CN110295169A - A kind of miRNA and its application for killing brown paddy plant hopper - Google Patents

A kind of miRNA and its application for killing brown paddy plant hopper Download PDF

Info

Publication number
CN110295169A
CN110295169A CN201910564291.XA CN201910564291A CN110295169A CN 110295169 A CN110295169 A CN 110295169A CN 201910564291 A CN201910564291 A CN 201910564291A CN 110295169 A CN110295169 A CN 110295169A
Authority
CN
China
Prior art keywords
plant hopper
paddy plant
brown paddy
mir
nlu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201910564291.XA
Other languages
Chinese (zh)
Other versions
CN110295169B (en
Inventor
姚英娟
李祥
华红霞
徐雪亮
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Agricultural Application Microbe Institute Of Jiangxi Academy Of Agricultural Sciences (jiangxi Rural Energy Research Center)
Huazhong Agricultural University
Original Assignee
Agricultural Application Microbe Institute Of Jiangxi Academy Of Agricultural Sciences (jiangxi Rural Energy Research Center)
Huazhong Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Agricultural Application Microbe Institute Of Jiangxi Academy Of Agricultural Sciences (jiangxi Rural Energy Research Center), Huazhong Agricultural University filed Critical Agricultural Application Microbe Institute Of Jiangxi Academy Of Agricultural Sciences (jiangxi Rural Energy Research Center)
Priority to CN201910564291.XA priority Critical patent/CN110295169B/en
Publication of CN110295169A publication Critical patent/CN110295169A/en
Application granted granted Critical
Publication of CN110295169B publication Critical patent/CN110295169B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N57/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
    • A01N57/10—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds
    • A01N57/16—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds containing heterocyclic radicals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Plant Pathology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Agronomy & Crop Science (AREA)
  • Pest Control & Pesticides (AREA)
  • Dentistry (AREA)
  • Environmental Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

A kind of application the present invention provides miRNA and its for killing brown paddy plant hopper, the technical solution has probed into a possibility that inhibiting brown paddy plant hopper to grow using gene regulation method by laboratory facilities, screening obtains the miRNA, i.e. Nlu-mir-9a that a kind of pair of brown paddy plant hopper has lethal effect on this basis.The initial transcript of Nlu-mir-9a has been cloned, Nlu-mir-9a precursor and Nlu-mir-9a maturation body sequence are disclosed.Prove that Nlu-mir-9a can act on 3 ' UTR of NlUbx gene, and the expression of negative regulation NlUbx.Husking is obstructed when brown paddy plant hopper being made to grow to advanced age (or emergence) by low age, finally dead because of stiff and feeding.Based on the new property found above, Nlu-mir-9a can be acted on brown paddy plant hopper using injection system, to realize killing effect；It can also be used and prepares brown paddy plant hopper protective agents；The gene constructed transgenic rice lines can be also based on, so that it is expressed Nlu-mir-9a precursor and Nlu-mir-9a maturation body, for preventing and treating the harm of brown paddy plant hopper.

Description

A kind of miRNA and its application for killing brown paddy plant hopper
Technical field
The present invention relates to technical field of molecular biology, and in particular to a kind of miRNA and its for killing answering for brown paddy plant hopper With.
Background technique
Brown paddy plant hopper belongs to Semiptera, Delphacidae (Hemiptera:Delphacidae), be important pests on rice it One.Brown paddy plant hopper feeding habits are single, the minority oryza plant such as rice of only causing harm；It, which is endangered, has concealment, burst and destructiveness etc. Feature.In addition, brown paddy plant hopper can also propagate Rice grassy stunt virus (rice grassy stunt virus), tingia dwarf virus (rice ragged stunt virus), wilting dwarf virus (rice wilted stunt virus).According to statistics, China is close The Rice Cropping producing region of half is all caused harm by brown paddy plant hopper is different degrees of, and the loss of the paddy as caused by brown paddy plant hopper every year is up to 100~1,500,000 tons.Since 21 century, brown paddy plant hopper all presents increased year by year in the hazard area and outburst number of each rice region Trend.The problems such as prevention and treatment of brown paddy plant hopper at present, relies primarily on chemical prevention, resulting drug resistance gets worse, it would be highly desirable to seek Look for new control of insect measure.
MicroRNA is a kind of single-stranded microRNA for only having 18~25 nucleotide, be widely present in nematode, drosophila, In plant and eucaryote including people, it thus is unable to coding protein without open reading frame, sequence is being evolved Upper highly conserved, there are apparent tissue specificity and temporals for its expression in growth course.MiRNA in vivo Can cooperate with the elements such as AGO, Dicer, TRBP, PACT formed miRISC, miRISC can by degradation mRNA or inhibit its translate two The different mechanism of kind carrys out the expression of negative regulation target gene.
MiRNA receives more extensive concern because its function has the characteristics that conservative in the research of insect.With black Various insects based on abdomen drosophila a large number of studies show that, miRNA takes part in the growth and development of insect, development by metamorphosis, reproduction, exempts from The almost all of physiology course such as epidemic disease.The expression of its target gene can be inhibited and then inhibit corresponding transcription by being overexpressed miRNA, It will lead to organismal development deformity or even death when serious.Such as mir-2 is overexpressed in Groton bug, it is overexpressed in drosophila Mir-6 and mir-11 can cause insect dead situation occur.Research at present about brown paddy plant hopper miRNA is also relatively fewer, Zhang etc. inhibits the intracorporal miRNAs of brown paddy plant hopper to function by building dicer1 deletion mutation, can significantly inhibit ovum mother The formation of cell.Mir-2703 is overexpressed in brown paddy plant hopper can inhibit the expression of chitin synthetase gene CHSA, lead to nymph Husking is difficult and dead.But it yet there are no the example or report using miRNA prevention and treatment brown paddy plant hopper.
Summary of the invention
The present invention is directed to be directed to the technological deficiency of the prior art, a kind of miRNA is provided and its for killing answering for brown paddy plant hopper With to expand the molecular biology control method of brown paddy plant hopper.
Inhibition is played to brown paddy plant hopper, is killed another technical problem to be solved by the present invention is that can be acted on by gene regulation The specific gene for effect of going out, is still not clear.
The invention solves another technical problem be the killing effect principle of Nlu-mir-9a gene pairs brown paddy plant hopper, still It is indefinite.
To realize the above technical purpose, the invention adopts the following technical scheme:
The nucleotide sequence of a kind of miRNA, the miRNA are as shown in SEQ ID NO:1.
On this basis, invention further provides the applications that above-mentioned miRNA is used to kill brown paddy plant hopper.
Preferably, the application is that the miRNA is injected in brown paddy plant hopper body.
Preferably, the injection dosage of every brown paddy plant hopper is 50~100ng.
Preferably, the brown paddy plant hopper is brown paddy plant hopper nymph.
Preferably, the injection, comprising the following steps: by miRNA RNase-free ddH2O is diluted to 5ng/nL concentration；3 age in days brown paddy plant hopper nymphs are taken, the CO for being first 180~220mL/min with throughput2To the brown paddy plant hopper nymph 15s is anaesthetized, is then using microinjection instrument to inject from the position between the brown paddy plant hopper nymph outside of belly mesopodium under stereomicroscope MiRNA solution after the dilution, miRNA injection dosage are 50~100ng.
On this basis, invention further provides the applications that above-mentioned miRNA is used to prepare brown paddy plant hopper protective agents.
Preferably, the dosage form of the drug is injection.
Preferably, the drug effect is in 3 ' UTR of NlUbx gene, and the expression water of negative regulation NlUbx gene It is flat.
It is described brown to fly preferably, when the drug hinders brown paddy plant hopper to grow to advanced age by low age or the husking of the when of emergence Lice dies of stiff and feeding.
A kind of application the present invention provides miRNA and its for killing brown paddy plant hopper, the technical solution pass through laboratory facilities A possibility that inhibiting brown paddy plant hopper to grow using gene regulation method is probed into, screening obtains a kind of pair of brown paddy plant hopper tool on this basis There are the miRNA of lethal effect, i.e. Nlu-mir-9a.The initial transcript of Nlu-mir-9a is cloned, before disclosing Nlu-mir-9a Body and Nlu-mir-9a maturation body sequence.Prove that Nlu-mir-9a can act on 3 ' UTR of NlUbx gene, and negative regulation The expression of NlUbx.Husking is obstructed when brown paddy plant hopper being made to grow to advanced age (or sprout wings) by low age, finally because stiff and take Food and it is dead.Based on the new property found above, Nlu-mir-9a can be acted on brown paddy plant hopper using injection system, to realize Killing effect；It can also be used and prepares brown paddy plant hopper protective agents；The gene constructed transgenic rice lines can be also based on, its table is made Up to Nlu-mir-9a precursor and Nlu-mir-9a maturation body, for preventing and treating the harm of brown paddy plant hopper.
Detailed description of the invention
Fig. 1 is the analysis of Nlu-mir-9a minimum free energy and secondary structure prediction figure in the specific embodiment of the invention；Its Middle part A is primary Nlu-mir-9a；Part B is precursor Nlu-mir-9a；It analyzes result and derives from RNAfold WebServer。
Fig. 2 is to inject mimics and inhibitors to Nlu-mir-9a expression in the specific embodiment of the invention Influence result figure；In figure, A, part B are injection mimics to Nlu-mir-9a table in long wing strain (A) and brachypterism strain (B) Up to horizontal influence；C, the part D is injection inhibitors to Nlu-mir-9a table in long wing strain (C) and brachypterism strain (D) Up to horizontal influence.
Fig. 3 is to inject influence of the mimics and inhibitors to NlUbx expression in the specific embodiment of the invention Result figure；In figure, A, part B are to inject mimics to the shadow of NlUbx expression in long wing strain (A) and brachypterism strain (B) It rings；C, the part D is the influence for injecting inhibitors to NlUbx expression in long wing strain (C) and brachypterism strain (D).
Fig. 4 is to inject the influence result figure of Ubx gene pairs brown paddy plant hopper survival rate in the specific embodiment of the invention；In figure, Part A is the survival rate of long wing strain；Part B is the survival rate of brachypterism strain.
Fig. 5 is Dual-Luciferase gene report carrier structure chart in the specific embodiment of the invention.
Fig. 6 is Dual-Luciferase gene reporter assay result figure in the specific embodiment of the invention；In figure, part A is wild The Dual-Luciferase reporter assay of raw type carrier；Part B is the Dual-Luciferase reporter assay of 1 carrier of saltant type；C portion is prominent The Dual-Luciferase reporter assay of 2 carrier of modification.
Fig. 7 is in the specific embodiment of the invention, and brown paddy plant hopper 3 age nymph injects the survival after Nlu-mir-9a mimics Rate experimental result picture；In figure, part A is the survival rate (50ng dosage) of long wing strain；Part B is the survival rate of brachypterism strain (50ng dosage)；C portion is the survival rate (100ng dosage) of long wing strain；The part D is survival rate (the 100ng agent of brachypterism strain Amount).
Specific embodiment
Below by specific embodiments of the present invention will be described in detail.In order to avoid excessive unnecessary details, It will not be described in detail in following embodiment to belonging to well known structure or function.Approximation used in following embodiment Language can be used for quantitative expression, show to allow quantity to have certain variation in the case where not changing basic function.It is fixed except having Adopted outer, technical and scientific term used in following embodiment has the phase being commonly understood by with those skilled in the art of the invention Same meaning.
1, the full-length clone of Nlu-mir-9a and sequence analysis
1.1 materials and methods
1.1.1 miRNA is extracted
It is carried out referring to miRNeasy Mini Kit (article No. 217004, QIAGEN, the Germany) reagent provided and step.It is first First test sample is placed in the glass homogenizer of Liquid nitrogen precooler be fully ground after, be added 700 μ L QIAzol reagents cracking tissue and Cell.On the silica gel film medium for the being integrated to adsorption column miRNA released specific under the conditions of certain salting liquid and pH, The small molecular weight impurities such as DNA, protein, salinity are removed by washing step.30 μ L RNase-free H are added2O elutes miRNA.
1.1.2 the cDNA full-length clone of miRNA
RACE (Rapid amplification of cDNA ends) full-length clone technology with one section in transcript Know and obtains the complete 5 ' end of the transcript and 3 ' terminal sequences based on sequence.RACE reaction is referring to SMARTer RACE 5 '/3 ' The reagent and step that Kit (article No. 634858, Clontech, Japan) is provided carry out.Respectively using 1 μ g miRNA as starting template, Using 5 '-CDS primer A, 3 '-CDS primer A and Oligonucleotide as primer, divide under the action of reverse transcriptase Not He Cheng 5 '-RACE cDNA and 3 '-RACE cDNA, the RACE-cDNA of acquisition include that the specificity of one section of known array connects Head.Use ddH2O is stand-by after diluting 10 times.
Touchdown PCR: being respectively amplification template with 5 '-RACE cDNA and 3 '-RACE cDNA, with 5 ' GSP (gene Special primer, gene-specific primer) or 3 ' GSP and agent box provide UPM (Universal Primer Mix, Long Primer and Short Primer comprising equal proportion) it is primer.Each reaction is configured to 50 μ L reaction systems, includes 2 25 252 μ L of μ L, 5 ' GSP or 3 ' GSP of μ L, 10 × UPM of μ L, 5 '-RACE cDNA or 3 '-RACE cDNA of × PCR premixed liquid (10 μM of concentration), ddH2O 16μL.Response procedures: 94 DEG C of initial denaturation 5min；5 circulations (94 DEG C of 30s, 72 DEG C of 3min)；5 are followed Ring (94 DEG C of 30s, 70 DEG C of 30s, 72 DEG C of 3min)；5 circulations (94 DEG C of 30s, 68 DEG C of 30s, 72 DEG C of 3min)；15 recycle (94 DEG C 30s, 66 DEG C of 30s, 72 DEG C of 3min)；72℃10min；It is down to 25 DEG C.
Nest-type PRC: being respectively amplification template with 5 ' touchdown PCR products and 3 ' touchdown PCR products, with 5 ' NGSP (nested Gene special primer, nest-type PRC gene-specific primer) or 3 ' NGSP and Short Primer be primer.Each Reaction is configured to 50 μ L reaction systems, includes 2 × PCR premixed liquid, the 25 μ touchdown PCR of L, 5 ' or 3 ' product, 2 μ L, Short Primer 2 μ L (10 μM of concentration), 2 μ L of 5 ' NGSP or 3 ' NGSP (10 μM of concentration), ddH2O 19μL.Response procedures: 94 DEG C of initial denaturations 5min；35 circulations (94 DEG C of 30s, 65 DEG C of 30s, 72 DEG C of 3min)；72℃10min；It is down to 25 DEG C.
PCR product is sent to Sangon Biotech (Shanghai) Co., Ltd. after the reaction was completed and is sequenced.1.2 result With analysis
By RACE technology, obtaining the initial transcript of Nlu-mir-9a (primary Nlu-mir-9a), full length sequence is such as Under: 5 '-ACAUGGGCAUAGUCCGAAAUAUUACAGUAACAUUAUUAAUAAUUAUUACUUUAUUU GUAAUUGUAUCUAC UAAUAAAUAAAUAUUACAUCAAUUACAUCAAUAUCAGUAGCUCCAUUAAUAUCUGCGAUAGUAGACUUUGAUAUCA UCAUGGCGAUGGCUGAAGAAAACGACUGAAUCCUUCAAUCUUCAAGAAGGUGCUGACGCUUUCUUUGGUUAUCUAG CUGUAUGAACGUUCGAUAUCAUAAAGCUAGGUUACCGAAGUUAUUAUCAGCAUCUGAUCUCUGCUCUACACUCACA CUGCGACUCCCUUCUUUCAAUCAGGCCCCACCAGAGGAUUUUUAUUAUUUAAUUACCAAUUUUGUAAUUAUAACGU GGACCUCACUAUAGUAGACCAGUUCUCAAUAUUUAUAUUGUAUCUUGCUUUAUUCAGCAUCAUUAUUCAAUAGCAU AAUUAUUCAAAAAAAAAAAAAAAAAAAAAAAAAA-3’。
The initial transcript overall length of Nlu-mir-9a is 484nt, and poly (A) sequence for being 26nt comprising a segment length is minimum Free energy is -90.20kcal/mol；Precursor Nlu-mir-9a precursor (precursor Nlu-mir-9a) overall length is 68nt, minimum free energy are -22.90kcal/mol (as shown in Figure 1).Nlu-mir-9a maturation body is the piece of a segment length 22nt Section, it may be assumed that 5 '-UCUUUGGUUAUCUAGCUGUAUGA-3 '.
2, Nlu-mir-9a regulates and controls NlUbx expression
2.1 materials and methods
2.1.1 microinjection
The injection dosage of Nlu-mir-9a mimics (analogies) and inhibitors (inhibitor) be respectively 100ng and 50ng injects the non-target control of isometric isoconcentration as control, these above-mentioned reagents are by sharp rich biological section The synthesis of skill Co., Ltd.By reagent agent RNase-free ddH2O is diluted to 5ng/nL concentration.When collecting hatching before experiment Between consistent incubates nymph, microinjection is carried out when nymph grew to for 3 age.With the CO of throughput about 200mL/min before injection2 15s is anaesthetized to for examination insect, is injected under stereomicroscope with 2010 microinjection instrument of Nanoliter (WPI, the U.S.), Medicament is by the position injection between brown paddy plant hopper outside of belly mesopodium (thus site carries out injecting caused mechanical damage minimum).It will note Brown paddy plant hopper after penetrating temporarily is transferred in clean culture dish and is observed, and is transferred on rice seedling and is seen after its recovery It examines and counts.The expression quantity of sample detection Nlu-mir-9a and NlUbx change when 1d and 3d after injection.3 repetitions of each processing, 10 nymphs of each repetition.
2.1.2 RNA is extracted
Total RNA extract: test sample is placed in the glass homogenizer of Liquid nitrogen precooler be fully ground after, be added 1000 μ L TransZol Up reagent cracks tissue and cell, and ground extracting solution is transferred to RNase-free centrifuge tube, is stored at room temperature 5min.200 μ L chloroforms are added into centrifuge tube, stand 5min after acutely shaking 30s.In refrigerated centrifuge, in 4 DEG C 12000rpm is centrifuged 15min, and solution is divided into the organic phase of water phase (comprising RNA) and lower layer on upper layer at this time.Upper strata aqueous phase is turned New centrifuge tube is moved to, the dehydrated alcohol of 1.5 times of volumes is added, stands 30min in -20 DEG C of refrigerators.In 4 DEG C after taking-up 12000rpm is centrifuged 30min, retains and precipitates and abandon most supernatant, and 1000 μ L, 75% ethyl alcohol (RNase-free H is added2O matches System), acutely shake 30s.It is centrifuged 10min in 4 DEG C of 7500rpm, retains and precipitates and abandon most supernatant, in dry in superclean bench 5-10min.30 μ L RNase-free H are added2O dissolves total RNA.
MiRNA is extracted: referring to miRNeasy Mini Kit (article No. 217004, QIAGEN, the Germany) reagent provided and step It is rapid to carry out.Test sample is placed in the glass homogenizer of Liquid nitrogen precooler first be fully ground after, be added 700 μ L QIAzol reagents Crack tissue and cell.The silicon for the being integrated to adsorption column miRNA released specific under the conditions of certain salting liquid and pH On glue film medium, the small molecular weight impurities such as DNA, protein, salinity are removed by washing step.30 μ L RNase-free are added H2O elutes miRNA.
2.1.3 cDNA is synthesized
Complementary (cDNA) synthetic reaction of Total RNA is referring to PrimeScript RT reagent Kit The reagent and step that with gDNA Eraser (article No. RR047, Takara, Japan) is provided carry out.It is with 1 μ g total RNA Starting template, after removing genomic DNA under the action of gDNA Eraser first, with 6 mers and Oligo dT of Random Primer is anchor primer, synthesizes cDNA under the action of reverse transcriptase.After reaction in 85 DEG C of heating 5s inactivation reaction bodies Enzyme in system.By gained cDNA ddH2It is stand-by that -20 DEG C of refrigerators are stored in after O dilution.It is expanded after 10 times of dilution for regular-PCR； It is reacted after 200 times of dilution for quantitative PCR.
The cDNA synthetic reaction of miRNA is provided referring to II RT kit of miScript (article No. 218160, QIAGEN, Germany) Reagent and step carry out.Using 1 μ g miRNA as starting template, 5 × miScript HiSpec Buffer is selected, mature is made MiRNA synthesizes one section of cDNA comprising known joint under the action of reverse transcriptase.It is lost after reaction in 95 DEG C of heating 5min Enzyme in reaction system living.By gained cDNA ddH2It is stand-by that O is stored in -20 DEG C of refrigerators after diluting 50 times.
2.1.4 quantitative fluorescent PCR
The quantitative fluorescent PCR reaction of mRNA is referring to SYBR Premix Ex Taq II (article No. RR820, Takara, Japan) The reagent and step of offer carry out.Each reaction is configured to 20 μ L reaction systems, includes 2 × qPCR premixed liquid 10 μ L, 50 × ROX 0.4 μ L of Reference Dye II, cDNA template 8.8 μ L, qPCR after 200 times of dilution react upstream primer and downstream primer Each 0.4 μ L (10 μM of concentration).QPCR reaction and analysis are in 7300 fluorescence quantitative PCR instrument of Applied Biosystems ABI It carries out.Response procedures: 95 DEG C of initial denaturation 2min；35 circulations (94 DEG C of 10s, 60 DEG C of 31s).
The quantitative fluorescent PCR of miRNA reacts referencemiScript SYBR Green PCR Kit(article No. 218073, QIAGEN, Germany) provide reagent and step carry out.Each reaction is configured to 20 μ L reaction systems, includes 2 × qPCR premixed liquid 10 μ L, cDNA template 6 μ L, qPCR after 50 times of dilution react 2 μ L of upstream primer (2 μM of concentration), 10 × miScript Universal Primer 2μL.QPCR reaction and analysis are in 7300 fluorescence quantitative PCR instrument of Applied Biosystems ABI Middle progress.Response procedures: 95 DEG C of initial denaturation 15min；35 circulations (94 DEG C of 10s, 55 DEG C of 30s, 70 DEG C of 31s).
According to the method for Livak and Schmittgen (2001), qPCR reacts using house-keeping gene Nlactin1 as internal reference Gene is used to calculate the relative expression levels of testing gene, relative expression quantity=2^ (Ctactin–Cttest gene) × 100%, wherein Ct is the recurring number that instrument is read.
2.2 results and analysis
By the mimics (analogies, for being overexpressed Nlu-mir-9a) and inhibitors that synthesize Nlu-mir-9a (inhibitor, for reducing the transcript abundance of Nlu-mir-9a) carries out microinjection to brown paddy plant hopper 3 age nymph, in vivo verifies Regulating and controlling effect of the Nlu-mir-9a to NlUbx.
The function and effect of mimics and inhibitors are evaluated first, qPCR the result shows that: the 1st day after injection When, long wing strain and brachypterism strain nymph injection 100ng mimics after, the expression of Nlu-mir-9a significantly rises respectively To 2.165 times of control group and 2.599 times；After injection the 3rd day when, long wing strain and brachypterism strain nymph inject 100ng After mimics, the expression of Nlu-mir-9a is significantly risen respectively to 3.547 times of control group and 1.950 times (Fig. 2A, B institutes Show).After injection the 1st day when, long wing strain and brachypterism strain nymph injection 50ng inhibitors after, Nlu-mir-9a's Expression is remarkably decreased respectively to the 32.47% of control group and 47.20%；After injection the 3rd day when, long wing strain and brachypterism After strain nymph injects 50ng inhibitors, the expression of Nlu-mir-9a is remarkably decreased respectively to control group 24.64% and 46.04% (shown in Fig. 2 C, D).
After injection the 1st day when, long wing strain and brachypterism strain nymph injection 100ng mimics after, the expression of NlUbx Level is remarkably decreased respectively to the 74.42% of control group and 85.65%；After injection the 3rd day when, long wing strain and brachypterism strain After nymph injects 100ng mimics, the expression of NlUbx is remarkably decreased respectively to the 68.50% of control group and 79.60% (shown in Fig. 3 A, B).After injection the 1st day when, long wing strain and brachypterism strain nymph injection 50ng inhibitors after, The expression of NlUbx is significantly risen respectively to 1.418 times of control group and 1.276 times；After injection the 3rd day when, long wing product After system and brachypterism strain nymph inject 50ng inhibitors, the expression of NlUbx is significantly risen respectively to control group Shown in 1.306 times and 1.344 times of Fig. 3 C, D).Show that Nlu-mir-9a can influence the expression of NlUbx by way of negative regulation It is horizontal.
3, the influence of Ubx gene pairs brown paddy plant hopper survival rate
3.1 materials and methods
3.1.1 double-stranded RNA (dsRNA) is synthesized
For synthesizing the preparation of the template of dsRNA: when PCR amplification is used to synthesize the template of dsRNA, with packet brown paddy plant hopper cDNA 5 ' the ends for template, upstream and downstream amplimer are connected with T7 promoter sequence (T7 sequence: 5 '- TAATACGACTCACTATAGGG-3').Each PCR reaction is configured to 400 μ L reaction systems, includes 2 × PCR premixed liquid, 200 μ L, 16 μ L of plasmid template, each 16 μ L of the upstream primer and downstream primer of target gene (10 μM of concentration), 152 μ L of ddH2O.Reaction Program: 94 DEG C of initial denaturation 5min；35 circulations (94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 1min)；72℃10min；It is down to 25 DEG C.
DNA purifying: being settled to 400 μ L with RNase-free H2O for plasmid PCR product, and isometric phenol chloroform examination is added 30s is acutely shaken in agent, is stored at room temperature 5min；In refrigerated centrifuge, it is centrifuged 15min in 4 DEG C of 12000rpm, at this time solution point For the organic phase of water phase (the including DNA) and lower layer on upper layer.Supernatant is transferred to new centrifuge tube, the nothing of 2 times of volumes is added The 3M sodium acetate of water-ethanol and 1/10 volume, stands 10min in -20 DEG C of refrigerators.It is centrifuged after taking-up in 4 DEG C of 12000rpm 30min retains precipitating and abandons supernatant to the greatest extent, is added 1000 μ L, 75% ethyl alcohol (RNase-free H2O preparation), acutely shakes 30s. It is centrifuged 10min in 4 DEG C of 7500rpm, retains precipitating and abandons supernatant to the greatest extent, in 5~10min dry in superclean bench.30 μ L are added RNase-free H2O dissolving DNA.
DsRNA synthesis: it is synthesis template with plasmid PCR product after purification, synthesizes dsRNA under the action of transcriptase. Each dsRNA synthetic reaction is configured to 400 μ L reaction systems: including 5 × Transcription buffer, 80 μ L and T7 RNA Each 10 μ L (40U/ μ of 8 μ L, RNase Inhibitor of 8 μ L of Polymerase (20U/ μ L), ATP, CTP, GTP, UTP (100mM) L), 10 μ g of template is synthesized, is settled to 400 μ L with RNase-free H2O.37 DEG C of water-bath 4h.
DsRNA purifying: dsRNA synthetic product is settled to 400 μ L with RNase-free H2O, half volume (200 μ are added L the chloroform of water-saturated phenol and half volume), acutely shakes 30s, is stored at room temperature 5min.In refrigerated centrifuge, in 4 DEG C 12000rpm is centrifuged 10min, and solution is divided into the organic phase of water phase (comprising dsRNA) and lower layer on upper layer at this time.Supernatant is turned New centrifuge tube is moved to, isometric chloroform is added, acutely shakes 30s, is stored at room temperature 5min.It is centrifuged in 4 DEG C of 12000rpm Supernatant is transferred to new centrifuge tube by 10min, and the dehydrated alcohol of 2 times of volumes and the 3M sodium acetate of 1/10 volume is added, in- 10min is stood in 20 DEG C of refrigerators.It is centrifuged 30min in 4 DEG C of 12000rpm after taking-up, retains precipitating and abandons supernatant to the greatest extent, 1000 μ are added 75% ethyl alcohol of L, acutely shakes 30s.It is centrifuged 10min in 4 DEG C of 7500rpm, retains precipitating and abandons supernatant to the greatest extent, in superclean bench Interior dry 5-10min.30 μ L ddH2O dissolution dsRNA is added.
3.1.2 microinjection
Injection dosage for trying dsNlUbx is 150ng, injects the dsGFP of isometric isoconcentration as control.It will be for reagent Agent RNase-free ddH2O is diluted to 5ng/nL concentration.The consistent incubates nymph of brooding time is collected before experiment, to nymph Microinjection is carried out when growing to for 3 age.With the CO of throughput about 200mL/min before injection215s is anaesthetized to for examination insect, in body Injected under stereomicroscope with 2010 microinjection instrument of Nanoliter (WPI, the U.S.), medicament by brown paddy plant hopper outside of belly mesopodium it Between position injection (thus it is minimum inject caused mechanical damage for site).Brown paddy plant hopper after injection is temporarily transferred to It is observed in clean culture dish, is transferred on rice seedling after its recovery and is observed and counted.Every for 24 hours after injection The survival condition of nymph is counted until turning into adult, 3 repetitions of each processing, 50 nymphs of each repetition.
3.2 results and analysis
Injection 150ng dsNlUbx results in the high death rate, and the long wing strain of brown paddy plant hopper and brachypterism strain only have respectively 5.33% and 19.33% nymph can successfully sprout wings, substantially less than control group (73.33% and 88.59%) (as shown in Figure 4). Almost all of lethal cases all originate from low age and are obstructed to husking when advanced age (or emergence), show as back and occur one obviously Ecdysial line, but successfully can not slough off old skin, final stiff and feeding and it is dead.
4, Dual-Luciferase Gene Reporter System verifying Nlu-mir-9a is to the negative regulation effect of NlUbx and binding site
4.1 materials and methods
Dual-Luciferase report carrier pmiR-RB-REPORT Vector main composition element is as follows, which can express Ampicillin resistant gene, fluorescent reporter gene are renilla luciferase gene (hRluc), and fluorescence correction gene is firefly Luciferase gene (hluc), exogenous sequences insertion point include the restriction enzyme sites such as Not I, Pme I, Xho I, Sgf I (as schemed Shown in 5).
4.1.1 wild-type reporter vector construction
3 ' UTR sequence of NlUbx amplification: referring to the sequence of 3 ' UTR of NlUbx, the double digestion of design construction wild type carrier React primer, it may be assumed that WT-Ubx-F 5 '-GCGGCTCGAGGTGGACAGCTAGGTGCTC-3 '；WT-Ubx-R 5'- AATGCGGCCGCGCTGGTATCTGTTTTTCT-3'.Wherein, CTCGAG is Xho I restriction enzyme site sequence；GCGGCCGC is Not I restriction enzyme site sequence, the sequence in 5 ' direction of restriction enzyme site are protection base.
Each touchdown PCR reaction is configured to 30 μ L reaction systems, pre- comprising 2 × Phusion High-Fidelity PCR Mixed liquid (article No. F531S,Thermo Fisher Scientific, the U.S.) 15 3 ' UTR plasmid template of μ L, NlUbx 1 μ L (about 100ng), upstream primer and each 1 μ L of downstream primer (10 μM), ddH2O 12μL.Response procedures: 98 DEG C of initial denaturation 3min.10 Circulation [98 DEG C of 10s, 65 DEG C of 30s (1 DEG C is reduced after each circulation), 72 DEG C of 1min]；25 circulation (98 DEG C of 10s, 60 DEG C of 30s, 72 ℃1min)；72℃10min；It is down to 25 DEG C.
Endonuclease reaction: referring to Xho I restriction endonuclease (article No. 1094S, Takara, Japan) and Not I inscribe enzyme reagent kit (goods Number 1166S, Takara, Japan) reagent that provides and method, double enzyme digestion reaction is carried out to above-mentioned PCR product.Prepare 40 μ L reaction System includes 10 × H buffer, 4 μ L, 2 μ g, Xho I restriction endonuclease (10U/ μ L) of purified product and Not I restriction endonuclease (10U/ μ L) Each 1 μ L, uses ddH2O is settled to 40 μ L.In 37 DEG C of reaction 4h.
Connection reaction: digestion products and report carrier are subjected to plasmid recombination.10 μ L reaction systems are prepared, comprising after purification Digestion products 150ng, pmiR-RB-REPORT Vector 50ng, solution I quickly connect 5 μ L of liquid, use ddH2O is fixed Hold to 10 μ L.In 16 DEG C of reaction 30min.Obtain wild-type reporter carrier.
4.1.2 1 report carrier of saltant type constructs
Referring to the sequence of 3 ' UTR of NlUbx and the binding site of prediction, the double enzyme digestion reaction of 1 carrier of design construction saltant type Primer, for being mutated the 1st potential binding site.It, can since the 1st mutational site is close to the initiation site of Insert Fragment Directly Mut1-Ubx-F and WT-Ubx-R to be utilized to match, PCR reaction, PCR product are carried out by template of 3 ' UTR plasmid of NlUbx Without splicing, as required 1 report carrier of saltant type.Mut1-Ubx-F 5'-GCGGCTCGAGGTGGACAGCTAGGTGCT CCACCAGGCGCACGGCGAGGTGGACGGTTTCACTCATAGCAGACATGCC-3'.Wherein, CTCGAG is Xho I digestion position Point sequence, the sequence in 5 ' direction of restriction enzyme site are protection base.
Each touchdown PCR reaction is configured to 30 μ L reaction systems, pre- comprising 2 × Phusion High-Fidelity PCR Mixed 15 3 ' UTR plasmid template of μ L, NlUbx of liquid, 1 μ L (about 100ng), upstream primer and each 1 μ L of downstream primer (10 μM), ddH2O 12μL.Response procedures: 98 DEG C of initial denaturation 3min.10 circulations [98 DEG C of 10s, 65 DEG C of 30s (reduce by 1 DEG C) after each circulation, and 72 DEG C 1min]；25 circulations (98 DEG C of 10s, 60 DEG C of 30s, 72 DEG C of 1min)；72℃10min；It is down to 25 DEG C.
Endonuclease reaction: referring to Xho I restriction endonuclease (article No. 1094S, Takara, Japan) and Not I inscribe enzyme reagent kit (goods Number 1166S, Takara, Japan) reagent that provides and method, double enzyme digestion reaction is carried out to above-mentioned PCR product.Prepare 40 μ L reaction System includes 10 × H buffer, 4 μ L, 2 μ g, Xho I restriction endonuclease (10U/ μ L) of purified product and Not I restriction endonuclease (10U/ μ L) Each 1 μ L, uses ddH2O is settled to 40 μ L.In 37 DEG C of reaction 4h.
Connection reaction: digestion products and report carrier are subjected to plasmid recombination.10 μ L reaction systems are prepared, comprising after purification Digestion products 150ng, pmiR-RB-REPORT Vector 50ng, solution I quickly connect 5 μ L of liquid, use ddH2O is fixed Hold to 10 μ L.In 16 DEG C of reaction 30min.Obtain 1 report carrier of saltant type.
4.1.3 2 report carrier of saltant type constructs
Referring to the sequence of 3 ' UTR of NlUbx and the binding site of prediction, the double enzyme digestion reaction of 2 carrier of design construction saltant type Primer, for being mutated the 2nd potential binding site.Mut2-Ubx-F 5'-AGTCAACAGGTTTCTCAACGACTGTCAAAG GT-3'；Mut2-Ubx-R 5'-GTCGTTGAGAAACCTGTTGACTGCGCCAACTG-3'.The sequence amplification of 2 carrier of saltant type Need to carry out segmented-PCR reaction: upstream primer (WT-Ubx-F) and downstream mutant primer (Mut2-Ubx-R) are matched；Upstream mutation is drawn Object (Mut2-Ubx-F) and downstream primer (WT-Ubx-R) are matched.Each touchdown PCR reaction is configured to 30 μ L reaction systems, includes 2 × Phusion High-Fidelity PCR premixed liquid, 15 3 ' UTR plasmid template of μ L, NlUbx, 1 μ L (about 100ng), upstream is drawn Object and each 1 μ L of downstream primer (10 μM), ddH2O 12μL.Response procedures: 98 DEG C of initial denaturation 3min.10 circulation [98 DEG C of 10s, 65 DEG C of 30s (1 DEG C is reduced after each circulation), 72 DEG C of 1min]；25 circulations (98 DEG C of 10s, 60 DEG C of 30s, 72 DEG C of 1min)；72℃ 10min；It is down to 25 DEG C.
The splicing of segmented-PCR product: being configured to 10 μ L reaction systems, pre- comprising 2 × Phusion High-Fidelity PCR Mixed 5 μ L of liquid, segmented-PCR product each 1 μ L, ddH2O 3μL.Response procedures: 98 DEG C of initial denaturation 3min；8 circulation [98 DEG C of 10s, 60 DEG C 30s (reduces by 1 DEG C) after each circulation, 72 DEG C of 30s]；10 circulations (98 DEG C of 10s, 55 DEG C of 30s, 72 DEG C of 30s)；72℃5min； It is down to 25 DEG C.
Splicing product PCR reaction: being configured to 30 μ L reaction systems, pre- comprising 2 × Phusion High-Fidelity PCR Mixed 15 μ L of liquid, above-mentioned splicing product is that template 1 μ L, Mut2-Ubx-F and Mut2-Ubx-R are each 1 μ L (10 μ of upstream and downstream primer M), ddH2O 12μL.Response procedures: 98 DEG C of initial denaturation 3min；35 circulations (98 DEG C of 10s, 60 DEG C of 30s, 72 DEG C of 1min)；72℃ 10min；It is down to 25 DEG C.
Endonuclease reaction: referring to Xho I restriction endonuclease (article No. 1094S, Takara, Japan) and Not I inscribe enzyme reagent kit (goods Number 1166S, Takara, Japan) reagent that provides and method, double enzyme digestion reaction is carried out to above-mentioned PCR product.Prepare 40 μ L reaction System includes 10 × H buffer, 4 μ L, 2 μ g, Xho I restriction endonuclease (10U/ μ L) of purified product and Not I restriction endonuclease (10U/ μ L) Each 1 μ L, uses ddH2O is settled to 40 μ L.In 37 DEG C of reaction 4h.
Connection reaction: digestion products and report carrier are subjected to plasmid recombination.10 μ L reaction systems are prepared, comprising after purification Digestion products 150ng, pmiR-RB-REPORT Vector 50ng, solution I quickly connect 5 μ L of liquid, use ddH2O is fixed Hold to 10 μ L.In 16 DEG C of reaction 30min.Obtain 2 report carrier of saltant type.
4.1.4 recombinant plasmid and the measurement of mimics cotransfection and fluorescent value
37 DEG C and 5%CO are lain in for examination 293T cell2Under the conditions of cultivated.The 293T cell of logarithmic growth phase will be in With every hole 1.5 × 104Cell (100 μ L) is transferred to 96 porocyte culture plates, continues culture in 37 DEG C for 24 hours.Take 10 μ L OPTI- MEM culture medium (article No. 31985070, GIBCO, the U.S.) dilutes Nlu-mir-9a mimics or non-target control, 15 μ L OPTI-MEM culture mediums dilute the Dual-Luciferase gene report carrier built, the dilution of 25 μ L OPTI-MEM culture mediums 0.25 μ L Lipofectamine, 2000 reagent (article No. 11668027, Invitrogen, the U.S.), by three after the completion of dilution After flicking mixing, it is stored at room temperature 20min；50 μ L culture mediums are sucked out in each cell culture well, and above-mentioned mixed liquor is added；It is added after 6h 100 μ L fresh cultures.Wherein, mimics transfection concentrations are the hole 50nM/, and report carrier transfection concentrations are the hole 250ng/.Each Processing is repeated comprising 3 groups of biology, and each repetition sets 3 technologies and repeats.
The examination recommended referring to Dual-Glo Luciferase Assay System (article No. E2920, Promega, the U.S.) Agent and method carry out fluorescence intensity detection.Before detection, by the luciferase substrate and luciferase buffer in kit It is saved after being uniformly mixed and dispensing in -80 DEG C, uses forward horizontal stand to room temperature；It will be protected after stop&Glo buffer packing in -80 DEG C It deposits, using forward horizontal stand to room temperature and takes appropriate addition stop&Glo substrate, it is ready-to-use.Culture medium, every hole is sucked out after transfection 48h 35 μ L PBS buffer solution and 35 μ L luciferase substrates, continuous oscillation 10min is added；Add 30 μ L stop Reagent, after persistent oscillation 10min.After the reaction was completed, fluorescence intensity is measured using Veritas 9100-002 fluorescence illumination photometer.
4.2 results and analysis
Complete 3 ' UTR sequence of NlUbx is connected to by renilla luciferase gene coding region by double enzyme digestion reaction first Downstream, construct wild type Dual-Luciferase fusion expression vector.By Nlu-miR-9a mimics (processing group) and non- Target control (control group) is trained with for examination expression vector cotransfection into human embryonic kidney cell line (HEK293T) respectively It supports.With firefly luciferase gene (hluc) for fluorescence correction gene, the expression of renilla luciferase gene (hRluc) is detected Level variation.The result shows that the fluorescence intensity of cell line expression has dropped about compared to control group when transfecting mimics 40.54% (as shown in Figure 6A) shows that Nlu-miR-9a can be encoded suppressor upstream and in conjunction with 3 ' UTR of NlUbx The expression in area.
In order to further determine the binding site of Nlu-miR-9a and NlUbx, respectively to software prediction go out two it is potential The carry out rite-directed mutagenesis (CCAAAG sports GGTTTC) of binding site constructs mutant expression vector.It is mutated first combination When carrying out cotransfection behind site, fluorescence intensity expressed by cell line has still been remarkably decreased 16.72% (as shown in Figure 6B)；It is prominent Cotransfection is carried out after becoming second binding site, does not have significance difference between fluorescence intensity caused by processing group and control group at this time It is different (as shown in Figure 6 C), show that second binding site is the true action site of Nlu-miR-9a and NlUbx.
1 mir-9a-5p of table and the forecast analysis of NlUbx action site
5, influence of the Nlu-mir-9a to brown paddy plant hopper survival rate
5.1 materials and methods
5.1.1 microinjection
The injection dosage of Nlu-mir-9a mimics (analogies) is respectively 100ng and 50ng, injects isometric isoconcentration Non-target control as control, these above-mentioned reagents synthesize by Rui Bo Biotechnology Co., Ltd.It will be for examination Medicament RNase-free ddH2O is diluted to 5ng/nL concentration.
The consistent incubates nymph of brooding time is collected before experiment, and microinjection is carried out when nymph grew to for 3 age.Before injection With the CO of throughput about 200mL/min215s is anaesthetized to for examination insect, it is micro- with Nanoliter 2010 under stereomicroscope Injection instrument (WPI, the U.S.) is injected, and medicament by the position injection between brown paddy plant hopper outside of belly mesopodium, (thus injected by site Caused mechanical damage is minimum).Brown paddy plant hopper after injection is temporarily transferred in clean culture dish and is observed, it is multiple to it It is transferred to after Soviet Union on rice seedling and is observed and counted.Survival condition after injection every statistics nymph for 24 hours is until turn into Adult, 3 repetitions of each processing, 50 nymphs of each repetition.
5.2 results and analysis
Injection 100ng Nlu-mir-9a mimics results in the high death rate, long wing strain and brachypterism strain difference Only 13.33% and 14.67% nymph can successfully sprout wings, and substantially less than control group (69.33% and 71.33%) is (such as Fig. 7 institute Show).Almost all of lethal cases all originate from low age and are obstructed to husking when advanced age (or emergence), show as back and occur one Apparent ecdysial line, but successfully can not slough off old skin, final stiff and feeding and it is dead.When injection relatively low-dose (50ng) Half or so when mimics, when the death rate is about high dose (100ng) injection.
The embodiments of the present invention have been described in detail above, but content is only the preferred embodiment of the present invention, It is not intended to limit the invention.All any modifications, equivalent replacements, and improvements etc. done in application range of the invention, should all It is included within protection scope of the present invention.
SEQUENCE LISTING
<110>Jiangxi Academy of Agricultural Sciences's agricultural microbe research institute (Kitchen Stoves In Rural Areas In Jiangxi Province energy research center)；Central China agriculture Sparetime university is learned
<120>a kind of miRNA and its application for killing brown paddy plant hopper
<160> 7
<210> 1
<211> 484
<212> RNA
<213>brown paddy plant hopper (Nilaparvata lugens)
<400> 1
acaugggcauaguccgaaauauuacaguaacauuauuaauaauuauuacuuuauuuguaauuguaucuacua auaaauaaauauuacaucaauuacaucaauaucaguagcuccauuaauaucugcgauaguagacuuugauaucauc auggcgauggcugaagaaaacgacugaauccuucaaucuucaagaaggugcugacgcuuucuuugguuaucuagcu guaugaacguucgauaucauaaagcuagguuaccgaaguuauuaucagcaucugaucucugcucuacacucacacu gcgacucccuucuuucaaucaggccccaccagaggauuuuuauuauuuaauuaccaauuuuguaauuauaacgugg accucacuauaguagaccaguucucaauauuuauauuguaucuugcuuuauucagcaucauuauucaauagcauaa uuauucaaaaaaaaaaaaaaaaaaaaaaaaaa
<210> 2
<211> 20
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 2
taatacgactcactataggg
<210> 3
<211> 28
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 3
gcggctcgaggtggacagctaggtgctc
<210> 4
<211> 29
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 4
aatgcggccgcgctggtatctgtttttct
<210> 5
<211> 76
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 5
gcggctcgaggtggacagctaggtgctccaccaggcgcacggcgaggtggacggtttcactcatagcagaca tgcc
<210> 6
<211> 32
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 6
agtcaacaggtttctcaacgactgtcaaaggt
<210> 7
<211> 32
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 7
gtcgttgagaaacctgttgactgcgccaactg

Claims (10)

1. a kind of miRNA, it is characterised in that the nucleotide sequence of the miRNA is as shown in SEQ ID NO:1.
2. the application that miRNA described in a kind of claim 1 is used to kill brown paddy plant hopper.
3. application according to claim 2, it is characterised in that the application is that the miRNA is injected in brown paddy plant hopper body.
4. application according to claim 3, it is characterised in that the injection dosage of every brown paddy plant hopper is 50~100ng.
5. application according to claim 4, it is characterised in that the brown paddy plant hopper is brown paddy plant hopper nymph.
6. application according to claim 5, it is characterised in that the injection, comprising the following steps: use the miRNA RNase-free ddH2O is diluted to 5ng/nL concentration；3 age in days brown paddy plant hopper nymphs are taken, are first 180~220mL/min with throughput CO215s is anaesthetized to the brown paddy plant hopper nymph, then uses microinjection instrument from the brown paddy plant hopper nymph abdomen under stereomicroscope The miRNA solution after the dilution is injected at position between the mesopodium of face, and miRNA injection dosage is 50~100ng.
7. the application that miRNA described in a kind of claim 1 is used to prepare brown paddy plant hopper protective agents.
8. application according to claim 7, it is characterised in that the dosage form of the drug is injection.
9. application according to claim 7, it is characterised in that the drug effect is born in 3 ' UTR of NlUbx gene Regulate and control the expression of NlUbx gene.
10. application according to claim 7, it is characterised in that when the drug hinders brown paddy plant hopper to grow to advanced age by low age Or husking when sprouting wings, the brown paddy plant hopper die of stiff and feeding.
CN201910564291.XA 2019-06-27 2019-06-27 MiRNA and application thereof in killing Nilaparvata lugens Active CN110295169B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910564291.XA CN110295169B (en) 2019-06-27 2019-06-27 MiRNA and application thereof in killing Nilaparvata lugens

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910564291.XA CN110295169B (en) 2019-06-27 2019-06-27 MiRNA and application thereof in killing Nilaparvata lugens

Publications (2)

Publication Number Publication Date
CN110295169A true CN110295169A (en) 2019-10-01
CN110295169B CN110295169B (en) 2022-11-08

Family

ID=68029057

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910564291.XA Active CN110295169B (en) 2019-06-27 2019-06-27 MiRNA and application thereof in killing Nilaparvata lugens

Country Status (1)

Country Link
CN (1) CN110295169B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111264475A (en) * 2020-03-09 2020-06-12 沈阳农业大学 Microinjection method for small insect adults of whiteflies
CN113564167A (en) * 2021-07-30 2021-10-29 中山大学 Rice insect-resistant microRNA and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101203611A (en) * 2005-04-19 2008-06-18 巴斯福植物科学有限公司 Improved methods controlling gene expression
CN104293797A (en) * 2014-10-15 2015-01-21 中国计量学院 NlAKTIP gene related to growth and development of brown planthopper as well as encoding protein and application thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101203611A (en) * 2005-04-19 2008-06-18 巴斯福植物科学有限公司 Improved methods controlling gene expression
US20160152994A1 (en) * 2005-04-19 2016-06-02 Basf Plant Science Gmbh Methods controlling gene expression
CN104293797A (en) * 2014-10-15 2015-01-21 中国计量学院 NlAKTIP gene related to growth and development of brown planthopper as well as encoding protein and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
张宏: "帕金森病患者脑脊液中miR-9a的表达及其临床意义", 《中国医药指南》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111264475A (en) * 2020-03-09 2020-06-12 沈阳农业大学 Microinjection method for small insect adults of whiteflies
CN113564167A (en) * 2021-07-30 2021-10-29 中山大学 Rice insect-resistant microRNA and application thereof
CN113564167B (en) * 2021-07-30 2023-07-07 中山大学 Rice insect-resistant microRNA and application thereof

Also Published As

Publication number Publication date
CN110295169B (en) 2022-11-08

Similar Documents

Publication Publication Date Title
CN106754948B (en) Nilaparvata lugens NlMLP gene, encoding protein and application thereof
CN111387105B (en) Method for producing seeds of all-male macrobrachium rosenbergii
CN114957426B (en) SP6RARS and application thereof in preventing and treating cockroaches
CN108610427A (en) Migratory locusts diapause hormone gene and its application in regulating and controlling Insect Diapause
CN114921467A (en) dsRNA (double-stranded ribonucleic acid) based on myzus persicae effect factor MpC002 gene and application thereof in prevention and treatment of myzus persicae
CN110295169A (en) A kind of miRNA and its application for killing brown paddy plant hopper
CN114853861B (en) Periplaneta americana PRP protein expression inhibitor, and encoding gene and application thereof
CN103215266B (en) RNAi and the application thereof of growing for regulating and controlling silkworm pupa
KR102008064B1 (en) Composition and method of controlling virus mediated by small brown planthopper using dsRNA targeting nuclear receptor E75 gene of small brown planthopper
CN111440823B (en) Recombinant vector and construction method and application thereof
CN112574989A (en) shRNA for inhibiting reproduction of largemouth black bass rhabdovirus and application thereof
EP2201116A1 (en) Means and methods for shrna mediated conditional knockdown of genes
CN106676112B (en) Citrus fruit fly Taiman gene and its qRT-PCR detection method and its siRNA
CN111606989B (en) Application of reproductive development related gene UCP and dsRNA thereof in prevention and control of bactrocera dorsalis
CN112522278B (en) dsRNA (double-stranded ribonucleic acid) designed based on periplaneta americana olfactory receptor gene OR3X, encoding gene, preparation method and application thereof
CN110106179B (en) dsRNA of locusta migratoria fatty acid synthetase gene LmFAS3 as well as preparation method and application thereof
CN108949769B (en) Cotton bollworm ecdysone regulatory factor E78-C gene cDNA and application thereof
CN110106175A (en) A kind of dsRNA and its application in control of insect
CN112725345B (en) dsRNA designed based on periplaneta americana sex pheromone receptor gene OR5M, coding gene, preparation method and application thereof
CN116491520B (en) Application of Tetranychus urticae effector Tu28 gene in regulation and control of Tetranychus urticae
CN109295058B (en) MicroRNA sponge for inhibiting miR-34 family molecules, nucleic acid construct and application
CN117965544A (en) MiR-8529-5p for controlling lepidoptera pests and application thereof
CN117965545A (en) MiR-8492-3p for preventing lepidoptera pests and application thereof
CN115927357A (en) Apolygus punctatus secretory protein RPSP4043 and application thereof in prevention and control of soybean&#39; symptom green
AU2013202599B2 (en) MicroRNA molecules

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant