking the small bag off the rice, removing the brown planthoppers in the small bag, weighing again, and weighing the difference value of two times to obtain the honeydew secretion amount of the brown planthoppers. And after the brown planthopper recovers for 72 hours, weighing the weight by using a ten-thousandth balance, connecting the weight to single-plant rice TN1, rice RH and artificial bursa (0mg/l of wheat flavone/100 mg/l of wheat flavone), weighing again after 24 hours, and obtaining the difference value, namely the acquired weight. The amount of honeydew on rice is shown in fig. 5, a: the honeydew on RH and TN1 rice in the dsNLSP27 experimental group was significantly lower than that of the Control and dsGFP groups on RH and TN1 rice, and the acquired body weights are shown in B, C in fig. 5: the dsNLSP27 experimental group can not normally take food on RH rice and TN1 rice, and the food taking amount of the dsNLSP27 experimental group is obviously lower than that of the Control group and the dsGFP group on RH rice and TN1 rice; the body weight of RH population at 3 days after dsNLSP27 injection is reduced compared with that of dsGFP of a control group, the difference of the wheat flavone artificial bursa is obvious, but the difference of the wheat flavone-free artificial bursa is not obvious, which shows that after the brown planthopper NLSP27 is silenced, the food intake of the brown planthopper is obviously influenced by the wheat flavone.

Example 7 Effect of Nilaparvata lugens NLSP7 Gene on Rice Secondary metabolite, tricin

Two kinds of female adults with different resistant populations, namely brown planthopper TNl and Rathu Heenati, are extracted, total RNA of the whole insects is taken 3 days after the female adults eat TN1 rice and RH rice respectively, the total RNA is subjected to reverse transcription to form cDNA, and then quantitative PCR detection is carried out (the specific method is the same as the embodiment 2), and the result is shown as A in the figure 6: the expression level of NLSP7 of the TN1 rice fed by the RH population brown planthopper is obviously reduced, while the expression level of NLSP7 of the TN1 population brown planthopper fed by the RH rice is obviously increased, which indicates that NLSP7 may play a role in feeding and virulence of the brown planthopper. The sample is sent to the gene center of Guangdong province academy of agricultural sciences, the content of the tricin at different parts in rice RH and rice TN1 is respectively detected (as shown in B in figure 6), and the eclosion 1d of the adult brachyptera is respectively treated by the following three treatments, and each treatment is repeated for 3 times. dsNLSP 27: injection of dsNLSP 27; dsGFP: injection of dsGFP; control: no injection treatment was performed. Cylindrical glass covers are respectively fixed at the base parts of rice stems of rice RH and TN1, after 30 short-wing adults injected with dsRNA 3d are respectively inserted into the glass covers, feeding hazards are taken for 72h, then all brown planthoppers are removed, and the content of the tricin on-ground parts of the rice RH and TN1 rice is detected, and the result is shown as C, D in figure 6: the rice RH that the brown planthopper treated by the dsNLSP27 eats is obviously increased in the content of the wheat flavone, while the rice TN1 that the brown planthopper treated by the dsNLSP27 eats is not obviously different from the rice TN1 of a control group and a GFP group, because the wheat flavone content in the rice TN1 is far lower than that of the rice RH, the normal brown planthopper does not mobilize NLSP27 gene to regulate the wheat flavone in the TN1 rice when eating the TN1 rice.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> institute for plant protection of academy of agricultural sciences of Guangdong province

Application of <120> brown planthopper NLSP7 as target spot in prevention and treatment of brown planthopper

<130>

<160> 18

<170> PatentIn version 3.5

<210> 1

<211> 18

<212> DNA

<213> Artificial sequence

<400> 1

atgagggctg ccctgatt 18

<210> 2

<211> 18

<212> DNA

<213> Artificial sequence

<400> 2

tagacaacct gtggtcca 18

<210> 3

<211> 355

<212> DNA

<213> Nilaparvata lugens (Stal)

<400> 3

atgagggctg ccctgattct tctcatcgta tctgccatca ttattgattc ggccatggca 60

ggccccaaat cgaagaaagg caagagcaag aggcgatcaa gggagagaat cgtgtatgca 120

cagcctcctc caaccccagt catcatccaa ggtgctgctc catacaacta tgacaacaga 180

ggctactatg acaacaggcc ttaccctgga gatggtcgcg gatattatga cgccaacggt 240

gtctggatca atggaggcta caatggacct taccccaata atggtccagt ggttgtctac 300

cccaataatg gtccttatgt gcagcctacc tatggaccac aggttgtcta ctaga 355

<210> 4

<211> 18

<212> DNA

<213> Artificial sequence

<400> 4

atgagggctg ccctgatt 18

<210> 5

<211> 18

<212> DNA

<213> Artificial sequence

<400> 5

tagacaacct gtggtcca 18

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence

<400> 6

aagggcgagg agctgttcac cg 22

<210> 7

<211> 22

<212> DNA

<213> Artificial sequence

<400> 7

cagcaggacc atgtgatcgc gc 22

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence

<400> 8

atgaaaccgt ctacaactcg 20

<210> 9

<211> 18

<212> DNA

<213> Artificial sequence

<400> 9

gcatcctgtc ggcaatac 18

<210> 10

<211> 276

<212> DNA

<213> Artificial sequence

<400> 10

aggcaagagc aagaggcgat caagggagag aatcgtgtat gcacagcctc ctccaacccc 60

agtcatcatc caaggtgctg ctccatacaa ctatgacaac agaggctact atgacaacag 120

gccttaccct ggagatggtc gcggatatta tgacgccaac ggtgtctgga tcaatggagg 180

ctacaatgga ccttacccca ataatggtcc agtggttgtc taccccaata atggtcctta 240

tgtgcagcct acctatggac cacaggttgt ctacta 276

<210> 11

<211> 271

<212> DNA

<213> Artificial sequence

<400> 11

cggctataac ttctgcatct gcctcatcca gtgttttaat ggatgtacca caggaagtct 60

atatctatat gggctgctcc atacaactat gactacagag gtactatgac aacagtcctt 120

accctggaga tggtcgcgga tattatgacg ccaacggtgt ctggatcaat ggaggctaca 180

atggacctta ccccaataat ggtccagtgg ttgtctaccc caataatggt ccttatgtgc 240

agcctaccta tggaccacag gttgtctaaa t 271

<210> 12

<211> 18

<212> DNA

<213> Artificial sequence

<400> 12

aagaaaggca agagcaag 18

<210> 13

<211> 18

<212> DNA

<213> Artificial sequence

<400> 13

gtaggctgca cataagga 18

<210> 14

<211> 45

<212> DNA

<213> Artificial sequence

<400> 14

ggatcctaat acgactcact ataggtcggc catggcaggc cccaa 45

<210> 15

<211> 47

<212> DNA

<213> Artificial sequence

<400> 15

ggatcctaat acgactcact ataggaaggg cgaggagctg ttcaccg 47

<210> 16

<211> 43

<212> DNA

<213> Artificial sequence

<400> 16

ggatcctaat acgactcact ataggtagac aacctgtggt cca 43

<210> 17

<211> 47

<212> DNA

<213> Artificial sequence

<400> 17

ggatcctaat acgactcact ataggcagca ggaccatgtg atcgcgc 47

<210> 18

<211> 657

<212> DNA

<213> Artificial sequence

<400> 18

aaaggagaag aacttttcac tggagttgtt ccaattcttg ttgaattaga tggtgatgtt 60

aatgggcaca aattttctgt cagtggagag ggtgaaggtg atgcaacata cggaaaactt 120

acccttaaat ttatttgcac tactggaaaa ctacctgttc catggccaac acttgtcact 180

actttcgcct atggtgttca atgcttttca agatacccag atcatatgaa acggcatgac 240

tttttcaaga gtgccatgcc cgaaggttat gtacaggaaa gaactatatt tttcaaagat 300

gacgggaact acaagacacg tgctgaagtc aagtttgaag gtgataccct tgttaataga 360

atcgagttaa aaggtattga ttttaaagaa gatggaaaca ttcttggaca caaattggaa 420

tacaactata actcacacaa tgtatacatc atggcagaca aacaaaagaa tggaatcaaa 480

gttaacttca aaattagaca caacattgaa gatggaagcg ttcaactagc agaccattat 540

caacaaaata ctccaattgg cgatggccct gtccttctac cagacaacca ttacctgtcc 600

acacaatctg tcctttcgaa agaccccaac gaaaagagag accacatggt ccttctt 657

Claims

1. The application of the brown planthopper NLSP7 as a target spot in preventing and treating the brown planthopper and/or improving the content of rice wheat flavone is characterized in that: the nucleotide sequence of the NLSP7 is shown as SEQ ID NO. 3.

2. A dsRNA, wherein: the nucleotide sequence of one strand of the dsRNA has at least 80 percent of homology with the nucleotide sequence shown in SEQ ID NO. 10.

3. A gene encoding the dsRNA of claim 2.

4. A recombinant expression vector, a recombinant microorganism or a transgenic cell line comprising the dsRNA of claim 2 and/or the encoding gene of claim 3.

5. A drug characterized by comprising the active ingredients of any one of (1) to (3):

(1) the dsRNA of claim 2;

(2) the coding gene of claim 3;

(3) the recombinant expression vector, recombinant microorganism, or transgenic cell line of claim 4.

6. The use of the medicament according to claim 5 for controlling brown planthopper and/or increasing the content of rice tricin.

7. Use of a transgenic rice comprising the dsRNA of claim 2 and/or the coding gene of claim 3 for controlling brown planthopper.

8. Use of a transgenic rice comprising the dsRNA of claim 2 and/or the coding gene of claim 3 for increasing the amount of rice tricin.

9. A method for controlling brown planthopper is characterized by comprising the following steps: introducing the dsRNA of claim 2 into Nilaparvata lugens.

10. A method for improving the content of rice wheat flavone is characterized in that: introducing the dsRNA of claim 2 into Nilaparvata lugens.