CN110295169B

CN110295169B - MiRNA and application thereof in killing Nilaparvata lugens

Info

Publication number: CN110295169B
Application number: CN201910564291.XA
Authority: CN
Inventors: 姚英娟; 李祥; 华红霞; 徐雪亮
Original assignee: Agricultural Application Microbe Institute Of Jiangxi Academy Of Agricultural Sciences (jiangxi Rural Energy Research Center); Huazhong Agricultural University
Current assignee: Agricultural Application Microbe Institute Of Jiangxi Academy Of Agricultural Sciences (jiangxi Rural Energy Research Center); Huazhong Agricultural University
Priority date: 2019-06-27
Filing date: 2019-06-27
Publication date: 2022-11-08
Anticipated expiration: 2039-06-27
Also published as: CN110295169A

Abstract

The invention provides miRNA and application thereof in killing Nilaparvata lugens, the technical scheme researches the possibility of inhibiting the growth of Nilaparvata lugens by using a gene regulation method through an experimental means, and on the basis, the miRNA with lethal effect on Nilaparvata lugens, namely Nlu-mir-9a, is obtained through screening. Nlu-mir-9a initial transcripts were cloned, and Nlu-mir-9a precursor and Nlu-mir-9a mature body sequences were published. Nlu-mir-9a was demonstrated to act on the 3' UTR of the NlUbx gene and negatively regulate the expression level of NlUbx. The molting of the brown planthopper is hindered when the brown planthopper grows from the low age to the high age (or eclosion), and the brown planthopper finally dies due to incapability of activity and feeding. Based on the new properties discovered above, nlu-mir-9a can act on the brown planthopper in an injection mode, so that the killing effect is realized; the brown planthopper control drug can also be prepared by using the same; the transgenic rice strain can be constructed based on the gene to express Nlu-mir-9a precursor and Nlu-mir-9a mature body for preventing and treating the damage of brown planthopper.

Description

MiRNA and application thereof in killing Nilaparvata lugens

Technical Field

The invention relates to the technical field of molecular biology, in particular to miRNA and application thereof in killing Nilaparvata lugens.

Background

Brown planthopper belongs to Hemiptera and plant hopper (Hemiptera: delphacidae) and is one of important pests on rice. The brown planthopper has single feeding property and is only harmful to a few of rice plants such as rice and the like; the harm is characterized by concealment, explosiveness, destructiveness and the like. In addition, brown planthopper can also transmit rice straw dwarf virus (rice straw stunt virus), tooth-leaved dwarf virus (rice strained stunt virus), and wilting dwarf virus (rice-wounded stunt virus). According to statistics, nearly half of rice planting production areas in China are damaged by brown planthoppers in different degrees, and the rice loss caused by the brown planthoppers is up to 100-150 ten thousand tons every year. Since the 21 st century, the area of damage and the number of outbreaks of brown planthopper in each rice field have been on the increasing trend year by year. At present, the prevention and control of brown planthopper mainly depends on chemical prevention and control, so that the problems of drug resistance and the like are increasingly serious, and a new pest prevention and control measure is urgently needed to be found.

The microRNA is a single-stranded small-molecule RNA with only 18-25 nucleotides, widely exists in nematodes, drosophila, plants and eukaryotes including human, does not have an open reading frame and cannot encode protein, the sequence of the microRNA is highly conserved in evolution, and the expression of the microRNA has obvious tissue specificity and time specificity in the development process. In organisms, miRNA can cooperate with elements such as AGO, dicer, TRBP, PACT and the like to form miRISC, which can negatively regulate and control the expression of target genes by degrading mRNA or inhibiting the translation of mRNA.

Due to the characteristic that the functions of the miRNAs are conservative, the miRNAs are more widely concerned in the research of insects. A large number of researches on various insects mainly including drosophila melanogaster show that miRNA participates in almost all physiological processes of growth and development, metamorphosis and development, reproduction, immunity and the like of the insects. The over-expression of miRNA can inhibit the expression of target genes thereof and further inhibit the corresponding transcription process, and can lead to the development malformation and even death of organisms in severe cases. For example, overexpression of mir-2 in Blattella germanica and overexpression of mir-6 and mir-11 in Drosophila will result in death of the insects. At present, researches on miRNA of brown planthopper are relatively few, zhang and the like inhibit miRNAs in brown planthopper bodies to play a function by constructing dicer1 deletion mutation, and can obviously inhibit the formation of oocytes. Overexpression of mir-2703 in brown planthopper can inhibit expression of chitin synthase gene CHSA, and cause difficult moulting of nymphs and death. However, no example or report of utilizing miRNA to control brown planthopper exists at present.

Disclosure of Invention

The invention aims to overcome the technical defects of the prior art and provides miRNA and application thereof in killing Nilaparvata lugens so as to expand the molecular biological control method of Nilaparvata lugens.

The other technical problem to be solved by the invention is that the specific gene which can inhibit and kill the brown planthopper through the gene regulation function is not clear.

The invention aims to solve the technical problem that the principle of the killing effect of the Nlu-mir-9a gene on brown planthopper is not clear.

In order to achieve the technical purpose, the invention adopts the following technical scheme:

a miRNA, the nucleotide sequence of which is shown in SEQ ID NO 1.

On the basis, the invention further provides application of the miRNA in killing brown planthoppers.

Preferably, the application is to inject the miRNA into the brown planthopper body.

Preferably, the injection dosage of each brown planthopper is 50-100 ng.

Preferably, the brown planthopper is a brown planthopper nymph.

Preferably, the injection comprises the following steps: the miRNA is treated with RNase-free ddH ₂ Diluting O to 5ng/nL concentration; collecting 3-day-old brown planthopper nymphs, and firstly using CO with the air flow rate of 180-220 mL/min ₂ And (3) narcotizing the brown planthopper nymphs for 15s, and then injecting the diluted miRNA solution from the part between the midfeet of the ventral surfaces of the brown planthopper nymphs by using a microinjection instrument under a stereoscopic microscope, wherein the miRNA injection dose is 50-100 ng.

On the basis, the invention further provides application of the miRNA in preparing a brown planthopper control drug.

Preferably, the dosage form of the medicament is injection.

Preferably, the drug acts on the 3' UTR of the NlUbx gene and negatively regulates the expression level of the NlUbx gene.

Preferably, the medicament retards molting of brown planthopper from low age to high age or at eclosion, which is dead from immobility and feeding.

Drawings

FIG. 1 is a diagram of Nlu-mir-9a minimum free energy analysis and secondary structure prediction in an embodiment of the present invention; wherein part A is primary Nlu-mir-9a; part B is precursor Nlu-mir-9a; the analysis result is from RNAfold WebServer.

FIG. 2 is a graph showing the effect of injecting mimics and inhibitors on the expression level of Nlu-mir-9a in an embodiment of the present invention; in the figure, the A, B part is the effect of injecting mimics on the Nlu-mir-9a expression level in the long wing strain (A) and the short wing strain (B); C. section D is the effect of injection of inhibitors on the expression level of Nlu-mir-9a in the long wing lines (C) and the short wing lines (D).

FIG. 3 is a graph showing the effect of injecting mimics and inhibitors on the expression level of NlUbx in an embodiment of the present invention; in the figure, part A, B is the effect of injecting mimics on the expression level of NlUbx in long-wing lines (a) and short-wing lines (B); C. part D is the effect of injection of inhibilors on NlUbx expression levels in the long wing line (C) and the short wing line (D).

FIG. 4 is a graph showing the effect of Ubx gene injection on the survival rate of Nilaparvata lugens in an embodiment of the present invention; in the figure, section a is the survival rate of long wing lines; part B is the survival rate of the brachypteran line.

FIG. 5 is a structural diagram of a dual luciferase gene reporter vector according to an embodiment of the present invention.

FIG. 6 is a graph of dual luciferase gene report experiment results in accordance with an embodiment of the present invention; in the figure, part a is a dual luciferase reporter assay with wild-type vector; dual luciferase reporter assay with mutant 1 vector as part B; dual luciferase reporter assay with mutant 2 vector in part C.

FIG. 7 is a graph showing the results of experiments on the survival rate of 3 instar nymphs of brown planthopper after injection of Nlu-mir-9a mics; in the figure, part a is the survival rate of long wing lines (50 ng dose); part B is survival rate of the brachyptera line (50 ng dose); part C is survival rate of long wing lines (100 ng dose); part D is survival rate of the brachypteran line (100 ng dose).

Detailed Description

Hereinafter, specific embodiments of the present invention will be described in detail. Well-known structures or functions may not be described in detail in the following embodiments in order to avoid unnecessarily obscuring the details. Approximating language, as used herein in the following examples, may be applied to identify quantitative representations that could permissibly vary in number without resulting in a change in the basic function. Unless defined otherwise, technical and scientific terms used in the following examples have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

1. Full-length cloning and sequence analysis of Nlu-mir-9a

1.1 materials and methods

1.1.1 MiRNA extraction

Reference is made to the reagents and procedures provided in the miRNeasy Mini Kit (cat No. 217004, QIAGEN, germany). First, a test sample was thoroughly ground in a glass homogenizer pre-cooled with liquid nitrogen, and then 700. Mu.L of QIAzol reagent was added to lyse tissues and cells. The released miRNA is specifically bound to a silica gel membrane medium of the adsorption column under certain salt solution and pH conditions, and micromolecular impurities such as DNA, protein, salt and the like are removed through a washing step. Adding 30. Mu.L of RNase-free H ₂ And O, eluting miRNA.

1.1.2 cDNA full-Length cloning of miRNA

RACE (Rapid amplification of cDNA ends) full-length cloning technology obtains complete 5 'end and 3' end sequences of a transcript on the basis of a section of known sequences in the transcript. RACE reaction was carried out with reference to the reagents and procedures provided in SMARTer RACE 5'/3' kit (cat No. 634858, clontech, japan). Respectively synthesizing 5'-RACE cDNA and 3' -RACE cDNA by using 1 mu g of miRNA as initial templates and 5'-CDS primer A, 3' -CDS primer A and Oligonucleotide as primers under the action of reverse transcriptase, wherein the obtained RACE-cDNA comprises a section of specific joint with a known sequence. By ddH ₂ Diluting the solution by 10 times with O for later use.

Dropping PCR: 5'-RACE cDNA and 3' -RACE cDNA were used as amplification templates, respectively, and 5'GSP (gene specific Primer) or 3' GSP and UPM (Universal Primer Mix containing equal proportions of Long Primer and Short Primer) supplied by kit were used as primers. Each reaction was prepared as a 50. Mu.L reaction system containing 25. Mu.L, 5'-RACE cDNA or 3' -RACE cDNA 2. Mu.L, 10 XUPM 5. Mu.L, 5'GSP or 3' GSP 2. Mu.L (10. Mu.M concentration), ddH ₂ O16. Mu.L. Reaction procedure: pre-denaturation at 94 deg.C for 5min;5 cycles (94 ℃ 30s,72 ℃ 3 min); 5 cycles (94 ℃ 30s,70 ℃ 30s,72 ℃ 3 min); 5 cycles (94 ℃ 30s,68 ℃ 30s,72 ℃ 3 min); 15 cycles (94 ℃ 30s,66 ℃ 30s,72 ℃ 3 min); 10min at 72 ℃; the temperature is reduced to 25 ℃.

Nested PCR: the 5 'touchdown PCR product and the 3' touchdown PCR product were used as amplification templates, and 5'NGSP (nested gene specific Primer) or 3' NGSP and Short Primer were used as primers. Each reaction was prepared as a 50. Mu.L reaction system containing 2. Mu.L of 2 XPCR premix 25. Mu.L, 5 'or 3' touchdown PCR product 2. Mu.L, short Primer 2. Mu.L (10. Mu.M concentration), 5'NGSP or 3' NGSP 2. Mu.L (10. Mu.M concentration), ddH ₂ O19. Mu.L. Reaction procedure: pre-denaturation at 94 ℃ for 5min;35 cycles (94 ℃ 30s,65 ℃ 30s,72 ℃ 3 min); 10min at 72 ℃; the temperature is reduced to 25 ℃.

After the reaction, the PCR product was sent to Biotechnology engineering (Shanghai) Co., ltd for sequencing. 1.2 results and analysis

Through RACE technology, the full-length sequence of Nlu-mir-9a initial transcript (primary Nlu-mir-9 a) is obtained as follows: 5'-ACAUGGGCAUAGUCCGAAAUAUUACAGUAACAUUAUUAAUAAUUAUUACUUUAUUUGUAAUUGUAUCUACUAAUAAAUAAAUAUUACAUCAAUUACAUCAAUAUCAGUAGCUCCAUUAAUAUCUGCGAUAGUAGACUUUGAUAUCAUCAUGGCGAUGGCUGAAGAAAACGACUGAAUCCUUCAAUCUUCAAGAAGGUGCUGACGCUUUCUUUGGUUAUCUAGCUGUAUGAACGUUCGAUAUCAUAAAGCUAGGUUACCGAAGUUAUUAUCAGCAUCUGAUCUCUGCUCUACACUCACACUGCGACUCCCUUCUUUCAAUCAGGCCCCACCAGAGGAUUUUUAUUAUUUAAUUACCAAUUUUGUAAUUAUAACGUGGACCUCACUAUAGUAGACCAGUUCUCAAUAUUUAUAUUGUAUCUUGCUUUAUUCAGCAUCAUUAUUCAAUAGCAUAAUUAUUCAAAAAAAAAAAAAAAAAAAAAAAAAA-3'.

Nlu-mir-9a initial transcript has a total length of 484nt, contains a poly (A) sequence with a length of 26nt and a minimum free energy of-90.20 kcal/mol; the precursor Nlu-mir-9a precursor (precursor Nlu-mir-9 a) has a total length of 68nt and a minimum free energy of-22.90 kcal/mol (shown in FIG. 1). Nlu-mir-9a mature body is a segment with the length of 22nt, namely: 5'-UCUUUGGUUAUCUAGCUGUAUGA-3'.

2. Nlu-mir-9a regulates NlUbx expression

2.1 materials and methods

2.1.1 microinjection

Nlu-mir-9a mimics and inhibitors were injected at 100ng and 50ng, respectively, and as controls, non-target controls were injected at equal volumes, all of which were synthesized by Cambo Biotech, inc. The reagent is treated with RNase-free ddH ₂ O is diluted to 5 ng/nL. Collecting the nymphs hatched initially with consistent hatching time before the experiment, and carrying out microinjection when the nymphs grow to 3 years old. Before injection, the gas flow rate is about 200mL/min of CO ₂ The test insects were anesthetized for 15s and injected under a stereomicroscope using a Nanoliter 2010 microinjector (WPI, usa) with the agent injected from a site between the ventral midfoot of brown planthopper (with minimal mechanical damage from this site injection). And (3) temporarily transferring the injected brown planthopper into a clean culture dish for observation, and transferring the brown planthopper to rice seedlings for observation and statistics after the brown planthopper is revived. Sampling at 1d and 3d after injection to detect the expression changes of Nlu-mir-9a and NlUbx. Each treatment was repeated 3 times, with 10 nymphs per repeat.

2.1.2 RNA extraction

Total RNA extraction: the sample to be tested is put into a glass homogenizer precooled by liquid nitrogen for full grinding, 1000 mu L of TransZol Up reagent is added for cracking tissues and cells, and the ground extracting solution is transferred into an RNase-free centrifuge tube and is kept stand for 5min at room temperature. Add 200. Mu.L chloroform into the tube, shake vigorously for 30s, and then stand for 5min. The solution was centrifuged in a refrigerated centrifuge at 12000rpm for 15min at 4 ℃ whereupon the solution separated into an upper aqueous phase (containing RNA) and a lower organic phase. Transferring the upper water phase to a new centrifuge tube, adding 1.5 times volume of anhydrous ethanol, and standing in a refrigerator at-20 deg.C for 30min. Taking out, centrifuging at 12000rpm at 4 deg.C for 30min, retaining precipitate, removing supernatant, adding 1000 μ L75% ethanol (RNase-free H) ₂ O formulation), shake vigorously for 30s. Centrifuging at 7500rpm at 4 deg.C for 10min, retaining precipitate, removing supernatant, and drying in a clean bench for 5-10min. Adding 30 μ L of RNase-free H ₂ O Total RNA was dissolved.

And (3) miRNA extraction: reference is made to the reagents and procedures provided in the miRNeasy Mini Kit (cat No. 217004, QIAGEN, germany). First, a test sample was thoroughly ground in a glass homogenizer pre-cooled in liquid nitrogen, and 700. Mu.L of QIAzol reagent was added to lyse tissues and cells. The released miRNA is specifically bound to a silica gel membrane medium of the adsorption column under certain salt solution and pH conditions, and micromolecular impurities such as DNA, protein, salt and the like are removed through a washing step. Adding 30 μ L of RNase-free H ₂ And O, eluting miRNA.

2.1.3 cDNA Synthesis

Total RNA complementary (cDNA) synthesis reactions were performed with reference to the reagents and procedures provided by PrimeScript RT reagent Kit with gDNA Eraser (cat No. RR047, takara, japan). Using 1 ug total RNA as initial template, firstly removing genome DNA under the action of gDNA Eraser, then using Random 6 mers and Oligo dT Primer as anchor Primer, and synthesizing cDNA under the action of reverse transcriptase. After the reaction, the enzyme in the reaction system was inactivated by heating at 85 ℃ for 5 seconds. The obtained cDNA was treated with ddH ₂ And storing the diluted O in a refrigerator at the temperature of-20 ℃ for later use. Diluting by 10 times and then using for common PCR amplification; diluted 200 times and used for quantitative PCR reaction.

cDNA Synthesis reaction reference for miRNAThe reagents and procedures provided in the MiScript II RT kit (cat # 218160, QIAGEN, germany) were performed. Using 1. Mu.g of miRNA as a starting template, 5 XmiScript HiSpec Buffer was selected, and the format miRNA was synthesized into a cDNA segment containing a known linker under the action of reverse transcriptase. After the reaction, the reaction system was heated at 95 ℃ for 5min to inactivate the enzyme. The obtained cDNA was treated with ddH ₂ Diluting the O by 50 times, and storing the diluted O in a refrigerator at the temperature of minus 20 ℃ for later use.

2.1.4 fluorescent quantitative PCR

The fluorescent quantitative PCR reaction of mRNA was carried out with reference to the reagents and procedures provided in SYBR Premix Ex Taq II (cat No. RR820, takara, japan). Each reaction was prepared as a 20. Mu.L reaction system containing 10. Mu.L of 2 XqqPCR premix, 0.4. Mu.L of 50 XROX Reference Dye II, 8.8. Mu.L of cDNA template diluted 200-fold, and 0.4. Mu.L each of the forward and reverse primers of the qPCR reaction (10. Mu.M concentration). The qPCR reactions and analysis were performed in an Applied Biosystems ABI 7300 fluorescent quantitative PCR instrument. Reaction procedures are as follows: pre-denaturation at 95 ℃ for 2min;35 cycles (94 ℃ C. 10s,60 ℃ C. 31 s).

Fluorescence quantitative PCR reaction reference of miRNAmiScript SYBR Green PCR Kit(Cat No. 218073, QIAGEN, germany) was performed using the reagents and procedures provided. Each reaction was prepared as a 20. Mu.L reaction containing 10. Mu.L of 2 XqqPCR premix, 6. Mu.L of 50-fold diluted cDNA template, 2. Mu.L of qPCR upstream Primer (2. Mu.M concentration), and 2. Mu.L of 10 XmiScript Universal Primer. The qPCR reactions and analyses were performed in an Applied Biosystems ABI 7300 fluorescent quantitative PCR instrument. Reaction procedure: pre-denaturation at 95 ℃ for 15min;35 cycles (94 ℃ C. 10s,55 ℃ C. 30s,70 ℃ C. 31 s).

According to the method of Livak and Schmittgen (2001), the qPCR reaction takes housekeeping gene Nlactin1 as an internal reference gene to calculate the relative expression level of the gene to be detected, and the relative expression =2^ (Ct) _actin –Ct _{test gene} ) X 100%, where Ct is the number of cycles that the instrument reads.

2.2 results and analysis

The regulating effect of Nlu-mir-9a on NlUbx was verified in vivo by microinjection of 3 rd Laodelphax niloticus with mimicrs (mimics for over-expressing Nlu-mir-9 a) and inhibitors (inhibitors for reducing the transcriptional abundance of Nlu-mir-9 a) of Nlu-mir-9a.

Firstly, the action effects of mimics and inhibitors are evaluated, and qPCR results show that: on the 1 st day after injection, after 100ng of mics was injected into nymphs of the long-wing strain and the short-wing strain, the expression levels of Nlu-mir-9a were significantly increased to 2.165 times and 2.599 times of the control group, respectively; on day 3 after injection, the expression level of Nlu-mir-9a significantly increased to 3.547 times and 1.950 times of the control group, respectively, after 100ng of mics was injected into the nymphs of the long-wing strain and the short-wing strain (shown in fig. 2A, B). On day 1 after injection, after 50ng of inhibitors were injected into the nymphs of the long-wing strain and the short-wing strain, the expression level of Nlu-mir-9a was significantly reduced to 32.47% and 47.20% of the control group, respectively; on day 3 post-injection, the expression levels of Nlu-mir-9a decreased significantly to 24.64% and 46.04% of the control group, respectively, after 50ng of inhibitors were injected into the nymphs of the long and short wing strains (shown in fig. 2C, D).

On the 1 st day after injection, after 100ng of mics is injected into nymphs of long-wing strains and short-wing strains, the expression level of NlUbx is respectively and remarkably reduced to 74.42% and 85.65% of the control group; on day 3 after injection, the expression level of NlUbx significantly decreased to 68.50% and 79.60% of the control group, respectively, after 100ng of mics was injected into the nymphs of the long-wing line and the short-wing line (shown in fig. 3A, B). On day 1 after injection, the expression level of NlUbx significantly increased to 1.418-fold and 1.276-fold of the control group after 50ng of inhibitors was injected to the nymphs of the long wing strain and the short wing strain, respectively; on day 3 post-injection, the expression levels of NlUbx increased significantly to 1.306 times and 1.344 times that of the control group as shown in fig. 3C, D, respectively, after 50ng of inhitotors were injected into the nymphs of the long-wing and short-wing strains. It is shown that Nlu-mir-9a can affect the expression level of NlUbx in a negative regulation manner.

3. Influence of Ubx gene on survival rate of brown planthopper

3.1 materials and methods

3.1.1 double-stranded RNA (dsRNA) synthesis

Preparation of templates for synthesis of dsRNA: when the template for synthesizing dsRNA is amplified by PCR, the cDNA of brown planthopper is taken as the template, and the 5' ends of the upstream and downstream amplification primers are connected with a T7 promoter sequence (T7 sequence: 5'-TAATACGACTCACTATAGGG-3'). Each PCR reaction was prepared as a 400. Mu.L reaction system containing 200. Mu.L of 2 XPCR premix, 16. Mu.L of plasmid template, 16. Mu.L each of the forward primer and the reverse primer of the target gene (10. Mu.M concentration), and 152. Mu.L of ddH 2O. Reaction procedure: pre-denaturation at 94 ℃ for 5min;35 cycles (94 ℃ 30s,60 ℃ 30s,72 ℃ 1 min); 10min at 72 ℃; the temperature is reduced to 25 ℃.

DNA purification: fixing the volume of the plasmid PCR product to 400 mu L by RNase-free H2O, adding an isovolumetric phenol chloroform reagent, violently shaking for 30s, and standing for 5min at room temperature; the solution was centrifuged in a refrigerated centrifuge at 12000rpm for 15min at 4 ℃ whereupon it separated into an upper aqueous phase (containing DNA) and a lower organic phase. Transferring the supernatant to a new centrifuge tube, adding 2 times of anhydrous ethanol and 1/10 of 3M sodium acetate, and standing in a refrigerator at-20 deg.C for 10min. Taking out, centrifuging at 12000rpm at 4 deg.C for 30min, retaining precipitate, discarding supernatant, adding 1000 μ L75% ethanol (prepared by RNase-free H2O), and shaking vigorously for 30s. Centrifuging at 7500rpm at 4 ℃ for 10min, reserving the precipitate, discarding the supernatant, and drying in an ultra-clean bench for 5-10min. The DNA was dissolved by adding 30. Mu.L of RNase-free H2O.

dsRNA synthesis: and synthesizing dsRNA under the action of a transcriptase by taking the purified plasmid PCR product as a synthesis template. Each dsRNA synthesis reaction was formulated as a 400 μ L reaction system: containing 5 × Transcription buffer 80 μ L and T7 RNA Polymerase 8 μ L (20U/. Mu.L), ATP, CTP, GTP, UTP (100 mM) each 8 μ L, RNase Inhibitor 10 μ L (40U/. Mu.L), a synthetic template of 10 μ g, and making up to 400 μ L with RNase-free H2O. Reacting in water bath at 37 ℃ for 4h.

And (3) dsRNA purification: the dsRNA synthesis product was made up to 400. Mu.L with RNase-free H2O, half volume (200. Mu.L) of water-saturated phenol and half volume of chloroform were added, shaken vigorously for 30s, and left to stand at room temperature for 5min. The solution was centrifuged in a refrigerated centrifuge at 12000rpm for 10min at 4 ℃ whereupon it separated into an upper aqueous phase (containing dsRNA) and a lower organic phase. Transferring the supernatant to a new centrifuge tube, adding equal volume of chloroform, shaking vigorously for 30s, and standing at room temperature for 5min. Centrifuging at 12000rpm at 4 deg.C for 10min, transferring the supernatant to a new centrifuge tube, adding 2 times volume of anhydrous ethanol and 1/10 volume of 3M sodium acetate, and standing in a refrigerator at-20 deg.C for 10min. Taking out, centrifuging at 12000rpm at 4 deg.C for 30min, retaining precipitate, discarding supernatant, adding 1000 μ L75% ethanol, and shaking vigorously for 30s. Centrifuging at 4 deg.C and 7500rpm for 10min, retaining precipitate, discarding supernatant, and drying in a clean bench for 5-10min. Add 30. Mu.L of ddH2O to solubilize the dsRNA.

3.1.2 microinjection

The test dsNlUbx was injected at a dose of 150ng, and an equal volume of dsGFP was injected as a control. The reagent is treated with RNase-free ddH ₂ O is diluted to a concentration of 5 ng/nL. Collecting the primarily hatched nymphs with consistent hatching time before the experiment, and carrying out microinjection when the nymphs grow to 3 years old. Before injection, the gas flow rate is about 200mL/min of CO ₂ The test insects were anesthetized for 15s and injected under a stereomicroscope using a Nanoliter 2010 microinjector (WPI, usa) from a site between the ventral midfoot of brown planthopper (with minimal mechanical damage from the site). And (4) temporarily transferring the injected brown planthopper into a clean culture dish for observation, and transferring the brown planthopper to rice seedlings for observation and statistics after the brown planthopper is revived. The survival of nymphs was counted every 24h after injection until eclosion to adults, 3 replicates per treatment, 50 nymphs per replicate.

3.2 results and analysis

Injection of 150ng dsNlUbx resulted in very high mortality, with only 5.33% and 19.33% of nymphs of the brown planthopper long and short wing lines, respectively, successfully emerging significantly lower than the control (73.33% and 88.59%) (as shown in figure 4). Almost all cases of death result from stunted molting from the young to the advanced age (or eclosion), which is manifested by a pronounced sloughing line in the back, but failure to successfully slough off the old skin and ultimately failure to move and eat and die.

4. Double-luciferase gene reporter system verification Nlu-mir-9a negative regulation and control effect on NlUbx and binding site

4.1 materials and methods

The dual-luciferase reporter Vector pmiR-RB-REPORT Vector mainly comprises the following components, the Vector can express Ampicillin resistance genes, the fluorescent reporter gene is Renilla luciferase gene (hRluc), the fluorescent correction gene is firefly luciferase gene (hluc), and the insertion sites of exogenous fragments comprise Not I, pme I, xho I, sgf I and other enzyme cutting sites (shown in figure 5).

4.1.1 wild-type reporter vector construction

NlUbx 3' UTR sequence amplification: with reference to the sequence of NlUbx 3' UTR, a double enzyme digestion reaction primer for constructing a wild-type vector is designed, namely: WT-Ubx-F5'-GCGGCTCGAGGTGGACAGCTAGGTGCTC-3'; WT-Ubx-R5'-AATGCGGCCGCGCTGGTATCTGTTTTTCT-3'. Wherein CTCGAG is Xho I enzyme cutting site sequence; GCGGCCGC is Not I enzyme cutting site sequence, and the sequence in the 5' direction of the enzyme cutting site is a protective base.

Each touchdown PCR reaction was prepared as a 30. Mu.L reaction system containing a 2 XPPhusion High-Fidelity PCR premix (cat # F531S,Thermo Fisher ScientificU.S.A.) 15. Mu.L, nlUbx 3' UTR plasmid template 1. Mu.L (about 100 ng), upstream and downstream primers 1. Mu.L (10. Mu.M) each, ddH ₂ O12. Mu.L. Reaction procedure: pre-denaturation at 98 ℃ for 3min.10 cycles [98 ℃ for 10s,65 ℃ for 30s (1 ℃ reduction after each cycle), 72 ℃ for 1min](ii) a 25 cycles (98 ℃ C. 10s,60 ℃ C. 30s,72 ℃ C. 1 min); 10min at 72 ℃; the temperature is reduced to 25 ℃.

And (3) enzyme digestion reaction: the above PCR product was subjected to double digestion reaction with reference to the reagents and methods provided by Xho I endonuclease (Cat. No. 1094S, takara, japan) and Not I endonuclease kit (Cat. No. 1166S, takara, japan). A40. Mu.L reaction system containing 4. Mu.L of 10 XH buffer, 2. Mu.g of purified product, 1. Mu.L each of Xho I endonuclease (10U/. Mu.L) and Not I endonuclease (10U/. Mu.L) was prepared using ddH ₂ The volume of O is up to 40 mu L. The reaction was carried out at 37 ℃ for 4h.

And (3) connection reaction: and (4) carrying out plasmid recombination on the enzyme digestion product and a report vector. Preparing 10 μ L reaction system containing purified enzyme cutting product 150ng, pmiR-RB-REPORT Vector 50ng, solution I quick-connecting liquid 5 μ L, using ddH ₂ The volume of O is up to 10 mu L. The reaction was carried out at 16 ℃ for 30min. A wild-type reporter vector was obtained.

4.1.2 mutant 1 reporter vector construction

By reference to the sequence of NlUbx 3' UTR and predicted binding site, double-restriction reaction primers for constructing mutant type 1 vector were designed for mutating the 1 st potential binding site. Since the 1 st mutation site is close to the start site of the insert, mut1-Ubx-F and WT-Ubx-R can be directly paired, and NlUbx 3' UTR plasmid is used as a template for PCR reaction, and the PCR product does not need splicing and is the required mutant type 1 reporter vector. Mut 1-Ubx-F5'-GCGGCTCGAGGTGGACAGCTAGGTGCTCCACCAGGCGCACGGCGAGGTGGACGGTTTCACTCATAGCAGACATGCC-3'. Wherein CTCGAG is Xho I enzyme cutting site sequence, and the sequence in the 5' direction of the enzyme cutting site is a protective base.

Each touchdown PCR reaction was prepared as a 30. Mu.L reaction containing 15. Mu.L of 2 XPUSION High-Fidelity PCR premix, 1. Mu.L (about 100 ng) of plasmid template for NlUbx 3' UTR, 1. Mu.L (10. Mu.M) of each of the forward and reverse primers, ddH ₂ O12. Mu.L. Reaction procedure: pre-denaturation at 98 ℃ for 3min.10 cycles [98 ℃ for 10s,65 ℃ for 30s (1 ℃ reduction after each cycle), 72 ℃ for 1min](ii) a 25 cycles (98 ℃ 10s,60 ℃ 30s,72 ℃ 1 min); 10min at 72 ℃; the temperature is reduced to 25 ℃.

And (3) connection reaction: and (4) carrying out plasmid recombination on the enzyme digestion product and a report vector. Preparing 10 μ L reaction system containing purified enzyme cutting product 150ng, pmiR-RB-REPORT Vector 50ng, solution I quick-connecting liquid 5 μ L, using ddH ₂ The volume of O is up to 10 mu L. The reaction was carried out at 16 ℃ for 30min. Mutant 1 reporter vectors were obtained.

4.1.3 mutant 2 reporter vector construction

And (3) designing a double enzyme digestion reaction primer for constructing a mutant 2 vector by referring to the sequence of the NlUbx 3' UTR and the predicted binding site, and mutating the 2 nd potential binding site. Mut 2-Ubx-F5'-AGTCAACAGGTTTCTCAACGACTGTCAAAGGT-3'; mut 2-Ubx-R5'-GTCGTTGAGAAACCTGTTGACTGCGCCAACTG-3'. Sequence amplification of mutant 2 vector requires a segmented PCR reaction: the upstream primer (WT-Ubx-F) is paired with the downstream mutation primer (Mut 2-Ubx-R); the upstream mutation primer (Mut 2-Ubx-F) is paired with the downstream primer (WT-Ubx-R). Each landingPCR reaction A30. Mu.L reaction system was prepared containing 15. Mu.L of 2 XPUSION High-Fidelity PCR premix, 1. Mu.L (about 100 ng) of plasmid template for NlUbx 3' UTR, 1. Mu.L (10. Mu.M) of each of the forward and reverse primers, and ddH ₂ O12. Mu.L. Reaction procedure: pre-denaturation at 98 ℃ for 3min.10 cycles [98 ℃ for 10s,65 ℃ for 30s (1 ℃ reduction after each cycle), 72 ℃ for 1min](ii) a 25 cycles (98 ℃ 10s,60 ℃ 30s,72 ℃ 1 min); 10min at 72 ℃; the temperature is reduced to 25 ℃.

Splicing segmented PCR products: preparing a 10-mu-L reaction system containing 5 mu L of 2 XPHUSION High-Fidelity PCR premix, 1 mu L of each segmented PCR product and ddH ₂ O3. Mu.L. Reaction procedure: pre-denaturation at 98 ℃ for 3min;8 cycles [98 ℃ for 10s,60 ℃ for 30s (1 ℃ reduction after each cycle), 72 ℃ for 30s](ii) a 10 cycles (98 ℃ C. 10s,55 ℃ C. 30s,72 ℃ C. 30 s); 5min at 72 ℃; the temperature is reduced to 25 ℃.

PCR reaction of splicing products: preparing a 30 mu L reaction system comprising 15 mu L of 2 XPHUSION High-Fidelity PCR premixed solution, taking the spliced product as a template of 1 mu L, taking Mut2-Ubx-F and Mut2-Ubx-R as an upstream primer and a downstream primer of 1 mu L (10 mu M) respectively, and taking ddH ₂ O12. Mu.L. Reaction procedure: pre-denaturation at 98 ℃ for 3min;35 cycles (98 ℃ C. 10s,60 ℃ C. 30s,72 ℃ C. 1 min); 10min at 72 ℃; the temperature is reduced to 25 ℃.

And (3) enzyme digestion reaction: the above PCR product was subjected to double digestion reaction with reference to the reagents and methods provided by Xho I endonuclease (Cat. No. 1094S, takara, japan) and Not I endonuclease kit (Cat. No. 1166S, takara, japan). A40. Mu.L reaction system containing 4. Mu.L of 10 XH buffer, 2. Mu.g of purified product, 1. Mu.L each of Xho I endonuclease (10U/. Mu.L) and Not I endonuclease (10U/. Mu.L) was prepared using ddH ₂ O is added to 40 mu L. The reaction was carried out at 37 ℃ for 4h.

And (3) connection reaction: and (4) carrying out plasmid recombination on the enzyme digestion product and a report vector. Preparing 10 μ L reaction system containing purified enzyme cutting product 150ng, pmiR-RB-REPORT Vector 50ng, solution I quick-connecting liquid 5 μ L, using ddH ₂ The volume of O is up to 10 mu L. The reaction was carried out at 16 ℃ for 30min. Mutant 2 reporter vectors were obtained.

4.1.4 Co-transfection of recombinant plasmids and mimics and fluorescence value determination

Test 293T cell line at 37 ℃ and 5% CO ₂ Culturing is carried out under the conditions.293T cells in logarithmic growth phase at 1.5X 10 per well ⁴ Cells (100. Mu.L) were transferred to 96-well cell culture plates and cultured at 37 ℃ for an additional 24h. Diluting Nlu-mir-9a mics or non-target control with 10. Mu.L OPTI-MEM culture medium (product number 31985070, GIBCO, USA) to construct a dual-luciferase gene reporter vector, diluting 0.25. Mu.L Lipofectamine 2000 reagent (product number 11668027, invitrogen, USA) with 25. Mu.L OPTI-MEM culture medium, mixing the three gently after dilution, and standing at room temperature for 20min; sucking 50 μ L of culture medium from each cell culture well, and adding the above mixed solution; after 6h 100. Mu.L of fresh medium was added. Wherein the mimics transfection concentration is 50 nM/well, and the reporter vector transfection concentration is 250 ng/well. Each treatment contained 3 sets of biological replicates, each replicate being 3 technical replicates.

Fluorescence intensity measurements were performed with reference to the reagents and methods recommended by the Dual-Glo Luciferase Assay System (cat. No. E2920, promega, USA). Before detection, the luciferase substrate and the luciferase buffer in the kit are uniformly mixed, subpackaged and stored at-80 ℃, and the mixture is balanced to room temperature before use; and (3) subpackaging the stop & Glo buffer, storing at-80 ℃, balancing to room temperature before use, taking a proper amount of the stop & Glo substrate, and adding the substrate for use. After transfection for 48h, the culture medium is sucked out, 35 mu L of PBS buffer solution and 35 mu L of luciferase substrate are added into each hole, and the continuous oscillation is carried out for 10min; then 30. Mu.L of stop reagent was added and the shaking was continued for 10min. After the reaction was completed, the fluorescence intensity was measured using a Veritas 9100-002 fluorescence luminometer.

4.2 results and analysis

Firstly, connecting the complete NlUbx 3' UTR sequence to the downstream of a coding region of a renilla luciferase gene through double enzyme digestion reaction to construct a wild-type double-luciferase fusion expression vector. Nlu-miR-9a mimics (treatment group) and non-target control (control group) were co-transfected with the test expression vector into human embryonic kidney cell line (HEK 293T) for culture, respectively. The change of the expression level of the Renilla luciferase gene (hRluc) is detected by using the firefly luciferase gene (hluc) as a fluorescence correction gene. The results indicate that when mimics was transfected, the fluorescence intensity of cell line expression was reduced by about 40.54% compared to the control group (as shown in fig. 6A), indicating that Nlu-miR-9a can inhibit expression of coding region upstream of gene by binding to NlUbx 3' utr.

In order to further determine the binding sites of Nlu-miR-9a and NlUbx, site-directed mutagenesis (CCAAAG mutagenesis is GGTTTC) is carried out on two potential binding sites predicted by software respectively, and a mutant expression vector is constructed. When co-transfection was performed after mutation of the first binding site, the fluorescence intensity expressed by the cell line was still significantly reduced by 16.72% (as shown in fig. 6B); co-transfection was performed after mutation of the second binding site, when there was no significant difference between the fluorescence intensities generated by the treated and control groups (as shown in FIG. 6C), indicating that the second binding site is the true site of action for Nlu-miR-9a and NlUbx.

TABLE 1 mir-9a-5p and NlUbx site of action prediction analysis

5. Effect of Nlu-mir-9a on survival rates of brown planthopper

5.1 materials and methods

5.1.1 microinjection

Nlu-mir-9a mimics (simulant) were injected at 100ng and 50ng doses, respectively, and a non-target control of equal volume and concentration was injected as a control, all of which were synthesized by Cambo Biotech, inc. The reagent is treated with RNase-free ddH ₂ O is diluted to a concentration of 5 ng/nL.

Collecting the primarily hatched nymphs with consistent hatching time before the experiment, and carrying out microinjection when the nymphs grow to 3 years old. Before injection, the gas flow rate is about 200mL/min of CO ₂ The test insects were anesthetized for 15s and injected under a stereomicroscope using a Nanoliter 2010 microinjector (WPI, usa) from a site between the ventral midfoot of brown planthopper (with minimal mechanical damage from the site). And (3) temporarily transferring the injected brown planthopper into a clean culture dish for observation, and transferring the brown planthopper to rice seedlings for observation and statistics after the brown planthopper is revived. Counting the survival condition of nymphs every 24h after injection until eclosion into adults, repeating each treatment for 3 times, and repeating each repetition50 nymphs.

5.2 results and analysis

Injection of 100ng of Nlu-mir-9a mimics resulted in a very high mortality, with only 13.33% and 14.67% of nymphs successfully emerging from the long and short wing lines, respectively, significantly lower than the control group (69.33% and 71.33%) (as shown in fig. 7). Almost all cases of death result from stunted molting from the young to the advanced age (or eclosion), which is manifested by a pronounced sloughing line in the back, but failure to successfully slough off the old skin and ultimately failure to move and eat and die. When a lower dose (50 ng) of mix was injected, the mortality rate was about half that of the high dose (100 ng).

The embodiments of the present invention have been described in detail, but the description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention. Any modification, equivalent replacement, and improvement made within the scope of the application of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> institute of microbiology for agricultural application (rural energy research center in Jiangxi province) of agricultural academy of sciences in Jiangxi province; university of agriculture in china

<120> miRNA and application thereof in killing Nilaparvata lugens

<160> 7

<210> 1

<211> 484

<212> RNA

<213> Brown planthopper (Nilaparvata lugens)

<400> 1

acaugggcauaguccgaaauauuacaguaacauuauuaauaauuauuacuuuauuuguaauuguaucuacuaauaaauaaauauuacaucaauuacaucaauaucaguagcuccauuaauaucugcgauaguagacuuugauaucaucauggcgauggcugaagaaaacgacugaauccuucaaucuucaagaaggugcugacgcuuucuuugguuaucuagcuguaugaacguucgauaucauaaagcuagguuaccgaaguuauuaucagcaucugaucucugcucuacacucacacugcgacucccuucuuucaaucaggccccaccagaggauuuuuauuauuuaauuaccaauuuuguaauuauaacguggaccucacuauaguagaccaguucucaauauuuauauuguaucuugcuuuauucagcaucauuauucaauagcauaauuauucaaaaaaaaaaaaaaaaaaaaaaaaaa

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 2

taatacgactcactataggg

<210> 3

<211> 28

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

gcggctcgaggtggacagctaggtgctc

<210> 4

<211> 29

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

aatgcggccgcgctggtatctgtttttct

<210> 5

<211> 76

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

gcggctcgaggtggacagctaggtgctccaccaggcgcacggcgaggtggacggtttcactcatagcagacatgcc

<210> 6

<211> 32

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 6

agtcaacaggtttctcaacgactgtcaaaggt

<210> 7

<211> 32

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 7

gtcgttgagaaacctgttgactgcgccaactg

Claims

1. A primary transcript comprising a miRNA, wherein the nucleotide sequence of the primary transcript is as set forth in SEQ ID NO:1, the nucleotide sequence of the mature body of the miRNA is Nlu-mir-9a and Nlu-mir-9 a: UCUUUGGUUAUCUAGCUGUAUGA.

2. Use of the miRNA of claim 1 for killing Nilaparvata lugens.

3. The use according to claim 2, characterized in that the use is the injection of said miRNA into brown planthopper.

4. Use according to claim 3, characterized in that the injected dose per Nilaparvata lugens is between 50 and 100ng.

5. Use according to claim 4, characterized in that the brown planthopper is a brown planthopper nymph.

6. Use according to claim 5, characterized in that said injection comprises the following steps: the miRNA is treated with RNase-free ddH ₂ Diluting O to 5ng/nL concentration; collecting 3-day-old brown planthopper nymphs, and firstly using CO with the air flow rate of 180-220 mL/min ₂ Anaesthetizing the brown planthopper nymphs for 15s, and then injecting the diluted miRNA solution from the part between the middle feet of the ventral surfaces of the brown planthopper nymphs by using a microinjection instrument under a stereoscopic microscope, wherein the miRNA injection dose is 50-100 ng.

7. Use of the miRNA of claim 1 for preparing a Nilaparvata lugens control drug.

8. The use according to claim 7, wherein the medicament is in the form of an injection.