CN104313031B - Freshwater shrimp molt-inhibiting hormone gene and its application in accelerating freshwater shrimp to cast off a skin and grow - Google Patents
Freshwater shrimp molt-inhibiting hormone gene and its application in accelerating freshwater shrimp to cast off a skin and grow Download PDFInfo
- Publication number
- CN104313031B CN104313031B CN201410560745.3A CN201410560745A CN104313031B CN 104313031 B CN104313031 B CN 104313031B CN 201410560745 A CN201410560745 A CN 201410560745A CN 104313031 B CN104313031 B CN 104313031B
- Authority
- CN
- China
- Prior art keywords
- freshwater shrimp
- seq
- shrimp
- dsrna
- molt
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Saccharide Compounds (AREA)
Abstract
A kind of application the invention discloses freshwater shrimp molt-inhibiting hormone gene and its in accelerating freshwater shrimp to cast off a skin and grow, freshwater shrimp molt-inhibiting hormone gene, its nucleotide sequence such as SEQ ID NO:Shown in 1.Using RNA perturbation techniques, primer is disturbed according to the ORFs designated rna of freshwater shrimp molt-inhibiting hormone gene sequence, performing PCR amplification is then entered by template of the total cDNA of freshwater shrimp, sequence such as SEQ ID NO are obtained:Shown in 4, with SEQ ID NO:4 carry out in-vitro transcription synthesis dsRNA, and dsRNA is expelled to after the cardiocoelom of freshwater shrimp, accelerates freshwater shrimp to cast off a skin and grow.Damage using RNAi method to freshwater shrimp is small, does not influence it normally to search for food, perch and mate, and is convenient for long-term research, and action effect is notable.The present invention grows for regulation and control freshwater shrimp, cultivates freshwater shrimp improved seeds and provides new thinking and effective means.
Description
Technical field
The present invention relates to biotechnology and developmental regulation field, and in particular to a kind of freshwater shrimp molt-inhibiting hormone gene and its
Application in accelerating freshwater shrimp to cast off a skin and grow.
Background technology
Freshwater shrimp, scientific name Macrobrachium nipponensis (Macrobrachium nipponense), river prawn is commonly called as, is subordinate to Decapoda
（Decapoda）, Palaemonidae（Palaemonidae）, pond crayfish category（Macrobrachium）, it is distributed widely in China's various regions water
Domain, growth is fast, strong adaptability, fanning economics are high, is the important freshwater aquiculture shrimps of China.According to 2012《China Fisheries
Yearbook》Record, whole nation cultivation freshwater shrimp annual production is more than 23.7 ten thousand tons, and annual value of production is more than 15,000,000,000 yuan, and shrimp culture is in China's water
Very important effect has been played in production cultivation.In recent years, with large-scale cultivation continuous expansion and consumption demand it is continuous
Improve, cultivate the key that the more excellent new varieties of character are current freshwater shrimp genetic breedings.
Molt inhibition hormone（Molt-inhibting hormone, MIH）, it is the first of synthesis secretion in crustacean optic stalk
Shell animal hyperglycemic hormone（Crustacean hyperglycemic hormone, CHH）A kind of important neuropeptide in family,
Casted off a skin with regulation and control crustacean, the effect of development activity.Multinomial research discovery in crustacean, molt inhibition hormone energy
Enough suppress the generation casted off a skin of crustacean, be a kind of important hormone in crustacean reproduction and developmental regulation.
RNAi（RNA interference, RNAi）Technology is a kind of gene silent technology induced by double-stranded RNA.
Cell interior energy specifically induces the degraded of the mRNA of homologous complementary therewith, closes the expression of corresponding gene.RNAi is considered as
It is one of most efficient method in gene functional research, it has also become research of the function of crustacean important gene etc. is much led
Important tool in domain.But at present, the application in freshwater shrimp important gene research not yet has been reported that.
The content of the invention
Cast off a skin and grow it is an object of the invention to provide a kind of freshwater shrimp molt-inhibiting hormone gene and its in acceleration freshwater shrimp
In application.The dsRNA of the freshwater shrimp molt-inhibiting hormone gene design synthesis provided using the present invention, can effectively accelerate green grass or young crops
The generation that shrimp casts off a skin is provided newly so as to accelerate the growth and development of freshwater shrimp to cultivate the freshwater shrimp improved seeds that development is fast, grown
Thinking and effective means.
Freshwater shrimp molt-inhibiting hormone gene, its nucleotide sequence such as SEQ ID NO:Shown in 1.
Application of the freshwater shrimp molt-inhibiting hormone gene in accelerating freshwater shrimp to cast off a skin and grow.
Described application, is to utilize RNA perturbation techniques, according to the ORFs of freshwater shrimp molt-inhibiting hormone gene sequence
Designated rna disturbs primer, and performing PCR amplification is then entered by template of the total cDNA of freshwater shrimp, sequence such as SEQ ID NO are obtained:Shown in 4,
With SEQ ID NO:4 carry out in-vitro transcriptions synthesis dsRNA, dsRNA is expelled to after the cardiocoelom of freshwater shrimp, accelerate freshwater shrimp cast off a skin and
Growth.
The RNA disturbs the sense primer nucleotide sequence such as SEQ ID NO of primer:Shown in 2, anti-sense primer nucleotides
Sequence such as SEQ ID NO:Shown in 3.
DsRNA is to use sense primer SEQ ID NO:2 and anti-sense primer SEQ ID NO:3 expand obtained PCR by PCR
Product SEQ ID NO:After 4 is purified, carry out what in-vitro transcription synthesis was obtained.
The injection dosage that dsRNA is expelled to the cardiocoelom of freshwater shrimp injects 2 ~ 6 μ g dsRNA for every gram of body weight, is preferably every
Gram body weight injects 4 μ g dsRNA.
That applies comprises the following steps that：
First according to freshwater shrimp molt-inhibiting hormone gene（MIH genes）Sequence SEQ ID NO:1, in its open reading inframe
Designated rna disturbs primer, and the addition T7 promoter sequences before above-mentioned primer（TAATACGACTCACTATAGGG）, determine upstream
Primer SEQ ID NO:2 and anti-sense primer SEQ ID NO:3, sequence is respectively：TAATACGACTCACTATAGGGGTAAACCTGACAGCGCAAGG
、TAATACGACTCACTATAGGGCCATCTGTTGAGCTGTTCCA（Underscore is T7 promoter sequences）.
With the above-mentioned sense primer SEQ ID NO containing T7 promoters:2 and anti-sense primer SEQ ID NO:3 are expanded by PCR
Increasing obtains PCR primer（Sequence such as SEQ ID NO:Shown in 4）, it is purified after according to Transcript AidTM T7 High
Yield Transcription kit (Fermentas, Inc., USA) kit explanation carries out in-vitro transcription synthesis
DsRNA, its nucleotide sequence such as SEQ ID NO:Shown in 5.
DsRNA is casted off a skin developmental application in freshwater shrimp：Inject female and male shrimp green grass or young crops that above-mentioned dsRNA develops to the same period respectively
Continuous Observation and data statistics were carried out after the cardiocoelom of shrimp in six weeks.As a result show：DsRNA can be with specific silence MIH
Gene mRNA expression, and can significantly accelerate the generation that male and female freshwater shrimp casts off a skin and the increase of male shrimp body weight.
Beneficial effect：Shedding be determine freshwater shrimp growth and reproduction key factor, currently used for accelerate freshwater shrimp cast off a skin and
The main method grown is realized by eyestalk ablation.However, the mechanical damage that eyestalk ablation is caused to freshwater shrimp is very big,
Especially juvenile prawn, often results in high mortality.Damage using RNAi method to freshwater shrimp is small, do not influence it normally to search for food,
Perch and mate, be convenient for long-term research, and action effect is notable.
Brief description of the drawings
After Fig. 1 adults freshwater shrimp injection dsRNA, mrna expression amount of the MIH genes in the different sampled point times in optic stalk is blue or green
Shrimp β-Actin genes are used as reference gene.2,4,6,8,10,12 be respectively inject after 2 days, 4 days, 6 days, 8 days, 10 days and
12 days (N=3).**P < 0.01.Control group injects the DEPC water of same dose.
Freshwater shrimp casts off a skin the audio-visual picture of the change of the frequency (a) and body weight (b) during Fig. 2 continuitys RNAi.Wherein：Group 1, group
2, group 3, the respectively male dried shrimps of group 4 disturbs group, male shrimp control group, female dried shrimps and disturbs group, female shrimp control group control group injection same dose
DEPC water.
Embodiment
Embodiment 1：Freshwater shrimp MIH full length genes cDNA acquisition
Total RNAs extraction:Ripe freshwater shrimp two is chosen, sterile dissecting scissors Eyestalk tissue preserves liquid (TaKaRa in RNA
Bio Inc. Japan) in enter to be about to optic stalk pigment part clip broken, rinse pretreatment after carry out freshwater shrimp optic stalk Total RNAs extraction, tool
Body operating procedure is with reference to Takara Trizol kits.
First chain cDNA is synthesized：With above-mentioned total serum IgE, with reference to being obtained after Takara M-MLV reverse transcription reagent box reverse transcriptions
First chain cDNA.
Freshwater shrimp MIH full length genes cDNA acquisition:
Foundation Macrobrachium rosenbergii (Macrobrachium rosenbergii, KC990939.1) MIH cDNA conserved region
Domain, designs primer in the middle of two pairs, sees SEQ ID NO:6 ~ 9,
（ middle F1：5′-CCGGCATTCCTTTGTTTACCTG-3,middle R1：5′-
ATATTCTGGCGTGTGGTCCTG-3′;
middleF2:5′-CCTGAGTGTCTGTCCAGTTTGA-3′, middle R2:5′-
TGGTCCTGGAGCTTATTTTAGAGG-3′）, by template of above-mentioned first chain cDNA, the clone of progress intermediate segment, enters performing PCR
Amplification reaction system is as follows：
| RT liquid | 2 μL |
| 10×PCR Buffer | 2.5 μL |
| MgCl2(25mM) | 2 μL |
| dNTP Mixture(25mM each) | 0.2 μL |
| Forward Primer(10μM) | 1 μL |
| Reverse Primer(10μM) | 1 μL |
| Taq DNA Polymerse(5U/μL) | 0.2 μL |
| dH2O | up to 25 μL |
PCR response procedures are：94 DEG C of pre-degeneration 3min, subsequently into following circulation：94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C
30s, 30 circulations, last 72 DEG C of extensions 10min, 4 DEG C of preservations.1.2% agarose gel electrophoresis is detected.
Purpose piece is carried out using the pillar DNA glue reclaims kit of Shanghai Sheng Gong bioengineering Co., Ltd (Sangon)
The recovery of section, pMD18-T carriers are connected to by product（Takara）, and bacillus coli DH 5 alpha is transformed into, blue hickie screening is carried out,
After picking monoclonal hickie amplification cultivation, the positive colony for inserting purpose fragment is delivered into Shanghai Bo Shang biotech firms and is sequenced
Analysis, obtains the intermediate segment of freshwater shrimp MIH gene cDNAs.
According to the intermediate segment sequence of obtained freshwater shrimp MIH gene cDNAs, the end of RACE technologies amplification 3 ', 5 ' ends, behaviour are utilized
Make step by the-RACE of TaKaRa 3 ' and TaKaRa5 ' progress of-RACE kit specifications.PCR primer through gel extraction, purifying,
Clone, sequencing, obtain freshwater shrimp MIH genes complete after then being spliced with the intermediate segment of acquired freshwater shrimp MIH gene cDNAs
Long cDNA sequence, such as SEQ ID NO:Shown in 1.
Embodiment 2：The dsRNA of freshwater shrimp MIH genes acquisition
According to the freshwater shrimp MIH genes for having cloned acquisition（Accession number： KF878973）, it is online using NCBI
Sequence analysis software（http://www.ncbi.nlm.nih.gov/gorf/gorf.html）Determine the open reading of MIH genes
Frame position is 436-795bp.According to the above results, using online dsRNA primer-design softwares（http:// www.flyrnai.org/cgi-bin/RNAi_find_primers.pl）, dsRNA is designed in freshwater shrimp MIH open readings inframe
Primer, and-the TAATACGACTCACTATAGGG-3 ' of T7 promoter sequences 5 ' is added before every primer, constitute dsRNA synthesis
Primer, its primer sequence is respectively sense primer SEQ ID NO:2 and anti-sense primer SEQ ID NO:3.All primers are in platinum
Still biotechnology（Shanghai）Co., Ltd synthesizes.
Using above-mentioned freshwater shrimp dsRNA primers in the enterprising performing PCR amplifications of the total cDNA of freshwater shrimp（Condition be the same as Example 1）, obtain SEQ
ID NO:4, by raw work bioengineering（Shanghai）The SanPrep pillar PCR primer Purification Kits of limited company
Afterwards, according to TranscriptAidTM T7 High Yield Transcription kit (Fermentas, Inc., USA)
Kit explanation carries out in-vitro transcription synthesis dsRNA, sequence such as SEQ ID NO:Shown in 5.DsRNA concentration is used
BioPhotometer (Eppendorf, Hamburg, Germany) is measured in 260 nm, and adjusts final concentration of 4 μ
g/μl。
Embodiment 3：The dsRNA of injection freshwater shrimp MIH genes is casted off a skin the influence of development to freshwater shrimp
1. the experiment selection of shrimp
To study the silencing efficiency of dsMIH genes, this research carries out disposable RNAi first, and to test vigor of selecting stronger, individual
Body is uniform, and body weight is divided into two groups in 1.50 ± 0.35g or so the female shrimp of adult 50, and one group is injection dsRNA groups, separately
One group is injection DEPC water groups（Control group）.Temporarily foster 72 h are inflated in the 500L white bucket of vinyon before experiment, make it
Laboratory culture environment is adapted to, 1 spiral shell is respectively fed sooner or later daily.
The result design continuity RNAi experiments tested according to disposable RNAi, continuity RNAi experiments shrimp used is by this
The juvenile prawn of the same batch membrane of laboratory hatching, male and female are distinguished under Stereo microscope, select body weight left in 0.60 ± 0.25g
Each 30 right of female, male shrimp, is divided into four groups (n=15)：Male dried shrimps disturbs group and female dried shrimps disturbs a group injection dsRNA；Two control groups
Inject the DEPC water of equivalent.11 ~ December is carried out in the winter time for experiment, and experiment the last fortnight progressively rises to water temperature 25 DEG C, fits it
Should temperature, daily sooner or later respectively feed 1 spiral shell.
2. the dsRNA of freshwater shrimp MIH genes injection and detection
4 μ g dsRNA dosage is injected according to every gram of body weight, is drawn and attenuated using internal diameter as 1.2mm capillary tip and is used as injection
Pin, dsRNA solution is injected in cardiocoelom from freshwater shrimp carapace base portion, control group injection DEPC water.Disposable RNAi experiments
Sampling was respectively at the 2nd day, the 4th day, the 6th day, the 8th day, the 10th day and the 12nd day after injection, and each sampled point designs 3 biologies
Repeat, collection optic stalk be organized in RNA preserve liquid in pre-processed after for RNA extraction.Continuity RNAi is every 7 days to each
Group shrimp carries out same substance, a same dose after-teeming, and whole process continues 6 time-of-weeks.Daily in each group in experimentation
The shrimp that casts off a skin is counted, and body weight respectively to each group shrimp is measured and recorded before experiment and at the end of experiment, as a result see Fig. 1 and
Table 1.
Table 1., which is in continuous six weeks of female, the male freshwater shrimp of same developmental stage, to be injected the freshwater shrimp counted after dsRNA and casts off a skin the frequency
With the change of body weight.
| Group variable | Male dried shrimps disturbs group | Male shrimp control group | Female dried shrimps disturbs group | Female shrimp control group |
| The frequency of casting off a skin (number of times) | 17 | 2 | 12 | 5 |
| Body weight evolution (g) | 0.26 | 0.06 | 0.08 | 0.04 |
3. the detection of freshwater shrimp MIH gene silencing efficiency
Extract the total serum IgE of each sample and be inverted to cDNA, detect MIH genes relative to internal reference using Real Time PCR
Gene（Freshwater shrimp β-Actin）Expression quantity, to calculate the efficiency of MIH gene silencings.
4. freshwater shrimp MIH genes dsRNA freshwater shrimp is casted off a skin and body weight influence
The shrimp that casted off a skin in each group is counted daily in experimentation, experiment before and experiment at the end of respectively to each group shrimp
Body weight is measured, and is recorded and is carried out statistical analysis.
5. interpretation of result
As shown in figure 1, relative to control group, the 2nd day after injection, the expression quantity of freshwater shrimp MIH genes has been remarkably decreased 61%,
93% was have dropped at the 6th day, 91% was have dropped at the 8th day.67% and 62% were have dropped respectively at the 10th day and the 12nd day.
As shown in table 1 and Fig. 2, during Line Continuity RNAi is entered, the frequency of casting off a skin for the treatment of group and control group occurs significantly
Difference, the frequency of casting off a skin for the treatment of group is significantly higher than control group.In six weeks, the male shrimp and female shrimp of experimental group have respectively 17 times, 12
Secondary record of casting off a skin, and corresponding control group is only 2 times, 5 times.Experimental group hero shrimp weight average increase 0.26g, compared with before experiment
Increase significantly (P<0.05) increased weight is not notable, and before and after other three groups of experiments.
From result above, compared with control group, 4 μ g dsRNA dosage is injected with every gram of body weight, a shot is blue or green
After the dsRNA of shrimp MIH genes, the expression quantity of freshwater shrimp MIH genes is remarkably decreased, and at the 6th day, interference effect reached maximum, and this is done
Disturb acting duration long, difference is still notable at the 12nd day.This experimental studies results shows, the freshwater shrimp that the present invention is provided casts off a skin suppression
The dsRNA of hormone gene processed can effectively accelerate the frequency of casting off a skin of female, male freshwater shrimp, and the increase effect of male shrimp body weight is shown
Write.New thinking and effective means is provided to cultivate freshwater shrimp character improved seeds.
Sequence table
<110>China Aquatic Science Research Academy Fresh Water Fishery Research Center
<120>Freshwater shrimp molt-inhibiting hormone gene and its application in accelerating freshwater shrimp to cast off a skin and grow
<130>
<160> 9
<170> PatentIn version 3.3
<210> 1
<211> 925
<212> DNA
<213>Artificial sequence
<400> 1
tcgatggaaa gtaaactttc ctctgccgca gagcacgacg caaggacgag cgagtatacc 60
tgagccgtgc atttcgaagg cactgcttgg agaaaccttt ctctagacta atacgccacc 120
gcacgttcct ccctctccct ccctccctct ctctctctct ctttttctct tttgctcgct 180
ctctctcaaa agtctcgtcc gaccagaccc gtaaccttaa cctttgtcct gtaactgttt 240
cctagccccc tctccccacc ctccccaacc ccccttctgt ttgtgtctgt taacccatcc 300
tattcgcacc ttcccggcat tcctttgttt acctgaactc agcttttgag tgtctgtcca 360
gtttgaagac gaagtttagt gtcgactgag agttctatat cagtttcatt tgttttgtta 420
cttgcttagt gtttcatgtc tactcaaaag cacctgcaag gaatggtaaa cctgacagcg 480
caagggatct ctgcccagag agtcctggtg acagccccgg tcatcatcag cctgtttctg 540
gtctcgggca cgtcggccag gtacctagat gacgaatgcc ctggtgtcat gggcaacagg 600
gacctatacg agaaggtcgt cagggtatgc gacgattgtt ccaacatctt ccgtatgaat 660
gatatgggca ccagatgcag gaaggactgt ttctacaacg tggacttctt gtggtgcgtc 720
tacgccacgg aacgtcacgg cgacgtggaa cagctcaaca gatggatgag catcctacga 780
gccgggagaa aatgaaaaac acgccctcca actgaaatat cctctaaaat aagctccagg 840
accacacgcc agaatatact ccatgttttc aagtgatacc gatacattgt gaacatgaca 900
tatcagccgg aagaaaaaaa aaaaa 925
<210> 2
<211> 40
<212> DNA
<213>Artificial sequence
<400> 2
taatacgact cactataggg gtaaacctga cagcgcaagg 40
<210> 3
<211> 40
<212> DNA
<213>Artificial sequence
<400> 3
taatacgact cactataggg ccatctgttg agctgttcca 40
<210> 4
<211> 285
<212> DNA
<213>Artificial sequence
<400> 4
gtaaacctga cagcgcaagg gatctctgcc cagagagtcc tggtgacagc cccggtcatc 60
atcagcctgt ttctggtctc gggcacgtcg gccaggtacc tagatgacga atgccctggt 120
gtcatgggca acagggacct atacgagaag gtcgtcaggg tatgcgacga ttgttccaac 180
atcttccgta tgaatgatat gggcaccaga tgcaggaagg actgtttcta caacgtggac 240
ttcttgtggt gcgtctacgc cacggaacgt cacggcgacg tggaa 285
<210> 5
<211> 285
<212> RNA
<213>Artificial sequence
<400> 5
guaaaccuga cagcgcaagg gaucucugcc cagagagucc uggugacagc cccggucauc 60
aucagccugu uucuggucuc gggcacgucg gccagguacc uagaugacga augcccuggu 120
gucaugggca acagggaccu auacgagaag gucgucaggg uaugcgacga uuguuccaac 180
aucuuccgua ugaaugauau gggcaccaga ugcaggaagg acuguuucua caacguggac 240
uucuuguggu gcgucuacgc cacggaacgu cacggcgacg uggaa 285
<210> 6
<211> 22
<212> DNA
<213>Artificial sequence
<400> 6
ccggcattcc tttgtttacc tg 22
<210> 7
<211> 21
<212> DNA
<213>Artificial sequence
<400> 7
atattctggc gtgtggtcct g 21
<210> 8
<211> 22
<212> DNA
<213>Artificial sequence
<400> 8
cctgagtgtc tgtccagttt ga 22
<210> 9
<211> 24
<212> DNA
<213>Artificial sequence
<400> 9
tggtcctgga gcttatttta gagg 24
Claims (4)
1. application of the freshwater shrimp molt-inhibiting hormone gene in accelerating freshwater shrimp to cast off a skin and grow, it is characterised in that：Disturbed using RNA
Technology, disturbs primer, then with the total cDNA of freshwater shrimp according to the ORFs designated rna of freshwater shrimp molt-inhibiting hormone gene sequence
Enter performing PCR amplification for template, obtain sequence such as SEQ ID NO:Shown in 4, with SEQ ID NO:4 carry out in-vitro transcription synthesis
DsRNA, dsRNA is expelled to after the cardiocoelom of freshwater shrimp, accelerates freshwater shrimp to cast off a skin and grow；Wherein described freshwater shrimp molt inhibition hormone
The nucleotide sequence of gene such as SEQ ID NO:Shown in 1.
2. application according to claim 1, it is characterised in that：The RNA disturbs the sense primer nucleotide sequence of primer
Such as SEQ ID NO:Shown in 2, anti-sense primer nucleotide sequence such as SEQ ID NO:Shown in 3.
3. application according to claim 1, it is characterised in that：The dsRNA nucleotide sequences such as SEQ ID NO:5 institutes
Show.
4. application according to claim 1, it is characterised in that：DsRNA is expelled to the injection dosage of the cardiocoelom of freshwater shrimp
2 ~ 6 μ g dsRNA are injected for every gram of body weight.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410560745.3A CN104313031B (en) | 2014-10-21 | 2014-10-21 | Freshwater shrimp molt-inhibiting hormone gene and its application in accelerating freshwater shrimp to cast off a skin and grow |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410560745.3A CN104313031B (en) | 2014-10-21 | 2014-10-21 | Freshwater shrimp molt-inhibiting hormone gene and its application in accelerating freshwater shrimp to cast off a skin and grow |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104313031A CN104313031A (en) | 2015-01-28 |
| CN104313031B true CN104313031B (en) | 2017-09-05 |
Family
ID=52368344
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410560745.3A Expired - Fee Related CN104313031B (en) | 2014-10-21 | 2014-10-21 | Freshwater shrimp molt-inhibiting hormone gene and its application in accelerating freshwater shrimp to cast off a skin and grow |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104313031B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105002171B (en) * | 2015-07-30 | 2017-12-05 | 江苏省淡水水产研究所 | A kind of SNP mark related to Eriocheir sinensis body weight and its application |
| CN105505945B (en) * | 2016-01-27 | 2019-04-02 | 中国科学院海洋研究所 | A kind of exopalaemon carinicauda moulting hormone gene EcEH and its application |
| CN113862270B (en) * | 2021-10-26 | 2023-08-29 | 广东海洋大学 | dsRNA of prawn METTL3 gene and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1238382C (en) * | 2003-09-23 | 2006-01-25 | 南京师范大学 | Molt-inhibiting hormone-1 protein of mitten crab |
-
2014
- 2014-10-21 CN CN201410560745.3A patent/CN104313031B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN104313031A (en) | 2015-01-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102358902B (en) | Silkworm fibroin heavy-chain gene mutation sequence and mutation method and application | |
| CN107012174A (en) | Application of the CRISPR/Cas9 technologies in silkworm zinc finger protein gene mutant is obtained | |
| CN1176661A (en) | Cold-inducible promoter sequences | |
| CN106754948B (en) | Nilaparvata lugens NlMLP gene, encoding protein and application thereof | |
| CN108285906A (en) | A kind of construction method of site-directed integration exogenous DNA transgene pig | |
| CN110468137B (en) | Himalayan twenty eight star ladybug high-lethal gene and application thereof in preventing and treating ladybug | |
| CN104313031B (en) | Freshwater shrimp molt-inhibiting hormone gene and its application in accelerating freshwater shrimp to cast off a skin and grow | |
| CN108610427A (en) | Migratory locusts diapause hormone gene and its application in regulating and controlling Insect Diapause | |
| CN106676112B (en) | Citrus fruit fly Taiman gene and its qRT-PCR detection method and its siRNA | |
| CN114657264A (en) | Clarias fuscus gender-specific molecular marker primer and application thereof | |
| CN108795940A (en) | A method of effectively preventing lepidoptera pest with RNAi | |
| CN103215266A (en) | RNAi used for regulating and controlling growth of silkworm pupae and application | |
| CN110628789B (en) | Breeding method of insect-resistant low-phenol cotton variety | |
| CN110583581A (en) | Construction method of novel Bemisia tabaci nymph RNA interference method | |
| AU2020100222A4 (en) | Method of introducing double-stranded dna into the body of kerria chinensis | |
| CN104212813A (en) | Freshwater shrimp gonad inhibiting hormone gene and kit and method for accelerating development of ovary | |
| CN109913480B (en) | Locust uridine diphosphate glucuronosyltransferase gene and application thereof | |
| CN114349835A (en) | Application of GhREM protein and coding gene thereof in regulating and controlling aphid resistance of cotton | |
| CN107058324A (en) | Rice root specific expression promoter POsRO4 and corresponding rice cultivating method | |
| CN110106177B (en) | dsRNA of locusta migratoria fatty acid elongase gene LmElo as well as preparation method and application thereof | |
| CN104195153B (en) | A kind of Bicistronic mRNA coexpression gene transporter and preparation method | |
| CN109536506B (en) | Insulin-like receptor gene for regulating growth and development of macrobrachium nipponense and application thereof | |
| CN102363792A (en) | Lentivirus method for preparing IGF2b transgenic fish | |
| CN108795933B (en) | Method for changing feeding habits of silkworms and application thereof | |
| CN111549030A (en) | Molecular breeding method for thickening crucian muscles |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170905 Termination date: 20181021 |