CN103215266B - RNAi and the application thereof of growing for regulating and controlling silkworm pupa - Google Patents
RNAi and the application thereof of growing for regulating and controlling silkworm pupa Download PDFInfo
- Publication number
- CN103215266B CN103215266B CN201210019269.5A CN201210019269A CN103215266B CN 103215266 B CN103215266 B CN 103215266B CN 201210019269 A CN201210019269 A CN 201210019269A CN 103215266 B CN103215266 B CN 103215266B
- Authority
- CN
- China
- Prior art keywords
- seq
- dsrna
- sequence
- gene
- insect
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The present invention relates to RNAi and the application thereof of growing for regulating and controlling silkworm pupa. Particularly, the invention discloses 2 genetic fragments that cause silkworm death in pupa time based on RNA perturbation technique, by by the composition sprayed that contains dsRNA to the silkworm of feeding on mulberry leaf, can cause the silkworm larva phase to become large and death in pupa time. Described method is convenient, fast, accurate, has solved in the production of silkworm industry and must carry out energy resource consumption and the silk quality decline problem that cocoon drying processing causes, also for the control of lepidoptera pest provides reference.
Description
Technical field
The invention belongs to biotechnology and agriculture application, particularly, the present invention relates to for regulating and controlling silkwormThe RNAi of pupa development and application thereof.
Background technology
Silkworm (Bombyxmori) is China's artificial feeding history of existing nearly 5000, important economic class elder brotherWorm, the product silk of silkworm is valuable textile raw material. Silkworm mainly carries out the production of silk in pupa time,The growth cycle in silkworm pupa time is very short, and weaving silk will cocoon-break after 9-14 days after cocooing and go out, once silk cocoon is snappedBreak and just lost economic worth, people will expend every year a large amount of manpower and materials and extend the time in pupa time, improveThe output of silk.
In order to address this problem, silk is general in producing at present adopts baking to process. But, this processNot only to consume a large amount of energy, also can have a strong impact on the quality of silk. Therefore, this area is in the urgent need to looking forTo new method, the exploitation silkworm larva phase becomes large and extends the silkworm method in pupa time.
Summary of the invention
The dsRNA construction and the dsRNA that the object of the present invention is to provide regulation and control silkworm pupa to grow.
Another object of the present invention is to provide the regulation and control method that silkworm pupa is grown.
In a first aspect of the present invention, a kind of dsRNA construction is provided, the construction of described dsRNA isTwo strands, and its normal chain or minus strand contain the structure shown in formula I:
SeqForward-X-SeqOppositelyFormula I
In formula,
SeqForwardFor insect regulates and controls the nucleotide sequence of related gene or fragment pupa time;
SeqOppositelyFor with SeqForwardSubstantially complementary nucleotide sequence;
X is for being positioned at SeqForwardAnd SeqOppositelyBetween intervening sequence, and described intervening sequence and SeqForwardAnd SeqOppositelyIt is not complementary,
Wherein, described insect regulates and controls related gene be selected from pupa time: PTTH gene and Torso gene.
In another preference, SeqForward、SeqOppositelyLength be 50bp at least.
In another preference, described dsRNA construction can form the dsRNA shown in formula II,
In formula,
Seq’ForwardFor SeqForwardRNA sequence or sequence fragment that sequence is corresponding;
Seq’OppositelyFor with Seq 'ForwardSubstantially complementary sequence;
X ' is nothing; Or for being positioned at Seq 'ForwardAnd Seq 'OppositelyBetween intervening sequence, and described intervening sequence withSeq’ForwardAnd Seq 'OppositelyIt is not complementary,
|| be illustrated in SeqForwardAnd SeqOppositelyBetween form hydrogen bond.
In a second aspect of the present invention, the dsRNA shown in a kind of formula II is provided,
In formula,
Seq’ForwardFor insect regulates and controls corresponding RNA sequence or the order of nucleotide sequence of related gene or fragment pupa timeRow fragment;
Seq’OppositelyFor with Seq 'ForwardSubstantially complementary sequence;
X ' is nothing; Or for being positioned at Seq 'ForwardAnd Seq 'OppositelyBetween intervening sequence, and described intervening sequence withSeq’ForwardAnd Seq 'OppositelyNot complementary;
Wherein, described insect regulates and controls related gene be selected from pupa time: PTTH gene and Torso gene;
|| be illustrated in SeqForwardAnd SeqOppositelyBetween form hydrogen bond.
In another preference, SeqForward、SeqOppositelyLength be 50bp at least.
In another preference, the length of described intervening sequence X ' is 0-300bp.
In another preference, described insect regulates and controls related gene and derive from silkworm pupa time.
In another preference, the sequence of described PTTH gene as shown in SEQIDNO.:7, described TorsoThe sequence of gene is as shown in SEQIDNO.:8.
In another preference, described insect is plant-feed insect, is preferably lepidopterous insects, is bestSilkworm.
In a third aspect of the present invention, a kind of expression vector is provided, described expression vector contains the present invention firstDsRNA construction described in aspect.
In a fourth aspect of the present invention, a kind of host cell is provided, in described host cell, contain the present inventionIn expression vector described in three aspects: or chromosome, be integrated with corresponding to described in first aspect present inventionThe DNA sequence dna of dsRNA construction.
In another preference, described host cell is plant cell, is preferably mulberry leaf cell.
In a fifth aspect of the present invention, a kind of composition is provided, described composition comprises described in first aspectDsRNA construction and/or second aspect described in dsRNA, and acceptable carrier on insect feeding.
In another preference, on described insect feeding, acceptable carrier comprises water.
In another preference, described composition is the combination for inducing or cause silkworm death in pupa timeThing.
In another preference, described dsRNA has following sequence:
DsRNA1: have corresponding to the sequence shown in SEQIDNO.:7;
DsRNA2: have corresponding to the sequence shown in SEQIDNO.:8.
In another preference, PTTH gene and/or Torso gene are from insect, preferably from squama wingOrder insect, best from silkworm.
In another preference, in described pharmaceutical composition, dsRNA1 content is 10-500ng/ μ l, betterGround is 200ng/ μ l; DsRNA2 content is 10-500ng/ μ l, is preferably 200ng/ μ l.
In a sixth aspect of the present invention, the construction of the dsRNA described in first aspect present invention is provided, orDsRNA described in second aspect, or described in the host cell described in fourth aspect or the 5th aspectThe purposes of composition, described purposes is selected from lower group:
(1) regulation and control silkworm pupa is grown; And/or
(2) extend the silkworm larva phase; And/or
(3) make death in pupa time; And/or
(4) pupa being stagnated grows; And/or
(5) extend family's silkworms spin silk time.
In a seventh aspect of the present invention, a kind of method that regulates insect growth to grow is provided, comprise step:Regulate and control the disturbing molecule of related gene expression pupa time with interference insect, or containing the carrier of described disturbing molecule, thinBorn of the same parents, plant tissue or the feed insect of feeding;
Preferably, described insect regulates and controls related gene be selected from pupa time: PTTH gene and Torso gene.
Wherein, regulate insect growth to grow one or more that are selected from lower group:
(1) regulation and control insect pupa development; And/or
(2) extend the insect larvae phase; And/or
(3) make death in pupa time; And/or
(4) pupa being stagnated grows; And/or
(5) extending insect weaves silk the time.
In another preference, described disturbing molecule is selected from: regulate and control related gene or its sheet pupa time with insectSection or its transcript are dsRNA, antisensenucleic acids, siRNA, the Microrna of inhibition or reticent target.
In another preference, described insect regulates and controls related gene and derive from silkworm pupa time.
In another preference, described insect is plant-feed insect, preferably from lepidopterous insects, bestFrom silkworm.
In another preference, described method comprises step: with the dsRNA described in first aspect present inventionConstruction, or the host cell described in the dsRNA described in second aspect or fourth aspect or the 5th sideThe insect of feeding of composition described in face.
In a eighth aspect of the present invention, a kind of method of preparing dsRNA described in second aspect present invention is provided,Comprise step:
(i) construction of dsRNA is expressed in preparation, and described construction be two strands, and its normal chain or minus strand containStructure shown in formula I:
SeqForward-X-SeqOppositelyFormula I
In formula,
SeqForwardFor insect regulates and controls the nucleotide sequence of related gene or fragment pupa time;
SeqOppositelyFor with SeqForwardSubstantially complementary nucleotide sequence;
X is for being positioned at SeqForwardAnd SeqOppositelyBetween intervening sequence, and described intervening sequence and SeqForwardAnd SeqOppositelyIt is not complementary,
Wherein, described insect regulates and controls related gene be selected from pupa time: PTTH gene and Torso gene;
(ii) construction step (i) Suo Shu is proceeded to host cell, thereby express and form formula II in host cellShown dsRNA,
In formula,
Seq’ForwardFor SeqForwardRNA sequence or sequence fragment that sequence is corresponding;
Seq’OppositelyFor with Seq 'ForwardSubstantially complementary sequence;
X ' is nothing; Or for being positioned at Seq 'ForwardAnd Seq 'OppositelyBetween intervening sequence, and described intervening sequence withSeq’ForwardAnd Seq 'OppositelyIt is not complementary,
|| be illustrated in SeqForwardAnd SeqOppositelyBetween form hydrogen bond.
In a ninth aspect of the present invention, a kind of method of preparing feed is provided, comprise step: by first partyDsRNA construction described in face, or the dsRNA described in second aspect, or described in fourth aspectHost cell, or the composition sprayed described in the 5th aspect is in plant surface, thus make feed.
In another preference, described plant is mulberry leaf.
In should be understood that within the scope of the present invention, above-mentioned each technical characterictic of the present invention and at below (as embodiment)In can combine mutually between specifically described each technical characterictic, thereby form new or preferred technical sideCase. As space is limited, tire out and state no longer one by one at this.
Brief description of the drawings
Following accompanying drawing is used for illustrating specific embodiment of the invention scheme, limits by claims institute and be not used inThe scope of the invention defining.
Fig. 1 has shown the RNAi bioassay results of 2 genes, and contrast CK uses the base for EYFPThe dsRNA of cause processes.
The result of the expression identification of the method that Fig. 2 shows RT-PCR to silkworm PTTH and Torso gene, resultShow, dsRNA can suppress the expression of PTTH and Torso gene, and the change death large and pupa time of larval phase isBecause the silence of target gene (PTTH and Torso) causes, pre-pupa refers to prepupa, and ordinate is geneRelative expression quantity.
Detailed description of the invention
The inventor, through extensive and deep research, sieves silkworm pupa period regulation related gene fragmentChoosing, is surprised to find that, for the PTTH genetic fragment as shown in SEQIDNO:7 with as SEQIDNO:Torso gene shown in 8, synthetic RNA interfering (dsRNA), described dsRNA gets by phytophagous silkwormFood, enters in insect bodies, exercises the interference to target gene, suppresses the expression of target gene, finally causes houseThe silkworm larva phase becomes large and death in pupa time, reaches the object of regulation and control growth in pupa time.
The inventive method is convenient, fast, accurate, has solved silkworm industry and must carry out cocoon drying processing and cause in producingEnergy resource consumption and silk quality decline problem, also for the control of lepidoptera pest provides reference.
RNA disturbs (RNAi)
As used herein, term " RNA disturbs (RNAinterference, RNAi) " refers to: some are littleDouble-stranded RNA can block efficiently, specifically the expression of specific gene in body, impel mRNA degraded,Lure that cell shows the phenotype of specific gene disappearance into, it is intervened also referred to as RNA or RNA interferes. RNAInterference is the gene silencing mechanism in mRNA level of high special.
As used herein, term " siRNA (smallinterferingRNA, siRNA) " refers to onePlant short-movie section double stranded rna molecule, can degrade taking the mRNA of homologous complementary sequence as target specificMRNA, this process is exactly RNA interference channel (RNAinterferencepathway).
In the present invention, the general principle that described RNA disturbs is: using plant as medium, make insect clothesThe siRNA (siRNA) that food can disturb its gene (as PTTH gene and Torso gene) to express, therebySuppress the growth of insect.
Particularly, described principle is: take food by silkworm phytophagous, make RNAi enter polypide, and rightThe RNA of target gene disturbs, and suppress the expression of target gene, thereby interference insect grows normally,Cause the silkworm larva phase to become the death in large and pupa time, thereby extend house silkworms spin silk time, the output of raising silk.
As the preferred mode of one, utilize an intron sequences, two ends connect upper complementary gene order,After transfered cell, can produce " neck-ring " structure, and " neck " shape part can be in insect bodies processed into aboutThe little RNA of 21-25nt left and right, this little RNA can especially effectively suppress the expression of genes of interest.
Insect genes
As used herein, term " insect genes " word refers to insect and regulates and controls related gene pupa time, in the present inventionA preference in, described insect genes is that PTHH gene and/or PTHH acceptor gene are (as Torso baseBecause of), the low expression of described gene or do not express processes such as the growth that causes insect, growth, metabolism, breedingsProduce extremely, even cause the death of insect. Preferably, in fruit bat, the low expression of PTHH gene orDo not express and cause the drosophila larvae phase to grow prolongation, it is large that build becomes, and the individuality after pupating is larger than normal fruit bat; TorsoThe low expression of gene or do not express and also will cause similar phenotype.
As optimal way of the present invention, the length of the fragment of the preferred insect genes of the present invention is at least 50bp,Such as being 60bp, 80bp, 100bp, 200bp, 500bp, 1000bp. Described gene is for thisWhen bright, can be full-length gene or genetic fragment, preferably, for the fragment of PTHH gene as SEQIDShown in NO:7; For the fragment of Torso gene as shown in SEQIDNO:8.
The present invention also provides the dsRNA for EYFP gene, and the sequence of described EYFP gene is as SEQIDShown in NO:9. Compare the poor effect of EYFP gene with Torso gene with PTHH gene.
The invention provides the RNA interfering that regulates and controls related gene for insect pupa time, insect can be by oral sprinklingThe plant of RNAi or expression dsRNA construction or dsRNA, take in described RNA interfering i.
DsRNA construction shown in the present is suc as formula shown in I, and dsRNA is suc as formula shown in II, the interval adoptingThe length of sequence X has no particular limits, as long as at itself and forward sequence and reverse sequence formation construction and quiltAfter importing in body, can form the dsRNA shown in formula II. As optimal way of the present invention, thisThe length of bright described intervening sequence is 80-300bp; Be more preferably 100-250bp.
In a preference of the present invention, the construction of described expression insect genes dsRNA is imported toIn host cell, described host cell can be plant cell, tissue or organ, and described construction is plantIn body, can express insect genes dsRNA, dsRNA is processed to siRNA. Usually, the length of siRNADegree is about 21-25nt left and right.
Conventionally, described construction is positioned on expression vector. Described expression vector conventionally also contain promoter,Origin of replication and/or marker gene etc. Method well-known to those having ordinary skill in the art can be used for building institute of the present inventionThe expression vector needing. These methods comprise restructuring in extracorporeal recombinant DNA technology, DNA synthetic technology, bodyTechnology etc. Described expression vector preferably comprises one or more selected markers, to be provided forSelect the phenotypic character of the host cell transforming, as kalamycin, gentamicin, hygromycin, ammonia benzyl mouldElement resistance.
Comprise above-mentioned suitable gene order and the suitable carrier of promoter or control sequence, can be forTransform suitable host. In the method for the invention, described host can be any described table that is suitable for carryingReach the host that carrier also can pass to described expression vector plant cell. Preferably, described host isAgrobacterium.
Although the insect of giving an example in example of the present invention is silkworm chrysalis. But should be understood that the present invention is for being suitable forHave no particular limits in insect of the present invention, described insect can be any can taking plant as food plantingFeeding habits insect, such as it can be lepidopterous insects.
The present invention has no particular limits for being applicable to plant of the present invention, and what preferably silkworm was edible plantsThing, for example mulberry leaf.
PTTH
As used herein, term " PTTH peptide ", " PTTH albumen ", " prothoracic gland hormone " and" prothoracicotropichormone " can exchange use. Nineteen twenty-two Kopec sends out in insect gypsymothShow the existence of this hormone, and by its called after brain hormone. At silkworm and these two research PTTH of castor silkwormModel organism in, PTTH albumen is that molecular weight is the protein of 20-30kDa. Silkworm is first synthetic to be had224 amino acid whose PTTH precursors, are then cut into and have 109 amino acid whose mature peptides. ExistingEvidence shows, PTTH can regulate and control the output of downstream moulting hormone, knocks out the drosophila larvae of PTTH genePhase grows and extends, and it is large that build obviously becomes; After pupating, individuality is also large than normal fruit bat; Knock out PTTHAfter gene, fruit bat does not lose the ability that produces moulting hormone, the time of its generation that just lagged behind completelyWith reduced concentration.
In one embodiment of the invention, based on RNAi technology, using PTTH gene as target, sieveSelected the RNA interfering fragment for PTTH gene, preferably, the sequence of described PTTH genetic fragment asShown in SEQIDNO:7:
TGACCCAGACACGAGCCCAGAAGAATTGTCCGCTTTAATAGTTGATTACGCCAATATGATTAGGAATGATGTTATTCTGTTGGATAATTCCGTTGAAACGAGAACGCGAAAAAGGGGAAACATTCAAGTTGAAAACCAAGCTATTCCGGACCCACCTTGCACTTGCGAATACAAGAAAGAAATAGAAGACTTGGGCGAAAACTCTGTTCCACGCTTCATTGAAACCAGAAACTGCAATAAAACACAACAGCCGACCTGTCGACCCCCGTACATTTGCAAAGAAAGTTTATACAGTATAACTATTTTAAAAAGAAGGGAGACTAAATCGCAGGAGTCTCTCGAGATACCGAATGAATTGAAATATCGATGGGTGGCGGAATCTCACCCCGTCAGCGTGGCGTGTTTG(SEQIDNO.:7)
Torso
Torso gene code is as a kind of transmembrane protein, i.e. a Torso of extracellular signal molecular receptorAlbumen. This signaling molecule or its precursor are stored in dotter haut and cover ovum by the follicle cell at ovum two endsIn perivitelline space between vitellinae membrana. Torso acceptor is a kind of EGFR-TK, in the growth course of insectIn, Torso acceptor can mediate the formation of polypide body extremity structure, epimerite and periproct after being occupied by aglucon.As the acceptor of PTTH hormone, in prothoracic gland, knock out or reduce Torso gene, all can produce and knock outThe similar phenotype of PTTH gene.
In one embodiment of the invention, based on RNAi technology, using Torso gene as target, sieveSelect the RNA fragment for Torso gene, preferably, the sequence SEQID of described Torso genetic fragmentShown in NO:8:
TAGCGTGGGCGAAGCCACATTTTCAACCGGAGATTTATAATGTGACCGTTCGAGCTAATATGATAAGATCGATTATTTTACCCGGGAACGCGACTGAAACTACATTTAGAAACATACCCAACACGTTCCTTAGCGCCGGCAAAATCTACAATGTTTCGGTTTACGCAATAATTGGCCAGAAAGCTTCCCACACAAGTAGAAGAGCTTTTACTCCAGGCATGCTGCGCTGGGTGTGGGCGGGCGCCACGGCAGGCGCGGGGTGCGCGGCGGGGGGGCTGCTCGCGGCCACCCTGCTGTGCTGTGGACACCGCCGCGCTACCAGTCGCGTGTCACAGGAAGACCCCGACGAGAAAACGCCCAAAGAAGACGATGTCGAAATAATCGGCATCGAATCGGGCAGCGCAGACGATCACTGGGAGGTACGCTCGGACCGGGTGCTACTGCACGAAGTCATCGGCGAAGGAGCCTTCGGCGTCGTGCGGAGAGGCACTCTCGCGCCGGGAGGCAAGTCGGTCG(SEQIDNO.:8)
DsRNA construction and application thereof
The invention provides a kind of dsRNA construction, the construction of described dsRNA is double-stranded, and it justChain or minus strand contain the structure shown in formula I:
SeqForward-X-SeqOppositelyFormula I
In formula,
SeqForwardFor insect regulates and controls the nucleotide sequence of related gene or fragment pupa time;
SeqOppositelyFor with SeqForwardSubstantially complementary nucleotide sequence;
X is for being positioned at SeqForwardAnd SeqOppositelyBetween intervening sequence, and described intervening sequence and SeqForwardAnd SeqOppositelyIt is not complementary,
Wherein, described insect to regulate and control related gene pupa time be PTTH gene or Torso gene.
In a preference of the present invention, SeqForward、SeqOppositelyLength be 50bp at least.
In a preference of the present invention, after described dsRNA construction is ingested by insect (as silkworm), formDsRNA shown in formula II,
In formula,
Seq’ForwardFor SeqForwardRNA sequence or sequence fragment that sequence is corresponding;
Seq’OppositelyFor with Seq 'ForwardSubstantially complementary sequence;
X ' is nothing; Or for being positioned at Seq 'ForwardAnd Seq 'OppositelyBetween intervening sequence, and described intervening sequence withSeq’ForwardAnd Seq 'OppositelyIt is not complementary,
|| be illustrated in SeqForwardAnd SeqOppositelyBetween form hydrogen bond.
The present invention also provides the purposes of described dsRNA construction, and it is used to: regulation and control silkworm pupa is grown; OrExtend the silkworm larva phase; Or make death in pupa time; Or make pupa stagnate growth; Or extend family's silkworms spin silk time.
DsRNA and application thereof
It is a kind of suc as formula the dsRNA shown in II that the present invention also provides,
In formula,
Seq’ForwardFor SeqForwardRNA sequence or sequence fragment that sequence is corresponding;
Seq’OppositelyFor with Seq 'ForwardSubstantially complementary sequence;
X ' is nothing; Or for being positioned at Seq 'ForwardAnd Seq 'OppositelyBetween intervening sequence, and described intervening sequence withSeq’ForwardAnd Seq 'OppositelyIt is not complementary,
|| be illustrated in SeqForwardAnd SeqOppositelyBetween form hydrogen bond.
In another preference, the length of described intervening sequence X is 0-300bp, is preferably 80bp.
Described insect regulates and controls related gene and derive from silkworm pupa time; The sequence of PTTH gene is as SEQIDNO.:Shown in 7, the sequence of Torso gene is as shown in SEQIDNO.:8.
In another preference, described insect is plant-feed insect, preferably from lepidopterous insects, bestFrom silkworm.
The present invention also provides the purposes of described dsRNA, and it is used to: regulation and control silkworm pupa is grown; Or prolongation manThe silkworm larva phase; Or make death in pupa time; Or make pupa stagnate growth; Or extend family's silkworms spin silk time.
Composition and application thereof
The present invention also provides a kind of composition, and the inventor is for extending the difficult problem in domestic silkworm pupal stage growth cycle,Based on RNAi technological development for the RNAi fragment of target gene, and by feeding by insect, leadCausing the silkworm larva phase extends, and improves the death rate in pupa time, makes RNAi play the effect of inhibition of gene expression,Reach eventually the object that improves silk yield. The inventive method is convenient, fast, accurate and nuisanceless.
Described composition comprises dsRNA construction and/or dsRNA, and acceptable effective on insect feedingThe carrier of amount. In another preference, described composition is for inducing or causing silkworm death in pupa timeComposition.
In another preference, described dsRNA has following sequence:
DsRNA1: have corresponding to the sequence shown in SEQIDNO.:7;
DsRNA2: have corresponding to the sequence shown in SEQIDNO.:8.
The present invention also provides the purposes of described composition, and described purposes is selected from lower group:
Regulation and control silkworm pupa is grown; Or extend the silkworm larva phase; Or make death in pupa time; Or make pupa stagnate growth; Or prolongLong family silkworms spin silk time.
In a preference of the present invention, composition is the aqueous solution, and pH is about 5-8 conventionally, preferably,PH is about 6-8.
As used herein, term " effective dose " or " effective dose " refer to and can produce function to described insect feedingOr amount activity and that can be accepted by described insect. Preferably, the content of dsRNA1 is about 10-500Ng/ μ l; The content of dsRNA2 is about 10-500ng/ μ l; More, dsRNA1 content is 200ng/ μ l,DsRNA2 content is 200ng/ μ l. Preferably the selection of effective dose can be by those of ordinary skill in the art according to variousFor example, because usually determining (passing through feeding experiment).
As used herein, the composition of " acceptable on insect feeding " is to be applicable to described insect and without excessively notGood side reaction (as toxicity, stimulation and allergy), has the material of rational benefit/risk ratio.
As used herein, term " carrier " comprises various excipient and diluent. This class carrier comprises (but notBe limited to): water, salt solution, buffer solution, glucose, glycerine, ethanol and combination thereof.
Composition of the present invention can directly spray, feeding, or is made into injection form, for example water, lifeReason salt solution or the aqueous solution that contains glucose and other assistant agents are prepared by conventional method. Described combinationThing should be manufactured under aseptic or condition without RNA enzyme.
Advantage of the present invention
1) the present invention for regulate and control silkworm pupa grow RNAi position control, efficiency high, nuisanceless;
2) dsRNA obtaining can directly apply to silkworm cultivation, easy to use;
3) production cost is low, and good stability is applicable to produce;
4) environment compatibility is good.
Below in conjunction with specific embodiment, further set forth the present invention. Should be understood that these embodiment are only for sayingBright the present invention and being not used in limits the scope of the invention. The experiment side of unreceipted actual conditions in the following exampleMethod, conventionally according to normal condition as people such as Sambrook, molecular cloning: laboratory manual (NewYork:ColdSpringHarborLaboratoryPress, 1989) condition described in, or advise according to manufacturerCondition.
Embodiment 1
Screening target gene
1. the extraction of the total RNA of silkworm
Sample: silkworm is made greatly strain (P50).
Method: adopt conventional Trizol method to extract the total RNA of silkworm, and purify by conventional method. Use DNAEnzyme is processed the RNA obtaining, and obtains concentration >=300ng/ μ l, total amount >=6 μ g, OD260/280Total for 1.8-2.2RNA sample.
The separation of 2.mRNA and cDNA's is synthetic
Use with the magnetic bead of oligo-dT and isolate the mRNA with polyA, then use random 6 polymers andBe purchased from the synthetic cDNA first of SuperscriptIIreversetranscriptase kit of Invitrogen companyChain.
3. the amplification of gene and order-checking
Utilize the special primer of target gene to increase, by the genetic fragment purifying obtaining, be connected toIn PMD-18 carrier (production of Takara company), transform commercially available host cell (Top10 bacterial strain), use blueHickie screening method is selected suitable host cell, selects positive strain and carry out the sequence verification of genes of interest.
Wherein, primer sequence is in table 1.
Table 1
Embodiment 2
DsRNA's is synthetic
In the present embodiment, the inventor utilizes MAGEkit to synthesize, and obtains and can be used for biologicall testdsRNA。
UtilizeT7Kit (purchased from AMBION company, product article No. AM1334) carries out targetGene dsRNA's is synthetic, obtains the dsRNA that can be used for biologicall test. Its brief principle is: first use silkwormTotal RNA of larva tissue is template, and reverse transcription obtains cDNA, then uses two genes of primer (in table 1) amplificationDomain, its product is carried out to purifying, then taking purified product as template, utilizes kit to carry out in-vitro transcription,Obtain after dsRNA, then remove the DNA in product, and carry out purification process, just can obtain requireddsRNA。
Concrete operation step is as follows: taking the DNA sequence dna in two gene structure territories of aforementioned acquisition as template, according toDescription in AM1334Kit operates:
1) in-vitro transcription obtains dsRNA
Add without water to the 20 μ L of RNA enzyme and mix, of short duration centrifugal, hatch 4h for 37 DEG C.
2) eliminate DNA
In-vitro transcription reaction finishes, and contains a small amount of template DNA in enzyme reaction system, need to be at the work of DNaseIWith under digest, in above-mentioned reactant liquor, add the DnaseI of 1 μ L, mix, hatch 30min for 37 DEG C.
3) dsRNA purifying
In above-mentioned reaction system: add 100 μ L and 15 μ L ammonium acetate cessation reactions; Add equal-volume phenol/chloroform/differentAmylalcohol mixes liquid (25: 24: 1): 4 DEG C of 15000r/min, centrifugal 15min, gets upper water phase transfer to new 1.5mLIn centrifuge tube; Add 140 μ L (equal-volume) chloroform/isoamyl alcohol to mix liquid (24: 1); Add 12 μ L (1/10 volume)3M SAS (pH5.5); Add 2 times of volume absolute ethyl alcohols ,-20 DEG C of precipitated rnas that spend the night; 12000r/minCentrifugal 15-30min; Abandon supernatant, add 70% ethanol 250 μ L, room temperature blow and beat gently washing: 12000r/min fromHeart 10min, abandons supernatant, drying at room temperature precipitation; With appropriate TE dissolution precipitation. The final dsRNA obtaining respectivelyCalled after: dsPTTH, dsTorso, electrophoresis qualification, has successfully obtained required dsRNA.
Embodiment 3
The application of dsRNA
In the present embodiment, 2 kinds of dsRNA that obtain in embodiment 2 are prepared as respectively dsRNA by the inventorThe aqueous solution, concentration is all 200ng/ μ l. Every kind of dsRNA aqueous solution is got 300 μ l respectively, be sprayed on mulberry leaf,And the silkworm of feeding, once a day, continuous 5 days, set 3 groups and repeat experiment, every group uses 30 silkworms, everyIt carries out dsRNA effect identification.
Result shows, compared with EYFP gene
(1) for the dsRNA of 2 target genes (PTTH and Torso gene) to pupa time silkworm there is lethal workWith, wherein, in dsRNAPTTH group, dead pupa time, three groups of silkworms were respectively 20,22 and 23, flatEqual 21.7, the death rate reaches 72.3%; In dsRNATorso group, dead pupa time, three groups of silkworms were respectively19,21 and 23, average 21, the death rate reaches 70%.
(2) table to PTTH and Torso gene for the dsRNA of 2 target genes (PTTH and Torso gene)Reach and there is strong inhibitory action.
Fig. 1 has shown the lethal result of dsRNA to silkworm in pupa time.
The result of the expression identification of the method that Fig. 2 shows RT-PCR to silkworm PTTH and Torso gene.
Result shows, dsRNA can suppress the expression of PTTH and Torso gene, the change of larval phase large and pupa timeDeath be that pre-pupa refers to prepupa, ordinate because the silence of target gene (PTTH and Torso) causesFor the relative expression quantity of gene.
Embodiment 4
The preparation of composition
The present embodiment provides a kind of composition of growing for regulating and controlling silkworm pupa, and said composition is the aqueous solution,Comprise component:
1. for the dsRNA of sequence PTTH genetic fragment as shown in SEQIDNO.:7
Concentration is 200ng/ μ l;
2. for the dsRNA of sequence Torso genetic fragment as shown in SEQIDNO.:8
Concentration is 200ng/ μ l.
All documents of mentioning in the present invention are all quoted as a reference in this application, just as each section of documentQuoted separately as a reference. In addition should be understood that after having read above-mentioned instruction content of the present invention,Those skilled in the art can make various changes or modifications the present invention, and these equivalent form of values fall within this Shen equallyPlease appended claims limited range.
Claims (12)
1. a dsRNA construction, is characterized in that, the construction of described dsRNA is double-stranded, and itsNormal chain or minus strand contain the structure shown in formula I:
SeqForward-X-SeqOppositelyFormula I
In formula,
SeqForwardFor insect regulates and controls the nucleotide sequence of the fragment of related gene pupa time;
SeqOppositelyFor with SeqForwardComplementary nucleotide sequence;
X is for being positioned at SeqForwardAnd SeqOppositelyBetween intervening sequence, and described intervening sequence and SeqForwardAnd SeqOppositelyIt is not complementary,
Wherein, described insect regulates and controls related gene be selected from pupa time: PTTH gene and Torso gene; Wherein,The nucleotide sequence of the fragment of PTTH gene as shown in SEQIDNO.7, the core of the fragment of Torso geneNucleotide sequence is as shown in SEQIDNO.8;
Described insect is silkworm.
2. dsRNA construction as claimed in claim 1, is characterized in that, described dsRNA construction canForm the dsRNA shown in formula II,
In formula,
Seq’ForwardFor SeqForwardRNA sequence or sequence fragment that sequence is corresponding;
Seq’OppositelyFor with Seq 'ForwardComplementary sequence;
X ' is nothing; Or for being positioned at Seq 'ForwardAnd Seq 'OppositelyBetween intervening sequence, and described intervening sequence withSeq’ForwardAnd Seq 'OppositelyIt is not complementary,
|| be illustrated in SeqForwardAnd SeqOppositelyBetween form hydrogen bond.
3. the dsRNA shown in formula II,
In formula,
Seq’ForwardFor insect regulates and controls the RNA sequence corresponding to nucleotide sequence of the fragment of related gene pupa time;
Seq’OppositelyFor with Seq 'ForwardComplementary sequence;
X ' is nothing; Or for being positioned at Seq 'ForwardAnd Seq 'OppositelyBetween intervening sequence, and described intervening sequence withSeq’ForwardAnd Seq 'OppositelyNot complementary;
Wherein, described insect regulates and controls related gene be selected from pupa time: PTTH gene and Torso gene; Wherein,The sequence of the fragment of PTTH gene is as shown in SEQIDNO.7, and the sequence of the fragment of Torso gene is as SEQShown in IDNO.8;
|| be illustrated in SeqForwardAnd SeqOppositelyBetween form hydrogen bond;
Described insect is silkworm.
4. an expression vector, is characterized in that, described expression vector contains dsRNA claimed in claim 1Construction.
5. a host cell, is characterized in that, contains expression claimed in claim 4 in described host cellIn the chromosome of carrier or described host cell, be integrated with corresponding to dsRNA construction claimed in claim 1DNA sequence dna.
6. host cell as claimed in claim 5, is characterized in that, described host cell is mulberry leaf cell.
7. a composition, is characterized in that, described composition comprises that dsRNA claimed in claim 1 buildsThing and/or dsRNA claimed in claim 3, and acceptable carrier on insect feeding,
Described insect is silkworm.
8. dsRNA construction claimed in claim 1, or dsRNA claimed in claim 3, or rightDescribed in host cell described in requirement 5 or claim 7, the purposes of composition, is characterized in that, for makingSilkworm is in death in pupa time.
9. purposes as claimed in claim 8, is characterized in that, also for:
(1) regulation and control silkworm pupa is grown; And/or
(2) extend the silkworm larva phase; And/or
(3) pupa being stagnated grows; And/or
(4) extend family's silkworms spin silk time.
10. a method that regulates insect growth to grow, is characterized in that, comprises step: use interference insectRegulate and control the disturbing molecule of related gene expression pupa time, or contain carrier, cell, the plant group of described disturbing moleculeKnit or the feed insect of feeding,
Wherein, described insect regulates and controls related gene be selected from pupa time: PTTH gene and Torso gene; DescribedThe sequence of disturbing molecule is as shown in SEQIDNO.7, or as shown in SEQIDNO.8;
Described insect is silkworm; Described adjusting insect growth is grown for making death in pupa time.
11. methods as claimed in claim 10, is characterized in that, comprise step: by claim 1The dsRNA construction of stating, or dsRNA claimed in claim 3 or host claimed in claim 5 thinThe composition insect of feeding described in born of the same parents or claim 7.
Prepare the method for feed, comprise step for 12. 1 kinds: by dsRNA construction claimed in claim 1,Or the dsRNA described in claim 3, or host cell claimed in claim 5, or claim 7Described composition sprayed is in mulberry leaf surface, thereby makes feed.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201210019269.5A CN103215266B (en) | 2012-01-20 | 2012-01-20 | RNAi and the application thereof of growing for regulating and controlling silkworm pupa |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201210019269.5A CN103215266B (en) | 2012-01-20 | 2012-01-20 | RNAi and the application thereof of growing for regulating and controlling silkworm pupa |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103215266A CN103215266A (en) | 2013-07-24 |
CN103215266B true CN103215266B (en) | 2016-05-25 |
Family
ID=48813425
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201210019269.5A Expired - Fee Related CN103215266B (en) | 2012-01-20 | 2012-01-20 | RNAi and the application thereof of growing for regulating and controlling silkworm pupa |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103215266B (en) |
Families Citing this family (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104694548B (en) * | 2013-12-05 | 2017-12-15 | 中国科学院遗传与发育生物学研究所 | Insect thoratropic hormone gene and its application in terms of plant anti-insect |
CN104805085A (en) * | 2014-01-29 | 2015-07-29 | 江苏命码生物科技有限公司 | Tandem expressed siRNA and use of tandem expressed siRNA in treatment on chronic lymphocytic leukemia |
CN104928294A (en) * | 2015-06-08 | 2015-09-23 | 云南大学 | Method for inhibiting spodoptera lituras from growth development and reproduction by use of dsRNA of SPR gene |
CN106554962B (en) * | 2015-09-30 | 2021-06-04 | 中国科学院上海药物研究所 | Prevention, diagnosis and treatment of GPR160 overexpressing cancers |
CN108048464B (en) * | 2017-12-19 | 2021-01-19 | 浙江大学 | siRNA for enabling first-rate silkworm to produce non-diapause eggs, preparation method and application |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101851622A (en) * | 2010-01-15 | 2010-10-06 | 中国科学院微生物研究所 | Method for cultivating transgenic plant with improved insect resistance by using RNA interference technology and special DNA fragment thereof |
-
2012
- 2012-01-20 CN CN201210019269.5A patent/CN103215266B/en not_active Expired - Fee Related
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101851622A (en) * | 2010-01-15 | 2010-10-06 | 中国科学院微生物研究所 | Method for cultivating transgenic plant with improved insect resistance by using RNA interference technology and special DNA fragment thereof |
Non-Patent Citations (3)
Title |
---|
RNAi-dsRNA介导的基因沉默;刘家云等;《国外医学遗传学分册》;20040215;第27卷(第1期);第4-10页 * |
The Insect Neuropeptide PTTH Activates Receptor Tysosine Kinase Torso to initiate Metamorphosis;Kim等;《Science》;20091204;第326卷;摘要部分,第1403页右栏第2段 * |
靶向口蹄疫病毒IRES 区RNA 干扰位点的选择及shRNA 表达载体的构建与鉴定;崔丽瑾等;《动物医学进展》;20101231;第31卷(第3期);第1-5页 * |
Also Published As
Publication number | Publication date |
---|---|
CN103215266A (en) | 2013-07-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP5735927B2 (en) | Re-engineering the primary structure of mRNA to enhance protein production | |
CN103215266B (en) | RNAi and the application thereof of growing for regulating and controlling silkworm pupa | |
AU2009328633B2 (en) | Methods of modulating the sex of avians | |
CA2546853A1 (en) | Use of interfering rna in the production of transgenic animals | |
US20100169991A1 (en) | Biopesticide comprising insect belonging to family coccinellidae | |
CN108610427A (en) | Migratory locusts diapause hormone gene and its application in regulating and controlling Insect Diapause | |
CN104611348A (en) | Cotton fiber predominantly-expressed gene, expression vector and applications thereof, and preparation method of transgenic cotton containing gene | |
CN103088031A (en) | Insect fin plate dysplasia gene segment as well as dsRNA (Ribose Nucleic Acid) and application thereof | |
CN106676112B (en) | Citrus fruit fly Taiman gene and its qRT-PCR detection method and its siRNA | |
CN113122539A (en) | RNA interference fragment of donkey Zfy gene, expression vector and application thereof | |
CN110295169B (en) | MiRNA and application thereof in killing Nilaparvata lugens | |
SG189245A1 (en) | Preventive or therapeutic agent for fibrosis | |
CN101932708A (en) | Improved gene silencing methods | |
CN104313031B (en) | Freshwater shrimp molt-inhibiting hormone gene and its application in accelerating freshwater shrimp to cast off a skin and grow | |
CN102266571B (en) | Application of microRNA 302 in early embryonic development | |
CN108795933B (en) | Method for changing feeding habits of silkworms and application thereof | |
CN110904105B (en) | MSX promoter capable of being inhibited by pinctada martensii SMAD1/5 gene and application thereof | |
CN110643607B (en) | microRNA related to reproductive function of Liaoyu white cattle and obtaining method thereof | |
CN109295058B (en) | MicroRNA sponge for inhibiting miR-34 family molecules, nucleic acid construct and application | |
KR101873327B1 (en) | Novel homing endonuclease from arabidopsis thaliana | |
CN116376913A (en) | miRNA and application thereof in rice insecticidal improvement | |
US7994303B2 (en) | Penaeidin gene promoters in tiger shrimp and applications thereof | |
CN116121253A (en) | Application of lncRNA and antisense oligonucleotide thereof | |
CN117965545A (en) | MiR-8492-3p for preventing lepidoptera pests and application thereof | |
AU2015204349B2 (en) | Use of interfering RNA in the production of transgenic animals |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160525 Termination date: 20190120 |
|
CF01 | Termination of patent right due to non-payment of annual fee |