CN103215266A - RNAi used for regulating and controlling growth of silkworm pupae and application - Google Patents

Abstract

The invention relates to RNAi used for regulating and controlling growth of silkworm pupae and an application. Concretely, the invention discloses two gene segments based on the death of silkworm pupae due to a RNA interference technology, a composition containing dsRNA is sprayed on folium mori for feeding silkworm, so that the silkworm can be grown up at larval period and died at pupal period. The method is convenient, fast and accurate, can solve the problems of energy consumption and decreased silk quality due to cocoon drying treatment in sericulture industry, and provides references for preventing and controlling lepidoptera pests.

Description

Be used to regulate and control RNAi and application thereof that silkworm pupa is grown

Technical field

The invention belongs to biotechnology and agricultural application field, particularly, the present invention relates to be used to regulate and control RNAi and the application thereof that silkworm pupa is grown.

Background technology

Silkworm (Bombyx mori) has nearly 5000 artificial breeding history in China, important economic class insect, and the product silk of silkworm is valuable textile raw material.Silkworm mainly carries out the production of silk in pupa time, the growth cycle in silkworm pupa time is very short, weave silk cocoon the back will cocoon-break after 9-14 days and go out, in case silk cocoon is broken by the teeth and has just been lost economic worth, people will expend lot of manpower and material resources every year and prolong the time in pupa time, improve the output of silk.

In order to address this problem, the general baking processing that adopts during silk is produced at present.But this process not only will consume a large amount of energy, also can have a strong impact on the quality of silk.Therefore, this area presses for the new method that finds, and the exploitation silkworm larva phase becomes big and prolongs the silkworm method in pupa time.

Summary of the invention

The dsRNA construction and the dsRNA that the object of the present invention is to provide the regulation and control silkworm pupa to grow.

Another object of the present invention is to provide the regulation and control method that silkworm pupa is grown.

In a first aspect of the present invention, a kind of dsRNA construction is provided, the construction of described dsRNA is double-stranded, and its normal chain or minus strand contain the structure shown in the formula I:

Seq _Forward-X-Seq _OppositelyFormula I

In the formula,

Seq _ForwardFor insect is regulated and control genes involved or segmental nucleotide sequence pupa time;

Seq _OppositelyFor with Seq _ForwardBasically complementary nucleotide sequence;

X is for being positioned at Seq _ForwardAnd Seq _OppositelyBetween intervening sequence, and described intervening sequence and Seq _ForwardAnd Seq _OppositelyIt is not complementary,

Wherein, described insect is regulated and control genes involved be selected from pupa time: PTTH gene and Torso gene.

In another preference, Seq _Forward, Seq _OppositelyLength be 50bp at least.

In another preference, described dsRNA construction can form the dsRNA shown in the formula II,

In the formula,

Seq ' _ForwardBe Seq _ForwardThe RNA sequence or the sequence fragment of sequence correspondence;

Seq ' _OppositelyFor with Seq ' _ForwardBasically complementary sequence;

X ' is not for having; Or for being positioned at Seq ' _ForwardAnd Seq ' _OppositelyBetween intervening sequence, and described intervening sequence and Seq ' _ForwardAnd Seq ' _OppositelyIt is not complementary,

|| be illustrated in Seq _ForwardAnd Seq _OppositelyBetween the hydrogen bond that forms.

In a second aspect of the present invention, the dsRNA shown in a kind of formula II is provided,

In the formula,

Seq ' _ForwardRegulate and control the RNA sequence or the sequence fragment of genes involved or segmental nucleotide sequence correspondence pupa time for insect;

Seq ' _OppositelyFor with Seq ' _ForwardBasically complementary sequence;

X ' is not for having; Or for being positioned at Seq ' _ForwardAnd Seq ' _OppositelyBetween intervening sequence, and described intervening sequence and Seq ' _ForwardAnd Seq ' _OppositelyNot complementary;

Wherein, described insect is regulated and control genes involved be selected from pupa time: PTTH gene and Torso gene;

|| be illustrated in Seq _ForwardAnd Seq _OppositelyBetween the hydrogen bond that forms.

In another preference, Seq _Forward, Seq _OppositelyLength be 50bp at least.

In another preference, the length of described intervening sequence X ' is 0-300bp.

In another preference, described insect is regulated and control genes involved and derive from silkworm pupa time.

In another preference, the sequence of described PTTH gene is shown in SEQ ID NO.:7, and the sequence of described Torso gene is shown in SEQ ID NO.:8.

In another preference, described insect is a plant-feed insect, preferably is lepidopterous insects, is silkworm best.

In a third aspect of the present invention, a kind of expression vector is provided, described expression vector contains the dsRNA construction described in the first aspect present invention.

In a fourth aspect of the present invention, a kind of host cell is provided, contain the dna sequence dna that is integrated with in expression vector described in the third aspect present invention or the karyomit(e) corresponding to the dsRNA construction described in the first aspect present invention in the described host cell.

In another preference, described host cell is a vegetable cell, preferably is the mulberry leaf cell.

In a fifth aspect of the present invention, a kind of composition is provided, described composition comprises the dsRNA described in dsRNA construction described in the first aspect and/or the second aspect, and acceptable carrier on the insect feeding.

In another preference, acceptable carrier comprises water on the described insect feeding.

In another preference, described composition is the composition that is used to induce or cause silkworm death in pupa time.

In another preference, described dsRNA has following sequence:

DsRNA1: have corresponding to the sequence shown in the SEQ ID NO.:7;

DsRNA2: have corresponding to the sequence shown in the SEQ ID NO.:8.

In another preference, PTTH gene and/or Torso gene are from insect, preferably from lepidopterous insects, best from silkworm.

In another preference, dsRNA1 content is 10-500ng/ μ l in the described pharmaceutical composition, preferably is 200ng/ μ l; DsRNA2 content is 10-500ng/ μ l, preferably is 200ng/ μ l.

In a sixth aspect of the present invention, the dsRNA described in the first aspect present invention is provided construction, or the dsRNA described in the second aspect, or the purposes of composition described in host cell described in the fourth aspect or the 5th aspect, described purposes is selected from down group:

(1) the regulation and control silkworm pupa is grown; And/or

(2) prolong the silkworm larva phase; And/or

(3) make death in pupa time; And/or

(4) pupa being stagnated grows; And/or

(5) prolong house silkworms spin silk the time.

In a seventh aspect of the present invention, a kind of method that insect growth is grown of regulating is provided, comprise step: regulate and control the disturbing molecule of related gene expression pupa time with interference insect, or the carrier, cell, plant tissue or the feed that the contain described disturbing molecule insect of feeding;

Preferably, described insect is regulated and control genes involved be selected from pupa time: PTTH gene and Torso gene.

Wherein, regulate insect growth and grow one or more that are selected from down group:

(1) regulation and control insect pupa development; And/or

(2) prolong the insect larvae phase; And/or

(3) make death in pupa time; And/or

(4) pupa being stagnated grows; And/or

(5) prolonging insect weaves silk the time.

In another preference, described disturbing molecule is selected from: regulating and control genes involved or its fragment or its transcript pupa time with insect serves as to suppress or dsRNA, antisense nucleic acid, siRNA, the Microrna of reticent target.

In another preference, described insect is regulated and control genes involved and derive from silkworm pupa time.

In another preference, described insect is a plant-feed insect, preferably from lepidopterous insects, best from silkworm.

In another preference, described method comprises step: with the dsRNA construction described in the first aspect present invention, or the insect of feeding of composition described in host cell described in dsRNA described in the second aspect or the fourth aspect or the 5th aspect.

In a eighth aspect of the present invention, a kind of method for preparing dsRNA described in the second aspect present invention is provided, comprise step:

(i) construction of dsRNA is expressed in preparation, and described construction be a two strands, and its normal chain or minus strand contain the structure shown in the formula I:

Seq _Forward-X-Seq _OppositelyFormula I

In the formula,

Seq _ForwardFor insect is regulated and control genes involved or segmental nucleotide sequence pupa time;

Seq _OppositelyFor with Seq _ForwardBasically complementary nucleotide sequence;

X is for being positioned at Seq _ForwardAnd Seq _OppositelyBetween intervening sequence, and described intervening sequence and Seq _ForwardAnd Seq _OppositelyIt is not complementary,

Wherein, described insect is regulated and control genes involved be selected from pupa time: PTTH gene and Torso gene;

(ii) change the described construction of step (i) over to host cell, form the dsRNA shown in the formula II thereby in host cell, express,

In the formula,

Seq ' _ForwardBe Seq _ForwardThe RNA sequence or the sequence fragment of sequence correspondence;

Seq ' _OppositelyFor with Seq ' _ForwardBasically complementary sequence;

X ' is not for having; Or for being positioned at Seq ' _ForwardAnd Seq ' _OppositelyBetween intervening sequence, and described intervening sequence and Seq ' _ForwardAnd Seq ' _OppositelyIt is not complementary,

|| be illustrated in Seq _ForwardAnd Seq _OppositelyBetween the hydrogen bond that forms.

In a ninth aspect of the present invention, a kind of method for preparing feed is provided, comprise step: with the dsRNA construction described in the first aspect, or the dsRNA described in the second aspect, or the host cell described in the fourth aspect, or the 5th the composition sprayed described in the aspect in plant surface, thereby make feed.

In another preference, described plant is mulberry leaf.

In should be understood that within the scope of the present invention, can make up mutually between above-mentioned each technical characterictic of the present invention and specifically described in below (eg embodiment) each technical characterictic, thereby constitute new or optimized technical scheme.As space is limited, this tired no longer one by one stating.

Description of drawings

Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.

Fig. 1 has shown the RNAi bioassay results of 2 genes, and contrast CK uses the dsRNA at the EYFP gene to handle.

Fig. 2 shows the result of the method for RT-PCR to silkworm PTTH and the evaluation of Torso expression of gene, the result shows, dsRNA can suppress PTTH and Torso expression of gene, the change of larval stage death big and pupa time is because the silence of target gene (PTTH and Torso) causes, pre-pupa refers to prepupa, and ordinate zou is the relative expression quantity of gene.

Embodiment

The inventor is through extensive and deep research, silkworm pupa period regulation genes involved fragment is screened, be surprised to find that, at PTTH gene fragment shown in SEQ ID NO:7 and the Torso gene shown in SEQ ID NO:8, synthetic RNA interfering (dsRNA), described dsRNA gets food by the phytophagy silkworm, enter in the insect body, exercise interference, suppress target gene expression target gene, finally cause the silkworm larva phase to become big and death in pupa time, reach the purpose of regulation and control growth in pupa time.

The inventive method is convenient, fast, accurate, has solved to carry out energy consumption and the silk quality decline problem that the cocoon drying processing causes during silkworm already produces, and also the control for lepidoptera pest provides reference.

RNA disturbs (RNAi)

As used herein, term " the RNA interference (RNA interference; RNAi) " be meant: some little double-stranded RNAs can be blocked the expression of specific gene in the body efficiently, specifically, impel the mRNA degraded, lure that cell shows the phenotype of specific gene disappearance into, it is also referred to as, and RNA intervenes or RNA interferes.It is the gene silencing mechanism on the mRNA level of high special that RNA disturbs.

As used herein, term " siRNA (small interfering RNA; siRNA) " is meant a kind of short-movie section double stranded rna molecule, can be the specific mRNA of target degraded with the mRNA of homology complementary sequence, this process be exactly RNA interference channel (RNA interference pathway).

In the present invention, described RNA interferential ultimate principle is: with plant as media, the siRNA (siRNA) that insect is taken can disturb its gene (as PTTH gene and Torso gene) to be expressed, thus suppress the growth of insect.

Particularly, described principle is: get food by silkworm phytophagy, make RNAi enter polypide, RNA to target gene disturbs, suppress target gene expression, thereby interference insect grows normally, cause the silkworm larva phase to become the death in big and pupa time, thereby prolong house silkworms spin silk the time, improve the output of silk.

As a kind of preferred mode, utilize an intron sequences, two ends connect goes up the complementary gene order, behind the transfered cell, can produce " neck-ring " structure, and " neck " shape part can be processed into about the little RNA about 21-25nt in insect body, and this little RNA can especially effectively suppress the expression of goal gene.

Insect genes

As used herein, term " insect genes " speech is meant with insect regulates and control genes involved pupa time, in a preference of the present invention, described insect genes is PTHH gene and/or PTHH acceptor gene (as the Torso gene), the low expression of described gene or the processes such as the growth that will cause insect, growth, metabolism, breeding of not expressing produce unusual, even cause the death of insect.Preferably, in fruit bat, the low expression of PTHH gene or do not express causes the drosophila larvae phase to be grown prolonging, and it is big that build becomes, and the individuality after pupating is bigger than normal fruit bat; The low expression of Torso gene or do not express also and will cause similar phenotype.

As optimal way of the present invention, the segmental length of the preferred insect genes of the present invention is at least 50bp, such as being 60bp, 80bp, 100bp, 200bp, 500bp, 1000bp.Described gene can be full-length gene or gene fragment being used for when of the present invention, preferably, at the fragment of PTHH gene shown in SEQ ID NO:7; At the fragment of Torso gene shown in SEQ ID NO:8.

The present invention also provides the dsRNA at the EYFP gene, and the sequence of described EYFP gene is shown in SEQ ID NO:9.Compare the poor effect of EYFP gene with the Torso gene with the PTHH gene.

The invention provides the RNA interfering of regulating and control genes involved at insect pupa time, insect can be taken in described RNA interfering i by plant or expression dsRNA construction or the dsRNA of oral sprinkling RNAi.

DsRNA construction shown in the present is suc as formula shown in the I, dsRNA is suc as formula shown in the II, the length of the intervening sequence X that is adopted has no particular limits, if at it with forward sequence and reverse sequence formation construction and after being directed in the body, can form the dsRNA shown in the formula II and get final product.As optimal way of the present invention, the length of intervening sequence of the present invention is 80-300bp; More preferably be 100-250bp.

In a preference of the present invention, the construction of described expression insect genes dsRNA is imported in the host cell, described host cell can be vegetable cell, tissue or organ, and described construction can be expressed insect genes dsRNA in plant materials, and dsRNA is processed to siRNA.Usually, the length of siRNA is about about 21-25nt.

Usually, described construction is positioned on the expression vector.Described expression vector also contains promotor, replication orgin and/or marker gene etc. usually.Method well-known to those having ordinary skill in the art can be used to make up expression vector required for the present invention.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body etc.Described expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, as kalamycin, gentamicin, Totomycin, amicillin resistance.

Comprise the carrier of above-mentioned suitable gene order and suitable promotor or control sequence, can be used to transform suitable host.In the method for the invention, described host can be any host that described expression vector also can pass to described expression vector vegetable cell that is suitable for carrying.Preferably, described host is an Agrobacterium.

Although the insect of being given an example in example of the present invention is a silkworm chrysalis.Yet should be understood that the present invention for being applicable to that insect of the present invention has no particular limits, described insect can be any can be the plant-feed insect of food with the plant, can be lepidopterous insects such as it.

The present invention is for being applicable to that plant of the present invention has no particular limits, preferably the edible plant of silkworm, for example mulberry leaf.

PTTH

As used herein, term " PTTH peptide ", " PTTH albumen ", " prothoracic gland hormone " and " prothoracicotropic hormone " can exchange use.Nineteen twenty-two Kopec has found the existence of this hormone in the insect gypsymoth, and with its called after brain hormones.In the model animals of silkworm and these two research of Semen Ricini silkworm PTTH, PTTH albumen is that molecular weight is the protein of 20-30kDa.Silkworm is at first synthetic to have 224 amino acid whose PTTH precursors, is cut into then to have 109 amino acid whose mature peptides.Show that on evidence PTTH can regulate and control the output of downstream moulting hormone, the drosophila larvae phase that knocks out the PTTH gene is grown prolongation, and it is big that build obviously becomes; After pupating, individuality is also big than normal fruit bat; After knocking out the PTTH gene, fruit bat does not lose the ability that produces moulting hormone fully, time of its generation that just lagged behind and reduced concentration.

In one embodiment of the invention, based on the RNAi technology, as target, screened the RNA interfering fragment at the PTTH gene with the PTTH gene, preferably, the sequence of described PTTH gene fragment is shown in SEQ ID NO:7:

TGACCCAGACACGAGCCCAGAAGAATTGTCCGCTTTAATAGTTGATTACGCCAATATGATTAGGAATGATGTTATTCTGTTGGATAATTCCGTTGAAACGAGAACGCGAAAAAGGGGAAACATTCAAGTTGAAAACCAAGCTATTCCGGACCCACCTTGCACTTGCGAATACAAGAAAGAAATAGAAGACTTGGGCGAAAACTCTGTTCCACGCTTCATTGAAACCAGAAACTGCAATAAAACACAACAGCCGACCTGTCGACCCCCGTACATTTGCAAAGAAAGTTTATACAGTATAACTATTTTAAAAAGAAGGGAGACTAAATCGCAGGAGTCTCTCGAGATACCGAATGAATTGAAATATCGATGGGTGGCGGAATCTCACCCCGTCAGCGTGGCGTGTTTG(SEQ?ID?NO.：7)

Torso

The Torso genes encoding is as a transmembrane protein of a kind of extracellular signaling molecule acceptor, i.e. Torso albumen.This signaling molecule or its precursor are stored in dotter haut by the follicular cell at ovum two ends and cover in the perivitelline space between the vitelline membrane of ovum.The Torso acceptor is a kind of Tyrosylprotein kinase, in the growth course of insect, can mediate the formation of polypide body extremity structure, epimerite and periproct after the Torso acceptor is occupied by aglucon.As the acceptor of PTTH hormone, in prothoracic gland, knock out or reduce the Torso gene, all can produce and knock out the similar phenotype of PTTH gene.

In one embodiment of the invention,, as target, screened RNA fragment at the Torso gene with the Torso gene based on the RNAi technology, preferably, shown in the sequence SEQ ID NO:8 of described Torso gene fragment:

TAGCGTGGGCGAAGCCACATTTTCAACCGGAGATTTATAATGTGACCGTTCGAGCTAATATGATAAGATCGATTATTTTACCCGGGAACGCGACTGAAACTACATTTAGAAACATACCCAACACGTTCCTTAGCGCCGGCAAAATCTACAATGTTTCGGTTTACGCAATAATTGGCCAGAAAGCTTCCCACACAAGTAGAAGAGCTTTTACTCCAGGCATGCTGCGCTGGGTGTGGGCGGGCGCCACGGCAGGCGCGGGGTGCGCGGCGGGGGGGCTGCTCGCGGCCACCCTGCTGTGCTGTGGACACCGCCGCGCTACCAGTCGCGTGTCACAGGAAGACCCCGACGAGAAAACGCCCAAAGAAGACGATGTCGAAATAATCGGCATCGAATCGGGCAGCGCAGACGATCACTGGGAGGTACGCTCGGACCGGGTGCTACTGCACGAAGTCATCGGCGAAGGAGCCTTCGGCGTCGTGCGGAGAGGCACTCTCGCGCCGGGAGGCAAGTCGGTCG(SEQ?ID?NO.：8)

DsRNA construction and application thereof

The invention provides a kind of dsRNA construction, the construction of described dsRNA is double-stranded, and its normal chain or minus strand contain the structure shown in the formula I:

Seq _Forward-X-Seq _OppositelyFormula I

In the formula,

Seq _ForwardFor insect is regulated and control genes involved or segmental nucleotide sequence pupa time;

Seq _OppositelyFor with Seq _ForwardBasically complementary nucleotide sequence;

X is for being positioned at Seq _ForwardAnd Seq _OppositelyBetween intervening sequence, and described intervening sequence and Seq _ForwardAnd Seq _OppositelyIt is not complementary,

Wherein, described insect to regulate and control genes involved pupa time be PTTH gene or Torso gene.

In a preference of the present invention, Seq _Forward, Seq _OppositelyLength be 50bp at least.

In a preference of the present invention, described dsRNA construction forms the dsRNA shown in the formula II after being ingested by insect (as silkworm),

In the formula,

Seq ' _ForwardBe Seq _ForwardThe RNA sequence or the sequence fragment of sequence correspondence;

Seq ' _OppositelyFor with Seq ' _ForwardBasically complementary sequence;

X ' is not for having; Or for being positioned at Seq ' _ForwardAnd Seq ' _OppositelyBetween intervening sequence, and described intervening sequence and Seq ' _ForwardAnd Seq ' _OppositelyIt is not complementary,

|| be illustrated in Seq _ForwardAnd Seq _OppositelyBetween the hydrogen bond that forms.

The present invention also provides the purposes of described dsRNA construction, and it is used to: the regulation and control silkworm pupa is grown; Or prolong the silkworm larva phase; Or make death in pupa time; Or make pupa stagnate growth; Or prolong house silkworms spin silk the time.

DsRNA and application thereof

It is a kind of suc as formula the dsRNA shown in the II that the present invention also provides,

In the formula,

Seq ' _ForwardBe Seq _ForwardThe RNA sequence or the sequence fragment of sequence correspondence;

Seq ' _OppositelyFor with Seq ' _ForwardBasically complementary sequence;

X ' is not for having; Or for being positioned at Seq ' _ForwardAnd Seq ' _OppositelyBetween intervening sequence, and described intervening sequence and Seq ' _ForwardAnd Seq ' _OppositelyIt is not complementary,

|| be illustrated in Seq _ForwardAnd Seq _OppositelyBetween the hydrogen bond that forms.

In another preference, the length of described intervening sequence X is 0-300bp, preferably is 80bp.

Described insect is regulated and control genes involved and derive from silkworm pupa time; The sequence of PTTH gene is shown in SEQ ID NO.:7, and the sequence of Torso gene is shown in SEQ ID NO.:8.

In another preference, described insect is a plant-feed insect, preferably from lepidopterous insects, best from silkworm.

The present invention also provides the purposes of described dsRNA, and it is used to: the regulation and control silkworm pupa is grown; Or prolong the silkworm larva phase; Or make death in pupa time; Or make pupa stagnate growth; Or prolong house silkworms spin silk the time.

Composition and application thereof

The present invention also provides a kind of composition, the inventor is at prolonging the silkworm difficult problem of growth cycle in pupa time, based on the RNAi technological development at the RNAi fragment of target gene, and by feeding by insect, cause the silkworm larva phase to prolong, improve the mortality ratio in pupa time, make RNAi play the effect of inhibition of gene expression, finally reach the purpose that improves silk output.The inventive method is convenient, fast, accurate and nuisanceless.

Described composition comprises dsRNA construction and/or dsRNA, and the carrier of acceptable significant quantity on the insect feeding.In another preference, described composition is the composition that is used to induce or cause silkworm death in pupa time.

In another preference, described dsRNA has following sequence:

DsRNA1: have corresponding to the sequence shown in the SEQ ID NO.:7;

DsRNA2: have corresponding to the sequence shown in the SEQ ID NO.:8.

The present invention also provides the purposes of described composition, and described purposes is selected from down group:

The regulation and control silkworm pupa is grown; Or prolong the silkworm larva phase; Or make death in pupa time; Or make pupa stagnate growth; Or prolong house silkworms spin silk the time.

In a preference of the present invention, composition is the aqueous solution, and pH is about 5-8 usually, and preferably, pH is about 6-8.

As used herein, term " significant quantity " or " effective dose " are meant and can produce function or amount active and that can be accepted by described insect to described insect feeding.Preferably, the content of dsRNA1 is about 10-500ng/ μ l; The content of dsRNA2 is about 10-500ng/ μ l; More, dsRNA1 content is 200ng/ μ l, and dsRNA2 content is 200ng/ μ l.The selection of preferred significant quantity can be determined (for example passing through feeding experiment) according to various factors by those of ordinary skills.

As used herein, the composition of " acceptable on the insect feeding " is applicable to described insect and does not have excessive bad side reaction (as toxicity, stimulation and transformation reactions), promptly has the material of rational benefit/risk ratio.

As used herein, term " carrier " comprises various vehicle and thinner.This class carrier comprises (but being not limited to): water, salt solution, damping fluid, glucose, glycerine, ethanol and combination thereof.

Composition of the present invention can directly spray, feeding, or is made into the injection form, for example water, physiological saline or contain glucose and the aqueous solution of other assistant agents is prepared by ordinary method.Described composition should be aseptic or do not have under the condition of RNA enzyme and make.

Advantage of the present invention

1) the present invention is used to regulate and control RNAi set point control, the efficient height, nuisanceless that silkworm pupa is grown;

2) dsRNA of Huo Deing can directly apply to the silkworm breed, and is easy to use;

3) production cost is low, and good stability is applicable to production;

4) environment compatibility is good.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Embodiment 1

The screening target gene

1. the extraction of the total RNA of silkworm

Sample: silkworm is made strain (P50) greatly.

Method: adopt conventional Trizol method to extract the total RNA of silkworm, and use the ordinary method purifying.Use the DNA enzyme to handle the RNA that obtains, obtain concentration 〉=300ng/ μ l, total amount 〉=6 μ g, OD ₂₆₀/ ₂₈₀Total RNA sample for 1.8-2.2.

2.mRNA separation and cDNA synthetic

Isolate the mRNA that has polyA with the magnetic bead that has oligo-dT, then with 6 polymers at random with purchase in synthetic cDNA first chain of Invitrogen Corporation's Super script II reverse transcriptase test kit.

3. the amplification of gene and order-checking

Utilize the special primer of target gene to increase, with the gene fragment purifying that obtains, be connected in the PMD-18 carrier (production of Takara company), transform commercially available host cell (Top10 bacterial strain), use blue hickie sieve method to select proper host cell, select the sequence verification that positive strain carries out goal gene.

Wherein, primer sequence sees Table 1.

Table 1

Embodiment 2

DsRNA's is synthetic

In the present embodiment, the inventor utilizes MAGE kit to synthesize, and obtains can be used for the dsRNA of biological assay.

Utilize T7Kit (available from AMBION company, product article No. AM1334) carries out the synthetic of target gene dsRNA, obtains can be used for the dsRNA of biological assay.Its brief principle is: at first the total RNA with the silkworm larva tissue is a template, reverse transcription obtains cDNA, use the structural domain of two genes of primer (seeing Table 1) amplification then, its product is carried out purifying, is template with the purified product again, utilizes test kit to carry out in-vitro transcription, after obtaining dsRNA, remove the DNA in the product again, and carry out purification process, just can obtain required dsRNA.

The concrete operations step is as follows: the dna sequence dna with two gene structure territories of aforementioned acquisition is a template, operates according to the specification sheets among the AM1334Kit:

1) in-vitro transcription obtains dsRNA

Water to the 20 μ L that adds no RNA enzyme mixes, and is of short duration centrifugal, hatches 4h for 37 ℃.

2) eliminate DNA

The in-vitro transcription reaction finishes, and contains a small amount of template DNA in the enzyme reaction system, need digest under the effect of DNase I, adds the Dnase I of 1 μ L in above-mentioned reaction solution, mixes, and hatches 30min for 37 ℃.

3) dsRNA purifying

In the above-mentioned reaction system: add 100 μ L and 15 μ L ammonium acetate termination reactions; Add the mixed liquid (25: 24: 1) of equal-volume phenol/chloroform/primary isoamyl alcohol: 4 ℃ of 15000r/min, centrifugal 15min gets the upper water phase transition to new 1.5mL centrifuge tube; Add the mixed liquid (24: 1) of 140 μ L (equal-volume) chloroform/primary isoamyl alcohol; Add 12 μ L (1/10 volume) 3M sodium acetate solns (pH5.5); Add 2 times of volume dehydrated alcohols ,-20 ℃ of precipitated rnas that spend the night; The centrifugal 15-30min of 12000r/min; Abandon supernatant, add 70% ethanol, 250 μ L, room temperature is blown and beaten the centrifugal 10min of washing: 12000r/min gently, abandons supernatant, the drying at room temperature precipitation; With an amount of TE dissolution precipitation.The final dsRNA that obtains is called after: dsPTTH, dsTorso respectively, and electrophoresis is identified, promptly successfully obtained required dsRNA.

Embodiment 3

The application of dsRNA

In the present embodiment, the inventor is prepared as the dsRNA aqueous solution respectively with 2 kinds of dsRNA that obtain among the embodiment 2, and concentration all is 200ng/ μ l.Every kind of dsRNA aqueous solution is got 300 μ l respectively, be sprayed on the mulberry leaf, and the silkworm of feeding, once a day, continuous 5 days, set 3 groups of repeated experiments, every group is used 30 silkworms, carries out the dsRNA effect every day and identifies.

The result shows, compares with the EYFP gene

(1) at the dsRNA of 2 target genes (PTTH and Torso gene) to pupa time silkworm have lethal effect, wherein, in the dsRNA PTTH group, dead pupa time, three groups of silkworms were respectively 20,22 and 23, average 21.7, mortality ratio reaches 72.3%; In the dsRNA Torso group, dead pupa time, three groups of silkworms were respectively 19,21 and 23, and average 21, mortality ratio reaches 70%.

(2) dsRNA at 2 target genes (PTTH and Torso gene) has had strong inhibitory effects to PTTH and Torso expression of gene.

Fig. 1 has shown the deadly result of dsRNA to the silkworm in pupa time.

Fig. 2 shows the result of the method for RT-PCR to silkworm PTTH and the evaluation of Torso expression of gene.

The result shows that dsRNA can suppress PTTH and Torso expression of gene, and the change of larval stage death big and pupa time is that ordinate zou is the relative expression quantity of gene because the silence of target gene (PTTH and Torso) causes, and pre-pupa refers to prepupa.

Embodiment 4

Preparation of compositions

Present embodiment provides a kind of composition that silkworm pupa is grown that is used to regulate and control, and said composition is the aqueous solution, comprises component:

1. at the dsRNA of sequence PTTH gene fragment shown in SEQ ID NO.:7

Concentration is 200ng/ μ l;

2. at the dsRNA of sequence Torso gene fragment shown in SEQ ID NO.:8

Concentration is 200ng/ μ l.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Claims (10)

1. a dsRNA construction is characterized in that, the construction of described dsRNA is double-stranded, and its normal chain or minus strand contain the structure shown in the formula I:

Seq _Forward-X-Seq _OppositelyFormula I

In the formula,

Seq _ForwardFor insect is regulated and control genes involved or segmental nucleotide sequence pupa time;

Seq _OppositelyFor with Seq _ForwardBasically complementary nucleotide sequence;

X is for being positioned at Seq _ForwardAnd Seq _OppositelyBetween intervening sequence, and described intervening sequence and Seq _ForwardAnd Seq _OppositelyIt is not complementary,

Wherein, described insect is regulated and control genes involved be selected from pupa time: PTTH gene and Torso gene.

2. dsRNA construction as claimed in claim 1 is characterized in that, described dsRNA construction can form the dsRNA shown in the formula II,

In the formula,

Seq ' _ForwardBe Seq _ForwardThe RNA sequence or the sequence fragment of sequence correspondence;

Seq ' _OppositelyFor with Seq ' _ForwardBasically complementary sequence;

X ' is not for having; Or for being positioned at Seq ' _ForwardAnd Seq ' _OppositelyBetween intervening sequence, and described intervening sequence and Seq ' _ForwardAnd Seq ' _OppositelyIt is not complementary,

|| be illustrated in Seq _ForwardAnd Seq _OppositelyBetween the hydrogen bond that forms.

3. the dsRNA shown in the formula II,

In the formula,

Seq ' _ForwardRegulate and control the RNA sequence or the sequence fragment of genes involved or segmental nucleotide sequence correspondence pupa time for insect;

Seq ' _OppositelyFor with Seq ' _ForwardBasically complementary sequence;

X ' is not for having; Or for being positioned at Seq ' _ForwardAnd Seq ' _OppositelyBetween intervening sequence, and described intervening sequence and Seq ' _ForwardAnd Seq ' _OppositelyNot complementary;

Wherein, described insect is regulated and control genes involved be selected from pupa time: PTTH gene and Torso gene;

|| be illustrated in Seq _ForwardAnd Seq _OppositelyBetween the hydrogen bond that forms.

4. an expression vector is characterized in that, described expression vector contains the described dsRNA construction of claim 1.

5. a host cell is characterized in that, contains the dna sequence dna that is integrated with in described expression vector of claim 4 or the karyomit(e) corresponding to the described dsRNA construction of claim 1 in the described host cell.

6. a composition is characterized in that, described composition comprises described dsRNA construction of claim 1 and/or the described dsRNA of claim 3, and acceptable carrier on the insect feeding.

7. the described dsRNA construction of claim 1, or the described dsRNA of claim 3, or the purposes of described host cell of claim 5 or the described composition of claim 6 is characterized in that described purposes is selected from down group:

(1) the regulation and control silkworm pupa is grown; And/or

(2) prolong the silkworm larva phase; And/or

(3) make death in pupa time; And/or

(4) pupa being stagnated grows; And/or

(5) prolong house silkworms spin silk the time.

8. regulate the method that insect growth is grown for one kind, it is characterized in that, comprise step: regulate and control the disturbing molecule of related gene expression pupa time with interference insect, or the carrier, cell, plant tissue or the feed that the contain described disturbing molecule insect of feeding,

Wherein, described insect is regulated and control genes involved be selected from pupa time: PTTH gene and Torso gene.

9. method as claimed in claim 8 is characterized in that, comprises step: with claim 1 described dsRNA construction, or the described dsRNA of claim 3 or the described host cell of claim 5 or the described composition of claim 6 insect of feeding.

10. a method for preparing dsRNA is characterized in that, comprises step:

(i) construction of dsRNA is expressed in preparation, and described construction be a two strands, and its normal chain or minus strand contain the structure shown in the formula I:

Seq _Forward-X-Seq _OppositelyFormula I

In the formula,

Seq _ForwardFor insect is regulated and control genes involved or segmental nucleotide sequence pupa time;

Seq _OppositelyFor with Seq _ForwardBasically complementary nucleotide sequence;

X is for being positioned at Seq _ForwardAnd Seq _OppositelyBetween intervening sequence, and described intervening sequence and Seq _ForwardAnd Seq _OppositelyIt is not complementary,

Wherein, described insect is regulated and control genes involved be selected from pupa time: PTTH gene and Torso gene;

(ii) change the described construction of step (i) over to host cell, form the dsRNA shown in the formula II thereby in host cell, express,

In the formula,

Seq ' _ForwardBe Seq _ForwardThe RNA sequence or the sequence fragment of sequence correspondence;

Seq ' _OppositelyFor with Seq ' _ForwardBasically complementary sequence;

X ' is not for having; Or for being positioned at Seq ' _ForwardAnd Seq ' _OppositelyBetween intervening sequence, and described intervening sequence and Seq ' _ForwardAnd Seq ' _OppositelyIt is not complementary,

|| be illustrated in Seq _ForwardAnd Seq _OppositelyBetween the hydrogen bond that forms.

Images