CN112725345B

CN112725345B - dsRNA designed based on periplaneta americana sex pheromone receptor gene OR5M, coding gene, preparation method and application thereof

Info

Publication number: CN112725345B
Application number: CN202011596738.0A
Authority: CN
Inventors: 李娜; 李胜; 黄润; 董任科
Original assignee: Guangmeiyuan R & D Center Key Laboratory Of Insect Developmental Biology And Applied Technology Huashi Meizhou City; South China Normal University
Current assignee: Guangmeiyuan R & D Center Key Laboratory Of Insect Developmental Biology And Applied Technology Huashi Meizhou City; South China Normal University
Priority date: 2020-12-29
Filing date: 2020-12-29
Publication date: 2021-09-28
Anticipated expiration: 2040-12-29
Also published as: CN112725345A

Abstract

The invention discloses dsRNA designed based on a periplaneta americana sex pheromone receptor gene OR5M, a coding gene, a preparation method and application thereof, wherein the nucleotide sequence of the gene is shown as SEQ ID No.1, the sex pheromone receptor gene OR5M is targeted by synthesizing specific dsRNA to interfere the recognition of male adults on sex pheromones released by female periplaneta americana, so that the normal mating of the periplaneta americana is blocked, the aim of preventing and controlling the periplaneta americana is fulfilled finally, and a new technology and a new strategy are provided for the prevention and control of the periplaneta americana.

Description

dsRNA designed based on periplaneta americana sex pheromone receptor gene OR5M, coding gene, preparation method and application thereof

Technical Field

The invention relates to the field of sanitary pest control, in particular to dsRNA (double-stranded ribonucleic acid) designed based on a periplaneta americana sex pheromone receptor gene OR5M, a coding gene, a preparation method and application thereof.

Background

Cockroaches are an important worldwide sanitary pest group and pose serious hazards to human health and public health. Cockroaches carry various pathogenic microorganisms, can cause infectious diseases such as cholera, anthrax, tuberculosis and the like, and can also cause allergic reactions such as rash, asthma and the like. Periplaneta americana (Periplaneta americana L.) is one of the most common species of Blattaria, and is also the dominant population in the south China, and has superior environmental adaptability and vitality, and remarkable reproductive and detoxifying abilities. Periplaneta americana has developed into the dominant species of the town cockroach community in China, and the global greenhouse effect is gradually enhanced, the damage and outbreak frequency is increased year by year and the trend of continuous north movement is in existence.

Mating behavior is of great importance for the maintenance of populations. Mating behavior is the root cause of mass propagation of periplaneta americana. Periplaneta americana relies primarily on the olfactory system to recognize sex pheromone compounds. The olfactory system includes the central nervous system and the peripheral nervous system, where the antennae are extensions of the peripheral nervous system. The recognition of the foreign odor molecules by insects is mainly dependent on the antennae. The surface of the antenna is distributed with different types of nose receptors (commonly called sensory hair), the epidermis of the receptors is provided with a plurality of pores, and external odor molecules can enter the receptors through the pores. Olfactory Receptors (OR) are key proteins that recognize external odorant molecules, and can convert chemical signals into electrical signals, which are finally transmitted into the central nervous system. Olfactory receptors can be divided into two broad categories: one type is highly variable among different insects, has very low homology, and is called a traditional odorant receptor (PR), which includes a general odorant receptor and a pheromone receptor; the other is an atypical odorant receptor which is highly conserved among different insects, also known as odorant receptor co-receptor or complex receptor (Orco), which is well conserved in structure and function, and can form heterodimers with various conventional olfactory receptors to assist the latter in correctly positioning olfactory neurons and functioning as co-receptors. The common olfactory receptor can recognize specific external odorant molecules only by forming specific cation channels together with highly conserved Orco.

During the long-term evolution process, insects can breed in a population by utilizing the strong feeding and reproductive capacities of the insects. Different species of specific insects have unique feeding and breeding modes to adapt to different habitats. Insects form a specific and sensitive set of olfactory communication systems. They accomplish a series of important life activities, especially the selection of suitable spawning breeding sites, mating, etc., by identifying intraspecies or interspecies sex pheromones and various odorous compounds in nature. The recognition of the insect to the external odor molecules mainly depends on the antennae, about thousands to tens of thousands of olfactory sensors are arranged on the antennae of the adult insects, a plurality of small holes are arranged on the epidermis of the sensor, and the odor molecules in the environment can enter the sensor through the small holes. Numerous olfactory receptors are present within the receptor. Olfactory receptors can specifically recognize odorants, especially sex pheromones. Sex pheromone-related olfactory receptors have been identified in a variety of insects, such as bombyx mori, golden-spotted black-vein butterflies, red-sleeve butterflies, diamondback moths, and the like. However, the sex pheromone receptor of periplaneta americana has not been found so far.

At present, the prevention and the treatment of the periplaneta americana mainly depend on the traditional chemical pesticide, but the problems of drug resistance, drug residue, rampant and the like are increased day by day, and the health and the ecological environment of people and livestock are seriously threatened. Therefore, the development of a new biological control method and the exploration of a new American cockroach control strategy are imperative.

Disclosure of Invention

The present invention is directed to solving at least one of the problems of the prior art. Therefore, the invention provides a periplaneta americana sex pheromone receptor gene OR5M which can be used for controlling the periplaneta americana.

The invention also provides a method for preparing dsRNA of the gene.

The invention also provides dsRNA of the gene.

The invention also provides a coding gene of the dsRNA of the gene, and an expression vector, a transgenic cell line or a host bacterium containing the coding gene.

The invention also provides the application of the gene.

The periplaneta americana sex pheromone receptor gene OR5M according to the first aspect embodiment of the present invention has the nucleotide sequence shown in SEQ ID No. 1.

The method for preparing the above-mentioned gene dsRNA according to the second aspect embodiment of the present invention comprises the steps of: and carrying out PCR amplification by using cDNA of the periplaneta americana sex pheromone receptor gene OR5M as a template and using an interference primer group as a primer.

According to some embodiments of the invention, the set of interfering primers comprises an upstream primer OR5M Fp and a downstream primer OR5M Rp, wherein the nucleotide sequence of the upstream primer OR5M Fp is shown in SEQ ID No. 5; the nucleotide sequence of the downstream primer OR5M Rp is shown as SEQ ID NO. 6.

According to some embodiments of the invention, the preparation method is in particular: the interference primer group is used for amplifying a dsRNA targeting sequence DNA fragment of a targeted silent OR5M gene, the amplified DNA fragment is cloned to a pMD18-T vector named pMD18-T-OR5M, then a primer with T7 promoters at two ends is designed by taking pMD18-T-OR5M as a template, and PCR amplification is carried out to obtain the dsRNA targeting sequence.

According to some embodiments of the invention, the nucleotide sequence of the upstream primer OR5M T7-FP of the primer containing the T7 promoter at two ends is shown as SEQ ID No. 7; the nucleotide sequence of the downstream primer OR5M T7-RP is shown as SEQ ID No. 8.

According to some embodiments of the invention, the dsRNA targeting sequence is obtained by transcription synthesis using T7RiboMAX Express RNAi System.

According to some embodiments of the invention, the dsRNA is used in the preparation of a drug for controlling periplaneta americana.

According to some embodiments of the invention, the dsRNA is used in the preparation of a product for disrupting normal mating of periplaneta americana.

According to some embodiments of the invention, the dsRNA is used in the preparation of a composition for controlling the mating reproduction of periplaneta americana.

According to the dsRNA of the above gene of the third aspect of the present invention, the dsRNA is a double-stranded RNA consisting of the nucleotide sequence shown as SEQ ID No.2 as a sense strand and the nucleotide sequence SEQ ID No.3 reverse-complementary to the nucleotide sequence shown as SEQ ID No.2 as an antisense strand.

According to some embodiments of the invention, the nucleotide sequence of the dsRNA is as shown in SEQ ID No. 9.

The coding gene of dsRNA of the gene according to the fourth aspect of the invention and an expression vector, a transgenic cell line or a host bacterium containing the coding gene.

According to some embodiments of the invention, the method of preparing the gene comprises the steps of: designing a promoter primer pair based on the gene nucleotide sequence, and carrying out PCR amplification to obtain the gene.

According to some embodiments of the invention, the gene further comprises an expression vector, an expression cassette, a transgenic cell line or a host bacterium comprising the gene.

According to some embodiments of the invention, the expression vector is pMD 18-T.

According to some embodiments of the invention, the host bacterium is DH5 a.

The application of the gene is the application in preparing the periplaneta americana control medicament.

A method for controlling American cockroaches comprises the following steps: the dsRNA is introduced into the periplaneta americana.

According to some embodiments of the invention, the introducing is by way of injection; preferably, the injection operation is microinjection.

According to some embodiments of the invention, the introducing is performed into the abdominal cavity of the adult american cockroach.

According to some embodiments of the invention, the introducing may also be by feeding.

According to some embodiments of the invention, the introducing is performed before the operation by subjecting the periplaneta americana to CO₂And (6) anaesthetizing.

According to some embodiments of the invention, the injection is from the 3 rd to the 4 th abdominal segments along the abdomen from the bottom up direction.

According to some embodiments of the invention, the introducing is performed by injection on the third day immediately after eclosion.

The invention has the beneficial effects that: the invention provides a periplaneta americana sex pheromone receptor gene OR5M, a dsRNA sequence for targeted silencing of the periplaneta americana sex pheromone receptor gene OR5M is synthesized by design, the dsRNA is introduced into the periplaneta americana, the expression of the OR5M gene can be obviously inhibited, the activity of the periplaneta americana sex pheromone receptor is blocked, the induction effect of the sex pheromone on the periplaneta americana is inhibited, and therefore the control on the propagation quantity and speed of the periplaneta americana is realized; the invention provides a cockroach control method which is environment-friendly, efficient and low-toxicity in development, and the method targets a sex pheromone receptor gene OR5M by synthesizing specific dsRNA to interfere the recognition of male adults on sex pheromones released by female American cockroaches, so that the normal mating of the American cockroaches is blocked, the aim of controlling the American cockroaches is fulfilled finally, and a new technology and a new strategy are provided for the control of the American cockroaches.

Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.

Drawings

FIG. 1 is a graph showing the results of expression levels of OR5M gene in different tissues in example II of the present invention;

FIG. 2 is a graph showing the results of the expression level of OR5M gene at a time after emergence in the second example of the present invention;

FIG. 3 is a graph showing the results of the interference efficiency of OR5M gene in example III of the present invention;

FIG. 4 is a graph showing the odor selection result of male periplaneta americana to female periplaneta americana after the interference of OR5M gene in example three of the present invention.

Detailed Description

In order to explain technical contents, achieved objects, and effects of the present invention in detail, the following description is made with reference to the accompanying drawings in combination with the embodiments. The test methods used in the examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are commercially available reagents and materials unless otherwise specified.

A dsRNA designed based on Periplaneta americana sex pheromone receptor gene OR5M, wherein the sense strand sequence of the nucleotide sequence of the dsRNA is shown as SEQ ID No.2, the antisense strand sequence is a nucleotide sequence (shown as SEQ ID No. 3) which is reversely complementary with the nucleotide sequence shown as SEQ ID No.2, and the preparation process is as follows: molecular cloning is carried out on the sequence (shown as SEQ ID No.1) of the olfactory receptor OR5M gene, and DNA sequencing is carried out to check the authenticity and homology of the sequence, so that the dsRNA product of the periplaneta americana sex pheromone receptor gene OR5M with qualified quality and reliable effect is obtained by using an in vitro synthesis method.

The periplaneta americana strain is purchased from Tengfei breeding base (Anhui, China), and is fed into a plastic box with good air permeability for a long time in a closed greenhouse with the feeding environment of 28 +/-1 ℃, the relative humidity of 70-80% and reasonable light period (light: dark: 12 h). And periodically, on time and in quantity, sufficient dog food (purchased from aijia biotechnology, tianjin) and drinking water were given to periplaneta americana. And sorting the emerged male and female insects, and aggregating the female and male insects as required to maintain the number and the scale of the population.

Example 1: design and Synthesis of dsRNA

The design and synthesis of dsRNA comprise the following steps:

(1) primer design

From the reported sequences of the OR5M genes of other species, homologous alignment is carried out in the periplaneta americana genome to obtain the complete sequence of the periplaneta americana sex pheromone receptor gene OR5M (shown as SEQ ID No. 1). The dsRNA design website E-RNAi (https:// www.dkfz.de/signalling/E-RNAi 3/), the whole Periplaneta americana sex pheromone receptor gene OR5M open reading frame sequence is copied and pasted to the website, and the dsRNA target sequence I (shown as SEQ ID No. 2) is obtained through design parameter screening. Designing a primer according to the nucleotide sequence shown in the sequence SEQ ID No.2, wherein a forward primer OR 5M-Fp: ATTGCACGGAATTTGTT (SEQ ID No.5) and a reverse primer OR 5M-Rp: AGTCTGAGTAGTGGACTG (SEQ ID No. 6).

The sequence (SEQ ID No.1) of the periplaneta americana sex pheromone receptor gene OR5M is as follows:

ATGCGAAGTGACAGGAGAGATTTACCGACAGAGCTTCGCCCCGTTTCTTTGCAAAGTGCTCAACCTGGAACAGTTAGATTCGCCTTCACTGAAGGTACCACCTTGGTCAGCAATGTCCCAAAGAAAGGAAAAAAAAGTTTCAAAATGGTTGTCTGCAATATGGTGTGGAAGTAACCAGTTTCCATTTTTGTATATCATTTCACATATTGTTGAATCTTCACTTGCGATGGTTTAAAGTAGTAGTATAAGAAGGACACACTACTGTACCATGTCATACGCAGCATCGAAACTAGCTGTCAGAGACAGTTTTGATGATGAAGATGTCAGTGATGATGTCGAAGATGAAGTGTTTATTCGTGACGGAAGGAATGGGTTTAAGGTTGATGAAGAAAGAGGGGTTAAACGACCTCTCATGGCCCCAAGACGAAAAACGAAGCCTAATCAATTACACGGTGATGTTGGTAGAAGGCCTCCATGTAGAGCTCTATGTGCACCATGTTGCTATGGATGTATAGCATTGGCTGCTCTTTTAGGTTTAATAGTGTTGGTGGTGTCATTAGTGATGTGGTTTCCATTTCCGTTAGACCAAGTGACAGAGTTTTGGAAGATTAGGCAAGGGTCTCGCTCGGGAGGTTTCATAGTTCCTTGCACAGAGCTAGTCGTAGAAGATGTGTGGACGAAAACCTTATCAAAACTAACAGTGGAAACAGCTGTACGTCTAAATGACGTCAATGGAGATGGAGTATTGGATGTTATTGTAGGATATGGAACAGGGTTGTGACAGTCCTTTGCATGCAACATTGTGACATGAAGATGACTGACGATAAGCCAGATATAATCCTATTCTACAATTCTACTAAAGCAGGAATGGATGTTCTTGACAAGTGCATAAGAACATACTCTTGTTGCCGAGGAACACGGCGACGGCCAATGGCGGTTCTATTCAACCTCATTGACATTGCAGCATATAATGCATAA。

the dsRNA targeting sequence I (shown as SEQ ID No. 2) of the targeted silent periplaneta americana sex pheromone receptor gene OR5M is as follows:

GTACCATGTCATACGCAGCATCGAAACTAGCTGTCAGAGACAGTTTTGATGATGAAGATGTCAGTGATGATGTCGAAGATGAAGTGTTTATTCGTGACGGAAGGAATGGGTTTAAGGTTGATGAAGAAAGAGGGGTTAAACGACCTCTCATGGCCCCAAGACGAAAAACGAAGCCTAATC。

the dsRNA targeting sequence (shown as SEQ ID No. 3) of the targeted silent periplaneta americana sex pheromone receptor gene OR5M specifically comprises the following steps:

GATTAGGCTTCGTTTTTCGTCTTGGGGCCATGAGAGGTCGTTTAACCCCTCTTTCTTCATCAACCTTAAACCCATTCCTTCCGTCACGAATAAACACTTCATCTTCGACATCATCACTGACATCTTCATCATCAAAACTGTCTCTGACAGCTAGTTTCGATGCTGCGTATGACATGGTAC。

(2) cloning of target fragment and construction of vector

Samples of the tentacles (male and female), mouthparts, forepaws, brains, wings, spermary and ovaries of the periplaneta americana adults were ground with liquid nitrogen and placed into TRIzol reagent (Life technologies, Carlsbad, CA, USA), and total RNA of the samples was extracted according to a standard procedure. The concentration of sample RNA was determined using a NanoDrop 2000 micro-spectrophotometer (Thermo Fisher Scientific, Waltham, Massachusetts, USA) and detected electrophoretically. After treating the genomic DNA remaining in the sample with TURBO DNase (Life technologies, Carlsbad, Calif., USA), RNA having an initial concentration of 2. mu.g was unified as a template for cDNA synthesis. The cDNA synthesis system used PrimeScript II reverse transcriptase (Takara Bio, Shiga, Japan) and oligo (dT) primers (Promega, Madison, Wis., USA) and synthesized cDNA templates according to the instructions. Amplifying a nucleotide sequence by taking cDNA as a template, namely amplifying to obtain a DNA fragment I (such as the DNA fragment shown in Seq ID No. 4) containing a target sequence, cloning the DNA fragment I into a pMD18-T vector (Aidlab, China), verifying whether the sequence has base mutation by sequencing, selecting a clone without any mutation for subsequent experiments, and naming the vector as pMD18-T-OR 5M.

(3) Transformation of recombinant vectors

The constructed vector was ligated to a transformed competent bacterium (DH 5. alpha.) to prepare a recombinant strain. Screening out positive clone, and extracting recombinant plasmid after amplification culture.

(4) Synthetic OR5M dsRNA

Designing a primer containing a T7 promoter at two ends, wherein OR5M T7-Fp: TAATACGACTCACTATAGGGTACCATGTCATACGCA (shown as SEQ ID No. 7) and OR5M T7-Rp: TAATACGACTCACTATAGGGATTAGGCTTCGTTTT (shown in SEQ ID No. 8). Amplifying by taking pMD18-T-OR5M vector as a template to obtain a PCR product with two ends containing a T7 promoter, synthesizing forward and reverse RNAs by utilizing a T7RiboMAX Express RNAi System (Promega, Madison, Wisconsin, USA), mixing the two forward and reverse RNAs after sequentially treating T7 RNA polymerase and DNaseI, treating at 70 ℃ for 10min, and gradually cooling to room temperature to anneal the RNAs into dsRNA I, wherein the sequence is double-stranded RNA consisting of a nucleotide sequence shown as SEQ ID No.2 and a nucleotide sequence shown as SEQ ID No.3 which is reversely complementary to the nucleotide sequence shown as SEQ ID No. 2. The sequence of the mRNA fragment targeted by dsOR5M is shown in SEQ ID No. 9.

Similarly, dsGFP primers were designed based on GFP gene sequence: GFP Fp: CACAAGTTCAGCGTGTCCG (shown in SEQ ID No. 10) and GFP Rp: GTTCACCTTGATGCCGTTC (shown in SEQ ID No. 11). A DNA fragment II containing a target sequence is obtained by amplification by using a plasmid pEGFP-N1(Takara, Kusatsu, Shiga Prefecture, Japan) as a template, and a vector is obtained after cloning, sequencing and sequence verification of the DNA fragment II and is named as pMD 18-T-GFP. Designing a primer containing a T7 promoter at two ends, GFP T7 Fp: TAATACGACTCACTATAGGCACAAGTTCAGCGTGTCCG (SEQ ID No.12) and GFP T7 Rp: TAATACGACTCACTATAGGGTTCACCTTGATGCCGTTC (SEQ ID No. 13). The PCR product with T7 promoter at both ends is obtained by amplification with pMD18-T-GFP vector as template, and then dsRNAII is synthesized by T7RiboMAX Express RNAi System (Promega, Madison, Wis., USA), the sequence is double-stranded RNA composed of the nucleotide sequence shown in SEQ ID No. 14.

The DNA sequence (shown as SEQ ID No. 4) of targeted silent periplaneta americana sex pheromone receptor gene OR5M is as follows:

the dsRNA sequence (shown as SEQ ID No. 9) of targeted silent periplaneta americana sex pheromone receptor gene OR5M is as follows:

GUACCAUGUCAUACGCAGCAUCGAAACUAGCUGUCAGAGACAGUUUUGAUGAUGAAGAUGUCAGUGAUGAUGUCGAAGAUGAAGUGUUUAUUCGUGACGGAAGGAAUGGGUUUAAGGUUGAUGAAGAAAGAGGGGUUAAACGACCUCUCAUGGCCCCAAGACGAAAAACGAAGCCUAAUC。

the dsRNA sequence (shown as SEQ ID No. 14) of the targeted silent periplaneta Americana GFP gene specifically comprises the following steps:

CACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAACGGCAUCAAGGUGAAC。

example 2 expression levels of OR5M in different tissues and different development times of Periplaneta americana

Primer premier5 primer design software was used to design fluorescent quantitative PCR primers. The primers used for the fluorescent quantitative PCR assay were as shown in table 1, the quantitative assay of gene expression was performed using SYBR Green qPCR mix (yisheng, China), the expression level of OR5M gene in antennal (male and female), oral apparatus, forefoot, brain, wing, testis and ovary was determined by the quantitative PCR method (as shown in fig. 1), and the expression level of OR5M gene in male antenna was further determined 1 to 9 days after eclosion (as shown in fig. 2).

As can be seen from fig. 1, the expression level of OR5M in the male antenna is much higher than that in other tissues, and the expression level of the male antenna is significantly higher than that of the female antenna, which is consistent with the general feature that sex pheromones are mainly expressed in the male antenna. In addition, the expression level of OR5M is gradually increased within 1-9 days after eclosion, especially the expression level is higher at 9 days after eclosion, which may be related to the fact that the American cockroach is easy to generate large-scale mating behavior.

TABLE 1 primer sequences for OR5M Gene quantitative PCR

Example 3dsRNA interference Effect on OR5M Gene

(1) dsRNA (double-stranded ribonucleic acid) for specifically inhibiting periplaneta americana sex pheromone receptor gene OR5M by injecting into periplaneta americana living body

Healthy female and male periplaneta americana which have just completed eclosion are selected, and are singly raised and divided into an experimental group and a control group (dsGFP which can not target any gene of periplaneta americana is injected). On the third day after eclosion, males were treated with carbon dioxide non-destructive anesthesia and then placed on a dissecting table, and 2 μ g total amount of dsRNA targeting the OR5M gene was slowly injected into their abdominal cavity along the 3 rd to 4 th abdominal segments (from the bottom up direction) of the abdomen by microinjection. The same dose of GFP gene interference fragment was injected at the same time as a negative control. The periplaneta americana males which have finished injecting the dsRNA are still placed in the Y-selection glass tube alone; and female insects are placed. Subsequently, the starting time of mating and the duration of the mating process of the males and females were continuously observed and photographed. To ensure an effective statistical number of repeats, 25 Periplaneta americana males were injected with dsRNA of OR5M gene and GFP gene.

(2) Verification of interference effect of dsRNA on OR5M gene

After injecting dsRNA (including OR5M gene and GFP gene) for 48 hours, using carbon dioxide to perform anesthesia treatment on the male periplaneta americana, cutting off and taking off the tentacles, grinding the tentacles by liquid nitrogen, putting the tentacles into a TRIzol reagent, extracting total RNA of the tentacles according to a standard process, measuring the concentration of the total RNA by using a ultramicro spectrophotometer Nanodrop 2000(Thermo Fisher Scientific, Waltham, Massachusetts, USA), and then measuring 2 mu g of RNA for reverse transcription to obtain cDNA. Quantitative PCR was used to detect the effect of interference with the target gene (the specific quantitative primer sequences are shown in Table 1).

The expression of the OR5M gene interference ratio was calculated as (dsGFP expression level-dsOR 5M expression level)/dsGFP expression level X100%.

The results of the interference efficiency of OR5M gene are shown in FIG. 3, from which it can be seen that the expression level of OR5M gene in the antennal was reduced by 68.7%. As the abundantly expressed gene is easier to be subjected to RNAi induced silencing, the result not only shows the main expression site of the antenna OR5M gene, but also shows that the RNAi induced silencing system has high efficiency in the periplaneta americana.

(3) Y-shaped tube experiment after OR5M gene interference

The selection result of female odor of the periplaneta americana after the OR5M gene interference is shown in fig. 4, and it can be seen from the figure that the female odor of the periplaneta americana injected with the OR5M gene dsRNA has significantly reduced preference for female selection as compared with the control group, which indicates that the odor containing the female odor cannot be correctly identified. The results show that after the OR5M gene is interfered, the sex pheromone recognition ability of the male worms to the female worms is reduced rapidly. The mating time of the periplaneta americana of the OR5M gene interference group is reduced compared with that of the periplaneta americana of the control group in the female pest recognition capability, and a Y-shaped tube selection experiment proves that the tropism of the male periplaneta americana to the female pest smell disappears, so that the fact that the OR5M gene is interfered has a remarkable delay effect and weakening effect on the mating behavior of the periplaneta americana can be further demonstrated.

The invention deeply researches the mating behavior of the American cockroach with the olfactory receptor OR5M, and the olfactory receptor is indispensable in the process of identifying the sex pheromone of the American cockroach, so that the olfactory receptor of the American cockroach is identified at the early stage, and the receptor gene OR5M is found to have a key role in the process of gathering and propagating the American cockroach. The result of the invention shows that the expression of the interference sex pheromone receptor gene OR5M can obviously weaken the recognition of the male periplaneta americana on the sex pheromone of the female periplaneta americana, thus providing a new strategy for the prevention and control of the periplaneta americana.

The above description is only an embodiment of the present invention, and not intended to limit the scope of the present invention, and all equivalent changes made by using the contents of the present specification and the drawings, or applied directly or indirectly to the related technical fields, are included in the scope of the present invention.

Sequence listing

<110> university of south China

Guangmeiyuan R & D center, Key Laboratory of insect developmental biology and applied technology, Huashi, Meizhou City

<120> dsRNA designed based on American cockroach sex pheromone receptor gene OR5M, coding gene, preparation method and application thereof

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 978

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgcgaagtg acaggagaga tttaccgaca gagcttcgcc ccgtttcttt gcaaagtgct 60

caacctggaa cagttagatt cgccttcact gaaggtacca ccttggtcag caatgtccca 120

aagaaaggaa aaaaaagttt caaaatggtt gtctgcaata tggtgtggaa gtaaccagtt 180

tccatttttg tatatcattt cacatattgt tgaatcttca cttgcgatgg tttaaagtag 240

tagtataaga aggacacact actgtaccat gtcatacgca gcatcgaaac tagctgtcag 300

agacagtttt gatgatgaag atgtcagtga tgatgtcgaa gatgaagtgt ttattcgtga 360

cggaaggaat gggtttaagg ttgatgaaga aagaggggtt aaacgacctc tcatggcccc 420

aagacgaaaa acgaagccta atcaattaca cggtgatgtt ggtagaaggc ctccatgtag 480

agctctatgt gcaccatgtt gctatggatg tatagcattg gctgctcttt taggtttaat 540

agtgttggtg gtgtcattag tgatgtggtt tccatttccg ttagaccaag tgacagagtt 600

ttggaagatt aggcaagggt ctcgctcggg aggtttcata gttccttgca cagagctagt 660

cgtagaagat gtgtggacga aaaccttatc aaaactaaca gtggaaacag ctgtacgtct 720

aaatgacgtc aatggagatg gagtattgga tgttattgta ggatatggaa cagggttgtg 780

acagtccttt gcatgcaaca ttgtgacatg aagatgactg acgataagcc agatataatc 840

ctattctaca attctactaa agcaggaatg gatgttcttg acaagtgcat aagaacatac 900

tcttgttgcc gaggaacacg gcgacggcca atggcggttc tattcaacct cattgacatt 960

gcagcatata atgcataa 978

<210> 2

<211> 180

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gtaccatgtc atacgcagca tcgaaactag ctgtcagaga cagttttgat gatgaagatg 60

tcagtgatga tgtcgaagat gaagtgttta ttcgtgacgg aaggaatggg tttaaggttg 120

atgaagaaag aggggttaaa cgacctctca tggccccaag acgaaaaacg aagcctaatc 180

<210> 3

<211> 180

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gattaggctt cgtttttcgt cttggggcca tgagaggtcg tttaacccct ctttcttcat 60

caaccttaaa cccattcctt ccgtcacgaa taaacacttc atcttcgaca tcatcactga 120

catcttcatc atcaaaactg tctctgacag ctagtttcga tgctgcgtat gacatggtac 180

<210> 4

<211> 180

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtaccatgtc atacgcagca tcgaaactag ctgtcagaga cagttttgat gatgaagatg 60

tcagtgatga tgtcgaagat gaagtgttta ttcgtgacgg aaggaatggg tttaaggttg 120

atgaagaaag aggggttaaa cgacctctca tggccccaag acgaaaaacg aagcctaatc 180

<210> 5

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gtaccatgtc atacgca 17

<210> 6

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gattaggctt cgtttt 16

<210> 7

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

taatacgact cactataggg taccatgtca tacgca 36

<210> 8

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

taatacgact cactataggg attaggcttc gtttt 35

<210> 9

<211> 180

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

guaccauguc auacgcagca ucgaaacuag cugucagaga caguuuugau gaugaagaug 60

ucagugauga ugucgaagau gaaguguuua uucgugacgg aaggaauggg uuuaagguug 120

augaagaaag agggguuaaa cgaccucuca uggccccaag acgaaaaacg aagccuaauc 180

<210> 10

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

cacaagttca gcgtgtccg 19

<210> 11

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gttcaccttg atgccgttc 19

<210> 12

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

taatacgact cactataggc acaagttcag cgtgtccg 38

<210> 13

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

taatacgact cactataggg ttcaccttga tgccgttc 38

<210> 14

<211> 420

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

cacaaguuca gcguguccgg cgagggcgag ggcgaugcca ccuacggcaa gcugacccug 60

aaguucaucu gcaccaccgg caagcugccc gugcccuggc ccacccucgu gaccacccug 120

accuacggcg ugcagugcuu cagccgcuac cccgaccaca ugaagcagca cgacuucuuc 180

aaguccgcca ugcccgaagg cuacguccag gagcgcacca ucuucuucaa ggacgacggc 240

aacuacaaga cccgcgccga ggugaaguuc gagggcgaca cccuggugaa ccgcaucgag 300

cugaagggca ucgacuucaa ggaggacggc aacauccugg ggcacaagcu ggaguacaac 360

uacaacagcc acaacgucua uaucauggcc gacaagcaga agaacggcau caaggugaac 420

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gacgaaaacc ttatcaaaac 20

<210> 16

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

tgcatgcaaa ggactgtca 19

Claims

1. Periplaneta americana sex pheromone receptor geneOR5MThe method is characterized in that: the nucleotide sequence of the gene is shown in SEQ ID NO. 1.

2. A method for producing the gene of claim 1OR5MThe method for interfering with sequence dsRNA of (a), characterized by: the method comprises the following steps: uses the American cockroach sex pheromone receptor geneOR5MThe cDNA is taken as a template, and the interference primer group is taken as a primer for PCR amplification; the interference primer group comprises an upstream primer OR5M Fp and a downstream primer OR5M Rp, wherein the nucleotide sequence of the upstream primer OR5M Fp is shown as SEQ ID NO. 5; the nucleotide sequence of the downstream primer OR5M Rp is shown as SEQ ID NO. 6.

3. The gene of claim 1OR5MOfA scrambling dsRNA characterized by: the dsRNA is double-stranded RNA which is composed of a nucleotide sequence shown as SEQ ID No.2 as a sense strand and a nucleotide sequence SEQ ID No.3 which is reversely complementary with the nucleotide sequence shown as SEQ ID No.2 as an antisense strand.

4. The dsRNA of claim 3, which is characterized in that: the nucleotide sequence of the dsRNA is shown as SEQ ID No. 9.

5. The use of the dsRNA of claim 3 in the preparation of a medicament for the control of periplaneta americana.

6. Use of the dsRNA of claim 3 for the manufacture of a product for disrupting normal mating of Periplaneta americana.

7. Use of the dsRNA of claim 3 for the preparation of a product for controlling the mating reproduction of Periplaneta americana.

8. A method for controlling American cockroaches comprises the following steps: introducing the dsRNA of claim 3 into Periplaneta americana.