WO2016110691A1 - Enhanced rnai mediated gene regulation - Google Patents

Enhanced rnai mediated gene regulation Download PDF

Info

Publication number
WO2016110691A1
WO2016110691A1 PCT/GB2016/050015 GB2016050015W WO2016110691A1 WO 2016110691 A1 WO2016110691 A1 WO 2016110691A1 GB 2016050015 W GB2016050015 W GB 2016050015W WO 2016110691 A1 WO2016110691 A1 WO 2016110691A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
target
concatemer
gene
acid sequence
Prior art date
Application number
PCT/GB2016/050015
Other languages
French (fr)
Inventor
Alan Stuart BOWMAN
Ewan McInnes CAMPBELL
Original Assignee
The University Court Of The University Of Aberdeen
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The University Court Of The University Of Aberdeen filed Critical The University Court Of The University Of Aberdeen
Publication of WO2016110691A1 publication Critical patent/WO2016110691A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/50—Physical structure
    • C12N2310/51—Physical structure in polymeric form, e.g. multimers, concatemers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/50—Methods for regulating/modulating their activity

Definitions

  • the present invention relates to nucleic acid agents for the simultaneous down-regulation of multiple gene targets.
  • Compositions comprising the nucleic acid agents and methods for using the agent to target specific cell populations, such as those of the parasite in a host/parasite relationship, are also disclosed.
  • RNAi is an RNA-dependent gene silencing process that is controlled by the RNA-induced silencing complex (RISC) and is initiated by short double-stranded RNA molecules in a cell's cytoplasm, where they interact with the catalytic RISC component argonaute.
  • RISC RNA-induced silencing complex
  • the RNA When the dsRNA is exogenous (for example, coming from infection by a virus with an RNA genome), the RNA is imported directly into the cytoplasm and cleaved to short fragments by the argonaute enzyme.
  • the initiating dsRNA can also be endogenous (originating in the cell), as in pre-microRNAs expressed from RNA-coding genes in the genome.
  • the primary transcripts from such genes are first processed to form the characteristic stem-loop structure of pre-miRNA in the nucleus, then exported to the cytoplasm to be cleaved by Dicer.
  • Dicer the two dsRNA pathways, exogenous and endogenous, converge at the RISC complex.
  • dsRNA initiates RNAi by activating the ribonuclease protein Dicer, which binds and cleaves double-stranded RNAs (dsRNAs) to produce double-stranded fragments of 20-25 base pairs with a 2-nucleotide overhang at the 3' end.
  • siRNAs small interfering RNAs
  • ss single-stranded ssRNAs
  • the passenger strand is degraded, and the guide strand is incorporated into the RNA-induced silencing complex (RISC).
  • RISC RNA-induced silencing complex
  • RNAi effect is a short stretch (-21 nucleotides) of duplex RNA having 100% sequence identity to the downregulated mRNA. Any nucleic acid which will be processed into, or lead to the generation of, an siRNA with this feature can lead to RNAi suppression of the target mRNA.
  • dsRNA which is processed into siRNA by the activity of Dicer and the RISC complex
  • shRNAs short hairpin RNAs
  • miRNAs may also initiate RNAi suppression.
  • RNAi is becoming an ever more powerful for determining the functional role of specific genes that may be potential targets for chemotherapeutic intervention. It is a particularly useful method since the RNAi gene silencing mechanism appears to be present in all eukaryotic organisms. Thus ubiquity combined with relative ease of application means that RNAi is not only an important tool in modern cell biology research but also has potential beyond the laboratory to the clinic and other applied areas.
  • RNAi shows particular promise is in targeting cells within a mixed population, wherein the targeted cells are distinguished from the general population of cells by the identity of the genes, or gene combination, they express.
  • RNAi's selectivity is in pest / parasite control, where the sequence specificity of RNAi coupled with its ability to suppress genes critical for pest survival allow the
  • dsRNA long double-stranded
  • Delivery systems for dsRNAs to pests include spraying on plants, delivery in food, and engineering transgenic plants to produce the dsRNA.
  • RNAi to target the Varroa destructor parasitic mite of Apis mellifera honey bees has been documented in Garbian et al., 2012.
  • the authors prepare two separate mixtures of dsRNA, with 'Mixture ⁇ containing a mixture of dsRNAs corresponding to five different V.destructor gene sequences, and 'Mixture ⁇ containing a mixture of dsRNAs corresponding to fourteen different V.destructor gene sequences.
  • sucrose solution containing one or other of these mixtures
  • the authors noted mortality in the V.destruct or mites parasitizing the fed A.mellifera bees.
  • the present inventors have developed an improved method dsRNA delivery technology for inducing the RNAi-mediated down-regulation of multiple genes. As compared to existing technology for delivering multiple dsRNAs, the improved technology described herein leads to a significant increase in the mortality rates of the target cell or organism population.
  • RNAi When using RNAi to target a cell or organism population it is desirable to maximise the mortality rate in the targeted population.
  • Existing methods have used a number of strategies to increase the observed mortality.
  • V.destruct or target genes involved in key cellular processes such as cell architecture (alpha tubulin) and DNA transcription (RNA polymerase), the silencing of which was expected to harm the Varroa mites.
  • the authors of Garbian et al. 2012 also describe the importance of selecting target sequences within the V.destructor genes which do not correspond to any A.melliifera (i.e. the host) or human genes, so as to prevent any off-target gene silencing.
  • Garbian et al. 2012 In addition to selecting target genes involved in key cellular processes, the authors of Garbian et al. 2012 also co-administered dsRNA corresponding to multiple target genes with the aim of increasing the total mortality levels through simultaneously inhibiting multiple cellular pathways. Consistent with this, Garbian et al. 2012 reported that a mixture of 14 dsRNAs (“Mixture II”) caused a significant decrease in Varroa destructor mite number when fed to bees, but a mixture of 5 dsRNAs (“Mixture I”) did not.
  • the present inventors have developed an improved delivery technology for down-regulating multiple genes using RNAi.
  • the improved technology does not exhibit the reduced efficacy of gene knockdown observed with some of the dsRNA delivery technologies described in the art.
  • dsRNA delivered by the improved technology has been demonstrated to result in a significantly higher target mortality in the treated animals than an equivalent dose of dsRNA delivered by conventional means.
  • the improved technology is based on the insight that when targeting multiple genes higher target mortality can be achieved if the dsRNAs corresponding to each target gene are administered to the target as a concatemer, rather than as a mixture of separate dsRNAs. So, for example, if the genes ⁇ ', ' ⁇ ', and 'C are to be targeted, higher target mortality can be achieved by administering the dsRNA[A-B-C] than administering the same total amount of dsRNA as a mixture of dsRNA[A] + dsRNA[B] + dsRNA[C].
  • producing a single dsRNA concatemer is typically simpler and less expensive than producing an equivalent mixture of separate dsRNAs.
  • the higher target mortality is at least partially because the concatemer structure enforces simultaneous down-regulation of all the targeted genes within each target cell (or cell within a target organism) that takes up a dsRNA molecule. That is, a cell which takes up a dsRNA[A-B-C] molecule will experience simultaneous down-regulation of genes ⁇ ', ' ⁇ ', and 'C, with the cumulative damage arising from the inhibition of multiple cellular processes multiplying the likelihood of cell death.
  • a target cell (or cell within a target organism) must take up each of the separate dsRNA molecules. This is true for each target cell (or cell within a target organism).
  • each target cell or cell within a target organism.
  • Differences between the transport and/or uptake of the different dsRNAs will further magnify this uneven distribution of the dsRNA within the target cells. It can be envisioned that the overall effect of this less even distribution of dsRNAs is a reduced level of cumulative damage in individual cells and, therefore, a lower proportion of cell death.
  • the concatemer structure places a lower burden on the cellular dsRNA transport system. That is, for example, only concatemer dsRNA molecule (i.e. dsRNA[A-B-C]) needs to be taken up to achieve down- regulation of genes ⁇ ', ' ⁇ ', and 'C. To achieve the same effect with a mixture, three dsRNA molecules must be taken up (i.e. dsRNA[A] + dsRNA[B] + dsRNA[C]). Thus, at saturating concentrations the concatemer can be expected to lead to more effective gene knockdown. Accordingly, in one aspect the present invention provides an isolated nucleic acid concatemer comprising at least a first nucleic acid sequence and a second nucleic acid sequence;
  • first nucleic acid sequence is capable of down-regulating the expression of a first gene of a target
  • second nucleic acid sequence is capable of down- regulating the expression of a second gene of the target.
  • first and second genes are different genes.
  • isolated nucleic acid concatemer is used herein to refer to a two or more nucleic acid sequences capable of down-regulating gene expression which have been joined ('concatenated') such that they form a single, contiguous nucleic acid molecule.
  • isolated nucleic acid concatemer is intended to refer to concatenates not naturally occurring in nature.
  • each of the constituent nucleic acid sequences of an “isolated nucleic acid concatemer” targets a different gene such that the concatemer is capable of down-regulating the expression of at least two different genes simultaneously.
  • the constituent nucleic acid sequences of an isolated nucleic acid concatemer are found sequentially on the nucleic acid molecule with only short, or no, intervening sequence ('spacer sequence') between the sequences capable of down-regulating gene expression.
  • 'spacer sequence' intervening sequence between the sequences capable of down-regulating gene expression.
  • an isolated nucleic acid concatemer is shown in Figure 10.
  • an isolated nucleic acid concatemer according to the present description extends from the first base of MOA (base 1395) to the last base of AChE (base 2355) to give a total concatemer length of 960 bases.
  • the concatemer is composed of three nucleic acid sequences capable of down-regulating the expression (marked MOA, ATP, AChE) which are arranged sequentially on the nucleic acid molecule with no spacer sequences.
  • This isolated nucleic acid concatemer is capable of down-regulating three genes (MOA, vATPc, AChE) simultaneously (see Figure 9; in this example, the target is the Varroa destructor mite).
  • nucleic acid concatemer consisting of three nucleic acid sequences capable of down-regulating the expression genes.
  • tricatemer Such a concatemer consisting of three nucleic acid sequences capable of down-regulating the expression genes is herein called a "tricatemer”.
  • the present invention provides an isolated nucleic acid concatemer comprising at least a first nucleic acid sequence, a second nucleic acid sequence, and a third nucleic acid sequence;
  • the first nucleic acid sequence is capable of down-regulating the expression of a first gene of a target
  • the second nucleic acid sequence is capable of down-regulating the expression of a second gene of the target
  • the third nucleic acid sequence is capable of down-regulating the expression of a third gene of the target.
  • the first, second and third genes are different genes.
  • the present invention provides an isolated nucleic acid concatemer comprising at least a first nucleic acid sequence, a second nucleic acid sequence, a third nucleic acid sequence, and a fourth nucleic acid sequence;
  • the first nucleic acid sequence is capable of down-regulating the expression of a first gene of a target
  • the second nucleic acid sequence is capable of down-regulating the expression of a second gene of the target
  • the third nucleic acid sequence is capable of down-regulating the expression of a third gene of the target
  • the fourth nucleic acid sequence is capable of down-regulating the expression of a fourth gene of the target.
  • the first, second, third and fourth genes are different genes.
  • the present invention provides an isolated nucleic acid concatemer comprising at least a first nucleic acid sequence, a second nucleic acid sequence, a third nucleic acid sequence, a fourth nucleic acid sequence, and a fifth nucleic acid sequence; wherein the first nucleic acid sequence is capable of down-regulating the expression of a first gene of a target, the second nucleic acid sequence is capable of down-regulating the expression of a second gene of the target, the third nucleic acid sequence is capable of down-regulating the expression of a third gene of the target, the fourth nucleic acid sequence is capable of down-regulating the expression of a fourth gene of the target, and the fifth nucleic acid sequence is capable of down-regulating the expression of a fifth gene of the target.
  • the first, second, third, fourth and fifth genes are different genes.
  • the present invention provides an isolated nucleic acid concatemer comprising at least a first nucleic acid sequence, a second nucleic acid sequence, a third nucleic acid sequence, a fourth nucleic acid sequence, a fifth nucleic acid sequence, and a sixth nucleic acid sequence;
  • the first nucleic acid sequence is capable of down-regulating the expression of a first gene of a target
  • the second nucleic acid sequence is capable of down-regulating the expression of a second gene of the target
  • the third nucleic acid sequence is capable of down-regulating the expression of a third gene of the target
  • the fourth nucleic acid sequence is capable of down-regulating the expression of a fourth gene of the target
  • the fifth nucleic acid sequence is capable of down-regulating the expression of a fifth gene of the target
  • the sixth nucleic acid sequence is capable of down-regulating the expression of a sixth gene of the target.
  • the first, second, third, fourth, fifth and sixth genes are different genes.
  • nucleic acid sequences comprising seven, eight, nine, ten, fifteen, twenty or more than twenty nucleic acid sequences are envisaged (preferably capable of, respectively, down-regulating the expression of two, three, four, five, six, seven, eight, nine, ten, fifteen, twenty or more than twenty different genes of the target).
  • the concatemers described herein are consistently more effective than the equivalent dsRNAs delivered as a mixture. Furthermore, the increased effectiveness of the concatemer relative to the corresponding mixture appears to be independent of the identity of the specific genes, or the species of the target. This independence is consistent with the postulated theory underpinning the present invention, as well as the known presence of dsRNA-mediated gene silencing (RNAi) mechanisms in many eukaryotic organisms.
  • RNAi gene silencing
  • the 'target' whose gene expression is down regulated by the isolated nucleic acid concatemers described herein may be any cell or organism capable of
  • the target is an organism. In some embodiments the target is a member of the Acari subclass. In some embodiments the target is a member of the
  • Arthropoda phylum for example a member of the Insecta class (such as a member of the order Coleoptera).
  • the target is not the Varroa destructor mite. In some embodiments the target is not the Caenorhabditis elegans nematode.
  • the target may be a pest organism such as Tribolium castaneum or Aedes aegypti.
  • the target is a cell, or population of cells.
  • a human tumour cell For example, a human tumour cell.
  • the target cell or population of cells may be in vivo, ex vivo, or in vitro.
  • the target is an organism (or a cell or population of cells derived therefrom) listed in any one of Tables 'A' to ⁇ '.
  • the target is not Varroa destructor, or a cell or population of cells derived therefrom.
  • any embodiment described herein in which the target is Varroa destructor is not encompassed by the present invention.
  • any embodiment described herein in which or the first, second, third, and/or further genes are Varroa destructor genes is not encompassed by the present invention
  • a typical strategy is to select genes with functions in key cellular processes such as cell architecture (for example, alpha tubulin), DNA transcription (for example, RNA polymerase), or energy generation / gradient maintenance (Pyruvate kinase, vacuolar ATPase).
  • cell architecture for example, alpha tubulin
  • DNA transcription for example, RNA polymerase
  • energy generation / gradient maintenance Pyruvate kinase, vacuolar ATPase
  • the first and/or second gene and/or third gene (if present) and/or fourth gene (if present) and/or fifth gene (if present) and/or sixth gene (if present) are selected from the group consisting of the genes which encode: Na+/K+- ATPase (any of the subunits), Vacuolar ATPase (proton pump; any of the subunits), Plasma membrane Calcium ATPase (PMCA), Sarcoplasmic reticulum Ca2+ ATPase (SERCA), ADP/ATP- translocase, Sodium-glucose linked transporter, Trehalase, Pyruvate
  • the target is the V.destructor organism and the first and/or second gene (and/or third gene, if present) are selected from the group consisting of the genes which encode: Acetylcholinesterase (AChE; GenBank accession number
  • ADDG01035752.1 Preferably all of the first and second gene (and third gene, if present) are selected from the above group.
  • the target is the V.destructor organism and the first and/or second nucleic acid sequence (and/or third nucleic acid sequence, if present) comprises a nucleic acid sequence that has 100% sequence identity to at least 18 contiguous nucleotides (such as at least 21 , 25, 30, 50, 100, 200, or 500 nucleotides) encoded by a sequence selected from the group consisting of SEQ ID N0.1 , SEQ ID NO.2, and SEQ ID NO.3.
  • the first or second nucleic acid sequence is SEQ ID NO.2.
  • all of the first and second nucleic acid sequence (and third nucleic acid sequence, if present) are selected from the above group.
  • the target is the T.castaneum organism and the first and/or second gene and/or third gene (if present) and/or fourth gene (if present) and/or fifth gene (if present) and/or sixth gene (if present) are selected from the group consisting of the genes which encode: Plasma membrane calcium-transporting ATPase 1 (TcPMCA; NCBI accession number XM_008201630.1), Na/K ATPase alpha (TcNaK; NCBI accession number XM_008198203.1), A DP/ATP translocase (TcADPt; NCBI accession number XM_968164.3) , vATPase subunit E (TcvATPe; NCBI accession number XM_965528.2), Calcium-transporting ATPase sarcoplasmic /endoplasmic reticulum type (TcSERCA; NCBI accession number XM_961690.3), a-tubulin 1 (TcPMCA
  • the first and second gene (and third gene, if present) are selected from the above group.
  • the first, second, and third genes are selected from the combinations: (i)TcPMCA, TcNaK, TcADPt, (ii) TcPMCA, TcNaK, TcvATPe, (iii) TcaTUB, TcHSP90, TcADPt, and (iv) TcaTUB, TcHSP90, TcvATPe.
  • the target is the T.castaneum organism and the first and/or second nucleic acid sequence and/or third nucleic acid sequence (if present) and/or fourth nucleic acid sequence (if present) and/or fifth nucleic acid sequence (if present) and/or sixth nucleic acid sequence (if present) comprises a nucleic acid sequence that has 100% sequence identity to at least 18 contiguous nucleotides (such as at least 21 , 25, 30, 50, 100, 200, or 500 nucleotides) encoded by a sequence selected from the group consisting of SEQ ID NO.8, SEQ ID NO.9, SEQ ID N0.113, SEQ ID NO.10, SEQ ID NO.1 1 , SEQ ID N0.12, SEQ ID NO.13, and SEQ ID NO.14.
  • all of the first and second nucleic acid sequence (and third nucleic acid sequence, if present) are selected from the above group.
  • the first, second, and third genes are selected from the combinations: (i) SEQ ID NO.8, 9, and 10, (ii) SEQ ID NO.8, 9, and 11 , (iii) SEQ ID N0.13, 14, and 10, (iv) SEQ ID N0.13, 14, and 1 1 , (v) SEQ ID NO.8, 1 13, and 10, and (vi) SEQ ID NO.8, 113, and 11.
  • the target is the A.aegypti organism and the first and/or second gene (and/or third gene, if present) are selected from the group consisting of the genes which encode: Tubulin beta chain (AabTub; NCBI accession number XM_001662168.1), Na/K ATPase alpha subunit (AaNaK; NCBI accession number ADDG01053234.1), and A DP/ATP carrier protein (AaADPt; NCBI accession number XM_001649861.1).
  • the first and second gene (and third gene, if present) are selected from the above group.
  • the target is the A.aegypti organism and the first and/or second nucleic acid sequence (and/or third nucleic acid sequence, if present) comprises a nucleic acid sequence that has 100% sequence identity to at least 18 contiguous nucleotides (such as at least 21 , 25, 30, 50, 100, 200, or 500 nucleotides) encoded by a sequence selected from the group consisting of SEQ ID NO.19, SEQ ID NO.20, and SEQ ID NO.21. In some embodiments, all of the first and second nucleic acid sequence (and third nucleic acid sequence, if present) are selected from the above group.
  • the target is the L.salmonis organism and the first and/or second gene (and/or third gene, if present) are selected from the group consisting of the genes which encode: A DP/ATP translocase 1 (LsADPt; NCBI accession number BT077972.1), V- type ATPase unit E (LsvATPe; NCBI accession number BT120776.1), and
  • acetylcholinesterase (LsAChE; NCBI accession number KJ132369.1).
  • all of the first and second gene (and third gene, if present) are selected from the above group.
  • the target is the L.salmonis organism and the first and/or second nucleic acid sequence (and/or third nucleic acid sequence, if present) comprises a nucleic acid sequence that has 100% sequence identity to at least 18 contiguous nucleotides (such as at least 21 , 25, 30, 50, 100, 200, or 500 nucleotides) encoded by a sequence selected from the group consisting of SEQ ID N0.23, SEQ ID N0.24, and SEQ ID N0.25. In some embodiments, all of the first and second nucleic acid sequence (and third nucleic acid sequence, if present) are selected from the above group.
  • the target is the C.elegans organism and the first and/or second gene (and/or third gene, if present) are selected from the group consisting of the genes which encode: pat-10 (NCBI accession number NM_059100.6), bli-5 (NCBI accession number NM_067371.1), and egl-30 (NCBI accession number U56864.1).
  • pat-10 NCBI accession number NM_059100.6
  • bli-5 NCBI accession number NM_067371.1
  • egl-30 NCBI accession number U56864.1
  • all of the first and second gene (and third gene, if present) are selected from the above group.
  • the target is the C.elegans organism and the first and/or second nucleic acid sequence (and/or third nucleic acid sequence, if present) comprises a nucleic acid sequence that has 100% sequence identity to at least 18 contiguous nucleotides (such as at least 21 , 25, 30, 50, 100, 200, or 500 nucleotides) encoded by a sequence selected from the group consisting of SEQ ID N0.27, SEQ ID N0.28, and SEQ ID N0.29. In some embodiments, all of the first and second nucleic acid sequence (and third nucleic acid sequence, if present) are selected from the above group.
  • Concatemers according to the present invention will be recombinant and may be provided isolated and/or purified, in substantially pure or homogeneous form, or free or substantially free of other nucleic acid.
  • isolated encompasses all these possibilities.
  • Concatemers may be ribonucleic acids or deoxy ribonucleic acids.
  • the concatemer is a dsRNA, such as siRNA, shRNA or miRNA.
  • the concatemer is antisense RNA, or a ribozyme.
  • nucleic acid may be double stranded, where the concatemer (or nucleotide sequence) of the invention is referred to herein, use of the complement of that nucleic acid agent (or nucleotide sequence) will also be embraced by the invention.
  • the 'complement' in each case is the same length as the reference, but is 100% complementary thereto whereby by each nucleotide is base paired to its counterpart i.e. G to C, and A to T or U.
  • the total length of the nucleic acid concatemer is less than 10,000 bases (or base pairs) long.
  • the nucleic acid concatemer is less than 5000 bases long, such as less than 4000, 3000, 2000, 1500, 1000, 500, 400, 300, 200 or less than 100 bases (or base pairs) long.
  • the nucleic acid concatemer is less than 950 bases long, such as less than 900, 850, 800, 750, 700, 650, 600, 550, 500, 450, 400, 300, 250, 200, 150, 100 or less than 50 bases long.
  • the total length of the nucleic acid concatemer greater than 500 bases (or base pairs) long, such as greater than 600, 700, 800, 900, or greater than 1000 base pairs long.
  • the total length of the nucleic acid concatemer is 501 to 2000 bases (or base pairs) long, such as 600 to 1800, 700 to 1600, or 750 to 1500 bases.
  • total length of the concatemer is measured from the first base of the 5'-most sequence capable of down-regulating gene expression to the last base of the 3'- most sequence capable of down-regulating gene expression.
  • the present invention also provides nucleic acid constructs (for example, DNA constructs) encoding concatemers according to the present invention.
  • Such vectors may include, in addition to the sequence encoding the concatemer of the invention, a promoter, a terminator and/or other regulatory sequence such as to define an expression cassette comprising the sequence encoding the nucleic acid agent of the invention.
  • the sequence of some vectors according to the present invention are shown in SEQ ID NOs. 4, 15, 22, and 26.
  • Gene of a/the target is a term used to mean a coding sequence in the genome of the target organism or cell which is, or may be, expressed as a functional gene product. For example, via transcription to mRNA and translation to a protein according to well established principles.
  • Expression of a gene is a term used to describe the process by which the information from, a gene is used to synthesise a gene product, such as an mRNA or polypeptide.
  • Capable of downregulating the expression is a term generally used to refer to the ability to reduce the levels of a gene product in response to the presence of the agent. Reduction is measured compared to an otherwise identical gene expression system which has not been exposed to the agent in question. The degree of reduction may be so as to totally abolish production of the encoded gene product, but may also be such that the abolition of expression is not complete, with some small degree of expression remaining. The term should not therefore be taken to require a complete absence of expression. It is used herein where convenient because those skilled in the art well understand this. Examples of downregulated expression are (i) reduced transcription of the gene, (ii) reduced mRNA amount, stability or translatability, and (iii) reduced amount of polypeptide product.
  • the ability to downregulate expression can be assayed, for example, via direct detection of gene transcripts (e.g. via PCR) or polypeptides (e.g. via Western blot), via polypeptide activity (e.g. enzyme activity) or via observation of target behaviour (e.g. via cell/organism mortality).
  • gene transcripts e.g. via PCR
  • polypeptides e.g. via Western blot
  • polypeptide activity e.g. enzyme activity
  • observation of target behaviour e.g. via cell/organism mortality
  • inhibited if the amount of expressed protein is at least 10% lower than in an otherwise identical system not exposed to the agent; for example, at least 20% lower, at least 30% lower, at least 40% lower, at least 50% lower, at least 60% lower, at least 70% lower, at least 80% lower, or at least 90% lower than in an otherwise identical system not exposed to the agent.
  • degradation of mRNA is "induced” if the amount of mRNA ( ⁇ 9/ ⁇ ) is at least 10% lower than in an otherwise identical system not exposed to the agent; for example, at least 20% lower, at least 30% lower, at least 40% lower, at least 50% lower, at least 60% lower, at least 70% lower, at least 80% lower, at least 90% lower, at least 95% lower, at least 98% lower, or at least 99% lower than in an otherwise identical system not exposed to the agent.
  • the mRNA levels of the targeted genes in treated target cells / organisms is at least 10% lower than in targets treated with a control agent (for example, GFP dsRNA).
  • a control agent for example, GFP dsRNA
  • mRNA levels ⁇ / ⁇ of the targeted genes may be at least 20% lower, at least 30% lower, at least 40% lower, at least 50% lower, at least 60% lower, at least 70% lower, at least 80% lower, at least 90%, at least 95%, at least 98%, or at least 99% lower than in mites treated with a control agent (for example, GFP dsRNA).
  • the amount of protein or mRNA is measured 24 hours after the system is first exposed to the agent. In other embodiments the amount of protein or mRNA is measured 48 or 72 hours after the system is first exposed to the agent, composition or concatemer.
  • the mRNA levels of the targeted genes in treated target cells / organisms is at least 95% lower than in mites treated with a control agent (for example, GFP dsRNA) 72 hours after exposure to the agent, composition or concatemer.
  • a control agent for example, GFP dsRNA
  • the effectiveness of the isolated nucleic acid concatemer disclosed herein, for example in methods of inhibiting the growth of, or reducing, a population of a target, may be assessed by monitoring the % mortality of the population of the target treated with the nucleic acid concatemer.
  • the nucleic acid agent causes greater than 40% target mortality, such as greater than 50%, greater than 60%, greater than 70%, greater than 80%, or greater than 90% mortality as measured, for example, 108 hours after a 12 hour soaking of the target in a 1.25 g/ ⁇ solution of the nucleic acid concatemer.
  • mortality is observed in the target organisms contacted with the concatemer.
  • the mortality phenotype is not observed in the target organisms contacted with the concatemer and, if observed at all, is first observed in the progeny of the organisms contacted with the concatemer (or in subsequent generations). Interaction with non-target cells / organisms
  • the target cell / organism is a different species to non-target organisms; for example, in applications where the target is a parasitic organism such as V. destructor. In these applications it is preferable to ensure the nucleic acid concatemer down-regulates gene expression only in the target organism species.
  • downregulation can be achieved by ensuring (i) that the concatemer selected do not possess sufficient sequence identity with any non-target cell/organism to induce repression of gene expression in those non-target cells/organisms, or (ii) that the nucleic acid concatemer is only expressed in the target cell/organism (by, for example, through using a construct having a target specific promoter).
  • the target may be a specific cell or populations of cells within an organism; that is, the target cells are in an environment where they are surrounded by non- target cells of the same species.
  • the target may be a population of tumour cells within an organism.
  • target-specific repression of gene expression can be achieved by ensuring that that the nucleic acid concatemer is only expressed in the target cells (by, for example, through using a construct having a promoter activated by a combination of factors only present in (or greatly enriched in) the target cell population).
  • the nucleic acid concatemer described herein is capable of specifically down-regulating genes within the target organism; that is, the concatemer does not down-regulate the expression of genes in any non-target organisms.
  • the concatemer is capable of downregulating the targeted gene to a significantly greater extent a non-target orthologue (such as the human orthologue).
  • the nucleic acid concatemer may induce a reduction in the target gene product that is at least 2-fold greater than the reduction in a non-target orthologue (for example, if the nucleic acid concatemer causes a 70% reduction in target mRNA levels, there will be no more than a 35% reduction in non-target mRNA levels).
  • the nucleic acid agent may induce a reduction in target gene product that is at least 3-fold, 4-, 5-, 6-, 8-, 10-, 20-, 50-, 100-, 200-, 500- or 1000-fold greater than the reduction in a non-target gene product.
  • the nucleic acid a concatemer of the present invention is capable of downregulating a targeted gene to a significantly greater extent than any gene in a non- targeted cell / organism (e.g. human) gene.
  • the nucleic acid agent may induce a reduction in the target gene product that is at least 2-fold greater than the reduction in any non-target gene product (for example, if the nucleic acid agent causes a 70% reduction in targeted gene mRNA levels, there will be no more than a 35% reduction in non-targeted gene mRNA level).
  • the nucleic acid agent may induce a reduction in targeted gene product that is at least 3-fold, 4-, 5-, 6-, 8-, 10-, 20-, 50-, 100-, 200-, 500- or 1000-fold greater than the reduction in any non-targeted gene product.
  • the nucleic acid concatemer according to the present invention does not comprise a nucleic acid sequence that has 100% sequence identity to at least 18 (for example, at least 21 , at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100) contiguous nucleotides of the transcribed portions of the Varroa destructor genome.
  • the nucleic acid concatemer according to the present invention does not comprise a nucleic acid sequence that has 100% sequence identity to at least 18 (for example, at least 21 , at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100) contiguous nucleotides of the transcribed portions of the human genome.
  • the specificity of gene regulation may also be assayed through monitoring the mortality of non-target cells / organisms exposed to the isolated nucleic acid concatemer) For example, in some embodiments there is less than an additional 10% non-target mortality (relative to an untreated control), as measured 168 hours after the onset of treatment of the target population with the isolated nucleic acid concatemer. In some embodiments there is less than an additional 5%, 2%, 1 %, 0.5%, 0.2%, 0.1 % non-target mortality (relative to an untreated control), as measured 168 hours after the onset of treatment of the target population with the isolated nucleic acid concatemer. In preferred embodiments, there is no significant additional non-target mortality (relative to an untreated control, as measured 168 hours after the onset of treatment of the target population with the isolated nucleic acid agent). Delivery of nucleic acids
  • nucleic acid concatemer of the present invention In order to influence the expression of genes the nucleic acid concatemer of the present invention must be delivered to the target.
  • nucleic acid agents may be delivered to the target directly by contacting the target with a solution of the nucleic acid agents, for example by spraying a solution of the nucleic acid agents or concatemers directly onto the targets; on contact with the target, the nucleic acid concatemer can enter the target body via diffusion or transfer through orifices on the target body.
  • the present invention provides a concatemer of the invention (or a solution thereof) for use in a method of treatment; for example, a method of inhibiting the growth of, or reducing, a population of a target cell / organism.
  • the present invention also provides for the use of a concatemer of the invention (or a solution thereof) in the manufacture of a medicament for, for example, inhibiting the growth of, or reducing, a population of a target cell / organism.
  • the present invention further provides a method of inhibiting the growth of, or reducing, a population of a target cell / organism, the method comprising spraying, or otherwise contacting, the target cell/organism population with a solution comprising concatemer of the invention.
  • the above methods of inhibiting the growth of, or reducing, a population of a target cell / organism encompass methods of treating the disorders caused by these organism.
  • the target is a pathogenic cell population (for example a cancerous tumour).
  • a pathogenic cell population for example a cancerous tumour.
  • the above methods of inhibiting the growth of, or reducing, a population of a target cell / organism encompass methods of treating disorders caused by pathogenic cell populations (for example, cancer).
  • Concatemers of the present invention may be delivered to the target indirectly via adding the concatemer nucleic acid to the target's feed.
  • the nucleic acid concatemers of the present invention are delivered to the target organism indirectly via non-target organisms parasitized by the target organism.
  • the nucleic acid agents or concatemers of the present invention may be delivered to the non-target organism by, for example, spraying or otherwise contacting the non-target organism with a solution comprising a nucleic acid concatemer of the invention.
  • nucleic acid concatemers of the present invention may be delivered to the target organism by feeding the concatemer to the non-target organism.
  • the nucleic acid concatemers of the present invention may be delivered to the target organism by providing the target organism with feed comprising the nucleic acid concatemers.
  • the nucleic acid concatemers of the present invention may be delivered to the target organism by providing a plant comprising the nucleic acid concatemers of the present invention.
  • the present disclosure provides a transgenic plant cell, plant, or part thereof, comprising a nucleic acid concatemer of the present invention, or a nucleic acid construct encoding a nucleic acid concatemer of the invention.
  • the present disclosure provides reproductive or propagation material for a transgenic plant, a transgenic tuber, stem, seed, and/or fruit comprising a nucleic acid concatemer as described herein, or a nucleic acid construct encoding a nucleic acid concatemer as described herein.
  • the present disclosure provides a transgenic plant cell, plant, or part thereof, which expresses a nucleic acid concatemer of the present invention.
  • the present disclosure provides a transgenic tuber, stem, seed, and/or fruit comprising a nucleic acid concatemer as described herein.
  • the present disclosure also provides methods for producing a transgenic plant cell, plant, or part thereof, which expresses a nucleic acid concatemer of the present invention
  • the present disclosure also provides a cell, e.g. a host cell, comprising any of the nucleic acid concatemers, nucleotide sequences or nucleic acid (e.g. DNA) constructs described herein.
  • a cell e.g. a host cell
  • Such cells include prokaryotic cells (such as, but not limited to, gram-positive and gram-negative bacterial cells) and eukaryotic cells (such as, but not limited to, yeast cells or plant cells).
  • Preferably said cell is a bacterial cell or a plant cell.
  • the present disclosure provides a composition comprising at least one comprising at least one nucleic acid concatemer or nucleic acid (e.g. DNA) constructs construct described herein, plus a physiological or agronomical acceptable carrier, excipient or diluent.
  • composition may contain further components which serve to stabilise dsRNA and/or prevent degradation of dsRNA during prolonged storage of the composition.
  • composition may still further contain components which enhance or promote uptake of dsRNA by the target organism.
  • components which enhance or promote uptake of dsRNA by the target organism may include, for example, chemical agents which generally promote the uptake of RNA into cells e.g. lipofectamin etc., and enzymes or chemical agents capable of digesting the fungal cell wall, e.g. a chitinase.
  • composition may be in any suitable physical form for application to the target, to substrates, to cells (e.g. plant cells), or to organism infected by or susceptible to infection by a target species. It is contemplated that the "composition" of the disclosure may be supplied as a "kit-of-parts" comprising the nucleic acid concatemer in one container and a suitable diluent or carrier in a separate container.
  • the invention also relates to supply of the nucleic acid concatemer alone without any further components.
  • the nucleic acid concatemer may be supplied in a concentrated form, such as a concentrated aqueous solution. It may even be supplied in frozen form or in freeze-dried or lyophilised form. The latter may be more stable for long term storage and may be de-frosted and/or reconstituted with a suitable diluent immediately prior to use.
  • the present invention relates to pesticidal compositions developed to be used in agriculture or horticulture.
  • These pesticidal compositions may be prepared in a manner, known per se.
  • the active compounds can be converted into formulations, such as solutions, emulsions, wettable powders, water dispersible granules, suspensions, powders, dusting agents, foaming agents, pastes, soluble powders, granules, suspo-emulsion concentrates, microcapsules, fumigants, natural and synthetic materials impregnated with active compound and very fine capsules and polymeric substances.
  • the pesticidal compositions according to the present disclosure may comprise a synergist.
  • dsRNA or dsRNA constructs according to the invention can also be used in a mixture with known fungicides, bactericides, acaricides, nematicides or insecticides, to widen, for example, the activity spectrum or to prevent the development of resistance. In many cases, this results in synergistic effects, i.e. the activity of the mixture exceeds the activity of the individual components.
  • active compounds according to the disclosure can also be used in a mixture with other known active compounds, such as herbicides, fertilizers and/or growth regulators.
  • the present invention also relates to fibrous pesticide composition and its use as pesticide, wherein the fibrous composition comprises a non-woven fibre and an effective amount of at least one of the nucleic acid concatamers described herein, covalently attached or stably adsorbed to the fibre.
  • the present invention also relates to surfactant-diatomaceous earth compositions for pesticidal use in the form of dry spreadable granules comprising at least one nucleic acid concatemer, or at least two nucleic acid concatamers as described herein.
  • the present disclosure also provides solid, water-insoluble lipospheres and their use as pesticide, wherein said lipospheres are formed of a solid hydrophobic core having a layer of a phospholipid embedded on the surface of the core, containing at least nucleic acid concatemer as described herein in the core, in the phospholipid, adhered to the
  • the invention further relates to pesticidal formulations in the form of microcapsules having a capsule wall made from a
  • urea/dialdehyde precondensate and comprising at least one nucleic acid concatemer as described herein.
  • the below combinations are encompasses by the present invention. In an alternative aspect, the below combinations are not encompassed by the present invention.
  • nucleic acid agent according to any one of paragraphs 4 to 13, a nucleic acid composition according to either one of paragraphs 15 or 16, or a composition according to paragraph 17 for use in a method of treating or preventing a Varroa destructor mite infestation of a beehive.
  • nucleic acid agent any one of paragraphs 4 to 13, a nucleic acid composition according to either one of paragraphs 15 or 16, or a composition according to paragraph 17 in the manufacture of a medicament for the treatment or prevention of a Varroa destructor mite infestation of a beehive.
  • a method of treating or preventing a Varroa destructor mite infestation of a beehive comprising administering to a member of the beehive an isolated nucleic acid agent according to any one of paragraphs 4 to 13, a nucleic acid composition according to either one of paragraphs 15 or 16, or a composition according to paragraph 17.
  • An isolated nucleic acid agent comprising a nucleic acid sequence that is capable of downregulating the expression of a gene of the Varroa destructor mite, wherein the gene encodes Acetylcholinesterase (AChE; GenBank accession number ADDG01069748.1), Monoamine Oxidase (MOA; GenBank accession number ADDG01053234.1), vATPase subunit C (vATPc; GenBank accession number ADDG01035752.1 , GABA-receptor alpha subunit (GABA-Ra; GenBank accession number ADDG01060981.1), Chitin Synthase 1 (CHS-1 ; GenBank accession number ADDG01037469.1), Pyruvate Kinase (PyK; GenBank accession number ADDG01095321.1), alpha Tubulin (aTUB; GenBank accession number ADDG01073340.1), Prothoracicostatic peptide precursor (PTTH; GenBank accession number ADDG01
  • nucleic acid agent comprises at least two or at least three nucleic acid sequences, wherein, optionally, the at least two or at least three nucleic acid sequences are capable of downregulating the expression of at least two or at least three different genes from Varroa destructor.
  • nucleic acid agent according to any one of paragraph 4 to paragraph 6 wherein the or each nucleic acid sequence independently has at least 80% sequence identity to at least 18 contiguous nucleotides of an mRNA encoded by the gene of the Varroa destructor mite, and wherein the nucleic acid agent inhibits translation of the mRNA.
  • each nucleic acid sequence independently has at least 80% sequence identity to at least 18 contiguous nucleotides encoded by SEQ ID NO.1 , SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.1 13, or SEQ ID NO.10.
  • nucleic acid agent according to any one of paragraph 4 to paragraph 6 wherein the or each nucleic acid sequence independently has 100% sequence identity to at least 18 contiguous nucleotides of an mRNA encoded by the gene of the Varroa destructor mite, and wherein the nucleic acid agent induces the degradation of the mRNA.
  • nucleic acid agent according to any one of paragraphs 4 to10 wherein the nucleic acid agent is a dsRNA, antisense RNA, or a ribozyme.
  • dsRNA is an siRNA, shRNA or miRNA.
  • a nucleic acid composition comprising at least two isolated nucleic acid agents according to any one of paragraphs 4 to 13.
  • a composition for feeding to bees comprising an isolated nucleic acid agent according to any one of paragraphs 4 to 13 or a nucleic acid composition according to either one of paragraphs 15 or 16.
  • FIG. 1 Assessing the effect of different dsRNA targets on Tribolium larvae mortality.
  • Larvae were microinjected with 100 nl of solutions containing 60ng dsRNAs coding for one of five Tribolium target genes, or dsGFP serving as a negative control.
  • Larvae were maintained in Petri dishes with food at 23°C and 80% RH. Mortality was determined daily.
  • FIG. 3 Effect of different dsRNA treatments on Tribolium larvae mortality in Trial #1.
  • the 'Mix' treatments contained of a mixture of individual dsRNAs coding for PMCA, Na+/K+-ATPase subunit alpha and ADP/ATP-translocase.
  • the Tricat' treatments contained dsRNAs coding for those three genes, but concatamerized together into a single dsRNA.
  • ⁇ ' treatments were doses of 60 ng larva -1 .
  • '3 ⁇ ' treatments were doses of 180 ng larvae -1 .
  • FIG. 4 Effect of different dsRNA treatment on Tribolium larvae mortality in Trial one. Experimental details are given in legend to Figure 3, above. Effect of treatments on larvae mortality at 216 hours post-treatment was assessed initially by oneway-ANOVA and pairwise comparisons determined by Fisher's LSD. Treatments that do not share a letter are significantly different (P ⁇ 0.15).
  • FIG. 6 Effect of different dsRNA treatments on Tribolium larvae mortality in Trial #2.
  • Larvae were microinjected with 100 nl of solutions containing different dsRNAs and maintained in Petri dishes with food at 23°C and 80% RH. Mortality was determined daily.
  • the 'Mix' treatments contained of a mixture of individual dsRNAs coding for PMCA, Na+/K+-ATPase subunit alpha and V-ATPase subunit E.
  • the Tricat' treatments contained dsRNAs coding for those three genes, but concatamerized together into a single dsRNA.
  • ⁇ ' treatments were total doses of 60 ng larva -1 .
  • '3 ⁇ ' treatments were total doses of 180 ng larvae -1 .
  • FIG. 8 Effect of different dsRNA treatment on Varroa mite mortality.
  • Figure 9 Assessment of the level of the gene knockdown in adult Varroa 72 hours after overnight immersion in dsRNA preparations coding for AChE, MOA and V-ATPase C- subunit either presented as a 3.75 ⁇ g ⁇ -1 mixture (Mix 3.75) or as a 1.2 or 5 3.75 ⁇ g ⁇ -1 tricatamer (Tri 1.25 or Tri 3.75, respectively) .
  • MOA and V-ATPase C- subunit either presented as a 3.75 ⁇ g ⁇ -1 mixture (Mix 3.75) or as a 1.2 or 5 3.75 ⁇ g ⁇ -1 tricatamer (Tri 1.25 or Tri 3.75, respectively) .
  • FIG. 10 L4440-MOA-V-ATPC-ACHE-Tricatemer plasmid map: MOA, vATPc, and AChE targets are indicated Figure 11.
  • L4440- PM C A- N A K- A D P Tricatamer 1 plasmid map Figure 12.
  • FIG. 13 Effect of different dsRNA treatments on Tribolium larvae mortality Example 6.
  • the Mix treatments contained of a mixture of individual dsRNAs coding for alpha-tubulin, HSP90 and ADP/ATP-translocase.
  • the tricatemer treatments contained dsRNAs coding for those three genes, but concatamerized together into a single dsRNA.
  • 1X treatments were doses of 60 ng larva -1 .
  • 3X treatments were doses of 180 ng larvae -1 .
  • FIG 14. Effect of different dsRNA treatment on Tribolium larvae mortality Example 6.
  • the Mix treatments contained of a mixture of individual dsRNAs coding for alpha-tubulin, HSP90 and ADP/ATP-translocase.
  • the Tricatemer treatments contained dsRNAs coding for those three genes, but concatamerized together into a single dsRNA.
  • 1X treatments were doses of 60 ng larva -1 .
  • 3X treatments were doses of 180 ng larvae -1 .
  • Effect of treatments on larvae mortality at 216 hours post-treatment was assessed initially by oneway-ANOVA (P ⁇ 0.0001) and pairwise comparisons determined by Fisher's LSD. Treatments that do not share a letter are significantly different (P ⁇ 0.05).
  • FIG. 15 Effect of different dsRNA treatments on Tribolium larvae mortality Example 5.
  • Larvae were fed food administered with 10 ⁇ of either 1.25 or 3.75 g/ ⁇ of different dsRNAs and maintained in Petri dishes at 23°C and 80% RH. Mortality was determined daily.
  • the Mix treatments contained of a mixture of individual dsRNAs coding for PMCA, Na + /K + -ATPase-a, and ADP/ATPtranslocase.
  • the tricatemer treatments contained dsRNAs coding for those three genes, but concatamerized together into a single dsRNA.
  • FIG. 16 Effect of different dsRNA treatments on Tribolium larvae mortality in Example 5.
  • Larvae were fed food administered with 10 ⁇ of either 1.25 or 3.75 g/ ⁇ of different dsRNAs and maintained in Petri dishes at 23°C and 80% RH. Mortality was determined daily.
  • the Mix treatments contained of a mixture of individual dsRNAs coding for PMCA, Na7K + -ATPase-a, and ADP/ATPtranslocase.
  • the tricatemer treatments contained dsRNAs coding for those three genes, but concatamerized together into a single dsRNA. Effect of treatments on larvae mortality at 96 hours post-treatment was assessed initially by oneway-ANOVA (P ⁇ 0.005) and pairwise comparisons determined by Fisher's LSD. Treatments that do not share a letter are significantly different (P ⁇ 0.06).
  • FIG. 17 Effect of different dsRNA treatments on Aedes aegypti larvae mortality in Example 9.
  • the Mix treatments contained of a mixture of individual dsRNAs coding for ⁇ -tubulin, Na 7K + -ATPase alpha subunit and ADP/ATP translocase.
  • the tricatemer treatments contained dsRNAs coding for those three genes, but concatamerized together into a single dsRNA.
  • FIG. 18 Effect of different dsRNA treatments on Aedes aegypti larvae mortality in Example 9.
  • the Mix treatments contained of a mixture of individual dsRNAs coding for ⁇ -tubulin, Na + /K + -ATPase alpha subunit and ADP/ATP translocase.
  • the tricatemer treatments contained dsRNAs coding for those three genes, but concatamerized together into a single dsRNA. Effect of treatments on larvae mortality at 144 hours post-treatment was assessed initially by oneway-ANOVA (P ⁇ 0.001) and pairwise comparisons determined by Fisher's LSD. Treatments that do not share a letter are significantly different (P ⁇ 0.05).
  • percentage sequence identity refers to identity as measure over the entire length of the SEQ ID in question.
  • polypeptide comprising a sequence having 70% sequence identity to SEQ ID NO:1 would contain a contiguous polypeptide where:
  • the percent identity of two amino acid or two nucleic acid sequences can be determined by visual inspection and mathematical calculation, or more preferably, the comparison is done by comparing sequence information using a computer program.
  • An exemplary, preferred computer program is the Genetics Computer Group (GCG; Madison, Wis.) Wisconsin package version 10.0 program, 'GAP' (Devereux et al., 1984, Nucl. Acids Res. 12: 387).
  • the preferred default parameters for the 'GAP' program includes: (1) The GCG implementation of a unary comparison matrix (containing a value of 1 for identities and 0 for non-identities) for nucleotides, and the weighted amino acid comparison matrix of Gribskov and Burgess, Nucl. Acids Res.
  • an isolated nucleic acid agent comprising at least two nucleic acid sequences wherein each nucleic acid sequence independently has at least 80% sequence identity to at least 18 contiguous nucleotides encoded by SEQ ID NO. 1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO. 113, or SEQ ID NO. 10" encompasses an isolated nucleic acid agent wherein (for example) one nucleic acid sequence has identity to SEQ ID N0.1 and another has identity to SEQ ID NO.2. That is, both sequences do not have to have identity to the same SEQ ID (since they are independent).
  • Varroa destructor adult female mites were collected from capped brood cells frames from Apis mellifera hives in York, England that had purposefully been left untreated for Varroa control. Prior to harvesting mites the frames were maintained at 27°C in a 80% relative humidity environment, 15.5h : 8.5h, light:dark regime. Mites were attached ventral side down on double sided tape attached to Petri dishes and approximately 50 were harvested for synganglion in phosphate buffered saline (PBS) before being washed in sterile ice-cold PBS and pooled together in a 1.5ml eppendorf tube containing 200 ⁇ RNA-later (Sigma, Poole, UK). Prior to RNA extraction, an additional 450 ⁇ dissection buffer was added to sample tubes and centrifuged at 14000rpm for 15 min. Supernatant was removed and the
  • cDNA synthesis 3.5 ⁇ (O ⁇ g) of total Varroa destructor RNA was used for first strand cDNA synthesis.
  • the construction of cDNA libraries was done using the SMART cDNA library construction kit (Clontech, St-Germain-en-Laye, France) according to the protocol provided by manufacturer, with some modifications.
  • SMART cDNA library construction kit (Clontech, St-Germain-en-Laye, France) according to the protocol provided by manufacturer, with some modifications.
  • To determine optimal number of cycles two identical amplification reactions were prepared. After the 10th amplification cycle the first reaction was stored on the ice, while the second one was used for the PCR cycle number optimization by removing 3 ⁇ samples from the reaction every two cycles until cycle number 20. Samples were checked by visualization on a 1.1 % agarose gel. The optimal number of cycles with visible and equally represented products, in this case 20 cycles, was used for primary amplification.
  • cDNA was proteinase K treated, followed by phenol:chloroform extraction and resuspension in water. After Sfil digestion and size fractionation with Chroma Spin-400 column, the fractions were checked using agarose gel and pooled into large or medium libraries. Pooled cDNA was ethanol precipitated and eluted in 4ul of water. 3ul from each fraction was ligated into the ATripleEx2 vector and packed into phage using the Gigapack III Gold Packaging extract (Stratagene).
  • Each un-amplified library was mixed with E.coli XL1 blue cells and top agar supplemented with X-gal and IPTG before being plated onto LB MgS04 agar plates in serial dilutions of 1 , 1 :10, 1 : 100 and 1 : 1000.
  • the large library consisted of 6.23 x106 colony forming units (cfu)/ml and the medium library 1.07 x107 cfu/ml with recombination of 94.3 and 96.3% respectively.
  • 600 randomly selected recombinant plaques (white) were picked as agar plugs into plates of 96-wells, each well containing 100 ⁇ of SM buffer (0.58% NaCI, 0.2% MgS04 ⁇ H20 0.05M Tris-HCI, pH 7.5, 0.02% gelatin).
  • SM buffer 0.58% NaCI, 0.2% MgS04 ⁇ H20 0.05M Tris-HCI, pH 7.5, 0.02% gelatin.
  • Four plates were picked from the large fraction library, two from the medium fraction library and an additional 24 clones from the large fraction library for initial quality control.
  • PCR with vector-specific primers was carried out using SM buffer / picked plaques as templates. PCR was carried out in 96-well plates containing 25ul
  • AAGTACTCTAGCAATTGTGAGC-3' AAGTACTCTAGCAATTGTGAGC-3'
  • PT2R1 5'- CTCTTCGCTATTACGCCAGCTG- 3'
  • 18ul water 18ul water to give a 50ul final reaction volume. Cycling conditions were 94'C for 15min followed by 33 cycles of 94'C for 1 min, 49'C for 1 min and 72'C for 1 min 20s.
  • PCR products were sent to GATC (Konstanz, Germany) for PCR reaction clean up and sequenced using primer PT2F3 (5' - CTCGGGAAGCGCGCCATTGT- 3').
  • PT2F3 is upstream from inserted cDNA and downstream from PT2F1 primer used in initial PCR reaction.
  • ESTs Expressed sequence tags
  • ESTs were modified in silico. ESTs were trimmed of primer and vector sequences, clusterized and checked for sequence quality using Lasergene Seqman (Lasergene v8.03, DNAstar, Madison, USA).
  • BLASTn, BLASTx and tBLASTx programmes were used within the program BLAST2GO to compare the EST nucleotide sequences with the nonredundant (NR) databases of the NCBI and to the Gene Ontology (GO) database (www.blast2go.org).
  • NR nonredundant
  • GO Gene Ontology
  • Putative targets were chosen from the annotated sequences obtained in the EST library and were resequenced. In addition, other putative targets were postulated based on their likelihood of having critical function in Acari and the likelihood of being fast-acting with little chance of having alternative rescue pathways.
  • dsRNA was prepared using a BLOCK-iT RNAi TOPO transcription kit (Invitrogen), according to the manufacturer's instructions. LacZ-dsRNA was prepared and used as a negative control. Briefly, PCR was carried out as described above using adult female V. destructor cDNA in conjunction with specific primers, or with control LacZ-plasmid and LacZ specific primers (LacZ-F2, ACCAGAAGCGGTGCCGGAAA and LacZ-R2,
  • RNA strands were annealed and the resultant dsRNA purified and quantified in a micro-spectrophotometer (Nanodrop Technology Ltd). dsRNA was ethanol precipitated and resuspended in DEPC-treated water to a working concentration of 2.5 Mg/ ⁇ and stored at -80°C.
  • Mites were left for 1 - 2 min to allow the injection site to "seal" then returned to Petri dishes containing 1 bee larvae per 4 mites. Dead or unhealthy looking mites were removed after 1 hour and mortality was monitored over 72 h in LacZ-dsRNA, VdGSTmul-dsRNA and non-injected mites.
  • mites were either completely immersed in dsRNA or were exposed to a droplet of dsRNA on their ventral carapace.
  • adult mites were removed from capped brood cells and placed in 500 ⁇ microfuge tubes containing 20 ⁇ VdGST-mu1-dsRNA or LacZ-dsRNA (2.5 ⁇ 9/ ⁇ ) supplemented with either nothing, 0.9% NaCI, 0.2% Triton-X100 or both. Mites were soaked at 4°C overnight before being removed, dried and placed in Petri dishes at 27°C, 95% relative humidity with bee larvae.
  • a sample of mites was exposed to dsRNA by attaching them to double-sided tape and placing a 1 ⁇ drop of VdGST-mu1-dsRNA or LacZ- dsRNA (2.5 ⁇ /Mg) supplemented with either nothing, 0.9% NaCI, 0.2% Triton-X100 or both on the ventral carapace. Mortality was monitored for 48 h prior to collection and validation of knockdown.
  • MOA, vATPc and AChE targets were assembled into a single assembly using the Gibson Assembly cloning kit (New England Biolabs).
  • Initial PCR reactions to add overlapping assembly regions were carried out using 25 ⁇ Biomix (Bioline), 23 ⁇ water, 1 ⁇ (1 ng/ ⁇ ) of PCR4.1 plasmids containing either MOA, AChE or vATPc dsRNA target sequences and 1 ⁇ (2mM) respective target primers containing target and L4440 overlapping regions (Table 1).
  • the following cycling conditions were used: 1 cycle of 5 min at 94°C, followed by 35 cycles of 1 min at 94°C, 1 min at 58°C and 45 s at 72°C.
  • Products were resolved on an agarose gel and visualised by UV light to check product size prior to assembly. Reaction was assembled on ice with the following 2 ⁇ MOA, 1.5 ⁇ ATP, 1 ⁇ AChE and 0.5 ⁇ L4440 plasmid, 10 ⁇ Gibson Assembly Master Mix and 5 ⁇ RNAse-free water. Samples were incubated at 50°C for 60 minutes.
  • GIB-MOA-FWD tggatccaccggttcgaacccactagccgaaatggac
  • GIB-vATPc-FWD ggaggtcacgaaaggagcattttgtgcttgg
  • GIB-vATPc-REV gcaactaattctcgacaaagagacgcagtgc
  • GIB-AChE-FWD ttgtcgagaattagttgctcgccacgatatcattg
  • GIB-AChE-REV cgtcacgtggctagctggcaagaggacttcccataag
  • PCR was carried out using 25 ⁇ Biomix (Bioline), 23 ⁇ water, 1 ⁇ (1 ng/ ⁇ ) of PCR4.1 plasmids containing either MOA, AChE, vATPc or the tricatemer dsRNA target sequences and 1 ⁇ (2mM) respective target primers containing restriction enzyme Bglll sites at 5'ends (Table 2).
  • the following cycling conditions were used: 1 cycle of 5 min at 94°C, followed by 35 cycles of 1 min at 94°C, 1 min at 56°C and 45 s at 72°C. Products were resolved on an agarose gel and visualised by UV light. PCR products were purified using a Qiaquick PCR purification kit.
  • Restriction digests were carried out on the purified PCR products, as well as dsRNA expression plasmid L4440, using Bglll restriction enzymes (Promega). Digested PCR and plasmids were ligated using a quick ligation it (New England Biolabs).
  • RNA samples were disrupted in Tri-reagent by pipetting and allowed to stand for 10 minutes. 0.2ml chloroform was added per ml Tri-reagent and samples were shaken vigorously for 20s before incubating at room temperature for a further 10 minutes. Samples were centrifuged at 12000 x g for 15 minutes and aqueous layer retained. An additional chloroform extraction was performed and RNA isolated by the addition of 0.5ml isopropanol per ml Tri-reagent. Precipitated RNA was pelleted by centrifugation at 12000 x g for 15 minutes. RNA pellets were washed in 75% ethanol and air dried prior to re-suspension in RNAse-free water.
  • Tri-reagent extracted dsRNA was digested with RNAse A or RNase III which specifically digest either ssRNA or dsRNA, respectively.
  • the resultant RNAs were visualised by agarose gel electrophoresis. dsRNA purity and quantity was analysed by both Nanodrop ND-1000 and by comparison with dsRNA markers.
  • MOA dsRNA Bglll For primer: atagatctgaacccactagccgaaatg
  • Tribolium castaneum the red flour beetle
  • T. castaneum is a model organism that is easy to rear in large numbers, has a well annotated genome and is used extensively in food safety research.
  • Tribolium demonstrate a strong, systemic RNAi response elicited by intra-hemocoel injection with dsRNA.
  • T.castanuem were purchased from Blades Biologicals (Edinbridge, UK) and maintained in bran, flour and yeast medium in temperature / humidity controlled chambers at 23°C and 80%RH. Larvae and adults were removed from culture and the RNA extracted by Tri-reagent (Life Technologies), according to manufacturer's instructions. After isolation, 1.5 ⁇ g total RNA was DNase treated with 1 ⁇ (2U) RQ1-DNase (Promega, Victoria, UK) and 1 ⁇ 01 buffer and incubated at 37°C for 30 min. DNase-treated total RNA was incubated at 70°C with O ⁇ g of oligo d(T)15 (Promega) in a total volume of 10 ⁇ for 5 min.
  • Plasma membrane Ca2+ ATPase is a transport protein found in the plasma membrane of cells. Its major function is to export calcium (Ca2+) from the cell across membranes, facilitating a vital role in regulating the amount of Ca2+ within cells and, thus, maintaining the much lower intracellular Ca2+ levels ( ⁇ ) relative to the extracellular (e.g. blood) levels (mM).
  • Na+/K+-ATPase is found in the plasma membrane of eukaryotic cells where it acts as an anti porter-like enzyme; pumping Na+ out of cells while simultaneously pumping K+ inwards.
  • Na+/K+-ATPase is vital in regulating and maintaining cellular resting potential as well as volume. It also functions as signal transducer. Na+/K+-ATPase places high energy demands on cells and is responsible for around 20% of cellular energy expenditure.
  • ADP/ATP translocase is a transporter protein that enables ATP and ADP to traverse the inner mitochondrial membrane. ATP produced from oxidative phosphorylation in the mitochondria is transferred via ATP- ADP translocase from the mitochondrial matrix to the cytoplasm, with ADP moving in the opposite direction. ADP/ATP translocase is vital to cellular energy production.
  • V-ATPase subunit E (vATPe, XM_965528.2)
  • Vacuolar-type H+-ATPases are a class of enzyme that couple energy from ATP hydrolysis to facilitate proton transport across intracellular and plasma membranes of eukaryotic cells. They play a variety of roles crucial for the function of cells and organelles pH homeostasis. V-ATPase complexes are made of 13 subunits including units A-H, all of which are necessary for regulation and function.
  • a-tubulin is a small globular protein that together with ⁇ -tubulin makes up cellular microtubules that are vital in cellular cytoskeletal architecture and perform essential and diverse transport and structural functions within the eukaryotic cell.
  • heat shock protein 90 HSP90, NP_001094067
  • Heat shock protein 90 is a chaperone protein that folds proteins and stabilises them against heat stress. Hsp90 also aids in protein degradation and has roles in cell signalling. Previous investigations demonstrated that HSP90 was plays a crucial role in development, indeed silencing by dsRNA is lethal at all developmental stages.
  • Primers for ATPase are from (Whyard et al. 2009). PCR was carried out using 25 ⁇ Biomix (Bioline), 23 ⁇ water, 1 ⁇ cDNA and 1 ⁇ (2mM) respective target primers. The following cycling conditions were used: 1 cycle of 5 min at 94°C, followed by 35 cycles of 1 min at 94°C, 1 min at 59°C and 45 s at 72°C. Products were resolved on an agarose gel and visualised by UV light. PCR products were visible for all targets at expected sizes except SERCA.
  • PCR products were purified using Qiagen PCR purification kit and eluted in 20 ⁇ water.
  • Reaction was assembled on ice with the following; 1 ⁇ PMCA, 1.5 ⁇ NaK, 1 ⁇ ADP/ATP translocase and 0.5 ⁇ L4440 plasmid, 10 ⁇ Gibson Assembly Master Mix and 6 ⁇ RNAse-free water. Samples were incubated at 50°C for 60 minutes.
  • dsRNA was produced using T7 Ribomax kit (Promega) in conjuction with either T7-single targets or, for tricatemer production, T7-tricatemer PCR template. The following reaction was assembled at room temperature; 40 ⁇ T7-ribomax buffer, 32 ⁇ T7-adapted template (1 ⁇ g) and 8 ⁇ Ribomax enzyme. The reaction was incubated at 37°C for 2 hours, subsequently treated with 4 ⁇ RNAse-A and 1 ⁇ RQ1 DNAse with a final incubation at 37°C for 30 minutes. dsRNA was precipitated by the addition of 8.5 ⁇ 3M Sodium Acetate and 90 ⁇ Isopropanol, pelleted by centrifugation and washed with 70% EtOH. dsRNA purity and quantity was analysed using a Nanodrop ND-1000 microspectrophotometer and by comparison with dsRNA markers.
  • a tricatemer has been designed which incorporates three Aedes aegypti targets into a assembly plasmids using the Gibson Assembly cloning kit (New England Biolabs) in a similar manner to that described above for the T.castanuem tricatamer.
  • the Gibson assembly primers are shown in Table 6 below.
  • a tricatemer has been designed which incorporates three Lepeophtheirus salmonis targets into a single assembly plasmids using the Gibson Assembly cloning kit (New England Biolabs) in a similar manner to that described above for the T.castanuem tricatamer.
  • the Gibson assembly primers are shown in Table 7 below. Primer name Sequence
  • Example 1 Assessment of efficacy of T castaneum gene targets by administration of the corresponding individual dsRNAs
  • dsRNA for individual targets were diluted with 0.9% NaCI to O ⁇ g ⁇ l concentration.
  • Any injured or dead individuals from the injection trauma were removed within the first 24 hours and not included within the dataset. Larvae mortality was monitored daily. Live larvae, for example those injected with vATPe were removed after 72-96 hours and placed in Tri-reagent at -80°C to test for the degree of gene knockdown by qPCR.
  • Tribolium larvae were microinjected with 100 nl containing 60 ng of dsRNA coding for one of the following Tribolium genes: PMCA, Na+/K+-ATPase alpha subunit, alpha-tubulin, ADT/ATP-translocase, heat shock protein 90 or a similar amount of dsRNA GFP, acting as the negative control.
  • dsRNA mixtures were prepared with 0.9% NaCI to either 0.2 ⁇ 9/ ⁇ individual PMCA, NaK and ADP ("Mix 1X" total concentration 0 ⁇ g/ul), or ⁇ . ⁇ / ⁇ individual PMCA, NaK and ADP ("Mix 3X" total concentration
  • Tricatemer "Tc1" (PMCA-NaK-ADP) dsRNA was prepared with 0.9% NaCI to either ⁇ . ⁇ / ⁇ ("Tc1 1X”) or ⁇ / ⁇ ("Tc1 3X").
  • Control dsRNA was GFP at ⁇ . ⁇ / ⁇ or 1 ⁇ g/ul (see summary in Table 8 below).
  • Tribolium larvae of similar age class were removed from culture medium by sieves, chilled on ice for approximately 5 minutes and attached to injection platform using restraints. Larvae were then micro- injected between abdominal tergits VI - VI I with 100nl dsRNA and placed in groups of 7 -10 in 85mm vented Petri dishes containing culture medium. Petri dishes were kept in humidity controlled environments at 23°C 80%RH. Larvae were allowed to recover with any injured or dead individuals removed within the first 24 hours. Larvae were then monitored every 24 hours for mortality.
  • the data consistently shows that the dsRNAs coding for 3 target genes was significantly more effective when administered in a concatamerized form, as opposed to a mixture of separate dsRNAs (for a given total dsRNA dose).
  • Example 3 Assessing level of gene knockdown of target genes in Example 2 using qPCR
  • dsGFP 60 ng
  • Mc1 1x Larvae were treated as per Example 2, and sampled 72 hours after treatment with either dsRNA-GFP, dsRNA mixtures or dsRNA-tricatamer, placed in 1 ml Tri-reagent and kept at - 80°C until use.
  • the normalising reference gene employed in this study was ribosomal protein 6 (RP6, Accession # NM_001 172390.1), as described by Whyard et al. (2009).
  • Relative expression qPCR was carried out on an CFX-96 platform (Biorad) by Sybr-Green detection using iTaq reaction mix of 10 ⁇ Itaq buffer (BioRad), 4 ⁇ water, 5 ⁇ (5ng/ul) of template cDNA and 1 ⁇ (2mM) respective target and control RP6 primers (Table 9). The following cycling conditions were used: 1 cycle of 10 min at 94°C, followed by 45 cycles of 30s at 94°C and 30s at 60°C. Melting curve analysis was performed to confirm specificity of reaction products. Ct values were extracted by automatic adjustment from sample reaction curves in the linear phase. Knockdown was assessed by Biorad gene expression software (Bio-Rad CFX manager 3.1) using the 2-AACT method.
  • Example 4 Comparison of the mortality induced by mixed versus concatemerised PMCA, NaK and vATPe dsRNAs
  • dsRNA mixtures were prepared with 0.9% NaCI to either 0.2 ⁇ 9/ ⁇ individual PMCA, NaK and V-ATPaseE ("Mix 1X” total concentration 0 ⁇ g/ul) or O ⁇ g ⁇ l individual PMCA, NaK and V-ATPase-E ("Mix 3X” total concentration 1 ⁇ g/ul).
  • Tricatemer 2 (PMCA-NAK-V-ATPase-E) dsRNA was prepared with 0.9% NaCI to either 0.6 ⁇ 9/ ⁇ ("Tc2 1X”) or 1.8 ⁇ 9/ ⁇ (“Tc2 3X”).
  • Control dsRNA was GFP at 0.6 ⁇ 9/ ⁇ or 1 ⁇ g/ul. (See summary in Table 10 below).
  • Example 10 As observed in Example 2, the data in example 4 shows that over the 9-day period that there is greater mortality in Tribolium larvae treated with dsRNAs targeting Tribolium genes, as compared the control dsRNA GFP (see Figure 6). This indicates that the higher mortality of larvae treated with Tribolium gene-targeted dsRNA is a specific effect. Over the 4.5 days post-treatment period, there was a steady increase in the number of mites dying with any of the treatments involving dsRNA designed against any mite gene (see figure 6).
  • Tribolium gene-specific dsRNA treatments irrespective of dose or whether presented as a mixture or tricatemer, caused significantly higher mortality than the dsGFP at either dose (60 and 180 ng /larvae) treatments (see Figure 7).
  • Example 5 Comparisons of the mortality rates with dsRNA for PMCA, NaK and ADP/ATPt administered in diet.
  • L4440-tricatemer were purified from glycerol stocks and 1 ⁇ (100ng) transformed into 200 ⁇ ribonuclease-lll deficient E. coli HT115(DE3), plated onto LB agar containing 12.5mg/ml tetracycline and 100mg/ml ampicillin and incubated at 37°C for 36 hours.
  • Tricatemer-L4440 plasmid HT115 glycerol stock picks were grown overnight at 37°C in 5ml LB broth containing 12.5mg/ml tetracycline and 100mg/ml ampicillin. Each starter culture was diluted 100-fold with 2xYT broth containing 100mg/ml ampicillin only and incubated at 37°C until OD600 reached 0.4. T7 RNA polymerase, then induced by the addition of 0.4mM IPTG and incubated again at 37°C until OD600 reached 1.0.
  • RNA extracted cells were harvested by centrifugation at 6000xg for 5 min and supernatant discarded prior to dsRNA extraction with TRI-reagent (Life technologies). 1 ml Tri-reagent was used per 10 7 bacterial cells. Briefly, cells were disrupted in Tri-reagent by pipetting and allowed to stand for 10 minutes. 0.2ml chloroform was added per ml Tri-reagent and samples shaken vigorously for 20s before incubating at room temperature for a further 10 minutes. Samples were centrifuged at 12000 x g for 15 minutes and aqueous layer retained. An additional chloroform extraction was performed and RNA isolated by the addition of 0.5ml isopropanol per ml Tri-reagent.
  • Tri-reagent extracted dsRNA was digested with RNAse A or RNase III which specifically digest either ssRNA or dsRNA, respectively.
  • the resultant RNAs are visualised by agarose gel electrophoresis.
  • dsRNA purity and quantity is analysed by both Nanodrop ND-1000 and by comparison with dsRNA markers.
  • Feeding of dsRNA-tricatemer was carried out as described in Whyard et al. (2009). 10 mg of tribolium diet to be placed in 48-well plates, and 10 ⁇ of either the prepared 5 mg/ml dsRNA- tricatemer or a mixture of the three individual dsRNAs (PMCA, Na+/K+-ATPase-a, and ADP/ATPt) at total concentration of 5 mg/ml to be pipetted onto the surface of the food.
  • PMCA the prepared 5 mg/ml dsRNA- tricatemer or a mixture of the three individual dsRNAs (PMCA, Na+/K+-ATPase-a, and ADP/ATPt) at total concentration of 5 mg/ml to be pipetted onto the surface of the food.
  • PMCA a mixture of the three individual dsRNAs
  • Na+/K+-ATPase-a Na+/K+-ATPase-a
  • ADP/ATPt a mixture of
  • Tribolium larvae of similar age class approximately 6 mm in length, were removed from culture medium by sieves and larvae (6-8mm) placed in each well, which is then sealed with parafilm M (Pechiney, USA), with pin holes for respiration. Survival of larvae was monitored every 24h with samples removed after 72h for qPCR analysis of knockdown. Treatment effects were determined by ANOVA and, if significant, pair-wise comparisons investigated by Fisher's LSD.
  • the dietary dsRNAs presented in the single concatemerized form rather than as a mixture of 3 individual dsRNAs was significantly more effective in killing the Tenebrio larvae at the 1X dose (survival rates 62.5 ⁇ 7.2% vs 81.5 ⁇ 5.1 %, P ⁇ 0.05).
  • Example 6 Comparison of the mortality induced by mixed versus concatemerised aTUB, HSP90. and ADP dsRNAs
  • dsRNA mixtures were prepared with 0.9% NaCI to either O ⁇ g ⁇ l individual aTUB, HSP90, and ADP ("Mix 1X” total concentration 0 ⁇ g/ul) or O ⁇ g ⁇ l individual aTUB, HSP90, and ADP ("Mix 3X” total concentration 1 ⁇ g/ul).
  • Tricatemer 3 (aTUB-HSP90-ADP) dsRNA was prepared with 0.9% NaCI to either O ⁇ g ⁇ l ("Tc3 1X”) or 1.8 ⁇ 9/ ⁇ (“Tc3 3X”).
  • Control dsRNA was GFP at 0.6 ⁇ 9/ ⁇ or 1 ⁇ g/ul. (See summary in Table 1 1 below).
  • Table 11 As observed in Examples 2 and 4, the data in example 6 shows that over the 9-day period that there is a steady increase in the mortality of Tribolium larvae treated with dsRNAs targeting Tribolium genes, as compared the control dsRNA GFP (see Figure 13). This indicates that the higher mortality of larvae treated with Tribolium gene-targeted dsRNA is a specific effect.
  • tha data confirms that the dsRNAs coding for 3 target genes was significantly more effective when presented in a single concatamerized form rather than as a mixture of 3 individual dsRNAs, even though the equimolar amount remains the same.
  • Example 6 Assessing tricatemer's ability to cause gene knockdown of all three targets in V. destructor
  • Mites were sampled 72hours after treatment with either dsRNA-GFP or dsRNA-tricatemer, placed in 10 ⁇ RNAseLater and kept at -80°C until use. Mites removed from RNAse later, washed briefly in cold PBS and homogenised with plastic pestles under 800 ⁇ RNA lysis buffer. Samples were further homogenised by repeatedly passing debris and tissue through 23 gauge needles attached to 1 ml syringes. Mites were then processed according to ZR Tissue & Insect RNA MicroPrep Kit (Zymogen), DNAse-treated with RQ1 (Promega) and eluted in 10 ⁇ RNAse-free water.
  • RNA concentration of targets was measured by Nanodrop ND-1000 and 0.25 ⁇ g RNA for each sample was used in reverse transcription reactions with oligo-dt and Bioscript (Bioline). Resultant cDNA was again measured by Nanodrop-100.
  • Relative expression qPCR was carried out on an Opticon 2 Engine (Biorad) by Sybr-green detection using reaction mix of 12.5 ⁇ Immolase DNA polymerase (Bioline), 10.5 ⁇ water, 1 ⁇ (1 ng/ ⁇ ) of template cDNA and 1 ⁇ (2mM) of the respective target or actin, used as a normalising reference gene.
  • Primers (Table 1 1) were designed to hybridise to sequences of the cDNA that were external to the region of the dsRNA, thereby amplifying cDNAs derived from varroa mRNA but not amplifying the dsRNA itself.
  • Example 7 Assessing tricatemer's ability to kill mites and its effectiveness relative to MOA, AChE and vATPc singly or in combination
  • the tricatemer proved to be particularly effective at both 1.25 and 3.75 g/ ⁇ concentrations.
  • the tricatemer at 3.75 g/ ⁇ resulted in very high mite mortality with low variation.
  • Variation for the tricatemer at 1.25 ⁇ 9/ ⁇ also showed very high mite mortality, but with much higher variation due to a restriction on the number of replicates which could be performed (limited mite numbers). It is anticipated that subsequent replicates will reduce the observed variation. Even without additional replicates, the tricatemer led to significant mite mortality, as described in more detail below.
  • the tricatemer was significantly more effective than the singly targeted AChE and vATPc dsRNAs (ds RNAs at1.25 Mg/ ⁇ ; P ⁇ 0.05); at 3.75 Mg/ ⁇ the tricatemer was also significantly more effective than the singly targeted MOA dsRNA (ds RNA at1.25 ⁇ 9/ ⁇ ; PO.07).
  • the tricatemer at 3.75 ⁇ 9/ ⁇ was significantly more effective than the 3.75 ⁇ 9/ ⁇ mixture of MOA + AChE + vATPc (P ⁇ 0.05; Fig. 8). Consistent with the increased potency of the tricatemer versus a mixture of dsRNAs, the 3.75 ⁇ 9/ ⁇ mixture of MOA + AChE + vATPc is not significantly better than the tricatemer at 1.25 ⁇ 9/ ⁇ , despite having a three-fold higher dsRNA concentration. Indeed, the tricatemer at 1.25 ⁇ 9/ ⁇ causes significantly more lethality than the 3.75 ⁇ 9/ ⁇ mixture of MOA + AChE + vATPc (P ⁇ 0.125).
  • the reported 61 % reduction in mite population was recorded at the end of a 60-day trial period during which mites were exposed to a dsRNA mix containing 14 V .destructor sequences.
  • the 60-day trial period allowed for two reproductive cycles of V. destructor, and the authors of Garbain et al. 2012 did not directly measure V .destructor mite mortality; thus, the 61 % figure represents the combined effects of mortality and reduced fecundity over two generations of V .destructor mite.
  • Example 8 Comparing levels of gene knockdown achieved by the tricatemer relative to a mixture of MOA, AChE and vATPc singly or in combination
  • the level of gene expression in mites treated with dsGFP (1.25 Mg/ ⁇ ), the dsRNA mixture (3.75 g/ ⁇ ) and the dsRNA tricatamer (both 1.25 and 3.75 ⁇ 9/ ⁇ ) was determined.
  • Example 9 Aedes aegypti ' soaking methods using the ⁇ -tubulin, Na+/K+-ATPase-g and ADP/ATPt tricatamer
  • fragments of Aedes aegypti ⁇ -tubulin (XM_001655975.1), Na + /K + - ATPase alpha subunit (XM_001662168.1) and A DP/ATP translocase (XM_001649861.1) were amplified from A. aegypti cDNA and then conjoined into a tricatemer by appropriate Gibson assembly primers. The resultant tricatmer was inserted into L4440 plasmid and then transformed into E. coli HT1 15(DE3). Tricatemer was produced by the E. coli HT1 15(DE3)- L4440, purified and quantified as described above and diluted to appropriate concentration in preparation for efficacy testing in mortality studies against A. aegypti larvae.
  • Aedes aegypti were maintained in netted boxes in a secure insectary at 28°C, 40%RH, on a 16:8 L:D photoperiod.
  • Females to be fed warmed sheep blood encased in stretched parafilm M (Pechiney, USA).
  • Mosquito eggs to be allowed to develop to larval stage and then maintained on a ground liver powder and fish food.
  • Larvae were soaked in the dsRNA solutions for 2 hr at 21 ° C, transferred to 48-well tissue culture plates (also maintained at 21 ° C) and provided 5 mg/ml lab rat diet (Purina Mills, www.purinamills.com) suspended in water as a source of food on a daily basis. Survival and pupation rates of the larvae were monitored daily. Treatment effects were determined by ANOVA followed by pairwise comparisons by Fisher's LSD.
  • Example 10 Lepeophtheirus salmonis soaking methods using the ATPt, vATP, AChE tricatamer
  • Fresh copepodids (20 individuals) to be removed from aerated beakers and placed in 1 ml eppendorf tubes in 75ul sterile sea water along with 10ul (1 ug/ul) of either a mixture of three individual dsRNAs (PMCA, Na + /K + -ATPase-a, and ADP/ATPt, total 1.0 ⁇ / ⁇ ) dsRNA- tricatemers at 1.0 ⁇ 9/ ⁇ and left at 4'C for 7h.
  • Example 11 Caenorhabditis elegans feeding methods using the egl-30, pat-10, and bli-5 tricatamer
  • MOA target sequence is shown in BOLD text
  • V-ATPase target sequence is shown in ITALIC text
  • AChE target sequence is shown in UNDERLINED text
  • Target sequence SEQ ID NO. 8 Target sequence is shown in BOLD UNDERLINED text
  • SERCA /endoplasmic reticulum type
  • ADP target sequence is shown in UNDERLINED text
  • Target sequence is shown in BOLD text and flanked by primer sequences, which are UNDERLINED
  • Target sequence is shown in BOLD text and flanked by primer sequences, which are UNDERLINED
  • GENE - Aedes aegypti ADP/ATP carrier protein (AaADP)
  • Target sequence is shown in BOLD text and flanked by primer sequences, which are UNDERLINED
  • AaNaK target sequence is shown in ITALIC text
  • AaADP target sequence is shown in UNDERLINED text
  • Target sequence is shown in BOLD text and flanked by primer sequences, which are UNDERLINED
  • Target sequence is shown in BOLD text and flanked by primer sequences, which are UNDERLINED
  • LsAChE GENE Lepeophtheirus salmonis acetylcholinesterase
  • Target sequence is shown in BOLD text and flanked by primer sequences, which are UNDERLINED
  • Target sequence is shown in BOLD text and flanked by primer sequences, which are UNDERLINED
  • Target sequence is shown in BOLD text and flanked by primer sequences, which are UNDERLINED
  • Target sequence is shown in BOLD text and flanked by primer sequences, which are UNDERLINED

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present disclosure relates to nucleic acid agents for the simultaneous down-regulation of multiple gene targets. Compositions comprising the nucleic acid agents and methods for using the agent to target specific cell populations, such as those of the parasite in a host/parasite relationship, are also disclosed.

Description

ENHANCED RNAi MEDIATED GENE REGULATION
TECHNICAL FIELD
The present invention relates to nucleic acid agents for the simultaneous down-regulation of multiple gene targets. Compositions comprising the nucleic acid agents and methods for using the agent to target specific cell populations, such as those of the parasite in a host/parasite relationship, are also disclosed.
BACKGROUND
RNA interference
RNAi is an RNA-dependent gene silencing process that is controlled by the RNA-induced silencing complex (RISC) and is initiated by short double-stranded RNA molecules in a cell's cytoplasm, where they interact with the catalytic RISC component argonaute.
When the dsRNA is exogenous (for example, coming from infection by a virus with an RNA genome), the RNA is imported directly into the cytoplasm and cleaved to short fragments by the argonaute enzyme.
The initiating dsRNA can also be endogenous (originating in the cell), as in pre-microRNAs expressed from RNA-coding genes in the genome. The primary transcripts from such genes are first processed to form the characteristic stem-loop structure of pre-miRNA in the nucleus, then exported to the cytoplasm to be cleaved by Dicer. Thus, the two dsRNA pathways, exogenous and endogenous, converge at the RISC complex. dsRNA initiates RNAi by activating the ribonuclease protein Dicer, which binds and cleaves double-stranded RNAs (dsRNAs) to produce double-stranded fragments of 20-25 base pairs with a 2-nucleotide overhang at the 3' end. Bioinformatics studies on the genomes of multiple organisms suggest this length maximizes target-gene specificity and minimizes nonspecific effects. These short double-stranded fragments are called small interfering RNAs (siRNAs). These siRNAs are then separated into two single-stranded (ss) ssRNAs, namely the passenger strand and the guide strand. The passenger strand is degraded, and the guide strand is incorporated into the RNA-induced silencing complex (RISC). After integration into the RISC, siRNAs base-pair to their target mRNA and induce cleavage of the mRNA, thereby preventing it from being used as a translation template. In some organisms, this process is known to spread systemically, despite the initially limited molar
concentrations of siRNA. A key feature required for the RNAi effect is a short stretch (-21 nucleotides) of duplex RNA having 100% sequence identity to the downregulated mRNA. Any nucleic acid which will be processed into, or lead to the generation of, an siRNA with this feature can lead to RNAi suppression of the target mRNA. Thus in addition to dsRNA (which is processed into siRNA by the activity of Dicer and the RISC complex), short hairpin RNAs (shRNAs) and some miRNAs may also initiate RNAi suppression.
As an investigative tool, RNAi is becoming an ever more powerful for determining the functional role of specific genes that may be potential targets for chemotherapeutic intervention. It is a particularly useful method since the RNAi gene silencing mechanism appears to be present in all eukaryotic organisms. Thus ubiquity combined with relative ease of application means that RNAi is not only an important tool in modern cell biology research but also has potential beyond the laboratory to the clinic and other applied areas.
One field in which RNAi shows particular promise is in targeting cells within a mixed population, wherein the targeted cells are distinguished from the general population of cells by the identity of the genes, or gene combination, they express.
Pest / Parasite control uses of RNAi
One use of RNAi's selectivity is in pest / parasite control, where the sequence specificity of RNAi coupled with its ability to suppress genes critical for pest survival allow the
development of targeted pesticides able to kill the pest or parasite without adversely affecting non-target species or hosts.
Gene knockdown by long double-stranded (dsRNA) has been demonstrated in over 30 insect, tick and mite species (Aronstein et al., 201 1), many parasitic worms (Geldhof et al., 2007), economically important copepods such as sea lice (Campbell et al. 2009) and medically important protozoa such as Trypanosome spp., Entoamoeba histolytica, Giardia intestinalis and Toxoplasma gondii (Kolev et al., 2011). The possibility of suppression of critical genes by RNAi in these pests and parasites, thus causing pest death without harming host and non-target species holds great potential. Delivery systems for dsRNAs to pests include spraying on plants, delivery in food, and engineering transgenic plants to produce the dsRNA.
The use of RNAi to target the Varroa destructor parasitic mite of Apis mellifera honey bees has been documented in Garbian et al., 2012. In the assays described in that reference, the authors prepare two separate mixtures of dsRNA, with 'Mixture Γ containing a mixture of dsRNAs corresponding to five different V.destructor gene sequences, and 'Mixture ΙΓ containing a mixture of dsRNAs corresponding to fourteen different V.destructor gene sequences. Upon feeding bees with sucrose solution containing one or other of these mixtures, the authors noted mortality in the V.destruct or mites parasitizing the fed A.mellifera bees.
'Mixture ΙΓ is reported as being the most efficacious mixture, with the highest reported mortality recorded at the end of a 60-day trial period being 61 %. The 60-day trial period allowed for two reproductive cycles of V.destructor, and the authors did not directly measure V.destructor mite mortality; thus, the 61 % figure represents the combined effects of mortality and reduced fecundity over two generations of V.destructor mite.
Medical uses of RNAi
Within the medical field, major pharmaceutical companies initially invested several billion dollars in RNAi therapeutics, but the initial optimism failed to deliver the promise. However, recently there has been a renewed optimism and investment in RNAi therapeutics following refinements in RNAi targeting and delivery for liver-based diseases, viral infections, cancer and more (Bender 2014)
DISCLOSURE
The present inventors have developed an improved method dsRNA delivery technology for inducing the RNAi-mediated down-regulation of multiple genes. As compared to existing technology for delivering multiple dsRNAs, the improved technology described herein leads to a significant increase in the mortality rates of the target cell or organism population.
When using RNAi to target a cell or organism population it is desirable to maximise the mortality rate in the targeted population. Existing methods have used a number of strategies to increase the observed mortality. For example, the authors of Garbian et al. 2012 describe selecting V.destruct or target genes involved in key cellular processes such as cell architecture (alpha tubulin) and DNA transcription (RNA polymerase), the silencing of which was expected to harm the Varroa mites. The authors of Garbian et al. 2012 also describe the importance of selecting target sequences within the V.destructor genes which do not correspond to any A.melliifera (i.e. the host) or human genes, so as to prevent any off-target gene silencing. In addition to selecting target genes involved in key cellular processes, the authors of Garbian et al. 2012 also co-administered dsRNA corresponding to multiple target genes with the aim of increasing the total mortality levels through simultaneously inhibiting multiple cellular pathways. Consistent with this, Garbian et al. 2012 reported that a mixture of 14 dsRNAs ("Mixture II") caused a significant decrease in Varroa destructor mite number when fed to bees, but a mixture of 5 dsRNAs ("Mixture I") did not.
Notwithstanding the Garbain et al. data from V. destructor, studies in other experimental systems indicate that there is not a consistent or simple relationship between the number of simultaneously targeted genes and the observed level of mortality. For example, studies in both the soybean plant parasitic nematode Heterodera glycines (Bakhetia et al., 2008) and the red flour beetle Tribolium castaneum (Miller et al., 2012) have demonstrated that treatment with multiple dsRNAs can, in fact, reduce the efficacy of gene knockdown.
This potential for reduced efficiency of gene knockdown in combinatorial or multi-target dsRNA treatments has been documented in other studies (Aronstein et al., 201 1 ; Bakhetia et al., 2008; Charlton et al., 2010). A possible explanation for this effect has been put forward in Miller et al. (2012) based on carefully controlled competition studies in T. castaneum; the authors interpreted the results of these experiments as indicating that the decreased gene knockdown efficiency in multiple dsRNAs studies was due to cellular uptake competition. That is, the oversaturation of both the cellular uptake process and the intracellular dsRNAi machinery by multiple dsRNAs delivered simultaneously reduced the overall efficiency of gene knockdown.
The effects of multi-target dsRNA treatments is also described in WO2006/046148, whose authors describe the effects on C.elegans of simultaneously delivering dsRNA targeting up to 2 different genes (see, for example, Example 5 and Figure 28 of W02006/046148). The data in W02006/046148 indicates that dsRNA mixtures lead to significantly higher progeny mortality than individually delivered dsRNAs, but do not clearly show any significant difference between mixtures and concatamers. No lethality on the treated target organisms is reported - only progeny of treated organisms are examined.
The present inventors have developed an improved delivery technology for down-regulating multiple genes using RNAi. The improved technology does not exhibit the reduced efficacy of gene knockdown observed with some of the dsRNA delivery technologies described in the art. Furthermore, dsRNA delivered by the improved technology has been demonstrated to result in a significantly higher target mortality in the treated animals than an equivalent dose of dsRNA delivered by conventional means.
The improved technology is based on the insight that when targeting multiple genes higher target mortality can be achieved if the dsRNAs corresponding to each target gene are administered to the target as a concatemer, rather than as a mixture of separate dsRNAs. So, for example, if the genes Ά', 'Β', and 'C are to be targeted, higher target mortality can be achieved by administering the dsRNA[A-B-C] than administering the same total amount of dsRNA as a mixture of dsRNA[A] + dsRNA[B] + dsRNA[C].
In addition to allowing for higher target mortality, producing a single dsRNA concatemer is typically simpler and less expensive than producing an equivalent mixture of separate dsRNAs.
Without wishing to be bound by theory, it is believed that the higher target mortality is at least partially because the concatemer structure enforces simultaneous down-regulation of all the targeted genes within each target cell (or cell within a target organism) that takes up a dsRNA molecule. That is, a cell which takes up a dsRNA[A-B-C] molecule will experience simultaneous down-regulation of genes Ά', 'Β', and 'C, with the cumulative damage arising from the inhibition of multiple cellular processes multiplying the likelihood of cell death.
In contrast, to achieve a similar multiple process inhibition using a mixture of dsRNA[A] + dsRNA[B] + dsRNA[C], a target cell (or cell within a target organism) must take up each of the separate dsRNA molecules. This is true for each target cell (or cell within a target organism). Thus, even if each dsRNA is present in the mixture at equal concentration, it is unlikely that each target cell will take up an equal proportion of each dsRNA. Differences between the transport and/or uptake of the different dsRNAs will further magnify this uneven distribution of the dsRNA within the target cells. It can be envisioned that the overall effect of this less even distribution of dsRNAs is a reduced level of cumulative damage in individual cells and, therefore, a lower proportion of cell death.
Again, without wishing to be bound by theory, it is believed that the concatemer structure places a lower burden on the cellular dsRNA transport system. That is, for example, only concatemer dsRNA molecule (i.e. dsRNA[A-B-C]) needs to be taken up to achieve down- regulation of genes Ά', 'Β', and 'C. To achieve the same effect with a mixture, three dsRNA molecules must be taken up (i.e. dsRNA[A] + dsRNA[B] + dsRNA[C]). Thus, at saturating concentrations the concatemer can be expected to lead to more effective gene knockdown. Accordingly, in one aspect the present invention provides an isolated nucleic acid concatemer comprising at least a first nucleic acid sequence and a second nucleic acid sequence;
wherein the first nucleic acid sequence is capable of down-regulating the expression of a first gene of a target, and the second nucleic acid sequence is capable of down- regulating the expression of a second gene of the target. Preferably the first and second genes are different genes.
The term "isolated nucleic acid concatemer" is used herein to refer to a two or more nucleic acid sequences capable of down-regulating gene expression which have been joined ('concatenated') such that they form a single, contiguous nucleic acid molecule. In this sense the term "isolated nucleic acid concatemer" is intended to refer to concatenates not naturally occurring in nature. Preferably each of the constituent nucleic acid sequences of an "isolated nucleic acid concatemer" targets a different gene such that the concatemer is capable of down-regulating the expression of at least two different genes simultaneously.
Typically, the constituent nucleic acid sequences of an isolated nucleic acid concatemer are found sequentially on the nucleic acid molecule with only short, or no, intervening sequence ('spacer sequence') between the sequences capable of down-regulating gene expression. In some embodiments there is no more than 500 base pairs of spacer sequence between each sequence capable of down-regulating gene expression, such as no more than 400, 300, 200, 100, 50, 20, 10 or 5 base pairs of spacer sequence.
An example of an "isolated nucleic acid concatemer" is shown in Figure 10. In this Figure, an isolated nucleic acid concatemer according to the present description extends from the first base of MOA (base 1395) to the last base of AChE (base 2355) to give a total concatemer length of 960 bases. The concatemer is composed of three nucleic acid sequences capable of down-regulating the expression (marked MOA, ATP, AChE) which are arranged sequentially on the nucleic acid molecule with no spacer sequences. This isolated nucleic acid concatemer is capable of down-regulating three genes (MOA, vATPc, AChE) simultaneously (see Figure 9; in this example, the target is the Varroa destructor mite). Such a concatemer consisting of three nucleic acid sequences capable of down-regulating the expression genes is herein called a "tricatemer". Thus, in one aspect the present invention provides an isolated nucleic acid concatemer comprising at least a first nucleic acid sequence, a second nucleic acid sequence, and a third nucleic acid sequence;
wherein the first nucleic acid sequence is capable of down-regulating the expression of a first gene of a target, the second nucleic acid sequence is capable of down-regulating the expression of a second gene of the target, and the third nucleic acid sequence is capable of down-regulating the expression of a third gene of the target. Preferably the first, second and third genes are different genes.
In a further aspect the present invention provides an isolated nucleic acid concatemer comprising at least a first nucleic acid sequence, a second nucleic acid sequence, a third nucleic acid sequence, and a fourth nucleic acid sequence;
wherein the first nucleic acid sequence is capable of down-regulating the expression of a first gene of a target, the second nucleic acid sequence is capable of down-regulating the expression of a second gene of the target, the third nucleic acid sequence is capable of down-regulating the expression of a third gene of the target, and the fourth nucleic acid sequence is capable of down-regulating the expression of a fourth gene of the target.
Preferably the first, second, third and fourth genes are different genes.
In a yet further aspect the present invention provides an isolated nucleic acid concatemer comprising at least a first nucleic acid sequence, a second nucleic acid sequence, a third nucleic acid sequence, a fourth nucleic acid sequence, and a fifth nucleic acid sequence; wherein the first nucleic acid sequence is capable of down-regulating the expression of a first gene of a target, the second nucleic acid sequence is capable of down-regulating the expression of a second gene of the target, the third nucleic acid sequence is capable of down-regulating the expression of a third gene of the target, the fourth nucleic acid sequence is capable of down-regulating the expression of a fourth gene of the target, and the fifth nucleic acid sequence is capable of down-regulating the expression of a fifth gene of the target. Preferably the first, second, third, fourth and fifth genes are different genes.
In a yet further aspect the present invention provides an isolated nucleic acid concatemer comprising at least a first nucleic acid sequence, a second nucleic acid sequence, a third nucleic acid sequence, a fourth nucleic acid sequence, a fifth nucleic acid sequence, and a sixth nucleic acid sequence;
wherein the first nucleic acid sequence is capable of down-regulating the expression of a first gene of a target, the second nucleic acid sequence is capable of down-regulating the expression of a second gene of the target, the third nucleic acid sequence is capable of down-regulating the expression of a third gene of the target, the fourth nucleic acid sequence is capable of down-regulating the expression of a fourth gene of the target, the fifth nucleic acid sequence is capable of down-regulating the expression of a fifth gene of the target, and the sixth nucleic acid sequence is capable of down-regulating the expression of a sixth gene of the target. Preferably the first, second, third, fourth, fifth and sixth genes are different genes.
Further concatemers comprising seven, eight, nine, ten, fifteen, twenty or more than twenty nucleic acid sequences are envisaged (preferably capable of, respectively, down-regulating the expression of two, three, four, five, six, seven, eight, nine, ten, fifteen, twenty or more than twenty different genes of the target).
Target organisms for gene down-regulation
The present inventors have found that the concatemers described herein are consistently more effective than the equivalent dsRNAs delivered as a mixture. Furthermore, the increased effectiveness of the concatemer relative to the corresponding mixture appears to be independent of the identity of the specific genes, or the species of the target. This independence is consistent with the postulated theory underpinning the present invention, as well as the known presence of dsRNA-mediated gene silencing (RNAi) mechanisms in many eukaryotic organisms.
Accordingly, the 'target' whose gene expression is down regulated by the isolated nucleic acid concatemers described herein may be any cell or organism capable of
dsRNA-mediated gene silencing.
In some embodiments the target is an organism. In some embodiments the target is a member of the Acari subclass. In some embodiments the target is a member of the
Arthropoda phylum, for example a member of the Insecta class (such as a member of the order Coleoptera).
In some embodiments the target is not the Varroa destructor mite. In some embodiments the target is not the Caenorhabditis elegans nematode.
For example, the target may be a pest organism such as Tribolium castaneum or Aedes aegypti.
In some embodiments the target is a cell, or population of cells. For example, a human tumour cell. The target cell or population of cells may be in vivo, ex vivo, or in vitro. In some embodiments the target is an organism (or a cell or population of cells derived therefrom) listed in any one of Tables 'A' to Έ'.
Figure imgf000010_0001
Table A
Figure imgf000010_0002
Table B COMMON NAME LATIN NAME
Honey bee mite Varroa destructor
Greater wax moth Galleria mellonella
Lesser Wax moth Achroia grisella
Small hive beetle Aethina tumida
Acarine (Tracheal) mites
Acarapis woodi
Tropilaelaps Tropilaelaps clareae
Nosema Nosema apis
Noseama Nosema ceranae
Table C
Figure imgf000011_0001
Table D COMMON NAME LATIN NAME
Sleeping disease Trypanosma brucei
Chagas disease Trypanosma cruzi
Entamoeba histolytica
Toxoplasmosis Toxoplasma gondi
Giardiasis Giardia intestinalis
Table E
In some embodiments the target is not Varroa destructor, or a cell or population of cells derived therefrom.
More generally, in one aspect it is envisioned that any embodiment described herein in which the target is Varroa destructor is not encompassed by the present invention.
Furthermore. In one aspect it is envisioned that any embodiment described herein in which or the first, second, third, and/or further genes are Varroa destructor genes is not encompassed by the present invention
Target genes for down-regulation
As noted above, the increased effectiveness of the concatemer relative to the corresponding mixture appears to be independent of the identity of the specific genes. Nonetheless, for applications where the aim is toxicity to the target, a typical strategy is to select genes with functions in key cellular processes such as cell architecture (for example, alpha tubulin), DNA transcription (for example, RNA polymerase), or energy generation / gradient maintenance (Pyruvate kinase, vacuolar ATPase). The silencing of a number of these genes within a target can be expected to harm the target.
Accordingly, in some embodiments the first and/or second gene and/or third gene (if present) and/or fourth gene (if present) and/or fifth gene (if present) and/or sixth gene (if present) are selected from the group consisting of the genes which encode: Na+/K+- ATPase (any of the subunits), Vacuolar ATPase (proton pump; any of the subunits), Plasma membrane Calcium ATPase (PMCA), Sarcoplasmic reticulum Ca2+ ATPase (SERCA), ADP/ATP- translocase, Sodium-glucose linked transporter, Trehalase, Pyruvate
dehydrogenase, Pyruvate kinase, Pyruvate carboxylase, Tubulin, Monoamine oxidase, Acetylcholinesterase, Phosphodiesterase. In some embodiments all of the first and second gene (and third gene, if present) are selected from the above group. In some embodiments the target is the V.destructor organism and the first and/or second gene (and/or third gene, if present) are selected from the group consisting of the genes which encode: Acetylcholinesterase (AChE; GenBank accession number
ADDG01069748.1), Monoamine Oxidase (MOA; GenBank accession number
ADDG01053234.1), and vATPase subunit C (vATPc; GenBank accession number
ADDG01035752.1. Preferably all of the first and second gene (and third gene, if present) are selected from the above group.
In some embodiments the target is the V.destructor organism and the first and/or second nucleic acid sequence (and/or third nucleic acid sequence, if present) comprises a nucleic acid sequence that has 100% sequence identity to at least 18 contiguous nucleotides (such as at least 21 , 25, 30, 50, 100, 200, or 500 nucleotides) encoded by a sequence selected from the group consisting of SEQ ID N0.1 , SEQ ID NO.2, and SEQ ID NO.3. Preferably the first or second nucleic acid sequence is SEQ ID NO.2. In some embodiments, all of the first and second nucleic acid sequence (and third nucleic acid sequence, if present) are selected from the above group.
In some embodiments the target is the T.castaneum organism and the first and/or second gene and/or third gene (if present) and/or fourth gene (if present) and/or fifth gene (if present) and/or sixth gene (if present) are selected from the group consisting of the genes which encode: Plasma membrane calcium-transporting ATPase 1 (TcPMCA; NCBI accession number XM_008201630.1), Na/K ATPase alpha (TcNaK; NCBI accession number XM_008198203.1), A DP/ATP translocase (TcADPt; NCBI accession number XM_968164.3) , vATPase subunit E (TcvATPe; NCBI accession number XM_965528.2), Calcium-transporting ATPase sarcoplasmic /endoplasmic reticulum type (TcSERCA; NCBI accession number XM_961690.3), a-tubulin 1 (TcaTUB; NCBI accession number
XP_966492.1), and Heat shock protein 90 (TcHSP90; NCBI accession number
NP_001094067.1). Preferably all of the first and second gene (and third gene, if present) are selected from the above group. In some embodiments the first, second, and third genes are selected from the combinations: (i)TcPMCA, TcNaK, TcADPt, (ii) TcPMCA, TcNaK, TcvATPe, (iii) TcaTUB, TcHSP90, TcADPt, and (iv) TcaTUB, TcHSP90, TcvATPe.
In some embodiments the target is the T.castaneum organism and the first and/or second nucleic acid sequence and/or third nucleic acid sequence (if present) and/or fourth nucleic acid sequence (if present) and/or fifth nucleic acid sequence (if present) and/or sixth nucleic acid sequence (if present) comprises a nucleic acid sequence that has 100% sequence identity to at least 18 contiguous nucleotides (such as at least 21 , 25, 30, 50, 100, 200, or 500 nucleotides) encoded by a sequence selected from the group consisting of SEQ ID NO.8, SEQ ID NO.9, SEQ ID N0.113, SEQ ID NO.10, SEQ ID NO.1 1 , SEQ ID N0.12, SEQ ID NO.13, and SEQ ID NO.14. In some embodiments, all of the first and second nucleic acid sequence (and third nucleic acid sequence, if present) are selected from the above group. In some embodiments the first, second, and third genes are selected from the combinations: (i) SEQ ID NO.8, 9, and 10, (ii) SEQ ID NO.8, 9, and 11 , (iii) SEQ ID N0.13, 14, and 10, (iv) SEQ ID N0.13, 14, and 1 1 , (v) SEQ ID NO.8, 1 13, and 10, and (vi) SEQ ID NO.8, 113, and 11.
In some embodiments the target is the A.aegypti organism and the first and/or second gene (and/or third gene, if present) are selected from the group consisting of the genes which encode: Tubulin beta chain (AabTub; NCBI accession number XM_001662168.1), Na/K ATPase alpha subunit (AaNaK; NCBI accession number ADDG01053234.1), and A DP/ATP carrier protein (AaADPt; NCBI accession number XM_001649861.1). Preferably all of the first and second gene (and third gene, if present) are selected from the above group.
In some embodiments the target is the A.aegypti organism and the first and/or second nucleic acid sequence (and/or third nucleic acid sequence, if present) comprises a nucleic acid sequence that has 100% sequence identity to at least 18 contiguous nucleotides (such as at least 21 , 25, 30, 50, 100, 200, or 500 nucleotides) encoded by a sequence selected from the group consisting of SEQ ID NO.19, SEQ ID NO.20, and SEQ ID NO.21. In some embodiments, all of the first and second nucleic acid sequence (and third nucleic acid sequence, if present) are selected from the above group.
In some embodiments the target is the L.salmonis organism and the first and/or second gene (and/or third gene, if present) are selected from the group consisting of the genes which encode: A DP/ATP translocase 1 (LsADPt; NCBI accession number BT077972.1), V- type ATPase unit E (LsvATPe; NCBI accession number BT120776.1), and
acetylcholinesterase (LsAChE; NCBI accession number KJ132369.1). Preferably all of the first and second gene (and third gene, if present) are selected from the above group.
In some embodiments the target is the L.salmonis organism and the first and/or second nucleic acid sequence (and/or third nucleic acid sequence, if present) comprises a nucleic acid sequence that has 100% sequence identity to at least 18 contiguous nucleotides (such as at least 21 , 25, 30, 50, 100, 200, or 500 nucleotides) encoded by a sequence selected from the group consisting of SEQ ID N0.23, SEQ ID N0.24, and SEQ ID N0.25. In some embodiments, all of the first and second nucleic acid sequence (and third nucleic acid sequence, if present) are selected from the above group.
In some embodiments the target is the C.elegans organism and the first and/or second gene (and/or third gene, if present) are selected from the group consisting of the genes which encode: pat-10 (NCBI accession number NM_059100.6), bli-5 (NCBI accession number NM_067371.1), and egl-30 (NCBI accession number U56864.1). Preferably all of the first and second gene (and third gene, if present) are selected from the above group.
In some embodiments the target is the C.elegans organism and the first and/or second nucleic acid sequence (and/or third nucleic acid sequence, if present) comprises a nucleic acid sequence that has 100% sequence identity to at least 18 contiguous nucleotides (such as at least 21 , 25, 30, 50, 100, 200, or 500 nucleotides) encoded by a sequence selected from the group consisting of SEQ ID N0.27, SEQ ID N0.28, and SEQ ID N0.29. In some embodiments, all of the first and second nucleic acid sequence (and third nucleic acid sequence, if present) are selected from the above group.
Concatemers and constructs
Concatemers according to the present invention will be recombinant and may be provided isolated and/or purified, in substantially pure or homogeneous form, or free or substantially free of other nucleic acid. The term "isolated" encompasses all these possibilities.
Concatemers may be ribonucleic acids or deoxy ribonucleic acids. In some embodiments the concatemer is a dsRNA, such as siRNA, shRNA or miRNA. In other embodiments the concatemer is antisense RNA, or a ribozyme.
Since nucleic acid may be double stranded, where the concatemer (or nucleotide sequence) of the invention is referred to herein, use of the complement of that nucleic acid agent (or nucleotide sequence) will also be embraced by the invention. The 'complement' in each case is the same length as the reference, but is 100% complementary thereto whereby by each nucleotide is base paired to its counterpart i.e. G to C, and A to T or U.
In some embodiments the total length of the nucleic acid concatemer is less than 10,000 bases (or base pairs) long. For example, in some embodiments the nucleic acid concatemer is less than 5000 bases long, such as less than 4000, 3000, 2000, 1500, 1000, 500, 400, 300, 200 or less than 100 bases (or base pairs) long. In some embodiments the nucleic acid concatemer is less than 950 bases long, such as less than 900, 850, 800, 750, 700, 650, 600, 550, 500, 450, 400, 300, 250, 200, 150, 100 or less than 50 bases long.
In some embodiments the total length of the nucleic acid concatemer greater than 500 bases (or base pairs) long, such as greater than 600, 700, 800, 900, or greater than 1000 base pairs long.
In preferred embodiments the total length of the nucleic acid concatemer is 501 to 2000 bases (or base pairs) long, such as 600 to 1800, 700 to 1600, or 750 to 1500 bases.
(The "total length of the concatemer" as used herein is measured from the first base of the 5'-most sequence capable of down-regulating gene expression to the last base of the 3'- most sequence capable of down-regulating gene expression.)
The present invention also provides nucleic acid constructs (for example, DNA constructs) encoding concatemers according to the present invention. Such vectors may include, in addition to the sequence encoding the concatemer of the invention, a promoter, a terminator and/or other regulatory sequence such as to define an expression cassette comprising the sequence encoding the nucleic acid agent of the invention. The sequence of some vectors according to the present invention are shown in SEQ ID NOs. 4, 15, 22, and 26.
Generally speaking, in the light of the present disclosure, those skilled in the art will be able to construct vectors according to the present invention. For further details see, for example, Molecular Cloning: a Laboratory Manual: 2nd edition, Sambrook et al, I989, Cold Spring Harbor Laboratory Press. Many known techniques and protocols for manipulation of nucleic acid, for example in preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, and analysis of proteins, are described in detail in Protocols in Molecular Biology, Second Edition, Ausubel et al. eds., John Wiley & Sons, 1992.
Genes and gene expression
"Gene of a/the target" is a term used to mean a coding sequence in the genome of the target organism or cell which is, or may be, expressed as a functional gene product. For example, via transcription to mRNA and translation to a protein according to well established principles.
Expression of a gene is a term used to describe the process by which the information from, a gene is used to synthesise a gene product, such as an mRNA or polypeptide.
"Capable of downregulating the expression" is a term generally used to refer to the ability to reduce the levels of a gene product in response to the presence of the agent. Reduction is measured compared to an otherwise identical gene expression system which has not been exposed to the agent in question. The degree of reduction may be so as to totally abolish production of the encoded gene product, but may also be such that the abolition of expression is not complete, with some small degree of expression remaining. The term should not therefore be taken to require a complete absence of expression. It is used herein where convenient because those skilled in the art well understand this. Examples of downregulated expression are (i) reduced transcription of the gene, (ii) reduced mRNA amount, stability or translatability, and (iii) reduced amount of polypeptide product.
The ability to downregulate expression can be assayed, for example, via direct detection of gene transcripts (e.g. via PCR) or polypeptides (e.g. via Western blot), via polypeptide activity (e.g. enzyme activity) or via observation of target behaviour (e.g. via cell/organism mortality). Thus, whether a particular agent inhibits translation of mRNA, or induces degradation of mRNA, can be readily assayed using the above methods, or other methods well-known in the art. In some embodiments, translation of an mRNA is considered
"inhibited" if the amount of expressed protein is at least 10% lower than in an otherwise identical system not exposed to the agent; for example, at least 20% lower, at least 30% lower, at least 40% lower, at least 50% lower, at least 60% lower, at least 70% lower, at least 80% lower, or at least 90% lower than in an otherwise identical system not exposed to the agent. Similarly, in some embodiments, degradation of mRNA is "induced" if the amount of mRNA (μ9/μΙ) is at least 10% lower than in an otherwise identical system not exposed to the agent; for example, at least 20% lower, at least 30% lower, at least 40% lower, at least 50% lower, at least 60% lower, at least 70% lower, at least 80% lower, at least 90% lower, at least 95% lower, at least 98% lower, or at least 99% lower than in an otherwise identical system not exposed to the agent.
Thus, in some embodiments the mRNA levels of the targeted genes in treated target cells / organisms is at least 10% lower than in targets treated with a control agent (for example, GFP dsRNA). For example, mRNA levels ^/μΙ) of the targeted genes may be at least 20% lower, at least 30% lower, at least 40% lower, at least 50% lower, at least 60% lower, at least 70% lower, at least 80% lower, at least 90%, at least 95%, at least 98%, or at least 99% lower than in mites treated with a control agent (for example, GFP dsRNA).
In some embodiments the amount of protein or mRNA is measured 24 hours after the system is first exposed to the agent. In other embodiments the amount of protein or mRNA is measured 48 or 72 hours after the system is first exposed to the agent, composition or concatemer.
In preferred embodiments, the mRNA levels of the targeted genes in treated target cells / organisms is at least 95% lower than in mites treated with a control agent (for example, GFP dsRNA) 72 hours after exposure to the agent, composition or concatemer.
Target mortality
The effectiveness of the isolated nucleic acid concatemer disclosed herein, for example in methods of inhibiting the growth of, or reducing, a population of a target, may be assessed by monitoring the % mortality of the population of the target treated with the nucleic acid concatemer.
For example, in some embodiments the nucleic acid agent causes greater than 30% target mortality (= less than 70% target survival), as measured, for example, 108 hours after a 12 hour soaking of the target in a 1.25 g/μΙ solution of the nucleic acid concatemer. In some embodiments the nucleic acid agent causes greater than 40% target mortality, such as greater than 50%, greater than 60%, greater than 70%, greater than 80%, or greater than 90% mortality as measured, for example, 108 hours after a 12 hour soaking of the target in a 1.25 g/μΙ solution of the nucleic acid concatemer.
In preferred embodiments, the nucleic acid concatemer causes greater than 60% target mortality (= less than 40% target survival), as measured, for example, 108 hours after a 12 hour soaking of the target in a 1.25 g/μΙ solution of the nucleic acid concatemer.
In preferred embodiments, mortality is observed in the target organisms contacted with the concatemer. In other embodiments, the mortality phenotype is not observed in the target organisms contacted with the concatemer and, if observed at all, is first observed in the progeny of the organisms contacted with the concatemer (or in subsequent generations). Interaction with non-target cells / organisms
The mechanisms of gene down-regulation described above are widespread throughout a broad range of organisms. Thus, in situations where the nucleic acid agent will come into contact with more than one variety of cell / organism, it is preferable to ensure that only the target cell / organism (= cell or organism) is susceptible to expression downregulation by the agent. That is, gene expression in non-target cell / organism exposed to the nucleic acid agent should preferably remain unaltered.
In some applications the target cell / organism is a different species to non-target organisms; for example, in applications where the target is a parasitic organism such as V. destructor. In these applications it is preferable to ensure the nucleic acid concatemer down-regulates gene expression only in the target organism species. Such species-specific gene
downregulation can be achieved by ensuring (i) that the concatemer selected do not possess sufficient sequence identity with any non-target cell/organism to induce repression of gene expression in those non-target cells/organisms, or (ii) that the nucleic acid concatemer is only expressed in the target cell/organism (by, for example, through using a construct having a target specific promoter).
In other applications the target may be a specific cell or populations of cells within an organism; that is, the target cells are in an environment where they are surrounded by non- target cells of the same species. For example, the target may be a population of tumour cells within an organism. In these applications, target-specific repression of gene expression can be achieved by ensuring that that the nucleic acid concatemer is only expressed in the target cells (by, for example, through using a construct having a promoter activated by a combination of factors only present in (or greatly enriched in) the target cell population).
Accordingly, in some embodiments the nucleic acid concatemer described herein is capable of specifically down-regulating genes within the target organism; that is, the concatemer does not down-regulate the expression of genes in any non-target organisms. In some embodiments the concatemer is capable of downregulating the targeted gene to a significantly greater extent a non-target orthologue (such as the human orthologue). For example, the nucleic acid concatemer may induce a reduction in the target gene product that is at least 2-fold greater than the reduction in a non-target orthologue (for example, if the nucleic acid concatemer causes a 70% reduction in target mRNA levels, there will be no more than a 35% reduction in non-target mRNA levels). In some embodiments the nucleic acid agent may induce a reduction in target gene product that is at least 3-fold, 4-, 5-, 6-, 8-, 10-, 20-, 50-, 100-, 200-, 500- or 1000-fold greater than the reduction in a non-target gene product.
In some embodiments the nucleic acid a concatemer of the present invention is capable of downregulating a targeted gene to a significantly greater extent than any gene in a non- targeted cell / organism (e.g. human) gene. For example, the nucleic acid agent may induce a reduction in the target gene product that is at least 2-fold greater than the reduction in any non-target gene product (for example, if the nucleic acid agent causes a 70% reduction in targeted gene mRNA levels, there will be no more than a 35% reduction in non-targeted gene mRNA level). In some embodiments the nucleic acid agent may induce a reduction in targeted gene product that is at least 3-fold, 4-, 5-, 6-, 8-, 10-, 20-, 50-, 100-, 200-, 500- or 1000-fold greater than the reduction in any non-targeted gene product.
In some embodiments, the nucleic acid concatemer according to the present invention does not comprise a nucleic acid sequence that has 100% sequence identity to at least 18 (for example, at least 21 , at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100) contiguous nucleotides of the transcribed portions of the Varroa destructor genome. In some embodiments, the nucleic acid concatemer according to the present invention does not comprise a nucleic acid sequence that has 100% sequence identity to at least 18 (for example, at least 21 , at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100) contiguous nucleotides of the transcribed portions of the human genome.
The specificity of gene regulation may also be assayed through monitoring the mortality of non-target cells / organisms exposed to the isolated nucleic acid concatemer) For example, in some embodiments there is less than an additional 10% non-target mortality (relative to an untreated control), as measured 168 hours after the onset of treatment of the target population with the isolated nucleic acid concatemer. In some embodiments there is less than an additional 5%, 2%, 1 %, 0.5%, 0.2%, 0.1 % non-target mortality (relative to an untreated control), as measured 168 hours after the onset of treatment of the target population with the isolated nucleic acid concatemer. In preferred embodiments, there is no significant additional non-target mortality (relative to an untreated control, as measured 168 hours after the onset of treatment of the target population with the isolated nucleic acid agent). Delivery of nucleic acids
In order to influence the expression of genes the nucleic acid concatemer of the present invention must be delivered to the target.
Delivery of the nucleic acid concatemers of the present invention to the target can be achieved in several ways. For example, the nucleic acid agents may be delivered to the target directly by contacting the target with a solution of the nucleic acid agents, for example by spraying a solution of the nucleic acid agents or concatemers directly onto the targets; on contact with the target, the nucleic acid concatemer can enter the target body via diffusion or transfer through orifices on the target body.
Accordingly, the present invention provides a concatemer of the invention (or a solution thereof) for use in a method of treatment; for example, a method of inhibiting the growth of, or reducing, a population of a target cell / organism. The present invention also provides for the use of a concatemer of the invention (or a solution thereof) in the manufacture of a medicament for, for example, inhibiting the growth of, or reducing, a population of a target cell / organism. The present invention further provides a method of inhibiting the growth of, or reducing, a population of a target cell / organism, the method comprising spraying, or otherwise contacting, the target cell/organism population with a solution comprising concatemer of the invention.
Encompassed within the above methods of inhibiting the growth of, or reducing, a population of a target cell / organism are:
methods where the target is a parasitic / infectious organism (see, for example, Tables A and E above). Thus, the above methods of inhibiting the growth of, or reducing, a population of a target cell / organism encompass methods of treating the disorders caused by these organism.
methods where the target is a pathogenic cell population (for example a cancerous tumour). Thus, the above methods of inhibiting the growth of, or reducing, a population of a target cell / organism encompass methods of treating disorders caused by pathogenic cell populations (for example, cancer).
Concatemers of the present invention may be delivered to the target indirectly via adding the concatemer nucleic acid to the target's feed.
According to another embodiment of the present invention, the nucleic acid concatemers of the present invention are delivered to the target organism indirectly via non-target organisms parasitized by the target organism. The nucleic acid agents or concatemers of the present invention may be delivered to the non-target organism by, for example, spraying or otherwise contacting the non-target organism with a solution comprising a nucleic acid concatemer of the invention.
Thus, the nucleic acid concatemers of the present invention may be delivered to the target organism by feeding the concatemer to the non-target organism.
Following a similar principle, the nucleic acid concatemers of the present invention may be delivered to the target organism by providing the target organism with feed comprising the nucleic acid concatemers. For example, in embodiments where the target feeds on a plant, the nucleic acid concatemers of the present invention may be delivered to the target organism by providing a plant comprising the nucleic acid concatemers of the present invention.
Accordingly, the present disclosure provides a transgenic plant cell, plant, or part thereof, comprising a nucleic acid concatemer of the present invention, or a nucleic acid construct encoding a nucleic acid concatemer of the invention. For example, the present disclosure provides reproductive or propagation material for a transgenic plant, a transgenic tuber, stem, seed, and/or fruit comprising a nucleic acid concatemer as described herein, or a nucleic acid construct encoding a nucleic acid concatemer as described herein.
Similarly, the present disclosure provides a transgenic plant cell, plant, or part thereof, which expresses a nucleic acid concatemer of the present invention. For example, the present disclosure provides a transgenic tuber, stem, seed, and/or fruit comprising a nucleic acid concatemer as described herein.
The present disclosure also provides methods for producing a transgenic plant cell, plant, or part thereof, which expresses a nucleic acid concatemer of the present invention
The present disclosure also provides a cell, e.g. a host cell, comprising any of the nucleic acid concatemers, nucleotide sequences or nucleic acid (e.g. DNA) constructs described herein. Such cells include prokaryotic cells (such as, but not limited to, gram-positive and gram-negative bacterial cells) and eukaryotic cells (such as, but not limited to, yeast cells or plant cells). Preferably said cell is a bacterial cell or a plant cell. The present disclosure provides a composition comprising at least one comprising at least one nucleic acid concatemer or nucleic acid (e.g. DNA) constructs construct described herein, plus a physiological or agronomical acceptable carrier, excipient or diluent.
The composition may contain further components which serve to stabilise dsRNA and/or prevent degradation of dsRNA during prolonged storage of the composition.
The composition may still further contain components which enhance or promote uptake of dsRNA by the target organism. These may include, for example, chemical agents which generally promote the uptake of RNA into cells e.g. lipofectamin etc., and enzymes or chemical agents capable of digesting the fungal cell wall, e.g. a chitinase.
The composition may be in any suitable physical form for application to the target, to substrates, to cells (e.g. plant cells), or to organism infected by or susceptible to infection by a target species. It is contemplated that the "composition" of the disclosure may be supplied as a "kit-of-parts" comprising the nucleic acid concatemer in one container and a suitable diluent or carrier in a separate container.
The invention also relates to supply of the nucleic acid concatemer alone without any further components. In these embodiments the nucleic acid concatemer may be supplied in a concentrated form, such as a concentrated aqueous solution. It may even be supplied in frozen form or in freeze-dried or lyophilised form. The latter may be more stable for long term storage and may be de-frosted and/or reconstituted with a suitable diluent immediately prior to use.
The present invention relates to pesticidal compositions developed to be used in agriculture or horticulture. These pesticidal compositions may be prepared in a manner, known per se. For example, the active compounds can be converted into formulations, such as solutions, emulsions, wettable powders, water dispersible granules, suspensions, powders, dusting agents, foaming agents, pastes, soluble powders, granules, suspo-emulsion concentrates, microcapsules, fumigants, natural and synthetic materials impregnated with active compound and very fine capsules and polymeric substances. Furthermore, the pesticidal compositions according to the present disclosure may comprise a synergist. The dsRNA or dsRNA constructs according to the invention, as such or in their formulations, can also be used in a mixture with known fungicides, bactericides, acaricides, nematicides or insecticides, to widen, for example, the activity spectrum or to prevent the development of resistance. In many cases, this results in synergistic effects, i.e. the activity of the mixture exceeds the activity of the individual components.
Additionally the active compounds according to the disclosure, as such or in their formulations or above-mentioned mixtures, can also be used in a mixture with other known active compounds, such as herbicides, fertilizers and/or growth regulators.
The present invention also relates to fibrous pesticide composition and its use as pesticide, wherein the fibrous composition comprises a non-woven fibre and an effective amount of at least one of the nucleic acid concatamers described herein, covalently attached or stably adsorbed to the fibre. The present invention also relates to surfactant-diatomaceous earth compositions for pesticidal use in the form of dry spreadable granules comprising at least one nucleic acid concatemer, or at least two nucleic acid concatamers as described herein. The present disclosure also provides solid, water-insoluble lipospheres and their use as pesticide, wherein said lipospheres are formed of a solid hydrophobic core having a layer of a phospholipid embedded on the surface of the core, containing at least nucleic acid concatemer as described herein in the core, in the phospholipid, adhered to the
phospholipid, or a combination thereof. The invention further relates to pesticidal formulations in the form of microcapsules having a capsule wall made from a
urea/dialdehyde precondensate and comprising at least one nucleic acid concatemer as described herein.
Contemplated combinations
In one aspect, the below combinations are encompasses by the present invention. In an alternative aspect, the below combinations are not encompassed by the present invention.
1. An isolated nucleic acid agent according to any one of paragraphs 4 to 13, a nucleic acid composition according to either one of paragraphs 15 or 16, or a composition according to paragraph 17 for use in a method of treating or preventing a Varroa destructor mite infestation of a beehive.
2. Use of an isolated nucleic acid agent according to any one of paragraphs 4 to 13, a nucleic acid composition according to either one of paragraphs 15 or 16, or a composition according to paragraph 17 in the manufacture of a medicament for the treatment or prevention of a Varroa destructor mite infestation of a beehive.
3. A method of treating or preventing a Varroa destructor mite infestation of a beehive, the method comprising administering to a member of the beehive an isolated nucleic acid agent according to any one of paragraphs 4 to 13, a nucleic acid composition according to either one of paragraphs 15 or 16, or a composition according to paragraph 17.
4. An isolated nucleic acid agent comprising a nucleic acid sequence that is capable of downregulating the expression of a gene of the Varroa destructor mite, wherein the gene encodes Acetylcholinesterase (AChE; GenBank accession number ADDG01069748.1), Monoamine Oxidase (MOA; GenBank accession number ADDG01053234.1), vATPase subunit C (vATPc; GenBank accession number ADDG01035752.1 , GABA-receptor alpha subunit (GABA-Ra; GenBank accession number ADDG01060981.1), Chitin Synthase 1 (CHS-1 ; GenBank accession number ADDG01037469.1), Pyruvate Kinase (PyK; GenBank accession number ADDG01095321.1), alpha Tubulin (aTUB; GenBank accession number ADDG01073340.1), Prothoracicostatic peptide precursor (PTTH; GenBank accession number ADDG01000788.1), Crustacean hyperglycaemic hormone (CHH;GenBank accession number ADDG01078386.1) or Glutathione transferase mu1 (ΰβΤμΙ ; GenBank accession number ADDG01001667.1).
5. The isolated nucleic acid agent according to paragraph 4, wherein the nucleic acid agent comprises at least two or at least three nucleic acid sequences, wherein, optionally, the at least two or at least three nucleic acid sequences are capable of downregulating the expression of at least two or at least three different genes from Varroa destructor.
6. The isolated nucleic acid agent according to either one of paragraph 4 or paragraph 5, wherein the agent is less than 2000 bases long, or less than 1000 bases long, or less than 500 bases long.
7. The isolated nucleic acid agent according to any one of paragraph 4 to paragraph 6 wherein the or each nucleic acid sequence independently has at least 80% sequence identity to at least 18 contiguous nucleotides of an mRNA encoded by the gene of the Varroa destructor mite, and wherein the nucleic acid agent inhibits translation of the mRNA.
8. The isolated nucleic acid agent according to paragraph 7 wherein the or each nucleic acid sequence independently has at least 80% sequence identity to at least 18 contiguous nucleotides encoded by SEQ ID NO.1 , SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.1 13, or SEQ ID NO.10.
9. The isolated nucleic acid agent according to any one of paragraph 4 to paragraph 6 wherein the or each nucleic acid sequence independently has 100% sequence identity to at least 18 contiguous nucleotides of an mRNA encoded by the gene of the Varroa destructor mite, and wherein the nucleic acid agent induces the degradation of the mRNA.
10. The isolated nucleic acid agent according to paragraph 9 wherein the or each nucleic acid sequence independently has 100% sequence identity to at least 18 contiguous nucleotides encoded by SEQ ID NO.1 , SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.1 13, or SEQ ID NO.10.
11. The isolated nucleic acid agent according to any one of paragraphs 4 to10 wherein the nucleic acid agent is a dsRNA, antisense RNA, or a ribozyme.
12. The isolated nucleic acid agent according to paragraph 11 wherein the dsRNA is an siRNA, shRNA or miRNA.
13. The isolated nucleic acid agent according to any one of paragraphs 7 to 12 wherein the at least 18 contiguous nucleotides is at least 21 contiguous nucleotides, at least 25 contiguous nucleotides, or at least 30 contiguous nucleotides.
14. A nucleic acid construct encoding the isolated nucleic acid agent of any one of paragraphs 4 to 13.
15. A nucleic acid composition comprising at least two isolated nucleic acid agents according to any one of paragraphs 4 to 13.
16. The nucleic acid composition according to paragraph 15 wherein the at least two isolated nucleic acid agents are capable of downregulating the expression of at least two of the genes of the Varroa destructor mite. 17. A composition for feeding to bees comprising an isolated nucleic acid agent according to any one of paragraphs 4 to 13 or a nucleic acid composition according to either one of paragraphs 15 or 16.
FIGURES
Figure 1. Assessing the effect of different dsRNA targets on Tribolium larvae mortality. Larvae were microinjected with 100 nl of solutions containing 60ng dsRNAs coding for one of five Tribolium target genes, or dsGFP serving as a negative control. Larvae were maintained in Petri dishes with food at 23°C and 80% RH. Mortality was determined daily. Each treatment consisted of 2 Petri dishes containing 7-12 larvae each (n = 2), except for the GFP treatment where n = 3.
Figure 2. Assessment of the level of the gene knockdown in Tribolium larvae 72 hours after injection with 100 nl (60 ng) dsRNA coding for Tribolium V-ATPase subunit E or 100 nl saline. For each treatment the RNA from 2 larvae were assessed for transcript abundance by qPCR using RP6 as the normalising gene. Data are presented (mean ± SEM, n = 2) as relative to the expression observed in larvae administered with saline
Figure 3. Effect of different dsRNA treatments on Tribolium larvae mortality in Trial #1. Larvae were microinjected with 100 nl of solutions containing different dsRNAs and maintained in Petri dishes with food at 23°C and 80% RH. Mortality was determined daily. Each treatment consisted of 3 Petri dishes containing 7-10 larvae each (n = 3). The 'Mix' treatments contained of a mixture of individual dsRNAs coding for PMCA, Na+/K+-ATPase subunit alpha and ADP/ATP-translocase. The Tricat' treatments contained dsRNAs coding for those three genes, but concatamerized together into a single dsRNA. Ίχ' treatments were doses of 60 ng larva-1. '3χ' treatments were doses of 180 ng larvae-1.
Figure 4. Effect of different dsRNA treatment on Tribolium larvae mortality in Trial one. Experimental details are given in legend to Figure 3, above. Effect of treatments on larvae mortality at 216 hours post-treatment was assessed initially by oneway-ANOVA and pairwise comparisons determined by Fisher's LSD. Treatments that do not share a letter are significantly different (P<0.15).
Figure 5. Assessment of the level of the gene knockdown in Tribolium larvae 72-96 hours after injection with various dsRNA preparations, as described for Trial # 1 in legend to Figure 3, above. For each treatment the RNA from 4 larvae were assessed for transcript abundance by qPCR using the RP6 as the normalising gene. Data are presented (mean ± SEM, n = 4) as relative to the expression observed in larvae administered with dsGFP.
Figure 6. Effect of different dsRNA treatments on Tribolium larvae mortality in Trial #2. Larvae were microinjected with 100 nl of solutions containing different dsRNAs and maintained in Petri dishes with food at 23°C and 80% RH. Mortality was determined daily. Each treatment consisted of 3 Petri dishes containing 7-10 larvae each (n = 3). The 'Mix' treatments contained of a mixture of individual dsRNAs coding for PMCA, Na+/K+-ATPase subunit alpha and V-ATPase subunit E. The Tricat' treatments contained dsRNAs coding for those three genes, but concatamerized together into a single dsRNA. Ίχ' treatments were total doses of 60 ng larva-1. '3χ' treatments were total doses of 180 ng larvae-1.
Figure 7. Effect of different dsRNA treatment on Tribolium larvae mortality in Trial #2.
Experimental details are given in legend to Figure 6, above. Effect of treatments on larvae mortality at 216 hours post-treatment was assessed initially by oneway-ANOVA and pairwise comparisons determined by Fisher's LSD. Treatments that do not share a letter are significantly different (P<0.15).
Figure 8. Effect of different dsRNA treatment on Varroa mite mortality. In groups of 10, mites were soaked overnight at 4°C in 40 μΙ 0.9% saline containing various dsRNA treatments. Subsequently, mites were maintained on Apis mellifera larvae in Petri dishes at 30°C and 85% RH. Each treatment consisted of three petri dishes containing 10 mites (n = 3). Effect of treatments on mite mortality at 105 hours post-treatment was assessed initially by oneway-ANOVA and pairwise comparisons determined by Fisher's LSD. Treatments that do not share a letter are significantly different (P<0.05).
Figure 9. Assessment of the level of the gene knockdown in adult Varroa 72 hours after overnight immersion in dsRNA preparations coding for AChE, MOA and V-ATPase C- subunit either presented as a 3.75 μg μΙ-1 mixture (Mix 3.75) or as a 1.2 or 5 3.75 μg μΙ-1 tricatamer (Tri 1.25 or Tri 3.75, respectively) . For each treatment the RNA from 3 mites was assessed for transcript abundance by qPCR using R18s as the normalising gene. Data are presented (mean ± SEM, n = 4) as relative to the expression observed in mites administered with dsGFP.
Figure 10. L4440-MOA-V-ATPC-ACHE-Tricatemer plasmid map: MOA, vATPc, and AChE targets are indicated Figure 11. L4440- PM C A- N A K- A D P Tricatamer 1 plasmid map Figure 12. L.salmonis L4440-ADP-vATP-AChE plasmid map
Figure 13. Effect of different dsRNA treatments on Tribolium larvae mortality Example 6. Larvae were microinjected with 100 nl of solutions containing different dsRNAs and maintained in Petri dishes with food at 23°C and 80% RH. Mortality was determined daily. Each treatment consisted of 3 Petri dishes containing 7-10 larvae each (n = 3). The Mix treatments contained of a mixture of individual dsRNAs coding for alpha-tubulin, HSP90 and ADP/ATP-translocase. The tricatemer treatments contained dsRNAs coding for those three genes, but concatamerized together into a single dsRNA. 1X treatments were doses of 60 ng larva-1. 3X treatments were doses of 180 ng larvae-1.
Figure 14. Effect of different dsRNA treatment on Tribolium larvae mortality Example 6. The Mix treatments contained of a mixture of individual dsRNAs coding for alpha-tubulin, HSP90 and ADP/ATP-translocase. The Tricatemer treatments contained dsRNAs coding for those three genes, but concatamerized together into a single dsRNA. 1X treatments were doses of 60 ng larva-1. 3X treatments were doses of 180 ng larvae-1. Effect of treatments on larvae mortality at 216 hours post-treatment was assessed initially by oneway-ANOVA (P<0.0001) and pairwise comparisons determined by Fisher's LSD. Treatments that do not share a letter are significantly different (P<0.05).
Figure 15. Effect of different dsRNA treatments on Tribolium larvae mortality Example 5. Larvae were fed food administered with 10 μΙ of either 1.25 or 3.75 g/μΙ of different dsRNAs and maintained in Petri dishes at 23°C and 80% RH. Mortality was determined daily. Each treatment consisted of 3 Petri dishes containing 8 larvae each (n = 3). The Mix treatments contained of a mixture of individual dsRNAs coding for PMCA, Na+/K+-ATPase-a, and ADP/ATPtranslocase. The tricatemer treatments contained dsRNAs coding for those three genes, but concatamerized together into a single dsRNA.
Figure 16. Effect of different dsRNA treatments on Tribolium larvae mortality in Example 5. Larvae were fed food administered with 10 μΙ of either 1.25 or 3.75 g/μΙ of different dsRNAs and maintained in Petri dishes at 23°C and 80% RH. Mortality was determined daily. Each treatment consisted of 3 Petri dishes containing 8 larvae each (n = 3). The Mix treatments contained of a mixture of individual dsRNAs coding for PMCA, Na7K+-ATPase-a, and ADP/ATPtranslocase. The tricatemer treatments contained dsRNAs coding for those three genes, but concatamerized together into a single dsRNA. Effect of treatments on larvae mortality at 96 hours post-treatment was assessed initially by oneway-ANOVA (P<0.005) and pairwise comparisons determined by Fisher's LSD. Treatments that do not share a letter are significantly different (P<0.06).
Figure 17. Effect of different dsRNA treatments on Aedes aegypti larvae mortality in Example 9. Larvae (ca. 50 per tube, 3 tubes per treatment, n =3)) were soaked in 75 μΙ water containing either 1.25 or 3.75 g/μΙ of different dsRNAs for 2hr at 21 °C and then transferred to 48-well culture plates of water containing 5mg/ml rat diet. Mortality was monitored daily. The Mix treatments contained of a mixture of individual dsRNAs coding for β-tubulin, Na 7K+-ATPase alpha subunit and ADP/ATP translocase. The tricatemer treatments contained dsRNAs coding for those three genes, but concatamerized together into a single dsRNA.
Figure 18. Effect of different dsRNA treatments on Aedes aegypti larvae mortality in Example 9. Larvae (ca. 50 per tube, 3 tubes per treatment, n =3)) were soaked in 75 μΙ water containing either 1.25 or 3.75 g/μΙ of different dsRNAs for 2hr at 21 °C and then transferred to 48-well culture plates of water containing 5mg/ml rat diet. The Mix treatments contained of a mixture of individual dsRNAs coding for β-tubulin, Na +/K+-ATPase alpha subunit and ADP/ATP translocase. The tricatemer treatments contained dsRNAs coding for those three genes, but concatamerized together into a single dsRNA. Effect of treatments on larvae mortality at 144 hours post-treatment was assessed initially by oneway-ANOVA (P<0.001) and pairwise comparisons determined by Fisher's LSD. Treatments that do not share a letter are significantly different (P<0.05).
DEFINITIONS
Percentage Identity
As used herein, the term "percentage sequence identity" refers to identity as measure over the entire length of the SEQ ID in question.
For example, a polypeptide comprising a sequence having 70% sequence identity to SEQ ID NO:1 would contain a contiguous polypeptide where:
(Number of amino acids identical to SEQ ID NO 1) / Total number of amino acids in SEQ ID NO 1 = 0.7
The percent identity of two amino acid or two nucleic acid sequences can be determined by visual inspection and mathematical calculation, or more preferably, the comparison is done by comparing sequence information using a computer program. An exemplary, preferred computer program is the Genetics Computer Group (GCG; Madison, Wis.) Wisconsin package version 10.0 program, 'GAP' (Devereux et al., 1984, Nucl. Acids Res. 12: 387). The preferred default parameters for the 'GAP' program includes: (1) The GCG implementation of a unary comparison matrix (containing a value of 1 for identities and 0 for non-identities) for nucleotides, and the weighted amino acid comparison matrix of Gribskov and Burgess, Nucl. Acids Res. 14:6745,1986, as described by Schwartz and Dayhoff, eds., Atlas of Polypeptide Sequence and Structure, National Biomedical Research Foundation, pp. 353- 358, 1979; or other comparable comparison matrices; (2) a penalty of 30 for each gap and an additional penalty of 1 for each symbol in each gap for amino acid sequences, or penalty of 50 for each gap and an additional penalty of 3 for each symbol in each gap for nucleotide sequences; (3) no penalty for end gaps; and (4) no maximum penalty for long gaps.
Independently
As used herein, the term "independently" is used with reference to nucleic acid sequences within a single nucleic acid agent to indicate that the features of each sequence should be considered independently of any other sequences in a particular agent.
Thus, for example, "an isolated nucleic acid agent comprising at least two nucleic acid sequences wherein each nucleic acid sequence independently has at least 80% sequence identity to at least 18 contiguous nucleotides encoded by SEQ ID NO. 1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO. 113, or SEQ ID NO. 10" encompasses an isolated nucleic acid agent wherein (for example) one nucleic acid sequence has identity to SEQ ID N0.1 and another has identity to SEQ ID NO.2. That is, both sequences do not have to have identity to the same SEQ ID (since they are independent).
Statistical Significance
Unless stated otherwise, the significance of overall treatment effect is assessed by oneway- ANOVA and, if there a significant effect is detected, pairwise comparisons are performed by Fisher's least significant difference method. Statistical analysis is performed using Minitab Vers 16.0.
Unless stated otherwise, significance is assessed at the P<0.05 level
Following a description of the experimental methods employed by the present inventors, some particular embodiments of the invention will be discussed.
MATERIALS AND METHODS
V.destructor mite collection and husbandry
Varroa destructor (adult female) mites were collected from capped brood cells frames from Apis mellifera hives in York, England that had purposefully been left untreated for Varroa control. Prior to harvesting mites the frames were maintained at 27°C in a 80% relative humidity environment, 15.5h : 8.5h, light:dark regime. Mites were attached ventral side down on double sided tape attached to Petri dishes and approximately 50 were harvested for synganglion in phosphate buffered saline (PBS) before being washed in sterile ice-cold PBS and pooled together in a 1.5ml eppendorf tube containing 200μΙ RNA-later (Sigma, Poole, UK). Prior to RNA extraction, an additional 450μΙ dissection buffer was added to sample tubes and centrifuged at 14000rpm for 15 min. Supernatant was removed and the
synganglion washed with fresh PBS before a final centrifuge again at 14000rpm for 15 min. Supernatant was again removed and 600μΙ ZR extraction buffer added to each tissue sample. Total RNA was extracted using a mini-RNA isolation II Kit (Zymo Research, Orange, California, USA), as per manufacturer's instructions and eluted in 50μΙ water. RNA was co- precipitated with 1.5μΙ glycogen blue (NEB Biolabs, Ipswich, UK) and 2μΙ 3M sodium acetate in 95% ethanol and resuspended in 5μΙ of DEPC-treated water.
Methods to brood Varroa by artificial in vitro feeding have been tested. "Feeding units" utilising parafilm and artificial liquid food containing blue dye have been successful in showing that adult Varroa will feed as measured by the presence / absence after 48h of blue excretions. Adult Varroa have successfully lived in these chambers for up to 14 days although mortality is still high compared with mites living on fresh bee larvae.
Generation of a Varroa destructor cDNA library
3.5μΙ (O^g) of total Varroa destructor RNA was used for first strand cDNA synthesis. The construction of cDNA libraries was done using the SMART cDNA library construction kit (Clontech, St-Germain-en-Laye, France) according to the protocol provided by manufacturer, with some modifications. To determine optimal number of cycles, two identical amplification reactions were prepared. After the 10th amplification cycle the first reaction was stored on the ice, while the second one was used for the PCR cycle number optimization by removing 3μΙ samples from the reaction every two cycles until cycle number 20. Samples were checked by visualization on a 1.1 % agarose gel. The optimal number of cycles with visible and equally represented products, in this case 20 cycles, was used for primary amplification. cDNA was proteinase K treated, followed by phenol:chloroform extraction and resuspension in water. After Sfil digestion and size fractionation with Chroma Spin-400 column, the fractions were checked using agarose gel and pooled into large or medium libraries. Pooled cDNA was ethanol precipitated and eluted in 4ul of water. 3ul from each fraction was ligated into the ATripleEx2 vector and packed into phage using the Gigapack III Gold Packaging extract (Stratagene). Each un-amplified library was mixed with E.coli XL1 blue cells and top agar supplemented with X-gal and IPTG before being plated onto LB MgS04 agar plates in serial dilutions of 1 , 1 :10, 1 : 100 and 1 : 1000. The large library consisted of 6.23 x106 colony forming units (cfu)/ml and the medium library 1.07 x107 cfu/ml with recombination of 94.3 and 96.3% respectively.
EST sequencing and target selection
600 randomly selected recombinant plaques (white) were picked as agar plugs into plates of 96-wells, each well containing 100μΙ of SM buffer (0.58% NaCI, 0.2% MgS04 · H20 0.05M Tris-HCI, pH 7.5, 0.02% gelatin). Four plates were picked from the large fraction library, two from the medium fraction library and an additional 24 clones from the large fraction library for initial quality control. PCR with vector-specific primers was carried out using SM buffer / picked plaques as templates. PCR was carried out in 96-well plates containing 25ul
2xBiomix (Bioline), 5ul template, 1 ul (10ng/ul) each of PT2F1 (5'-
AAGTACTCTAGCAATTGTGAGC-3') and PT2R1 (5'- CTCTTCGCTATTACGCCAGCTG- 3') and 18ul water to give a 50ul final reaction volume. Cycling conditions were 94'C for 15min followed by 33 cycles of 94'C for 1 min, 49'C for 1 min and 72'C for 1 min 20s. PCR products were sent to GATC (Konstanz, Germany) for PCR reaction clean up and sequenced using primer PT2F3 (5' - CTCGGGAAGCGCGCCATTGT- 3'). PT2F3 is upstream from inserted cDNA and downstream from PT2F1 primer used in initial PCR reaction.
Following sequencing the Expressed sequence tags (ESTs) were modified in silico. ESTs were trimmed of primer and vector sequences, clusterized and checked for sequence quality using Lasergene Seqman (Lasergene v8.03, DNAstar, Madison, USA). BLASTn, BLASTx and tBLASTx programmes were used within the program BLAST2GO to compare the EST nucleotide sequences with the nonredundant (NR) databases of the NCBI and to the Gene Ontology (GO) database (www.blast2go.org). Following analysis of results, transcripts were primarily classified as novel sequences, putative identity or unknown function. Transcripts with a putative identity were further divided into functional categories by analysing GO identity and homology to known genes. Putative targets were chosen from the annotated sequences obtained in the EST library and were resequenced. In addition, other putative targets were postulated based on their likelihood of having critical function in Acari and the likelihood of being fast-acting with little chance of having alternative rescue pathways. The whole genome shotgun database for V. destructor proved
unsatisfactory to mine for targets due to the preliminary nature of the database and annotation. Such targets were obtained by designing primers around conserved regions in homologues in public databases of related species including Ixodes scapularis, Dermacentor variabilis ticks and the Metaseiulus occidentalis and Tetranychus urticae mites. Primers were designed and employed in anchored-PCR reactions with the pooled Varroa synganglia cDNA library as a template. Utilising the cDNA library as the template allowed anchored- PCR reactions to be employed, thus enhancing the chances of success when forward and reverse primers were not totally accurate. Further, using a cDNA library constructed from the synganglia ("brains") permitted greater success when searching for low-abundant neural targets. Resultant PCR products were then sequenced and specific Varroa primers designed. BLASTn was carried out against the Varroa whole genome shotgun database using the NCBI BLAST servers to obtain accession numbers.
Preparation of dsRNA
dsRNA was prepared using a BLOCK-iT RNAi TOPO transcription kit (Invitrogen), according to the manufacturer's instructions. LacZ-dsRNA was prepared and used as a negative control. Briefly, PCR was carried out as described above using adult female V. destructor cDNA in conjunction with specific primers, or with control LacZ-plasmid and LacZ specific primers (LacZ-F2, ACCAGAAGCGGTGCCGGAAA and LacZ-R2,
CCACAGCGGTGGTTCGGAT) .
Products were resolved on an agarose gel, excised and purified using a Qiagen gel extraction kit (Qiagen, Crawley, UK). TOPO-T7 linker was ligated to target and LacZ reactions before a secondary PCR was carried out to gain sense and antisense templates. T7-RNA polymerase was used in transcription reactions with target templates to generate sense and antisense RNA. Finally, RNA strands were annealed and the resultant dsRNA purified and quantified in a micro-spectrophotometer (Nanodrop Technology Ltd). dsRNA was ethanol precipitated and resuspended in DEPC-treated water to a working concentration of 2.5 Mg/μΙ and stored at -80°C.
Protocol of dsRNA injection and soaking
Adult female V. destructor were removed from capped brood cells along with associated bee larvae. Microinjections were carried out using pulled glass capillary needles in conjunction with a Harvard micro-injector system. Mites were placed on double-sided tape ventral side up, and injected with 20 nl (2.5 μς/μΙ) of either VdGST-mu1-dsRNA or LacZ-dsRNA in either the soft tissue proximal to the anal region and postcoxal plate, or in the coxa IV region, as indicated in Figure 7. Needles were left in each mite for 1 - 2 min to reduce the expulsion of fluid from the wound and withdrawn slowly. Mites were left for 1 - 2 min to allow the injection site to "seal" then returned to Petri dishes containing 1 bee larvae per 4 mites. Dead or unhealthy looking mites were removed after 1 hour and mortality was monitored over 72 h in LacZ-dsRNA, VdGSTmul-dsRNA and non-injected mites.
To assess non-invasive techniques for dsRNA delivery, mites were either completely immersed in dsRNA or were exposed to a droplet of dsRNA on their ventral carapace. For soaking experiments, adult mites were removed from capped brood cells and placed in 500 μΙ microfuge tubes containing 20 μΙ VdGST-mu1-dsRNA or LacZ-dsRNA (2.5 μ9/μΙ) supplemented with either nothing, 0.9% NaCI, 0.2% Triton-X100 or both. Mites were soaked at 4°C overnight before being removed, dried and placed in Petri dishes at 27°C, 95% relative humidity with bee larvae. Alternatively, a sample of mites was exposed to dsRNA by attaching them to double-sided tape and placing a 1 μΙ drop of VdGST-mu1-dsRNA or LacZ- dsRNA (2.5 μΙ/Mg) supplemented with either nothing, 0.9% NaCI, 0.2% Triton-X100 or both on the ventral carapace. Mortality was monitored for 48 h prior to collection and validation of knockdown.
V.destructor L4440-MOA-V-ATPC-ACHE Tricatemer construction
MOA, vATPc and AChE targets were assembled into a single assembly using the Gibson Assembly cloning kit (New England Biolabs). Initial PCR reactions to add overlapping assembly regions were carried out using 25μΙ Biomix (Bioline), 23μΙ water, 1 μΙ (1 ng/μΙ) of PCR4.1 plasmids containing either MOA, AChE or vATPc dsRNA target sequences and 1 μΙ (2mM) respective target primers containing target and L4440 overlapping regions (Table 1). The following cycling conditions were used: 1 cycle of 5 min at 94°C, followed by 35 cycles of 1 min at 94°C, 1 min at 58°C and 45 s at 72°C. Products were resolved on an agarose gel and visualised by UV light to check product size prior to assembly. Reaction was assembled on ice with the following 2μΙ MOA, 1.5μΙ ATP, 1 μΙ AChE and 0.5μΙ L4440 plasmid, 10μΙ Gibson Assembly Master Mix and 5μΙ RNAse-free water. Samples were incubated at 50°C for 60 minutes.
1 μΙ of GA reaction was transformed into 200μΙ ribonuclease-lll deficient E. coli HT115(DE3), plated onto LB agar containing 12.5mg/ml tetracycline and 100mg/ml ampicillin and incubated at 37°C for 36 hours. Multiple colonies were picked, grown overnight in LB broth containing 100mg/ml ampicillin at 37°C. Plasmids were purified using Qiagen miniprep columns and sequenced to verify tricatemer insertion (Fig. 13). Glycerol stocks of positive clones were kept at -80°C.
GIB-MOA-FWD : tggatccaccggttcgaacccactagccgaaatggac
G I B- M OA- R EV : tcctttcg tg acctccacccttaatag aaacg
GIB-vATPc-FWD: ggaggtcacgaaaggagcattttgtgcttgg
GIB-vATPc-REV: gcaactaattctcgacaaagagacgcagtgc
GIB-AChE-FWD: ttgtcgagaattagttgctcgccacgatatcattg
GIB-AChE-REV: cgtcacgtggctagctggcaagaggacttcccataag
Table 1. Gibson assembly primers
Insertion of targets into L4440 plasmid and expression bacteria
PCR was carried out using 25μΙ Biomix (Bioline), 23μΙ water, 1 μΙ (1 ng/μΙ) of PCR4.1 plasmids containing either MOA, AChE, vATPc or the tricatemer dsRNA target sequences and 1 μΙ (2mM) respective target primers containing restriction enzyme Bglll sites at 5'ends (Table 2). The following cycling conditions were used: 1 cycle of 5 min at 94°C, followed by 35 cycles of 1 min at 94°C, 1 min at 56°C and 45 s at 72°C. Products were resolved on an agarose gel and visualised by UV light. PCR products were purified using a Qiaquick PCR purification kit. Restriction digests were carried out on the purified PCR products, as well as dsRNA expression plasmid L4440, using Bglll restriction enzymes (Promega). Digested PCR and plasmids were ligated using a quick ligation it (New England Biolabs).
1 μΙ (100ng) purified L4440 plasmids, containing individual target inserts, were transformed into 200μΙ ribonuclease-lll deficient E. coli HT115(DE3), plated onto LB agar containing 12.5mg/ml tetracycline and 100mg/ml ampicillin and incubated at 37°C for 36 hours. Multiple colonies were selected, grown overnight in LB broth containing 100mg/ml ampicillin at 37°C. Plasmids were purified using Qiagen miniprep columns and sequenced to verify target insertion. Glycerol stocks of positive clones were kept at -80°C.
Production of dsRNA by E. coli HT1 15 (DE3)
Single colony stocks were grown overnight at 37°C in 5ml LB broth containing 12.5mg/ml tetracycline and 100mg/ml ampicillin. Each starter culture was diluted 100-fold with 2xYT broth containing 100mg/ml ampicillin only and incubated at 37°C until OD600 reached 0.4. T7 RNA polymerase was then induced by the addition of 0.4mM IPTG and incubated again at 37°C until OD600 reached 1.0. Cells were harvested by centrifugation at 6000xg for 5 min and supernatant was discarded prior to dsRNA extraction with TRI-reagent (Life technologies). 1 ml Tri-reagent was used per 107 bacterial cells. Briefly, cells were disrupted in Tri-reagent by pipetting and allowed to stand for 10 minutes. 0.2ml chloroform was added per ml Tri-reagent and samples were shaken vigorously for 20s before incubating at room temperature for a further 10 minutes. Samples were centrifuged at 12000 x g for 15 minutes and aqueous layer retained. An additional chloroform extraction was performed and RNA isolated by the addition of 0.5ml isopropanol per ml Tri-reagent. Precipitated RNA was pelleted by centrifugation at 12000 x g for 15 minutes. RNA pellets were washed in 75% ethanol and air dried prior to re-suspension in RNAse-free water. RNA was treated with RNAse A to remove endogenous bacterial ssRNA. To assess the dsRNA quality, Tri-reagent extracted dsRNA was digested with RNAse A or RNase III which specifically digest either ssRNA or dsRNA, respectively. The resultant RNAs were visualised by agarose gel electrophoresis. dsRNA purity and quantity was analysed by both Nanodrop ND-1000 and by comparison with dsRNA markers.
MOA dsRNA Bglll For primer: atagatctgaacccactagccgaaatg
MOA dsRNA Bglll Rev primer:atagatcttgacctccacccttaatagaaac
vATPc dsRNA Bglll For primer: atagatctcgaaaggagcattttgtgct
vATPc dsRNA BgllH Rev primer: atagatctctcgacaaagagacgcagtg
ACE dsRNA Bglll For primer: atagatctaattagttgctcgccacgat
ACE dsRNA Bglll Rev primer: atagatcttggcaagaggacttcccata
Table 2. Target L4440 insertion primers
Tribolium castaneum, the red flour beetle, is an economically important pest of stored products, including grains. T. castaneum is a model organism that is easy to rear in large numbers, has a well annotated genome and is used extensively in food safety research. Tribolium demonstrate a strong, systemic RNAi response elicited by intra-hemocoel injection with dsRNA. cDNA isolation and PCR of Tribolium castaneum targets
T.castanuem were purchased from Blades Biologicals (Edinbridge, UK) and maintained in bran, flour and yeast medium in temperature / humidity controlled chambers at 23°C and 80%RH. Larvae and adults were removed from culture and the RNA extracted by Tri-reagent (Life Technologies), according to manufacturer's instructions. After isolation, 1.5 μg total RNA was DNase treated with 1 μΙ (2U) RQ1-DNase (Promega, Southampton, UK) and 1 μ^01 buffer and incubated at 37°C for 30 min. DNase-treated total RNA was incubated at 70°C with O^g of oligo d(T)15 (Promega) in a total volume of 10 μΙ for 5 min. Material was snap- chilled on ice for 5 min prior to the addition of 5 μΙ 5*RT buffer, 1 μΙ dNTPs (25 mM each), 0.5 μΙ Bioscript-reverse transcriptase and DEPC water to 25 μΙ. The reaction was incubated at 42°C for 1 hour.
Primers were designed for seven Tribolium gene transcript targets (see Table 3):
1) Plasma membrane Ca2+ ATPase (PMCA, XP_008199852.1)
Plasma membrane Ca2+ ATPase (PMCA) is a transport protein found in the plasma membrane of cells. Its major function is to export calcium (Ca2+) from the cell across membranes, facilitating a vital role in regulating the amount of Ca2+ within cells and, thus, maintaining the much lower intracellular Ca2+ levels (μΜ) relative to the extracellular (e.g. blood) levels (mM).
2) Na+/K+ ATPase subunit alpha (NaK, XM_008198203.1)
Na+/K+-ATPase is found in the plasma membrane of eukaryotic cells where it acts as an anti porter-like enzyme; pumping Na+ out of cells while simultaneously pumping K+ inwards. Na+/K+- ATPase is vital in regulating and maintaining cellular resting potential as well as volume. It also functions as signal transducer. Na+/K+-ATPase places high energy demands on cells and is responsible for around 20% of cellular energy expenditure.
3) A DP/ATP translocase (ADP, XM_968164.3)
ADP/ATP translocase is a transporter protein that enables ATP and ADP to traverse the inner mitochondrial membrane. ATP produced from oxidative phosphorylation in the mitochondria is transferred via ATP- ADP translocase from the mitochondrial matrix to the cytoplasm, with ADP moving in the opposite direction. ADP/ATP translocase is vital to cellular energy production.
4) V-ATPase subunit E (vATPe, XM_965528.2)
Vacuolar-type H+-ATPases are a class of enzyme that couple energy from ATP hydrolysis to facilitate proton transport across intracellular and plasma membranes of eukaryotic cells. They play a variety of roles crucial for the function of cells and organelles pH homeostasis. V-ATPase complexes are made of 13 subunits including units A-H, all of which are necessary for regulation and function.
5) Tubulin alpha-1 chain (aTUB, XP_966492.1)
a-tubulin is a small globular protein that together with β-tubulin makes up cellular microtubules that are vital in cellular cytoskeletal architecture and perform essential and diverse transport and structural functions within the eukaryotic cell.
6) heat shock protein 90 (HSP90, NP_001094067)
Heat shock protein 90 (Hsp90) is a chaperone protein that folds proteins and stabilises them against heat stress. Hsp90 also aids in protein degradation and has roles in cell signalling. Previous investigations demonstrated that HSP90 was plays a crucial role in development, indeed silencing by dsRNA is lethal at all developmental stages.
7) Ca2+-transporting ATPase sarco/endoplasmic reticulum (SERCA, XP_966783.1)
Figure imgf000040_0001
Table 3 Primers for HSP90 and RP6 qPCR primers were from (Law 2011).
Primers for ATPase are from (Whyard et al. 2009). PCR was carried out using 25μΙ Biomix (Bioline), 23μΙ water, 1 μΙ cDNA and 1 μΙ (2mM) respective target primers. The following cycling conditions were used: 1 cycle of 5 min at 94°C, followed by 35 cycles of 1 min at 94°C, 1 min at 59°C and 45 s at 72°C. Products were resolved on an agarose gel and visualised by UV light. PCR products were visible for all targets at expected sizes except SERCA.
PCR products were purified using Qiagen PCR purification kit and eluted in 20μΙ water.
These purified PCR products were used in a secondary PCR using primers containing T7- Promoter sites for single target dsRNA constructs and with overlapping region primers between targets for use in Gibson Assembly.
Production of T.castanuem tricatemer templates into plasmid by Gibson Assembly
Four tricatemers were designed that incorporated six viable targets in combination into single assembly plasmids (Tables 4 and 5) using the Gibson Assembly cloning kit (New England Biolabs).
Initial PCR reactions to add overlapping assembly regions were carried out using 25μΙ Biomix (Bioline), 23μΙ water, 1 μΙ (1 ng/ul) of purified PCR products of target sequences and 1 μΙ (2mM) respective target primers containing target and L4440 plasmid overlapping regions (Table. 3). The following cycling conditions were used: 1 cycle of 5 min at 94°C, followed by 35 cycles of 1 min at 94°C, 1 min at 58°C and 45 s at 72°C. Products were resolved on an agarose gel and visualised by UV light to check product size prior to assembly. Reaction was assembled on ice with the following; 1 μΙ PMCA, 1.5μΙ NaK, 1 μΙ ADP/ATP translocase and 0.5μΙ L4440 plasmid, 10μΙ Gibson Assembly Master Mix and 6μΙ RNAse-free water. Samples were incubated at 50°C for 60 minutes.
1 μΙ Gibson Assembly reaction was transformed into 200μΙ DH5a E. coli, plated onto LB agar containing 100mg/ml ampicillin and incubated at 37°C for 16 hours. Multiple colonies were picked, grown overnight in LB broth containing 100mg/ml ampicillin at 37°C. Plasmids were purified using Qiagen miniprep columns. Glycerol stocks of positive clones were kept at - 80°C. Tricatemer dsRNA templates were produced by PCR using tricatemer plasmid template with T7-adapted forward and reverse primers for the outer target sequence regions. PCR conditions are as described above. T7-tricatemer PCR product was purified by Qiagen PCR purification kit and eluted in 32μΙ water. Tricatamer Targeted genes
Tc1 PMCA + NaK + ADP
Tc2 PMCA + NaK + vATPe
Tc3 aTUB + HSP90 + ADP
Tc4 aTUB + HSP90 + vATPe
Table 4
Figure imgf000042_0001
Table 5 dsRNA was produced using T7 Ribomax kit (Promega) in conjuction with either T7-single targets or, for tricatemer production, T7-tricatemer PCR template. The following reaction was assembled at room temperature; 40μΙ T7-ribomax buffer, 32μΙ T7-adapted template (1 ^g) and 8μΙ Ribomax enzyme. The reaction was incubated at 37°C for 2 hours, subsequently treated with 4μΙ RNAse-A and 1 μΙ RQ1 DNAse with a final incubation at 37°C for 30 minutes. dsRNA was precipitated by the addition of 8.5μΙ 3M Sodium Acetate and 90μΙ Isopropanol, pelleted by centrifugation and washed with 70% EtOH. dsRNA purity and quantity was analysed using a Nanodrop ND-1000 microspectrophotometer and by comparison with dsRNA markers.
Production of Aedes aegypti tricatemer templates into plasmid by Gibson Assembly
A tricatemer has been designed which incorporates three Aedes aegypti targets into a assembly plasmids using the Gibson Assembly cloning kit (New England Biolabs) in a similar manner to that described above for the T.castanuem tricatamer. The Gibson assembly primers are shown in Table 6 below.
Figure imgf000043_0001
Table 6
Production of Lepeophtheirus salmonis tricatemer templates into plasmid by Gibson
Assembly
A tricatemer has been designed which incorporates three Lepeophtheirus salmonis targets into a single assembly plasmids using the Gibson Assembly cloning kit (New England Biolabs) in a similar manner to that described above for the T.castanuem tricatamer. The Gibson assembly primers are shown in Table 7 below. Primer name Sequence
LsADPt_fwd actagtggatccaccggttcTAGCTCAAACTGTGGCAGCATG
LsADPt_rev ctcaaagacaAACAAGGACCAAGGCACATCC
LsvATP_E_fwd ggtccttgttTGTCTTTGAGCGATGCTGACG
LsvATP_E_rev gagagccatcCAACGACTTCATCCACATGCTC
LsAChEJwd gaagtcgttgGATGGCTCTCCAATGGGTAAAGAAC
LsAChE_rev ccacgcgtcacgtggctagcCTTCGACCACGACGGATACTTTC
Table 7
A plasmid map of the assembled tricatamer is shown in Figure 12.
EXAMPLES
Example 1 : Assessment of efficacy of T castaneum gene targets by administration of the corresponding individual dsRNAs
dsRNA for individual targets (vATPe, PMCA, NaK, aTUB, ADP, HSP90) were diluted with 0.9% NaCI to O^g^l concentration.
For single target dsRNA, Tribolium larvae of similar age and class, approximately 4mm in length, were removed from culture medium by sieves, chilled on ice for approximately 5 minutes and attached to injection platform using restraints. Larvae were then micro- injected between abdominal tergits VI - VII with 100nl (60 ng) dsRNA and placed in groups of 7 -10 in 85mm vented Petri dishes containing culture medium. Petri dishes were kept in humidity controlled environments at 23°C 80%RH.
Any injured or dead individuals from the injection trauma were removed within the first 24 hours and not included within the dataset. Larvae mortality was monitored daily. Live larvae, for example those injected with vATPe were removed after 72-96 hours and placed in Tri-reagent at -80°C to test for the degree of gene knockdown by qPCR.
As described above, Tribolium larvae were microinjected with 100 nl containing 60 ng of dsRNA coding for one of the following Tribolium genes: PMCA, Na+/K+-ATPase alpha subunit, alpha-tubulin, ADT/ATP-translocase, heat shock protein 90 or a similar amount of dsRNA GFP, acting as the negative control.
By 72 hours post-injection, increased larvae mortality was observed for all treatments with Tribolium-spec\f c dsRNA as compared to the dsGFP (see Figure 1). This increased mortality rate (compared the dsGFP) became more apparent over the 6.5 day period, confirming the induction of an effective RNAi effect by the dsRNA constructs.
Previously studies have shown that dsRNA coding for Tribolium vATPAe was lethal to Tribolium larvae when administered by feeding (Whyard et al., 2009). When 60 ng dsRNA for the similar coding region was injected into Tribolium larvae, a significant (P<0.0003) reduction of 78% in gene expression of the V-ATPase-E was observed (as compared to larvae injected with saline; see Figure 2). Example 2: Comparison of the mortality induced by mixed versus concatemerised PMCA, NaK and ADP dsRNAs
dsRNA mixtures were prepared with 0.9% NaCI to either 0.2μ9/μΙ individual PMCA, NaK and ADP ("Mix 1X" total concentration 0^g/ul), or Ο.δμς/μΙ individual PMCA, NaK and ADP ("Mix 3X" total concentration
Figure imgf000046_0001
Tricatemer "Tc1" (PMCA-NaK-ADP) dsRNA was prepared with 0.9% NaCI to either Ο.δμς/μΙ ("Tc1 1X") or δμς/μΙ ("Tc1 3X").
Control dsRNA was GFP at Ο.θμς/μΙ or 1 ^g/ul (see summary in Table 8 below).
Figure imgf000046_0002
Table 8
Tribolium larvae of similar age class, approximately 8mm in length, were removed from culture medium by sieves, chilled on ice for approximately 5 minutes and attached to injection platform using restraints. Larvae were then micro- injected between abdominal tergits VI - VI I with 100nl dsRNA and placed in groups of 7 -10 in 85mm vented Petri dishes containing culture medium. Petri dishes were kept in humidity controlled environments at 23°C 80%RH. Larvae were allowed to recover with any injured or dead individuals removed within the first 24 hours. Larvae were then monitored every 24 hours for mortality.
Additionally, some individuals injected were removed after 72-96 hours and placed in Tri- reagent at -80°C to test for knockdown by qPCR. Overall treatment effect was assessed by oneway-ANOVA and, if there was significant effect detected, then pairwise comparisons were performed by Fisher's least significant difference method. Statistical analysis was performed using Minitab Vers 16.0. Over the entire 9 days post-treatment period, there was a steady increase in the number of Tribolium larvae dying with any of the treatments involving dsRNA designed against any Tribolium gene compared to larvae injected with the negative control dsRNA GFP (see Figure 3). This indicates that the higher mortality of larvae treated with Tribolium gene- targeted dsRNA was a specific effect.
Statistical analysis was performed on data at time point 9 days (216 hours) post-treatment. A significant effect was detected of treatment upon larvae mortality (P<0.023, F = 3.11 , df 5/12).
All the Tribolium gene-specific dsRNA treatments, irrespective of dose or whether presented as a mixture or tricatemer, caused higher mortality than the dsGFP at either dose (60 and 180 ng /larvae) treatments (Fig. 4). However, neither of the "Mix" doses produced significantly (P>0.15) higher mortality than the dsGFP negative controls.
In contrast, both the tricatamer concentrations assayed resulted in significantly higher mortality (P<0.02) than either concentration of the dsGFP controls.
The data also shows that each tricatamer formulation was significantly more effective than the corresponding "Mix" formulation with an equivalent dsRNA concentration. That is, the "Tc1 1X" causes significantly more mortality than the "Mix 1x" (survival rates 55.5 ± 5.3% vs. 73.0 ± 2.4%, P = 0.032) and "Tc1 3X" causes significantly more mortality than the "Mix 3x" (44.4 ± 8.0% vs 63.7 ± 11.1 %, P =0.055).
Thus, the data consistently shows that the dsRNAs coding for 3 target genes was significantly more effective when administered in a concatamerized form, as opposed to a mixture of separate dsRNAs (for a given total dsRNA dose).
Example 3: Assessing level of gene knockdown of target genes in Example 2 using qPCR One possible explanation for the increased mortality observed in Example 2 with the tricatamer treatments was that the tricatamer led to enhanced suppression of the target genes. In order to test this hypothesis, the degree of target gene knockdown was assessed in larvae 72 - 96 hours post- injection with dsGFP (60 ng), "Mix 1x", "Mix 3x", and "Tc1 1x". Larvae were treated as per Example 2, and sampled 72 hours after treatment with either dsRNA-GFP, dsRNA mixtures or dsRNA-tricatamer, placed in 1 ml Tri-reagent and kept at - 80°C until use. RNA was extracted by Tri-reagent (Life Technologies) according to manufacturer's instructions. 1.5 μg total RNA was DNAse treated with 1 μΙ (2U) RQ1-DNase (Promega, Southampton, UK) and 1 μ^01 buffer and incubated at 37°C for 30 min. DNase- treated total RNA was incubated at 70°C with O^g of oligo d(T)15 (Promega) in a total volume of 10 μΙ for 5 min. Material was snap-chilled on ice for 5 min prior to the addition of 5 μΙ 5xRT buffer, 1 μΙ dNTPs (25 mM each), 0.5 μΙ Bioscript-reverse transcriptase and DEPC water to 25 μΙ. The reaction was incubated at 42°C for 1 hour. Resultant cDNA was measured by microspectrophotometry using a Nanodrop 100 and adjusted to 0.25μg/ul.
The normalising reference gene employed in this study was ribosomal protein 6 (RP6, Accession # NM_001 172390.1), as described by Whyard et al. (2009). Relative expression qPCR was carried out on an CFX-96 platform (Biorad) by Sybr-Green detection using iTaq reaction mix of 10μΙ Itaq buffer (BioRad), 4μΙ water, 5μΙ (5ng/ul) of template cDNA and 1 μΙ (2mM) respective target and control RP6 primers (Table 9). The following cycling conditions were used: 1 cycle of 10 min at 94°C, followed by 45 cycles of 30s at 94°C and 30s at 60°C. Melting curve analysis was performed to confirm specificity of reaction products. Ct values were extracted by automatic adjustment from sample reaction curves in the linear phase. Knockdown was assessed by Biorad gene expression software (Bio-Rad CFX manager 3.1) using the 2-AACT method.
Figure imgf000048_0001
Table 9 All dsRNA treatments targeting Tribolium genes significantly (P<0.05) reduced the expression of all the target genes (PCMA, ADP/ATP-translocase and Na+/K+-ATPase a subunit) relative to the GFP control (see Figure 5).
No consistent or significant difference was observed in the degree of gene knock-down achieved by "Mix 1x", "Mix 3x", and "Tc1 1x". Indeed, though larval mortality with the tricatemer treatment (survival 55.5 ± 5.3%) was higher than either the 60 ng dose (73.0 ± 2.4%) or the 180 ng dose mixture treatment (63.7 ± 11.1 %), this was not reflected in the level of knockdown of any of the three target genes.
Example 4: Comparison of the mortality induced by mixed versus concatemerised PMCA, NaK and vATPe dsRNAs
The protocol described in Example 2 was followed, but with "Tc2" used in place of "Tc1". dsRNA mixtures were prepared with 0.9% NaCI to either 0.2μ9/μΙ individual PMCA, NaK and V-ATPaseE ("Mix 1X" total concentration 0^g/ul) or O^g^l individual PMCA, NaK and V-ATPase-E ("Mix 3X" total concentration 1 ^g/ul).
Tricatemer 2 (PMCA-NAK-V-ATPase-E) dsRNA was prepared with 0.9% NaCI to either 0.6μ9/μΙ ("Tc2 1X") or 1.8μ9/μΙ ("Tc2 3X").
Control dsRNA was GFP at 0.6μ9/μΙ or 1 ^g/ul. (See summary in Table 10 below).
Figure imgf000049_0001
Table 10 As observed in Example 2, the data in example 4 shows that over the 9-day period that there is greater mortality in Tribolium larvae treated with dsRNAs targeting Tribolium genes, as compared the control dsRNA GFP (see Figure 6). This indicates that the higher mortality of larvae treated with Tribolium gene-targeted dsRNA is a specific effect. Over the 4.5 days post-treatment period, there was a steady increase in the number of mites dying with any of the treatments involving dsRNA designed against any mite gene (see figure 6). In contrast, little mortality was observed over the 4.5 day period in mites treated with either 1.25 or 3.75 g/μΙ dsGFP, indicating that the high mortality of mites treated with mite gene-targeted dsRNA was a specific effect brought about by careful selection of the targets.
Statistical analysis was performed on data at time point 8 days (192 hours) post-treatment. A significant effect was detected of treatment upon larvae mortality (P<0.0001 , F = 12.38, df 5/12).
All the Tribolium gene-specific dsRNA treatments, irrespective of dose or whether presented as a mixture or tricatemer, caused significantly higher mortality than the dsGFP at either dose (60 and 180 ng /larvae) treatments (see Figure 7).
The tricatamer formulations were more efficacious than the corresponding mixtures at killing larvae at both the "1X" dose (survival rates 47.6 ± 4.7% vs 57.1 ± 8.2%, P = 0.182) and the "3X" dose (38.1 ± 8.3% vs 50.6 ± 1 1.3%, P =0.02). Thus, the results of example 4 are consistent with those from example 2, showing as they do that the dsRNAs coding for 3 target genes are significantly more effective when administered in a concatamerized form, as opposed to a mixture of separate dsRNAs (for a given total dsRNA dose).
Example 5: Comparisons of the mortality rates with dsRNA for PMCA, NaK and ADP/ATPt administered in diet.
L4440-tricatemer were purified from glycerol stocks and 1 μΙ (100ng) transformed into 200μΙ ribonuclease-lll deficient E. coli HT115(DE3), plated onto LB agar containing 12.5mg/ml tetracycline and 100mg/ml ampicillin and incubated at 37°C for 36 hours.
Multiple colonies were selected, grown overnight in LB broth containing 100mg/ml ampicillin at 37°C. Glycerol stocks of E. coli HT1 15(DE3)-L4440-tricatemer positive clones were kept at -80°C.
Tricatemer-L4440 plasmid HT115 glycerol stock picks were grown overnight at 37°C in 5ml LB broth containing 12.5mg/ml tetracycline and 100mg/ml ampicillin. Each starter culture was diluted 100-fold with 2xYT broth containing 100mg/ml ampicillin only and incubated at 37°C until OD600 reached 0.4. T7 RNA polymerase, then induced by the addition of 0.4mM IPTG and incubated again at 37°C until OD600 reached 1.0.
Cells were harvested by centrifugation at 6000xg for 5 min and supernatant discarded prior to dsRNA extraction with TRI-reagent (Life technologies). 1 ml Tri-reagent was used per 107 bacterial cells. Briefly, cells were disrupted in Tri-reagent by pipetting and allowed to stand for 10 minutes. 0.2ml chloroform was added per ml Tri-reagent and samples shaken vigorously for 20s before incubating at room temperature for a further 10 minutes. Samples were centrifuged at 12000 x g for 15 minutes and aqueous layer retained. An additional chloroform extraction was performed and RNA isolated by the addition of 0.5ml isopropanol per ml Tri-reagent. Precipitated RNA was pelleted by centrifugation at 12000 x g for 15 minutes. RNA pellets was washed in 75% ethanol and air dried prior to re-suspension in RNAse-free water. RNA was treated with RNAse A to remove endogenous bacterial ssRNA.
To assess the dsRNA quality, Tri-reagent extracted dsRNA was digested with RNAse A or RNase III which specifically digest either ssRNA or dsRNA, respectively. The resultant RNAs are visualised by agarose gel electrophoresis. dsRNA purity and quantity is analysed by both Nanodrop ND-1000 and by comparison with dsRNA markers.
Feeding of dsRNA-tricatemer was carried out as described in Whyard et al. (2009). 10 mg of tribolium diet to be placed in 48-well plates, and 10μΙ of either the prepared 5 mg/ml dsRNA- tricatemer or a mixture of the three individual dsRNAs (PMCA, Na+/K+-ATPase-a, and ADP/ATPt) at total concentration of 5 mg/ml to be pipetted onto the surface of the food. As a negative control, similar diets were set up with equal amounts of dsGFP.
Tribolium larvae of similar age class, approximately 6 mm in length, were removed from culture medium by sieves and larvae (6-8mm) placed in each well, which is then sealed with parafilm M (Pechiney, USA), with pin holes for respiration. Survival of larvae was monitored every 24h with samples removed after 72h for qPCR analysis of knockdown. Treatment effects were determined by ANOVA and, if significant, pair-wise comparisons investigated by Fisher's LSD.
Results
Over the 9-day period there was greater mortality in Tribolium larvae fed diets containing dsRNAs targeting Tribolium genes compared to larvae fed with the irrelevant dsRNA GFP (Fig. 15). This indicated that the higher mortality of larvae treated with Tribolium gene- targeted dsRNA was a specific effect.
Statistical analysis was performed on data at time point 4 days (96 hours) post-treatment. A significant effect was detected of treatment upon larvae mortality (P<0.04, F = 3.53, df 5/12).
Although mortality in larvae fed the dsRNAs mixture at 1X dose was not significantly different from the dsGFP negative control treatment, the dsRNA fed as a tricatemer did result in significantly higher mortality (P<0.05), regardless of dose (Fig. 16).
The dietary dsRNAs presented in the single concatemerized form rather than as a mixture of 3 individual dsRNAs was significantly more effective in killing the Tenebrio larvae at the 1X dose (survival rates 62.5 ± 7.2% vs 81.5 ± 5.1 %, P <0.05).
Example 6: Comparison of the mortality induced by mixed versus concatemerised aTUB, HSP90. and ADP dsRNAs
The protocol described in Example 2 was followed, but with "Tc3" used in place of "Tc1" (see Tables 4 & 5 above) dsRNA mixtures were prepared with 0.9% NaCI to either O^g^l individual aTUB, HSP90, and ADP ("Mix 1X" total concentration 0^g/ul) or O^g^l individual aTUB, HSP90, and ADP ("Mix 3X" total concentration 1 ^g/ul).
Tricatemer 3 (aTUB-HSP90-ADP) dsRNA was prepared with 0.9% NaCI to either O^g^l ("Tc3 1X") or 1.8μ9/μΙ ("Tc3 3X").
Control dsRNA was GFP at 0.6μ9/μΙ or 1 ^g/ul. (See summary in Table 1 1 below).
Figure imgf000052_0001
Table 11 As observed in Examples 2 and 4, the data in example 6 shows that over the 9-day period that there is a steady increase in the mortality of Tribolium larvae treated with dsRNAs targeting Tribolium genes, as compared the control dsRNA GFP (see Figure 13). This indicates that the higher mortality of larvae treated with Tribolium gene-targeted dsRNA is a specific effect.
Statistical analysis was performed on data at time point 9 days (216 hours) post-treatment. A significant effect was detected of treatment upon larvae mortality (P<0.0001 , F = 22.87, df 5/12). All the Tribolium gene-specific dsRNA treatments, irrespective of dose or whether presented as a mixture or tricatemer, caused higher more mortality than either dose of the dsGFP (60 and 180 ng /larvae) treatments (Fig. 14).
The tricatamer formulations were significantly more efficacious than mixtures at killing larvae at both (a) the 1X (60 ng larvae-1) dose ( survival rates 66.7 ± 4.7% vs 47.6 ± 2.4%, P = 0.023) and (b) the 3X (180 ng larvae"1) dose (50.0 ± 7.2% vs 34.5 ± 3.0%, P <0.05). Thus, tha data confirms that the dsRNAs coding for 3 target genes was significantly more effective when presented in a single concatamerized form rather than as a mixture of 3 individual dsRNAs, even though the equimolar amount remains the same.
Significantly, this result is consisten with that found in Examples 2 and 4, despite there being no overlap in gene identity in the three tested genes making up the tricatamer. This indicates that the observed increase in mortality upon upon concaterisation is not a gene-specific effect.
Example 6: Assessing tricatemer's ability to cause gene knockdown of all three targets in V. destructor
Treatment of mites:
21 adult Varroa mites were removed from capped brood cells, maintained in humidity and temperature controlled environmental boxes in Petri dishes and with bee larvae to assess health. Active mites (18) were randomly divided into two groups and placed in 1.5ml Eppendorf tubes containing either 40μΙ of 1.25μ9/μΙ dsRNA-GFP control in 0.9% NaCI or 1.25μ9/μΙ dsRNA-tricatemer in 0.9% saline. Mites were soaked at 4°C overnight before being removed, dried and placed in Petri dishes. Mites were fed on similar aged developing bee larvae (replaced every 24h) and maintained at 30°C and 85% RH. Mites were harvested after 72h and stored in RNAIater at -80°C for qPCR analysis.
Measuring gene knockdown of dsRNA-tricatemer targets using qPCR:
Mites were sampled 72hours after treatment with either dsRNA-GFP or dsRNA-tricatemer, placed in 10ΟμΙ RNAseLater and kept at -80°C until use. Mites removed from RNAse later, washed briefly in cold PBS and homogenised with plastic pestles under 800μΙ RNA lysis buffer. Samples were further homogenised by repeatedly passing debris and tissue through 23 gauge needles attached to 1 ml syringes. Mites were then processed according to ZR Tissue & Insect RNA MicroPrep Kit (Zymogen), DNAse-treated with RQ1 (Promega) and eluted in 10μΙ RNAse-free water.
RNA concentration of targets was measured by Nanodrop ND-1000 and 0.25μg RNA for each sample was used in reverse transcription reactions with oligo-dt and Bioscript (Bioline). Resultant cDNA was again measured by Nanodrop-100.
Relative expression qPCR was carried out on an Opticon 2 Engine (Biorad) by Sybr-green detection using reaction mix of 12.5μΙ Immolase DNA polymerase (Bioline), 10.5μΙ water, 1 μΙ (1 ng/μΙ) of template cDNA and 1 μΙ (2mM) of the respective target or actin, used as a normalising reference gene. Primers (Table 1 1) were designed to hybridise to sequences of the cDNA that were external to the region of the dsRNA, thereby amplifying cDNAs derived from varroa mRNA but not amplifying the dsRNA itself. The following cycling conditions were used: 1 cycle of 15 min at 94°C, followed by 35 cycles of 45s at 94°C, 45s at 56°C and 45 s at 72°C. Melting curve analysis was carried out to confirm specificity of the reaction products. Ct values were extracted by manual adjustment from sample reaction curves in the linear phase. Knockdown was assessed by the 2"ΔΔ0Τ method (Livak et al. 2001).
MOA Exf1 : ggacgacttcccacacttct
MOA Exr1 : tgccacccttcatcttcatt
vATPc exfl : tccttacttgtgcgcaatct
vATPc exrl : ccggtagtccatagcgaagt
AChE exfl : aattagttgctcgccacgat
AChE Exr2 : gaaaatagccctttggcaag
Actin qPCR f1 : catcaccattggtaacgag
Actin qPCR r1 :cgatccagacggaatactt
Table 1 1. qPCR primers for determining knockdown of targets Results:
Compared to mites soaked in GFP dsRNA, the mites soaked I 1.25μ9/μΙ tricatemer dsRNA demonstrated a dramatic decrease (>98%) in their content of amplicons of all three targets, namely MOA, vATPc, and AChE 72hours after treatment (Table 12). It was noteworthy, that very similar levels of knockdown was observed for all three targets. This indicates that equal absolute amounts or, at least equal efficacy amounts, of dsRNA were generated for each of the gene targets using the 5' and 3' T7-flanked construct within the L440 plasmid. This is most notable for vATPc which sits in the centre of the construct (5'-T7-MOA-vATPc-AChE- T7-3') and might have been expected to have been generated in lower amounts.
with dsRNA-GFP controls
Example 7: Assessing tricatemer's ability to kill mites and its effectiveness relative to MOA, AChE and vATPc singly or in combination
300 adult Varroa mites were removed from capped brood cells and then maintained in Petri dishes within humidity and temperature controlled environmental boxes with bee larvae to assess health. Active mites (270) were randomly assigned into groups of 10 and placed in 1.5ml eppendorf tubes containing 40μΙ 0.9% NaCI and treatments, as detailed in Table 13, giving 3 replicates of 10 mites per treatment. Mites were soaked at 4°C overnight before being removed, dried and placed in Petri dishes. Mites were fed on similar aged developing bee larvae (replaced every 24h) and maintained at 30°C and 85% RH. Mites were monitored for mortality over the subsequent 5 days. Overall treatment effect was assessed by oneway- ANOVA and, if there was significant effect detected, then pairwise comparisons were performed by Fisher's least significant difference method. Statistical analysis was performed using Minitab Vers 16.0. Treatment dsRNA
Concentration
(μ9 μΙ"1)
0.9% NaCI control 0
dsRNA-GFP (1.25μο/μΙ) 1.25
dsRNA-GFP (3.75μο/μΙ) 3.75
dsRNA MOA (1.25μο/μΙ) 1.25
dsRNA νΑΤΡο (1.25μ9/μΙ) 1.25
dsRNA AChE (1.25μο/μΙ) 1.25
dsRNA MOA + vATPc + AChE (1.25μ9/μΙ each) 3.75
dsRNA-tricatemer (1.25μ9/μΙ) 1.25
dsRNA-tricatemer (3.75μ9/μΙ) 3.75
Table 13
Results
Over the entire 4.5 days post-treatment period, there was a steady increase in the number of mites dying with any of the treatments involving dsRNA designed against any mite gene (Fig. 14). In contrast, little mortality was observed over the 4.5 day period in mites treated with either 1.25 or 3.75 g/μΙ dsGFP, indicating that the high mortality of mites treated with mite gene-targeted dsRNA was a specific effect brought about by careful selection of the targets.
At time point 4.5 days post-treatment, a significant effect was detected of treatment upon mite mortality (P<0.0001 , F = 16.75, df 8/18). All the mite gene-specific dsRNAs caused significantly (P<0.05) more mite mortality than either the saline or the dsGFP (1.25 and 3.75 μθ/μΙ) treatments (Fig. 8).
The tricatemer proved to be particularly effective at both 1.25 and 3.75 g/μΙ concentrations. The tricatemer at 3.75 g/μΙ resulted in very high mite mortality with low variation. Variation for the tricatemer at 1.25 μ9/μΙ also showed very high mite mortality, but with much higher variation due to a restriction on the number of replicates which could be performed (limited mite numbers). It is anticipated that subsequent replicates will reduce the observed variation. Even without additional replicates, the tricatemer led to significant mite mortality, as described in more detail below. At 3.75 μς/μΙ, the tricatemer was significantly more effective than the singly targeted AChE and vATPc dsRNAs (ds RNAs at1.25 Mg/μΙ; P<0.05); at 3.75 Mg/μΙ the tricatemer was also significantly more effective than the singly targeted MOA dsRNA (ds RNA at1.25 μ9/μΙ; PO.07).
Surprisingly, the tricatemer at 3.75 μ9/μΙ was significantly more effective than the 3.75 μ9/μΙ mixture of MOA + AChE + vATPc (P<0.05; Fig. 8). Consistent with the increased potency of the tricatemer versus a mixture of dsRNAs, the 3.75 μ9/μΙ mixture of MOA + AChE + vATPc is not significantly better than the tricatemer at 1.25 μ9/μΙ, despite having a three-fold higher dsRNA concentration. Indeed, the tricatemer at 1.25 μ9/μΙ causes significantly more lethality than the 3.75 μ9/μΙ mixture of MOA + AChE + vATPc (P<0.125).
Comparison to earlier V. destructor dsRN Ά studies
As noted in the introduction, previous studies of the transfer of dsRNA from A.mellifera hosts to V .destructor mites have been reported a decrease in mite population in tested mini-hives of up to 61 % (Garbain et al. 2012).
The reported 61 % reduction in mite population was recorded at the end of a 60-day trial period during which mites were exposed to a dsRNA mix containing 14 V .destructor sequences. The 60-day trial period allowed for two reproductive cycles of V. destructor, and the authors of Garbain et al. 2012 did not directly measure V .destructor mite mortality; thus, the 61 % figure represents the combined effects of mortality and reduced fecundity over two generations of V .destructor mite.
In comparison, the results obtained using the nucleic acid agents of the present invention (see Figure 8) show that for each of the single gene dsRNA treatments of MOA, AChE, and vATPc a mite mortality of -52% was recorded. This figure was directly recorded mortality (i.e. mite death) on a single mite generation. Repeated over two generations, this level of mite death would result in a reduction in mite numbers of at least (1 - 0.482) = 77%.
For the MOA/AChE/vATPc tricatemer, a mortality of 71 % was recorded. Repeated over two generations, this level of mite death would result in a reduction in mite numbers of (1 - 0.292) = 92% (Both this figure and the above figure of 77% considers only direct mite mortality: an even greater reduction would be seen if the likely reduction in mite fecundity was also accounted for). In addition to increased potency, the ability to achieve high levels of mite mortality using a single, or a small number, of dsRNA sequences (as opposed to 14 different sequences) results in a range of handling and safety advantages. For example, fewer targets means a lower likelihood of "off target" gene silencing (that is, silencing genes other than the intended target(s)), and also reduces production costs and complexity.
Example 8: Comparing levels of gene knockdown achieved by the tricatemer relative to a mixture of MOA, AChE and vATPc singly or in combination
In order to assess if the enhanced kill rate of the tricatamer treatments was due to an increased knockdown of the target genes by this formulation, the level of gene expression in mites treated with dsGFP (1.25 Mg/μΙ ), the dsRNA mixture (3.75 g/μΙ) and the dsRNA tricatamer (both 1.25 and 3.75 μ9/μΙ) was determined.
As expected, all the treatments containing dsRNA targeting Varroa genes significantly reduced the expression of all the target genes (by 80 - 99%; see Figure 9). However, there was no significant or consistent difference between the levels of down-regulation observed with the different dsRNA formats or concentrations tested. In particular, it was there was no significant correlation between the level of mortality observed and the degree of knockdown of any of the targeted genes (AChE, MOA and V-ATPase; compare Figures 8 & 9).
This observation is what would be expected when the processes of dsRNA uptake and RNAi are not limiting the observed mortality.
Example 9: Aedes aegypti ' soaking methods using the β-tubulin, Na+/K+-ATPase-g and ADP/ATPt tricatamer
A further trial was conducted to see if the "conatemer effect" was effective in a dipteran (true fly). Trials were conducted on the yellow fever mosquito (Aedes aegypti) which is a medically important vector that transmits yellow fever, dengue fever and other important pathogens. The genes involved were β-tubulin, Na +/K+-ATPase alpha subunit and
A DP/ATP translocase.
As described above, fragments of Aedes aegypti β-tubulin (XM_001655975.1), Na+/K+- ATPase alpha subunit (XM_001662168.1) and A DP/ATP translocase (XM_001649861.1) were amplified from A. aegypti cDNA and then conjoined into a tricatemer by appropriate Gibson assembly primers. The resultant tricatmer was inserted into L4440 plasmid and then transformed into E. coli HT1 15(DE3). Tricatemer was produced by the E. coli HT1 15(DE3)- L4440, purified and quantified as described above and diluted to appropriate concentration in preparation for efficacy testing in mortality studies against A. aegypti larvae.
Treatment of animals:
Aedes aegypti were maintained in netted boxes in a secure insectary at 28°C, 40%RH, on a 16:8 L:D photoperiod. Females to be fed warmed sheep blood encased in stretched parafilm M (Pechiney, USA). Mosquito eggs to be allowed to develop to larval stage and then maintained on a ground liver powder and fish food.
Soaking:
Larvae were treated in groups of -50 individuals in a final volume 75 μΙ with either (i) a mixture of three individual dsRNAs (β-tubulin, Na+/K+-ATPase-a, and ADP/ATPt, total = 1.25μ9/μΙ), (ii) dsRNA-tricatemers as described above in material at 1.25μ9/μΙ or 3.75 μ9/μΙ in a 1.5 ml eppendorf tube, or (iii) dsRNA GFP at either 1.25 or 3.75 μ9/μΙ..
Larvae were soaked in the dsRNA solutions for 2 hr at 21 ° C, transferred to 48-well tissue culture plates (also maintained at 21 ° C) and provided 5 mg/ml lab rat diet (Purina Mills, www.purinamills.com) suspended in water as a source of food on a daily basis. Survival and pupation rates of the larvae were monitored daily. Treatment effects were determined by ANOVA followed by pairwise comparisons by Fisher's LSD.
Results
Statistical analysis was performed on data at time point 6 days (144 hours) post-treatment (Fig. 17). A significant effect of treatment upon larvae mortality was detected (P<0.0001 , F = 17.69, df 5/21). All treatments containing A. aegypti gene-specific dsRNA killed significantly (P<0.05) more mosquito larvae than the dsGFP negative control treatment (Fig. 18).
The dsRNA presented in the single concatemerized form rather than as a mixture of the 3 individual dsRNAs was significantly more effective at killing the mosquitoes at both the 1X dose (survival rates 43.7 ± 3.6% vs 59.5 ± 2.4%, P <0.01) and the 3X dose (survival rates 35.0 ± 4.7% vs 52.5 ± 4.7%, P O.03). Example 10: Lepeophtheirus salmonis soaking methods using the ATPt, vATP, AChE tricatamer
Adult and pre-adult Lepeophtheirus salmonis lice to be collected from a commercial Atlantic salmon (Salmo salar) farm. Lice were maintained at 12°C in sea water in 1 litre beakers with constant aeration. Water to be changed and dead lice removed daily. Egg strings to be carefully removed from any gravid female lice and kept in similar conditions to adults. After hatching, nauplius to be separated from the remaining eggs and allowed to develop into copepodid for dsRNA assays. All stages to be maintained in a 15.5h : 8.5h, light:dark regime.
Fresh copepodids (20 individuals) to be removed from aerated beakers and placed in 1 ml eppendorf tubes in 75ul sterile sea water along with 10ul (1 ug/ul) of either a mixture of three individual dsRNAs (PMCA, Na+/K+-ATPase-a, and ADP/ATPt, total = 1.0μο/μΙ) dsRNA- tricatemers at 1.0μ9/μΙ and left at 4'C for 7h. Negative control larvae to be similarly treated with dsRNA-GFP. After 7h lice to be removed from dsRNA sea water and placed into 25ml seawater in Petri dishes. Mortality to be monitored every 24 hours. Lice to be removed at 72h to validate knockdown by qPCR. Treatment effects to be determined by ANOVA followed by pairwise comparisons by Fisher's LSD.
Example 11 : Caenorhabditis elegans feeding methods using the egl-30, pat-10, and bli-5 tricatamer
The C. elegans L4440-tricatemer described herein to be purified from glycerol stocks and 1 μΙ (100ng) transformed into 200μΙ ribonuclease-lll deficient E. coli HT115(DE3), plated onto LB agar containing 12.5mg/ml tetracycline and 100mg/ml ampicillin and incubated at 37°C for 36 hours. Multiple colonies to be selected, grown overnight in LB broth containing 100mg/ml ampicillin at 37°C. Glycerol stocks of E. coli HT115 (DE3)-L4440-tricatemer positive clones kept at -80°C. Tricatemer-L4440 plasmid HT1 15 glycerol stock picks to be grown overnight at 37°C in 5ml LB broth containing 100mg/ml ampicillin. Bacterial cultures to be used to seed
NGM/Amp/I PTG plates.
C.elegans to be put on each plate to feed, and their L4 or adult progeny scored for GFP expression in the intestine. Worms grown on plates to be monitored by microscopy at 100* magnification using the appropriate filter. OpenLab 3.1.7 software (Improvision) to be used for capturing images (100*) of live worms put on 2% agarose pads; the same exposure time (typically -500 msec) is used for capturing images to be compared in the same experiment.
References
Aronstein, K.A., Oppert, B.S., Lorenzen, M.D. 2011. RNAi in agriculturally-important arthropods. In: Grabowski, P., editor. RNA Processing. Rijeka, Croatia: InTech. p. 157-180.
Bakhetia, M., P.E. Urwin, H.J. Atkinson (2008) Characterisation by RNAi of pioneer genes expressed in the dorsal pharyngeal gland cell of Heterodera glycines and the effects of combinatorial RNAi. International Journal for Parasitology 38: 1589-1597
Bender, E. (2014) The second coming of RNAi. The Scientist http://www.the- scientist.com/7articles.view/articleNo/40871/title/The-Second-Coming-of-RNAi/
Campbell, E.M., Pert, C.C., Bowman A. S. (2009) RNA-interference methods for gene- knockdown in the sea louse, Lepeophtheirus salmonis: studies on a putative prostaglandin E synthase. Parasitology 136: 867-874
Charlton, W.L, Harel, HH.Y.M., Bakhetia, M., Hibbard, J.K., Atkinson, H.J., McPherson, M.J. (2010) Additive effects of plant expressed double-stranded RNAs on root-knot nematode development. International Journal for Parasitology 40: 855-864
Garbian Y, Maori E, Kalev H, Shafir S, Sela I (2012) Bidirectional Transfer of RNAi between Honey Bee and Varroa destructor: Varroa gene silencing reduces Varroa population. PLoS Pathog 8(12): e1003035
Geldhof P., Visser A., Clark D., Saunders G., Britton C, Gilleard J., Berriman M., Knox D. (2007) RNA interference in parasitic helminths: current situation, potential pitfalls and future prospects. Parasitology 134: 609-19.
Kolev, N.G., Tschudi, C, Ullu, E. (2011) RNA interference in protozoan parasites:
achievements and challenges. Eukaryotic Cell 10: 1156-1 163
Law. E and Vilcinskas. A (201 1); Post-embryonic functions of HSP90 in Tribolium
castaneum include the regulation of compound eye development. Dev Genes Evol. 221 (5-6)
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001 , 25:402-8. Miller, S.C, Miyatat, K., Brown, S.J., Tomoyasu, Y. (2012) Dissecting systemic RNA interference in the red flour beetle Tribolium castaneum: Parameters affecting the efficiency of RNAi. PLoS One 7(10) e47431
Whyard. S, Singh. AD and Wong. S (2009) Ingested double-stranded RNAs can act as species-specific insecticides. Insect Biochem Mol Biol. 39(11)
SEQUENCES: target genes and constructs
GENE -» V.destructor Acetylcholinesterase (AChE)
Database details GenBank accession number ADDG01069748.1
Target sequence -» SEQ ID NO.1
GGAATTAGTTGCTCGCCACGATATCATTGTGGTAATAATAAACTACCGCCTGTCTGTAATGGGTTTCC TTTTTTAAACAATACGGAAGCTCCGGGCAATCAGGGACTGCATGATATTCTTTTAGCCGTAAAATTCG TAAAGGAGAATGCGCGAGCTTTAAATGGAGATCCAGATAAGTTCACCCTATGGGGCCAGTCTGCTGGG CGTTTGCCGTCGGCTTCCTTATGGGAAGTCCTCTTGCCAAAGGGCTATTTTC
GENE V.destructor Monoamine Oxidase (MOA)
Database details -> GenBank accession number ADDG01053234.1
Target sequence -» SEQ ID NO.2
ATTCAGGGCAAGCGATACCAGCACCCGGCGGACGACTTCCCACACTTCTGGAACCCACTAGCCGAAAT GGACGTCAACAATTTTTTCCGAACTTTAGACGATATGGGCAAAGAAATTCCGGCGGAGGCCCCGTGGA ACGCTCCTCATGCCGAGGAATGGGACCAAATGTTCTTCATTCAGATCAACGTCACCTCGGAGCCCTAC GAGTCCTCCCTTCTTTGGTTTCTTTGGTACATCAAACAATGTGGTGGCGTTAAGCGAATCGTTTCTAT TAAGCGAATCGTTTCTATTAAGGGTGGAGGTCAAGAAATGAAGATGAAGGGTGGCATGCAACAGCTCA GCGAGTCAAT
GENE V.destructor vATPase subunit C (vATPc)
Database details - GenBank accession number ADDG01035752.1
Target sequence -» SEQ ID NO.3
GAAAATCTCAAGTCGTACGAGCGCAAGCAAACAGGGTCCTTACTTGTGCGCAATCTGGGAGATCTCGT ACGAAAGGAGCATTTTGTGCTTGGTTCCGAGTATCTGGTAACGCTCCTTGTCGTTGTCCCCAAAGCGT TGTTTAAGGCATGGATGGAGAACTATGCAACGCTGACAACTATGGTCGTCCCAAGAACTACGCAGCTT GTACACGAAGACCAAGATCACGGATTATTCACCGTAACACTTTTCCGCAAAGTTGTCGATGAGTTTAA GACTCAGGCTCGAGCAAACAAATTCATTGTTCGTGATTTCGAATATAACGAACAAAGCATTCAATCAG GCAAAGATGAGCGTGGTCGAATGGAAACAGAAAAGAAACGCCAGCTTGCGCTACTCATTCGCTGGTTA AAGAACAACTTCAGTGAGGCTTTTATCGCTTGGATTCACACTAAGGCACTGCGTCTCTTTGTCGAGTC GGTACTTCGCTATGGACTACCGGTTAATTTCCAGGGTATGCTACTTCATCCTCAAAAGCGTTGTATGC GCAGGCTGAGAGACGTGCTGAACCAGTTGTACAGCCATTTGGATAACAGTGCTGCA
CONSTRUCT L4440-MOA-V-ATPC-ACHE-Tricatemer ( V.destructor) Sequence identifier SEQ ID NO.4
Notes L4440 vector is shown in normal text
MOA target sequence is shown in BOLD text
V-ATPase target sequence is shown in ITALIC text AChE target sequence is shown in UNDERLINED text
GAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACT TACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGC GCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGT ATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCA GGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAAC TGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATC TAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGC GTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCT TGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTT CCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGG CCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTG CTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAG CGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAG ATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGG TAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTAT AGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAG CCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACA TGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACC GCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCAACCTGGCTTATCGAAAT TAATACGACTCACTATAGGGAGACCGGCAGATCTGATATCATCGATGAATTCGAGCTCCACCGCGGTG GCGGCCGCTCTAGAACTAGTGGATCCACCGGTTCGAACCCACTAGCCGAAATGGACGTCAACAATTTT TTCCGAACTTTAGACGATATGGGCAAAGAAATTCCGGCGGAGGCCCCGTGGAACGCTCCTCATGCCGA GGAATGGGACCAAATGACATGTAGGGAGTTCGTCAACAAAACGTGTTGGACCAAAGAGGGTCGCGAAT TCGCAGAGTTCTTCATTCAGATCAACGTCACCTCGGAGCCCTACGAGTCCTCCCTTCTTTGGTTTCTT TGGTACATCAAACAATGTGGTGGCGTTAAGCGAATCGTTTCTATTAAGCGAATCGTTTCTATTAAGGG
TGGAGGTCACGAAAGGAGCA TTTTGTGCTTGGTTCCGAGTATCTGGTAACGCTCCTTGTCGTTGTCCC
CAAAGCGTTGTTTAAGGCATGGATGGAGAACTATGCAACGCTGACAACTA TGGTCGTCCCAAGAACTA CGCAGCTTGTACACGAAGACCAAGATCACGGA TTATTCACCGTAACACTTTTCCGCAAAGTTGTCGA T GAGTTTAAGACTCAGGCTCGAGCAAACAAA TTCA TTGTTCGTGA TTTCGAATATAACGAACAAAGCA T TCAA TCAGGCAAAGATGAGCGTGGTCGAATGGAAACAGAAAAGAAACGCCAGCTTGCGCTACTCATTC GCTGGTTAAAGAACAACTTCAGTGAGGCTTTTATCGCTTGGA TTCACACTAAGGCACTGCGTCTCTTT GTCGA GAATTAGTTGCTCGCCACGATATCATTGTGGTAATAATAAACTACCGCCTGTCTGTAATGGGT TTCCTTTTTTAAACAATACGGAAGCTCCGGGCAATCAGGGACTGCATGATATTCTTTTAGCCGTAAAA TTCGTAAAGGAGAATGCGCGAGCTTTAAATGGAGATCCAGATAAGTTCACCCTATGGGGCCAGTCTGC TGGGCGTTTGCCGTCGGCTTCCTTATGGGAAGTCCTCTTGCCAGCTAGCCACGTGACGCGTGGATCCC CCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCCAA TTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAA ACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAA GAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAG CGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAG CGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTA AATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTA GGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCA CGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTT GATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAA CGCGAATTTTAACAAAATATTAACGCTTACAATTTAGGTGGCACTTTTCGGGGAAATGTGCGCGGAAC CCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAA TGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTT TTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGA TCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTC GCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGT ATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTC ACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCA TGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTT TTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACC AAACGAC Sequence identifier SEQ ID N0.5
Notes MOA target sequence
GAACCCACTAGCCGAAATGGACGTCAACAATTTTTTCCGAACTTTAGACGATATGGGCAAAGAAATTC CGGCGGAGGCCCCGTGGAACGCTCCTCATGCCGAGGAATGGGACCAAATGACATGTAGGGAGTTCGTC AACAAAACGTGTTGGACCAAAGAGGGTCGCGAATTCGCAGAGTTCTTCATTCAGATCAACGTCACCTC GGAGCCCTACGAGTCCTCCCTTCTTTGGTTTCTTTGGTACATCAAACAATGTGGTGGCGTTAAGCGAA TCGTTTCTATTAAGCGAATCGTTTCTATTAAGGGTGGAGGTCA
Sequence identifier SEQ ID NO.6
Notes V-ATPase target sequence
CGAAAGGAGCATTTTGTGCTTGGTTCCGAGTATCTGGTAACGCTCCTTGTCGTTGTCCCCAAAGCGTT GTTTAAGGCATGGATGGAGAACTATGCAACGCTGACAACTATGGTCGTCCCAAGAACTACGCAGCTTG TACACGAAGACCAAGATCACGGATTATTCACCGTAACACTTTTCCGCAAAGTTGTCGATGAGTTTAAG ACTCAGGCTCGAGCAAACAAATTCATTGTTCGTGATTTCGAATATAACGAACAAAGCATTCAATCAGG CAAAGATGAGCGTGGTCGAATGGAAACAGAAAAGAAACGCCAGCTTGCGCTACTCATTCGCTGGTTAA AGAACAACTTCAGTGAGGCTTTTATCGCTTGGATTCACACTAAGGCACTGCGTCTCTTTGTCGAG
Sequence identifier SEQ ID NO.7
Notes AChE target sequence
AATTAGTTGCTCGCCACGATATCATTGTGGTAATAATAAACTACCGCCTGTCTGTAATGGGTTTCCTT TTTTAAACAATACGGAAGCTCCGGGCAATCAGGGACTGCATGATATTCTTTTAGCCGTAAAATTCGTA AAGGAGAATGCGCGAGCTTTAAATGGAGATCCAGATAAGTTCACCCTATGGGGCCAGTCTGCTGGGCG TTTGCCGTCGGCTTCCTTATGGGAAGTCCTCTTGCCA
GENE T.castaneum Plasma membrane calcium-transporting
ATPase 1 (PMCA)
Database details - NCBI accession number XM_008201630.1
Target sequence - SEQ ID NO. 8 Target sequence is shown in BOLD UNDERLINED text
AAATCCCGATCGGCAATTGTTTGTAGTGTTTGTTTGTGTGTGAATAATTGCAGTTTTAGGAGCTTTCT CATCTAGCTGTGAGAAATGGCTACGATAGACGGCCGTCCCGCGCAATATGGAATTACCCTGAAACAGT TACGCGACCTCATGGAACATCGAGGTCGCGAAGGAGTAAATAAAATTGCTGACTTTGGAGGAGTACAA GAAATTTGTAAGAAATTATACACATCGCCCAGTGAAGGTCTTAGCGGGTCACAGGTGGACCTTGAACA TAGAAGAGAAACATTCGGATCAAACTCAATTCCTCCCAAACCTCCAAAAACTTTTCTTCAATTAGTAT GGGAAGCTTTACAAGACATCACTCTTATTATTCTGGAAGTAGCAGCCATTGTGTCTTTAGGTCTTTCT TTCTATCAGCCGCAACAAGAAGATGTCCCTTTTGACGATGATGAAACTAGTCATGGTTGGATTGAGGG TTTAGCTATTTTAATCTCCGTTATCGTAGTAGTCTTAGTAACAGCATTTAACGATTATACGAAAGAAA GACAATTCAGAGGTCTTCAGAGTCGAATCGAGGGAGAACATAAATTTGCTGTGATTCGACAAGCTGAA GTAAAACAAGTTTCCGTTAGCGACATAGTTGTAGGTGATATTTGCCAGATAAAATACGGTGATCTTTT ACCGGCAGACGGCATCCTAATCCAATCCAATGACCTCAAGGTGGACGAATCTTCTCTTACGGGCGAGT CAGACCATGTCAAAAAGGGCGAAAACTACGACCCTATGGTCTTGTCTGGCACCCACGTGATGGAAGGT TCAGGAAAAATGTTGGTTACTGCGGTTGGTGTCAACTCCCAAGCAGGTATCATCTTCACACTACTAGG AGCAGCAGTTGATGAACAGGAAGCCGAAATTAAGAAAATGAAGAAAGAAGCTAAAAAGCAGCGGAAGA AGAAAAGTCTAACAGGTGCTGACGATGA-^AACGTAACTGGTAACAGTCATATGAATTCTCCCGCTCCG GTTCCAAATAAGCTTAACGAGAGTAAACAAGAATCCAAAGAAAATCACGTATCGTCACCACCGGCGTC GGCGGAAAGTCACAAGAAAGAAAAGTCGGTTCTTCAAGCAAAATTGACGAAACTTGCCATTCAGATTG GATATGCCGGTTCTACAATTGCCGTTCTCACTGTTGTAATTTTGATAATTCAGTTTTGCGTTAAAACC TACGTTGTTGAGGGCAATTCGTGGCAAAAGAATCACGCCAGCCACTTGGTGCGTCATTTGATCATCGG TGTAACTGTACTCGTGGTGGCAGTACCAGAAGGTTTGCCGCTCGCTGTTACGCTTTCTTTAGCTTATA GTGTCAAGAAAATGATGAAAGATAACAATTTGGTAAGACATTTGGACGCTTGCGAAACCATGGGTAAT GCCACTGCAATTTGTTCGGACAAAACCGGAACTTTGACCACCAATCGCATGACCGTTGTGCAATCCTA CATTTGTGAGCAGTTGTGTAAATCCATGCCGAAATTTTCTGATATTCCTGCACATGTCGGAAATGCGA TCCTCCAGGGCATTGCGGTTAATTGCGCTTACACATCGCGAGTTATGCCTCCGGATGATCCGACCGAC TTGCCCAAGCAAGTTGGTAACAAAACTGAGTGCGCATTGTTGGGATTCGTCCTCGGTCTCGGCAAGAA CTACCAAACGATCCGCGATGACTATCCTGAGGAGAGTTTTACCCGCGTTTATACATTTAACTCTGTGA GAAAATCCATGAGCACTGTCATCCCCAGAGCGGGTGGTGGATATCGATTGTACACAAAAGGTGCTTCT GAGATGATTTTAAACAAGTGTGCCTTCATTTACGGTCACGACGGCCGTTTAGAAAAGTTCACCAGAGA TATGCAAGAGCGTTTGTTGAAGCAAGTTATCGAACCAATGGCTTGTGATGGTCTTCGGACGATCTGTA TCGCTTTCCGCGAGTTCGTGCCGGGCAAGGCCGAGATCAATCAAGTACACATAGAAAACGAACCAAAT TGGGACGATGAAGATAACATTGTCAATAACTTGACTTGCCTTTGCGTTGTCGGAATTGAGGACCCTGT ACGTCCCGAAGTACCTGACGCCATCAGGAAGTGTCAGAAGGCCGGGATTACGGTTCGAATGGTCACCG GTGATAATCTTAACACAGCCAGGTCTATCGCAACCAAATGCGGTATCGTCAAACCTAACGAAGATTTC CTCATTATCGAGGGCAAAGAATTCAACAGACGCATTCGAGACAGTACTGGAGAAGTCCAACAACATCT ACTTGACAAAGTATGGCCTAAACTACGTGTACTTGCACGTTCTTCTCCCACTGACAAATACACCTTAG TCAAAGGTATAATCGACAGCAAAGTTAACGAAAATCGTGAAGTGGTCGCCGTAACTGGTGACGGCACA AACGATGGTCCTGCGTTGAAAAAGGCCGACGTTGGTTTCGCCATGGGTATCGCTGGCACAGACGTGGC AAAAGAAGCCTCTGATATTATTTTGACTGATGACAACTTTAGCAGTATCGTCAAGGCCGTGATGTGGG GACGTAACGTTTACGACAGTATAGCAAAGTTTCTGCAGTTTCAGCTTACCGTTAACGTTGTAGCTGTT GTTGTAGCATTTATTGGTGCCTGTGCTGTTCAAGACAGTCCTTTGAAGGCTGTCCAAATGCTGTGGGT TAACTTAATTATGGATACTTTAGCTTCTCTCGCTTTAGCTACAGAACTTCCCACAAACGATTTGTTGT T GAGAAAGC C GT AC GGCAGGAC TAAACC T T T GAT T T C AC GGAC GAT GAT GAAGAAT AT T C T T GGACAA GCAGTTTACCAGTTAACTGTAATTTTTGCTCTTCTTTTTGTCGGGGACAAGTTGTTAGATATTGAATC TGGACGTGGAACCGACCTCGGTGCCGGACCTACCCAACATTTTACCGTTATCTTTAATTCTTTTGTAA TGATGACTCTCTTCAATGAGTTCAATGCGAGGAAAATCCACGGACAGCGCAACGTATTTGAGGGGATC TTCACCAATCCAATTTTCTATACAATTTGGATTGGCACGTGTGTGTCACAAATTCTTATCATTCAGTA TGGTAAGATGGCTTTTGCCACTAAAAGCCTGACCTTGGAGCAGTGGCTCTGGTGCCTCTTCTTCGGTT TAGGAACGTTGCTTTGGGGACAACTTGTTACTACAGTTCCTACTCGTAAAATACCCAAGATTCTTTCT TGGGGTCGCGGCCATCCCGAGGAGTACACTGAAGCAATTGCCATTGGCGAAGAGAAGTTCGACGTAGA TTCAGACAAGAAGCCCAGAGCTGGCCAGATCTTGTGGATCCGCGGTTTGACTAGGTTGCAAACGCAGC TGCGAGTAATCAGAGCTTTCAAGTCCACCCTGGAGGATCTGGAGGAGCGTCGCTCGGTACATAGTTTA CACAGCTTACACAGTTTGCGCAGCTCGCGAAGCCACACCGGCCCTTGGCCGCCTCGTCCTCTCTCAGA CATCACTTACATAGACGAGGACCCAACCGCCAACAAATTGTCGCCGCAACCGTCGAAGAACGAGCGCG ACGACCACCGGCTGCTATCTCCCAACACCTTGAAGCTCCCACCCCATAACCCCCAATACAATGCGCAG CACCTGGCCCCCTCCTCCGCGAACAACTCGGATTTGCCCAAGCCCGTGCATGAGACTCGCATCTAGTG CCGGTCCTGGCCGCAGAGCCGCGGCGCGCACCGCATGCATCATATCCGTTTCCGGTGTAGCTTGCCGT TGCCGTTGCCGTTGCCGCCATAGCGTAGTCGCTCTGCCTCTGCTGCTCTGCTCTCTTGACCGCTCCAG CGTCCCACCCCCGACACTTACCACCACCCCCACCAACCACTACCGCCCTGGATCCATCACCAATCAGA CGATTTTATTATCTAGTAGTAGATGTTGCCTACCACTATTGCCATCCTTGTTATTATTATAACCCTAT ACTACCCGACTATCCTTCTATCGTTTAGCTTAGCACTAAGTAGACTTTTTCTTACTTGACCAAATCTG AGTATTTTGTATTATTTTGTACATAATTTCGTCGTTCACTGTAGACTAGCTGTATGTATAGCATTTTA GATAGCCTTAGACCTCAGGTTAGTGGTAATGGAAACAAATATTTTATTTTTGAACTTGTTGAACGCAT GCACACAACTGCGAGTCATCTGTATTGTGTGTCGACCGCCAACGACATGATCAGTGTTAATAATACAT AAAAAAACAAGTCAAACGAAAAACGATCATGCGAAACGAATGATAAATTACATCAATTTTTATTTATT ATTATTTTTGTATTCGGTCAGCAGGCCACATTACTTAATACTCAATTATCTAATTTATAAGATGTTAC ATTTGTATATTGATGGTTAAAATTTCCTGTTCATTTTTTACGTCGAATATAACGTTTTTTTATACTA
T.castaneum Na/K ATPase alpha (NaK)
NCBI accession number XM_008198203.1
SEQ ID NO. 9 Target sequence is shown in BOLD UNDERLINED text
ACTTTTAGTGGGTCCGCGCCCGTCGTCGCTGCTTCTAGTGCGATTTGTGTGCAGTGGTCGACATCACA TGAAGTACAGTATTTAACACCACTCCCCGGGATATTATCACACAATCAGCATGGGGGAGTCACGGAGG AAAAATAAGAAGGTCAGGAAAGCGGACGATTTAGATGATTTGAAACAAGAATTGGACATCGATTATCA TAAAATCACCCCAGAAGAATTATATCAGAGATTCCAGACACATCCAGAAAATGGCCTCAGTCATGCGA AAGCGAAAGAGAATTTGGAACGGGACGGACCCAATGCACTCACACCCCCAAAGACTACCCCCGAATGG GTGAAATTTTGTAAAAATCTCTTCGGGGGTTTCGCTCTCTTATTGTGGATCGGCGCCATCCTCTGCTT CATAGCCTATTCTATTCAGGCTAGCACCGTGGAGGAACCAGCCGATGATAATCTTTATCTTGGCATCG TCTTAGCTGCCGTTGTTATCGTTACAGxxGTATATTTTCTTATTATCAAGAAAGCAAGAGTTCGAAGA TTATGGAGTCGTTCAAAAACATGGTCCCCCAATTCGCTACAGTGATCCGCGAGGGTGAAAAGCTGACC CTCCGCGCGGAGGACCTGGTACTGGGCGACGTGGTCGAGGTGAAATTCGGTGACAGAATCCCAGCCGA TATCCGAATCATCGAATCTCGCGGCTTCAAAGTAGACAACTCATCCTTGACAGGCGAATCCGAACCGC AGTCCCGCAGTCCGGAGTTCACTCACGAGAACCCTCTCGAAACGAAAAACTTGGCGTTCTTCTCGACC AACGCCGTCGAAGGCACTGCCAAAGGTGTTGTGATTAGTTGTGGTGACAATACCGTGATGGGTCGCAT CGCCGGTCTCGCCTCCGGTCTGGACACCGGCGAGACGCCCATCGCCAAAGAAATCCATCATTTCATTC ACCTCATTACTGGCGTGGCTGTTTTCCTCGGAGTTACCTTCTTCGTAATCGCCTTCATCCTCGGCTAC CACTGGCTCGACGCTGTTATTTTCCTCATCGGTATTATCGTGGCGAACGTGCCCGAGGGGCTCCTCGC CACCGTCACCGTGTGTCTCACCCTCACTGCTAAGAGGATGGCTTCCAAGAACTGCCTCGTGAAGAATC TCGAGGCCGTAGAGACCCTCGGCTCCACAAGCACGATCTGCTCGGACAAGACCGGAACTTTGACCCAA AACCGGATGACGGTAGCACACATGTGGTTCGACAATCAGATCATTGAAGCCGACACCACTGAAGACCA GTCGGGAGTCCAATACGACCGCACAAGTCCAGGATTCAAAGCTTTGTCGCGCATTGCCACACTTTGCA ACCGGGCTGAGTTCAAAGGGGGGCAGAACGACGTCCCGATCCTTAAACGCGAAGTCAACGGAGACGCC TCTGAAGCCGCTCTCCTCAAATGCATGGAACTGGCTCTGGGCGACGTGATGTCCATCAGACGCAAGAA CAAGAAAGTTTGCGAAATTCCCTTCAACTCGACCAACAAATACCAAGTTTCCATCCACGAGAACGAGG ACGCGAGCGATCCTCGCCATATCCTTGTGATGAAGGGCGCTCCTGAACGAATCCTCGAACGCTGCAGC ACGATCTTCATCTGCGGCAAGGAGAAAGTCCTGGATGAGGAAATGAAGGAAGCTTTCAATAACGCCTA CTTGGAGTTGGGTGGTTTGGGCGAGCGTGTGCTCGGCTTCTGCGATTTTATGTTGCCCACTGATAAGT ACCCAATTGGGTACAAATTCAATTGCGATGACCCCAACTTCCCGTTGGATGGTTTGAGATTTGTTGGC TTGATGTCCATGATTGATCCTCCCAGAGCTGCAGTGCCTGACGCCGTTGCTAAATGCAGAAGTGCCGG TATTAAGGTCATTATGGTGACGGGAGATCACCCGATTACGGCCAAGGCTATTGCAAAGTCGGTTGGGA TTATTTCGGAGGGTAACGAAACGGTTGAAGATATTGCTCAACGGTTGAATATTCCTGTCTCGGAAGTC AACCCGAGGGAAGCCAAAGCTGCCGTTGTTCACGGATCTGATCTCAGAGACCTATCTTCCGATCAATT AGACGAAATTTTGAGATACCACACTGAAATTGTATTCGCTAGAACCTCGCCGCAACAGAAGTTGATCA TCGTCGAGGGGTGCCAACGGATGGGCGCTATTGTCGCCGTGACAGGCGACGGCGTGAACGACTCGCCG GCTTTGAAGAAGGCGGACATCGGTGTGGCCATGGGTATCGCGGGTTCGGATGTGTCCAAGCAAGCCGC CGACATGATCCTGCTGGACGATAACTTCGCGTCGATCGTGACAGGAGTGGAGGAAGGCCGTTTGATCT TCGATAACTTGAAGAAATCTATTGCCTACACCTTGACCTCAAACATTCCCGAAATCTCGCCTTTCCTT GCTTTCATTTTGTGCGACATTCCTTTGCCTCTCGGTACCGTAACAATTCTGTGCATCGATCTTGGAAC TGACATGGTGCCTGCTATTTCTCTGGCTTACGAAGCCCCGGAGTCCGACATAATGAAACGTCAGCCGC GCGACCCCTATAGGGACAACCTGGTTAATCGCAGGTTGATTTCGATGGCATACGGCCAGATTGGTATG ATTCAAGCAGCTGCTGGTTTCTTCGTGTACTTTGTCATCATGGCTGAGAACGGCTTCCGCCCGACTGA CTTGTTCGGTATTCGAAAGCAATGGGACTCGAAAGCTGTCAATGATCTCACAGATTCGTACGGTCAGG AATGGACTTATCGGGACAGGAAGACATTGGAATACACTTGCCACACTGCATTCTTCGTGTCCATCGTG GTTGTCCAATGGGCCGATTTGATCATTTGTAAGACCCGTCGCAATTCGATCCTCCACCAGGGAATGCG TAACTGGGCGCTCAACTTTGGTTTGGTTTTCGAAACTGCACTCGCAGCCTTCCTGTCGTACACTCCCG GGATGGACAAGGGTCTGCGCATGTTCCCGCTCAAGTTTGTGTGGTGGTTGCCTGCAATTCCGTTTATG TTGTCCATCTTCATTTACGACGAAACCCGTCGGTTTTATTTGCGTCGCAATCCAGGAGGTTGGCTGGA ACAGGAGACCTACTATTAAGCGCATCACACCGTTTTGCGTACTGCCACCAGGTGGCACTGCGTCTGCT GCCGCAGGTCACAAATAACAACAAACAAAACAAAACAAAAAATCACCACACTCGATTGGAAGGACTCC GTTTCACCCGCCGTGACGGCGTTGTTCCTTATCGGTCGTTGTGTTGTACAAACAAATCCTGTTGCTAT TTCTAGTAAAATTTGCTGCATGCTTACGCTGCAGTCCGTACATTTGTAATTCGAGAGTTTGGTCGTGT GCGAGGGCGAGTGAATGGGTGATAGACCGAGAGCGAGGATGATTGCAAGCGGGGCCAGTTGGATTGGT TGGTTGGTTGGTCTGCAAGAGCAGCAGTAGAGACGCAATAGTGTTTTCATACATTCCAAGTTGAAAAC AGTTGCCTTAGAGCCGATGTCGGACTGTGTGCGAGTGGGTGGGGGCGGAGCCTTGACGGACGGCGGTT GGTTGTTGCGCGGCCTTCGGGGCTCCGCCACTGAACGTCTTGAACGAGGTAGTATTATTTAGGCTTTC AACACTTAGGTTAGCTAGATTGTAACTGTGTTGTTATATCGTGTTAAGTGTCATACCAGTCGTGCTCA ATACACATGACTACCAACTACTATCACGATTGTAAACGTTTGACATTCGTTTCGTTTGTTGTGTATAT AGTTTACGTAACGGGCGGGTAGCAGTTACACTGTGTAGGCAGCACGAGTCCATAATATTGTTTCTAAC ATTGTTACGTTACGTGCGGTTAGTTGTTCAACGTTGGAGACACACTTCTGGAGGTCTGCTTCTGTAGA GCCCTATTTTCTTATACTCTCTGATGCGCGCTGCGTTGGTCTGAGACCAGCCGACCACGGTATTGTTA TCTTATTATTGTAAATATTTTTAAGTGATCACTTAATTATTTTTGCTTGTGTTCTTTTCACATTCATG TTTTAGTATGTAACGAAGCTGTATAAATTTGGGTTTTAATAAAATGGATGATAGTATTACATTACAAA
GENE T.castaneum A DP/A TP translocase (ADP)
Database details NCBI accession number XM_968164.3
Target sequence SEQ ID NO. 10
Target sequence is shown in BOLD UNDERLINED text
GCTCGTTCTGTCAAAACTGCCTCTTTCGTTCCCGAACAACCATCCGGTGTTAACGTGTACGAGTGTAA AAACCTTCAAAATGCCCACTGATCCCATGAGTTTCGCCAAGGATTTCCTCGCTGGGGGCATCTCGGCG GCTGTGTCCAAGACAGCGGTGGCCCCCATCGAGCGCGTGAAGCTCCTCCTCCAGGTCCAAGCCGCTAG CAAGCAAATTGCCGCCGACAAACAGTATAAAGGGATCATCGATTGCCTGGTCCGTATCCCCAAAGAAC AGGGATTCTTCAGTTTCTGGCGTGGAAATCTCGCCAACGTGATCCGTTATTTCCCAACCCAGGCATTG AACTTCGCCTTCAAGGATGTCTACAAACAGATGTTCTTGGGCGGTGTTGACAAAAACACCCAATTTTG GAGGTATTTCGCCGGTAATTTGGCGTCAGGTGGTGCCGCTGGTGCGACATCACTTTGCTTCGTCTACC CTCTAGATTACGCTCGTACTCGTTTGGGCGCCGATGTCGGCAAAGGCAAGGGCGAAAGGCAGTACACC GGCCTTCTGGACTGCATTAAGAAGACAGTGAAATCGGACGGACCGATCGGTTTGTACCGAGGTTTCGT TGTCTCAGTGCAAGGTATCATCATCTACCGTGCCTCCTACTTCGGCTTCTTCGATACTGCCAAGGGAA TGTTGCCCGATCCCAAGAACACACCGTTCCTCATCTCATTCCTTATTGCACAGTGCGTAACGACAGTT TCTGGAATTACGTCATATCCATTCGACACCGTCAGAAGGCGTATGATGATGCAGTCTGGACGCGCTAA AGCTGATATTATGTACAAGAATACGTTGGATTGCTGGATCAAGATCGGCAAAACCGAAGGCCCAACTG CCTTCTTCAAAGGAGCGTTCTCTAACGTTCTCCGTGGCACTGGCGGAGCTTTGGTTCTTGTACTATAC GACGAGCTTAAAGCTTTGCTCTAAACAGAAATAGTAGAATTATTACGGTTTAAATTATTAATTGTCTC ATAATTTATTTGTTTCATTCCGTGGTTGATGCATTTTTTAGGCCGACATTCCTTTTTTTAACACTATC AGGCGCAGGAATTTACATTCCAGCAATTTTTTTTCGTTACACGGTTTTAATAATGGCATTGTAAGCTG AAGTATTGATAGCCCTGTATTTTAAATCCTGTATATTTTAACAGCCGTTTACCAATAAACAGTTGTGA TAAGTTACTTTA
GENE T.castaneum vATPase subunit E (vATPe)
Database details NCBI accession number XM_965528.2
Target sequence SEQ ID NO. 11
Target sequence is shown in BOLD UNDERLINED text
GTCAAAATCATATGATCAATCAGTCTGTCACACTTTTGAGACAAGTTTTACTATAAAGGCGTTGTCTA AGGTGTCCCGTGAATTCAACCAATTTATTTCATTTAAAAAGTGTTAAAAACAATCTCCAACAATGGCA CTAAGCGATGTCGACGTCCAAAAACAAATCAAGCATATGATGGCTTTCATTGAGCAAGAAGCCAATGA AAAAGCCGAAGAAATCGATGCGAAAGCTGAGGAGGAGTTTAACATTGAAAAAGGGCGCCTGGTCCAAC AACAGCGCTTGAAGATCATGGAATATTACGAGAAGAAGGAGAAACAGGTGGAATTGCAGAAGAAAATT CAGTCGTCAAACATGCTGAACCAAGCCCGTTTGAAAGTATTAAAAGTGCGTGAAGACCACGTCCACAA TGTGCTGGATGACGCCCGCAAACGTCTGGGCGAAATCACCAATGACCAGGCGAGATATTCACAGCTTT TGGAGTCTCTCATTCTCCAGAGTCTCTACCAGTTGTTTGAGAACAATATAGTGGTGAGAGTCAGGCAA CAGGACAGGAGTATAATCCAGGGCATTCTCCCAGTTGTTGCGACGAAATACAGGGACGCCACTGGTAA AGACGTTCATCTTAAAATCGACGATGAGAGCCACTTGCCATCCGAAACCACCGGAGGAGTGGTTTTGT ATGCGCAAAAGGGTAAAATCAAGATTGACAACACCTTGGAGGCTCGTTTGGATTTAATCGCACAGCAA
CTTGTGCCAGAAATTCGTACGGCCTTGTTTGGACGTAACGTCAACCGTAAATTCACCGATTAAATATT
ATCAAGACAATTTTTCATCTCGTTAAAAATAACATTTTTACTGTAATTCCAAGCATTTTTAATGCACC ACCATAATGTAAAATAAAATTGTTGCTTACTGTACCAATGTTGTATATTAAATTATTTAGAATTGTAT TAAGAAGTATTCCATTTTTTGTGTAGTTGCGTTTGTAGCTATTCAAGGTCGTGGTGGTTGGTAACCTC ATGTAATCAAATGTACAACCCCATTTGTAAATAGATGGTTTTATGTTGAAACAATACATGTTACAAAT TA
GENE T.castaneum Calcium-transporting ATPase sarcoplasmic
/endoplasmic reticulum type (SERCA)
Database details -» NCBI accession number XM_961690.3
Target sequence -» SEQ ID NO.12
Target sequence is shown in BOLD UNDERLINED text
GGACGTGCCGATGATAAACTGCATGTTATCTGCCTCCTTAAAATAAGTGCAAGGCATGTGCGTCTATT TCGGTAATTTGGAAATTGCGGCGCGCGTTCAAATCGGCGAAAATGTAAAATGCGGGCGCTTAGGGGAG GCCCGAAGGCCCGGGTTGGCACTTTGCCCATGGACAGCGTCCCCGACAGGTAGCTACCGAGCTTATAA AAGCCCCGACAAACTTCGTCCGGCGCCCGTTCGTTTAGCAGCTTAGTACACGTTGCGCTCATCCATGG GGGCCTAACCACTTCGTGTTAGTTTTTATTTATACAAAGCGTTATCGAGTGATACGACTGGGACCACA ATTGTGATAGCGAAGTGACTGACAAACACCATGGAGGACGGACACACCAAAACGGTGGAAGAAGTATT AAACTATTTCAATACCGACCCAGAACGGGGGCTCACCTTAGATCAAGTCAAAAGAAACCAAGAAAAAT ATGGACCCAATGAACTTCCAGCGGAAGAAGGAAAGTCCATTTGGCAATTAGTTTTAGAACAGTTCGAT GATCTACTAGTCAAGATTTTATTGTTGGCCGCCATTATTTCATTCGTTCTCGCTTTATTTGAAGAACA CGATGGAGCTTTCACCGCTTTCGTAGAACCTTTCGTTATTCTTCTCATTCTTATCGCCAATGCAGTCG TCGGTGTCTGGCAGGAACGAAATGCCGAATCGGCCATTGAAGCGCTCAAAGAGTACGAGCCCGAAATG GGCAAAGTCCTCCGCGGCGACAAATCCGGCGTCCAGAAAATCCGGGCGAAAGAAATCGTCCCCGGAGA CATCGTCGAGGTCTCCGTCGGCGACAAAATCCCCGCTGATATTCGTCTAACAAAAATCTTTTCGACAA CTTTGCGCATTGATCAGTCGATTTTGACCGGAGAATCGGTCTCAGTCATCAAACACACCGACGCTATT CCCGACCCACGTGCCGTCAACCAGGACAAGAAAAACATCCTCTTCTCGGGTACCAATGTAGCGGCTGG CAAGGCACGTGGTGTTGTCGTTGGCACCGGCTTGAACACTGCGATCGGTAAGATTCGTACCGAAATGT CCGAAACTGAGGAAATCAAAACGCCGCTGCAACAAAAACTTGACGAGTTTGGCGAGCAATTGTCGAAG GTTATTTCTGTGATTTGTGTCGCTGTTTGGGCCATCAATATTGGGCATTTTAACGATCCGGCCCATGG CGGGTCCTGGATCAAGGGTGCTGTCTATTACTTTAAAATTGCCGTTGCCCTGGCTGTGGCTGCGATTC CCGAGGGCTTGCCTGCTGTTATTACGACTTGTCTGGCTTTGGGCACGCGCCGTATGGCCAAGAAGAAC GCAATTGTTAGGTCACTACCGTCTGTTGAAACCCTGGGTTGCACTTCGGTCATCTGTTCGGACAAGAC CGGCACTTTGACCACCAATCAAATGTCCGTTTCGCGCATGTTCGTGTTCGAGAAGGTTGAGGGTAGCG ATAGCAGTTTCCATGAGTTTGAAATCACCGGTTCGACGTACGAACCAATCGGCGAGGTTTTCCTCAAA GGCCAGAAGGTCAAGTGTTCTGAATACGAAGGTCTGCAAGAACTTGGCGTTATCTGCATTATGTGCAA CGACTCTGCCATCGATTTCAATGAGTTTAAGCAAGCGTTCGAGAAGGTCGGTGAAGCTACCGAGACTG CGCTGATTGTCCTGGCCGAGAAGATGAATCCGTTCCAAGTCACCAAGGCTGGTGATCGTCGCCAGACG GCCATTTGCGTGCGCCAGGACATTGAGACCAAGTGGAAGAAGGAGTTCACGCTGGAGTTTTCGCGCGA TCGCAAATCGATGTCTTCCTATTGTGTTCCTTTGAAGCCCTCGCGTCTGGGTAATGGTCCTAAGCTGT TCGTTAAAGGTGCCCCTGAAGGTGTGCTCGAGCGGTGCACGCATGCCCGTGTTGGTACCCAGAAAGTT CCTCTTACTAACACGCTCAAGAACCGGATTTTGGATTTGACGAAAGTTTACGGTACTGGACGGGACAC TCTCCGTTGTCTTGCGCTTGCGACCGGCGATAACCCGATGAAGCCCGAAGAGATGGACTTGGGTGATT CCACCAAATTCTACACTTATGAAGTTAATCTCACCTTTGTGGGTGTTGTGGGGATGTTGGATCCTCCA CGTAAGGAAGTTATGGATTCGATTGCCAGGTGCCGGGCGGCTGGTATTCGGGTTATTGTTATCACTGG TGATAATAAGGCTACTGCTGAGGCTATCTGCAGACGTATTGGTGTCTTTACGGAAGATGAGGATACAA CTGGAAAATCTTTCTCTGGAAGGGAATTTGACGATTTGAGTCCGGCTGAACAAAAGGCCGCCTGTGCC AAAGCCAGGCTGTTCTCACGTGTGGAGCCCGCTCACAAATCCAAGATTGTTGAATATTTGCAAAGCAT GAACGAAATTTCCGCTATGACTGGTGATGGTGTCAACGACGCCCCAGCCTTGAAGAAGGCCGAGATTG GCATTGCCATGGGTTCTGGAACGGCCGTCGCTAAATCAGCCTCTGAGATGGTCTTGGCCGACGATAAC TTCTCGTCCATTGTAGCAGCGGTTGAAGAAGGTCGCGCCATTTACAACAACATGAAACAGTTCATCCG TTACCTGATTTCCTCGAACATCGGTGAAGTCGTATCAATTTTCTTGACGGCTGCTCTTGGTCTTCCCG AAGCTTTGATCCCCGTACAACTTTTGTGGGTCAATTTGGTAACTGACGGTCTCCCCGCTACTGCATTA GGTTTCAATCCACCCGACTTGGACATCATGTCAAAACCGCCCAGAAAAGCCGACGAATCGCTCATTTC CGGCTGGTTGTTCTTCAGGTATCTCGCAATTGGTGGCTATGTCGGTGCTGCAACTGTTGGTGCTGCCG CCTGGTGGTTTATGTACTCGCCTGAAGGCCCACAAATGAATTATTACCAATTGACTCATCACTTGCAA TGCATCAGCGGTGGGCCTGAATTCAAAGGTATCGACTGCAAGGTCTTCAACGATCCTCATCCCATGAC CATGGCTCTCTCTGTACTCGTAACTATTGAAATGCTGAACGCTATGAACAGCTTGTCTGAGAACCAGT CGTTGATTGTCATGCCCCCATGGTCCAACTGGTGGTTGATGGGCTCGATGGCTCTGTCCTTCACCCTT CATTTTGTTATTCTTTACATTGATGTCTTATCCGTTGTGTTCCAAGTGTGTCCATTGACCGGAGACGA GTGGTTAACTGTAATGAAATTCTCAATTCCAGTAGTATTACTTGATGAAACGCTCAAATTCGTCGCAA GAAAGATCACAGATGGTGAGAGTCCAATTTACACTGTGCATTGGATTGTACTAATGTGGGCCGTTTTC TTTGGTTTACTGTGTGTGAGCCCCATCTAAGTGTGACTGCCTCCTTGGTCGAGGACAGTGTTAGTGCG TAAACGGGTGTCAATAGTAGGACCAACTTTTTTTCACTTAATTTGTTTATATCAAGTGCCCTTGATTG ATTGATTATCAAAAAAAAGTAATAAAAAGTGCAGTTTTAAATTAGATTTTTAATAATGGGATGGGTTA GGTTAACGCTTTGAATACTGAATCTCGTTTACTCACTAACTGTGCTACATAACTCTGCTAGCGCCCCC TAGTACCCTAAGAACAGGCGTCTTCCAGCACCTCGTTCAAGGCATGCCTCATGCCTGTGATCAATAAC AAGTGCATGCCTTGAACGCGATCGACAAGAACAGGCAAGTTGGTAAACCTCAAGTGTTGTGATCATAG ACAAAAGCGAATAAAAGTGCATGGTTCAATAAAACGCAACAAGACTGACAGTTTTGACCAGCAACGAA TGTTACAGACCATACGATATGGCGTAAATTAGTGAAATTAATACAAGCGAGAGCATGATGTTTGTTTG TTGATCAGAAGTAGTTTCAAATTTATGGCGCGTTTCGTAGAGATTTCGGTGATATTTTTAATAGTGCT CGTCCATTTTACTTAGAAACATAGCCATTCGTGTACTTATGCAGTAAATTTGAAATTATCACTGGTTC ACGTCTCTTACCCCTTGAGTTGAAGCGATTTTCGTAGATTCAATTTGTATAACAATTACAAAACAATT TTGTGATTTACTAGTTTATTTATTGGCGCGTCTTCGACGCGCTCGTCGGTGTTTCGGCAAATAGTTTT CATTTTCACAAGTATAACACTGGAGGAAAGTCTTTTTATTCATTGGGGGAGGATACATGTCTTTCTTC CCCTGGTGTACAAATAGCCACTGTGTGCAGTTTGATTGAGATTTCTAAATAGGTTTTTCTTTGGAAAC TGTTTGTCTTACACTATGTAAACTGTTACAAAAATGTACATATTTGTAATGGGCAGTGTTATTGAAAT AATAAAGTTATAAACGTTTTCAGTGTGTTTGCCATTAACTGTTTTGCA
GENE -» T.castaneum a-tubulin 1 (aTUB)
Database details -» NCBI accession number XP_966492.1
Target sequence -» SEQ ID N0.13
Target sequence is shown in BOLD UNDERLINED text
ACGACAGTTGAAAATCGAATCAAAGTCGTTTGGAAAAAGCCAGAGCTTGTATTTCCGAAGCGTACTCC CGTTTTTCTGCTCTTTTGTGGTGTAATTTGTAAAACTCAACTACCAAAATGCGTGAATGTATCTCAGT TCATGTCGGCCAAGCCGGAGTCCAGATCGGCAACGCCTGTTGGGAATTGTACTGTTTGGAACATGGAA TCCAACCCGACGGCCAAATGCCCTCTGATAAAACTGTCGGGGGCGGTGACGACAGTTTCAACACCTTC TTCAGCGAGACCGGTGCTGGAAAGCACGTCCCGAGGGCCGTCTTCGTCGACTTGGAACCCACTGTCGT CGATGAGGTCCGCACCGGGACTTACCGCCAGTTGTTCCACCCCGAACAATTGATCACTGGCAAAGAAG ACGCCGCCAATAACTACGCCAGAGGCCACTACACCATTGGCAAGGAAATCGTCGACTTGGTTTTGGAC CGCATCCGTAAATTGGCCGATCAATGCACGGGGCTCCAAGGTTTCTTGATTTTCCACTCGTTCGGTGG AGGCACCGGCTCAGGGTTCACTTCCTTGTTGATGGAAAGATTGTCGGTTGATTACGGCAAAAAATCGA AATTAGAATTCGCTATTTACCCCGCACCTCAGGTTTCTACAGCCGTTGTGGAGCCGTACAACTCGATC TTGACCACTCACACCACTTTGGAGCATTCTGACTGTGCCTTCATGGTCGACAATGAGGCGATCTACGA TATTTGTCGCCGAAACTTGGACATCGAACGCCCGACTTACACCAACTTGAACAGATTGATCGGCCAAA TTGTCTCCTCAATCACCGCTTCGTTGCGATTCGATGGGGCTTTGAACGTTGACTTGACCGAATTCCAG ACCAACTTGGTACCTTACCCACGTATCCACTTCCCTCTAGTCACCTACGCCCCAGTCATTTCCGCCGA GAAGGCCTACCATGAACAATTATCCGTTGCGGAAATCACCAACGCCTGCTTCGAGCCCGCCAACCAGA TGGTCAAATGCGACCCACGTCATGGTAAATACATGGCTTGCTGCATGTTGTACCGTGGAGATGTTGTC CCCAAGGATGTCAACGCGGCTATTGCCACCATCAAGACCAAACGTACCATTCAATTCGTTGACTGGTG TCCAACTGGGTTCAAAGTTGGTATCAACTACCAACCACCCACCGTCGTGCCAGGAGGTGACTTGGCCA AGGTACAACGTGCTGTTTGCATGTTGTCCAATACCACTGCTATCGCCGAAGCTTGGGCTCGTTTGGAT CATAAATTCGACTTGATGTACGCCAAACGTGCTTTCGTCCACTGGTATGTGGGTGAAGGTATGGAAGA AGGTGAATTCTCTGAAGCTCGTGAAGATTTGGCCGCTTTGGAAAAGGATTACGAAGAGGTCGGCATGG ACTCCGGAGAAGGAGAAGGCGAAGGTGGCGAAGAGTATTAAACGACAACTCGTTTAAAAAATTTCGAA ATTTTCCGATTTTTTTTACGAAACTTTTGAGTCTGATTTATTTCAATACATTTTTCCAACTCTGT GENE -» T.castaneum Heat shock protein 90 (HSP90)
Database details - NCBI accession number NP_001094067.1
Target sequence - SEQ ID NO.14
Target sequence is shown in BOLD UNDERLINED text
GCAACCGAACAAACACGAATCGCTCAGAGTTGAAAAAGCAAGCGCTAAGTGAAGAGCTAAAAAGCGAC AAATTTCCCAAGTGATAATTTTCCCAAAGCAATTTTCAAGTGATTTGTGCGTGTGTGCATTAATTTAA GCAAGGTAGGTGCAAATTTTCCTATTTTCCGGCCGTTTTCAGTCAAGGTTATGTCAAGCCGGTGTTTG ACCCCCAGGTCTGGGAAATCGTACGTTTTTCGCTAGGTTGCGGTTATTTGAGACGAGTTTATTAATCC TTTGACTATTTTAACGAATTTGAAGACCGCTTTACAGTTTTCCCGTTTTTTGTGTGGTTTTCTGCCAA GGTTATTCAGAGCGGTCTTTGACATTGCTACGGAATTTAGTCAAAATTTCCGGACTTTTCCACGTTGT TCAGTGTCCGATTAGTCATTTTTTAGTGATTCATGAGTTCGGTGAAATTTCAAGGTCGAATTTAATTG CAGATGCCGGAAGAAAACCAAAATGGAGATGTGGAAACCTTCGCCTTCCAGGCGGAAATCGCCCAGTT GATGAGTCTGATCATCAACACCTTCTACTCGAACAAGGAAATTTTCCTTCGGGAGTTGATTTCCAATT CGTCAGATGCGTTGGATAAAATCCGTTACGAGTCCTTGACCAACCCTTCCAGACTCGATTCAGGCAAA GAACTCTACATCAAGATCATCCCTAACAAGAATGACGGGACCTTGACCATTATTGACACCGGTATCGG GATGACTAAAGCCGATTTGGTCCATAACTTGGGCACCATCGCCAAGTCCGGCACCAAGGCCTTCATGG AGGC CCTCCAAGCTGGGGCTGACATCAGCATGATCGGTCAATTCGGTGTCGGTTTC TACT CGGCTTAC TTGGTAGCCGACAAGGTCACAGTCGTTTCGAAGAACAACGATGATGAGCAATACGTTTGGGAGTCGTC AGCTGGTGGTAGCTTCACTGTAACACAAGACCGTGGCGAGCCTTTGGGCCGTGGCACCAAGATTGTCC TTCACATGAAAGAGGACCAAACCGAATTTTTGGAAGAACACAAAATTAAAGAAATTGTAAAGAAACAC TCGCAGTTCATTGGCTATCCCATCAAATTGGTCGTGGAGAAGGAACGCGAGAAGGAGTTGAGCGACGA TGAGGCCGAAGAAGAGAAGAAGGAGGAAGAAGGC GAAGAC AAGGATAAAGATAAGCCAAAGATTGAGG AT GT AGGC GAGGAC GAAGAT GAAGAC AC GAAGAAGGAAGAT AAGAAAAAGAAGAAGAC T AT T AAGGAG AAATACACAGAAGATGAAGAATTGAACAAAACCAAGCCGATTTGGACAAGGAACGCTGACGATATCAG TCAGGAAGAATACGGAGAGTTTTACAAATCGTTGACTAATGATTGGGAGGACCATTTGGCCGTCAAAC ACTTTAGTGTTGAGGGTCAATTGGAGTTCCGTGCCCTCCTCTTTGTCCCACGTCGCGTTCCATTCGAT CTTTTCGAAAATAAGAAGCGCAAGAATAATATTAAATTATACGTGAGGAGGGTCTTCATTATGGACAA CTGCGAAGAACTCATCCCCGAATATTTGAACTTTATCAAGGGTGTCGTCGATTCGGAAGACTTGCCTT TGAACATTTCCCGTGAGATGTTGCAACAAAATAAGATCTTGAAGGTCATTCGTAAGAATTTGGTCAAG AAATGCCTAGAGTTGTTCGAGGAGTTGGCCGAGGATAAGGACGGCTACAAGAAATTCTACGAACAGTT CTCGAAGAATATTAAATTGGGTATTCATGAAGACTCGCAAAACCGGGCCAAATTGTCCGAATTGCTCC GTTATCACACTTCTGCAAGTGGCGATGAGGCTTGCTCTTTGAAGGACTACGTGAGCCGCATCAAGCCT AACCAGAAACACATTTATTACATTACTGGCGAi^AGCAAGGAGCAAGTGGCGAATTCGTCGTTCGTTGA
GAGGGTCAAGAAGCGCGGTTTCGAGGTCGTTTACATGACTGAGCCCATTGATGAATACGTCGTACAAC AAATGAAAGAATTCGACGGCAAAACTCTCGTTTCGGTCACAAAGGAAGGTCTCGAATTGCCTGAAGAC GAAGAAGAGAAGAAGAAGCGCGAAGAAGACAAAGCCAAATTCGAGGGACTTTGCAAGGTTATGAAGAG CATCCTCGATAATAAGGTTGAGAAGGTCGTGGTATCGAACCGTCTAGTCGAATCTCCCTGCTGTATTA CGATGCGCAGGTATGGCTGGACCGCCAACATGGAACGTATCATGAAAGCACAAGCTTTGAGAGACACC TCCACTATGGGCTACATGGCAGCCAAAAAGCACCTCGAAATCAACCCCGACCCTTCCATCCTTAAAAA TTTGAGACAGAAGGCCGAGGCTGATAAGAACGACAAGGCTGTTAAAGACTTGGTTATTCTTTTGTTCG AAACCGCTTTACTCAGCTCTGGGTTCACCTTGGATGAGCCTCAAGTCCACGCATCCAGGATCTACAGG ATGATCAAGCTGGGTCTGGGTATTGATGAGGAGGAAGCCATGATCACCGAAGATGCACAAGGAGGCGA TGCACCCTCTGCTGATGCCGCCGAGTCCGAGGACGCGTCGAGGATGGAGGAAGTTGATTAAGTGTTCG GATGTTAGGACATGTGTTCTAGTATGTTCTAATTGTCATTCCTAGTGTTTTTTATATTTCTTAATTAT TTTTATAAAAAATGAAGTATTATTTTGGCGGCCTACCGCCGCCGTGTTAACACCTGTAAAAGTCTGAG TTCGTTTTTTGTGAATAAAATTGATTTAATGAATTTCTTGGTTTTATTTAAACGCCTTTAGCAAATAA TTGTTGAAAAGCAAAAAAATCGATCACAAATTAGGCTTGGCTTCGCAAAATCAAGTCACGTGACACAT TTGACAGATGTTTGAGTGAATCTTAACCTTAAAAATGGAACCGGACGAAAAAAGCAAGAGCCAAAAGC CGGCCCCTACAGGTAACTCGCTCCCAAAACGGGACTTTTAGTCCAATTTCGCGTTTCTAGACGATCCG GAATGCATTTATCGCATTTACACGTCTCTCTTACTCATCGTCTCGAATCACATCTGGTAGATCGAAAC CTGGAGTCATCAGGAGTTCGATCCTCTGGGCAATGCGATACAGGGTGCT
CONSTRUCT L4440-PMCA-NAK-ADP Tricatamer
Sequence identifier SEQ ID N0.15
Notes L4440 vector is shown in normal text
T7 sites are shown in BOLD & UNDERLINED text
PMCA target sequence is shown in BOLD text
NaK target sequence is shown in ITALIC text
ADP target sequence is shown in UNDERLINED text
GAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACT TACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGC GCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGT ATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCA GGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAAC TGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATC TAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGC GTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCT TGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTT CCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGG CCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTG CTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAG CGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAG ATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGG TAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTAT AGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAG CCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACA TGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACC GCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCAACCTGGCTTATCGAAAT TAATACGACTCACTATAGGGAGACCGGCAGATCTGATATCATCGATGAATTCGAGCTCCACCGCGGTG GCGGCCGCTCTAGAACTAGTGGATCCACCGGTTCTAATACGACTCACTATAGGGAGACAGGAAGCCGA AATTAAGAAAATGAAGAAAGAAGCTAAAAAGCAGCGGAAGAAGAAAAGTCTAACAGGTGCTGACGATG AAAACGTAACTGGTAACAGTCATATGAATTCTCCCGCTCCGGTTCCAAATAAGCTTAACGAGAGTAAA CAAGAATCCAAAGAAAATCACGTATCGTCACCACCGGCGTCGGCGGAAAGTCACAAGAAAGAAAAGTC GGTTCTTCAAGCAAAATTGACGAAACTTGCCATTCAGATTGGTTCTTGGCATCGTCTTAGCTGCCGTT GTTATCGTTACAGGTATATTTTCTTATTATCAAGAAAGCAAGAGTTCGAAGATTATGGAGTCGTTCAA AAACATGGTCCCCCAATTCGCTACAGTGATCCGCGAGGGTGAAAAGCTGACCCTCCGCGCGGAGGACC TGGTACTGGGCGACGTGGTCGAGGTGAAATTCGGTGACAGAATCCCAGCCGATATCCGAATCATCGAA TCTCGCGGCTTCAAAGTAGACAACTCATCCTTGACAGGCGAATATTACGCTCGTACTCGTTTGGGCGC CGATGTCGGCAAAGGCAAGGGCGAAAGGCAGTACACCGGCCTTCTGGACTGCATTAAGAAGACAGTGA AATCGGACGGACCGATCGGTTTGTACCGAGGTTTCGTTGTCTCAGTGCAAGGTATCATCATCTACCGT GCCTCCTACTTCGGCTTCTTCGATACTGCCAAGGGAATGTTGCCCGATCCCAAGAACACACCGTTCCT CArcrCArrCTCTCCCTATAGTGAGTCGTATTAGCTAGCCACGTGACGCGTGGATCCCCCGGGCTGCA GGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCCAATTCGCCCTAT AGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGT TACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCA CCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTA AGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCC TTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGC TCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGT TCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAA TAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAG GGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTT AACAAAATATTAACGCTTACAATTTAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGT TTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATA ATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCAT TTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGT GCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGA ACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCG GGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACA GAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAA CACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACA TGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGAC
Sequence identifier SEQ ID N0.16
Notes PMCA target sequence
AGACAGGAAGCCGAAATTAAGAAAATGAAGAAAGAAGCTAAAAAGCAGCGGAAGAAGAAAAGTCTAAC AGGTGCTGACGATGAAAACGTAACTGGTAACAGTCATATGAATTCTCCCGCTCCGGTTCCAAATAAGC TTAACGAGAGTAAACAAGAATCCAAAGAAAATCACGTATCGTCACCACCGGCGTCGGCGGAAAGTCAC AAGAAAGAAAAGTCGGTTCTTCAAGCAAAATTGACGAAACTTGCCATTCAGATTGGT
Sequence identifier SEQ ID NO.17
Notes NaK target sequence
TCTTGGCATCGTCTTAGCTGCCGTTGTTATCGTTACAGGTATATTTTCTTATTATCAAGAAAGCAAGA GTTCGAAGATTATGGAGTCGTTCAAAAACATGGTCCCCCAATTCGCTACAGTGATCCGCGAGGGTGAA AAGCTGACCCTCCGCGCGGAGGACCTGGTACTGGGCGACGTGGTCGAGGTGAAATTCGGTGACAGAAT CCCAGCCGATATCCGAAT CATC GAATCTCGCGGCTTCAAAGTAGACAACT CATC CTTGACAGGCGAAT
Sequence identifier SEQ ID NO.18
Notes ADP target sequence
ATTACGCTCGTACTCGTTTGGGCGCCGATGTCGGCAAAGGCAAGGGCGAAAGGCAGTACACCGGCCTT CTGGACTGCATTAAGAAGACAGTGAAATCGGACGGACCGATCGGTTTGTACCGAGGTTTCGTTGTCTC AGTGCAAGGTATCATCATCTACCGTGCCTCCTACTTCGGCTTCTTCGATACTGCCAAGGGAATGTTGC CCGATCCCAAGAACACACCGTTCCTCATCTCATTC Aedes aegypti Tubulin beta chain (bTub)
NCBI accession number XM_001655975.1
SEQ ID N0.19
Target sequence is shown in BOLD text and flanked by primer sequences, which are UNDERLINED
ACTAGTCCCCTTCAGAGCAGCTCATTTAGTGTGTGATCGTCAAGGAGTACAGTCTCGGCGTTCTTTGATT GTTGCCCGTTTGTGTCTTCTTTCTGTGCTTTGAGGAGAGAAAAGCAGCAGAAGAACAGAAAAAAAGGAGT GAAGTGTGAAAAACAGACAAGTTTTAAAACTCGAATTTAAGAGCAGCCCTCGCCAAAGGCTACGCCGAAG TTTCTCTGTTAATTTGTTAAGAAACAAAAAAAAACCTTTCACCATGAGAGAAATCGTCCACATCCAAGCC GGTCAGTGCGGAAACCAAATTGGAGCTAAGTTTTGGGAAATCATCTCCGACGAACATGGAATCGACGCCA CCGGAGCCTACCATGGTGACTCAGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAAGCCTCCGG CGGCAAATACGTGCCACGTGCCGTGCTAGTCGATCTGGAACCCGGTACCATGGACTCCGTCCGCTCGGGG CCATTCGGACAGATCTTCCGCCCGGACAACTTCGTCTTCGGACAGTCCGGTGCCGGTAACAACTGGGCCA AGGGACACTACACCGAGGGTGCCGAACTGGTCGATTCAGTGTTGGACGTTGTCCGCAAAGAAGCCGAATC GTGCGACTGCCTGCAAGGATTCCAGCTGACCCACTCGCTCGGAGGTGGTACCGGCTCCGGTATGGGCACA CTGTTGATCTCGAAAATCCGCGAAGAATATCCCGACAGAATCATGAACACATACTCAGTTGTCCCCTCGC CAAAAGTATCAGACACCGTCGTAGAACCGTACAACGCCACCCTCTCAGTGCACCAGCTGGTCGAAAACAC CGACGAGACGTACTGTATCGACAATGAAGCCCTGTATGATATCTGCTTCCGCACCCTGAAGCTCACAACC CCAACCTACGGTGATCTGAACCATCTCGTGTCACTGACCATGTCCGGAGTTACCACCTGCCTGCGTTTCC CTGGTCAATTGAATGCTGATCTCCGAAAACTGGCTGTCAACATGGTTCCATTCCCACGTCTGCACTTCTT CATGCCTGGATTTGCCCCACTCACCTCCCGCGGATCGCAACAGTACCGTGCCCTCACCGTCCCAGAACTG ACCCAACAGATGTTCGATGCCAAGAACATGATGGCCGCCTGCGACCCACGACATGGACGTTACCTGACAG TTGCCGCCGTTTTCCGAGGACGCATGTCGATGAAGGAAGTCGATGAACAGATGCTGAACATCCAAAACAA GAACAGCAGCTACTTCGTTGAATGGATCCCCAACAACGTTAAGACCGCCGTCTGTGATATTCCTCCACGA GGACTGAAGATGTCTGCCACCTTCATCGGTAACTCGACCGCCATCCAGGAACTGTTCAAGCGTATCTCCG AACAATTCACTGCTATGTTCCGTCGTAAGGCTTTCTTGCATTGGTACACTGGCGAGGGTATGGATGAGAT GGAATTCACTGAAGCCGAAAGCAACATGAACGATCTGGTGTCCGAATATCAGCAATACCAGGAAGCCACC GCCGACGAGGATGCTGAATTCGACGAAGAACAGGAAGCTGAAGTTGACGAAAACTAAACTAATTGAGCTC TCACTCACACACACGAACCTGCCTCCCCTTCTATACAAATCTCCCCATCCCCCTCAAAGGGAAACTCTAC TCTCTCATTCCAAAAAAAAAAAAACTTTCCTCTATCTGCGCCACTTCTACTACTAATCTCAAAAAGTACC AATTCAGAGAGAATGCAACGTTCTTTTTTCGAAAAGAAAAACGAAAAAGTATCGATCAGGAGAGAATACA ACATCATCAAGCGAAAACCACAAAACAACAGCAGAAATGTGAAGAAAAAAACGCAGCAGCAGTAACACCA ACAAAACAGCCAGCGCAGCAAAAAAAAATCCTACAAAACAACTAAAAAAGAGTCGAAAAATAGCAAGAGA AAAGTCGCAAAATTAGTAACCACTGCCAGCTCAGCAAAAAAGAAAAGAATAAAAGTGAAGTAATTTAAAA AAAAACGGAAAACAAACTAAAATCAATTTCCTCTTGTTTGATTTTATTCTTTAGTGCACTTTTTTGCTTC AAAAACCCCCCAACAAGAGAAACTGCCATTTCGTTCGTTAGGTTTGTTCGGAGATCCCATCATTCCACAC CGCCTATCCAAGCGAACTCTCTTCTCTGATTTGTGTTGATTTCGTGTTTTGCATATTTCTTCCCACTTCT CTCTTCCCACACTTTCGTATTCGTCTCTCTTCACAGGCACGTGTGCAAAAGAGATGTAAAATCGTTATAT CGTAGCAGAAAGTACATTACTTTTCTCTTATAATTATTGATCAGCTAATTTTCTTCATTACTAATT
Aedes aegypti Na/K ATPase alpha subunit
NCBI accession number XM 001662168.1 Target sequence -» SEQ ID NO.20
Target sequence is shown in BOLD text and flanked by primer sequences, which are UNDERLINED
ATGCCACCAAAGAAGAAAGGAGATAACTTGGATGATCTGAAACAGGAGTTGGACATCGATTATCACAAAA TCACACCGGAAGAATTGTACCAGCGACTTCAGACACATCCAGAGAATGGTCTCAGCCACGCGAAGGCGAA GGAGAACCTAGAACGAGATGGACCAAACGCACTTACCCCACCTAAACAGACGCCCGAATGGGTCAAGTTC TGTAAGAATCTCTTCGGTGGCTTCGCTCTGCTGCTGTGGATCGGTGCTATCCTGTGTTTCATTGCCTACT CGATCCTGGCCAGTACCGTCGAGGAACCGGCCGACGATAACCTGTACCTCGGCATCGTGCTGACCGCCGT CGTGATAGTTACCGGTATTTTCTCGTATTATCAGGAATCGAAAAGTTCGAAGATTATGGAATCGTTCAAG AACATGGTGCCCCAGTTTGCGACCGTACTGCGTGAGGGCGAGAAGCTGACCCTGCGCGCCGAAGATCTGG TCATCGGTGACGTCGTGGAGGTCAAGTTTGGCGACAGGTTACCGGCCGATATTCGCATCATCGAAGCCCG AAACTTCAAGGTCGACAACTCTTCCCTGACCGGAGAGTCGGAGCCGCAGTCCCGTGGACCGGATTTCACC CATGAGAACCCCCTGGAAACCAAGAATCTGGCCTTCTTCTCGACCAATGCCGTCGAAGGTACCGCCAAGG GTGTCGTCATCAGCTGCGGTGATCACACCGTGATGGGTCGTATCGCTGGTCTCGCTTCCGGTCTGGACAC CGGTGAAACTCCGATCGCCAAGGAAATCCACCATTTCATCCATCTGATTACCGGCGTGGCTGTGTTCCTC GGTGTGACCTTCTTCGTGATTGCCTTCATCCTCGGCTACCACTGGCTGGACGCCGTTATCTTCCTGATCG GTATCATTGTCGCCAACGTGCCGGAAGGTCTGCTCGCCACCGTTACCGTCTGTTTGACCCTGACTGCCAA GCGTATGGCCTCGAAGAACTGTTTGGTCAAGAATTTGGAAGCCGTCGAAACCCTCGGATCGACCTCGACC ATCTGCTCGGATAAGACCGGTACACTGACCCAGAACCGTATGACTGTCGCCCACATGTGGTTCGACAACC AGATCATCGAAGCCGACACCACTGAGGATCAGAGCGGTGTTCAGTACGACCGTACCAGCCCTGGATTCAA GGCCCTGTCCCGCATCGCTACCCTGTGCAACCGTGCTGAATTCAAGGGAGGTCAAGAAGGTGTCCCAATT CTGAAGAAGGAAGTCAGTGGTGATGCTTCGGAAGCTGCTTTGCTCAAATGTATGGAACTGGCTCTCGGTG ATGTCCTGAGCATCCGCAAGCGCAACAAGAAGGTCTGCGAAATTCCATTCAACTCCACCAACAAGTACCA GGTTTCCATCCACGAAACTGAAGATCCCAGCGACCCACGTTATCTGCTGGTCATGAAGGGTGCCCCCGAA CGTATTCTGGAACGCTGCTCGACCATCTTCATCAACGGCAAGGAGAAGCTGATGGACGAAGAGATGAAGG AAGCCTTCAACAATGCCTACCTGGAGCTCGGAGGTCTCGGTGAACGTGTGCTCGGATTCTGCGACTTCAT GCTGCCATCGGACAAATTCCCCGCTGGATTCAAGTTCAACTCGGATGAAGTGAACTTCCCGTGCGAGAAC CTGCGCTTCGTCGGCCTCATGTCCATGATTGACCCTCCCCGCGCGGCTGTACCCGATGCCGTCGCCAAGT GCCGCTCCGCCGGTATTAAAGTTATCATGGTTACCGGTGATCACCCGATCACTGCCAAGGCCATTGCCAA GTCTGTTGGTATCATCTCGGAGGGCAACGAAACCGTCGAAGACATCGCCCAGCGTCTGAACATTCCGGTT TCGGAGGTTAATCCTCGTGAGGCTAAGGCCGCCGTTGTGCACGGTTCGGAACTGCGCGACCTGTCCACCG ATCAGATCGACGAAATTCTGCGCTACCACACGGAGATCGTGTTCGCTCGTACCTCGCCGCAGCAGAAGCT GATCATCGTGGAGGGTTGCCAGCGGATGGGAGCCATCGTGGCCGTCACCGGTGACGGTGTCAACGATTCG CCTGCCCTGAAGAAGGCTGACATTGGTGTTGCCATGGGTATCGCCGGGTCCGATGTGTCCAAGCAGGCCG CTGACATGATCCTGCTCGATGACAACTTCGCTTCGATCGTTACCGGAGTCGAGGAGGGCCGTCTCATTTT CGACAACCTGAAGAAGTCGATCGCGTACACGCTGACATCCAACATTCCGGAGATCTCGCCCTTCTTGGCG TTCATCCTGTGCGACATTCCGCTCCCGCTCGGAACCGTCACCATTCTGTGCATCGATCTGGGAACTGACA TGGTACCGGCCATTTCTCTTGCCTACGAAGCCGCCGAGAGCGACATTATGAAGCGCCGCCCGAGAGATCC GTACCGTGACAATCTGGTCAACCGCAGACTTATCTCGATGGCCTACGGACAGATCGGTATGATCCAGGCC GCGGCCGGTTTCTTCGTCTACTTCGTCATCATGGCTGAAAACGGATTCTTGCCGCTGCACCTGTTTGGCC TCCGCAAGGGCTGGGACTCAAAGGCCGTCAACGATCTGACCGACTCGTACGGACAGGAATGGACCTACCG TGACCGCAAGACGCTCGAGTTCACCTGCCACACCGCGTTCTTCGTCTCGATCGTCGTCGTCCAGTGGGCC GATTTGATCATTTGCAAGACCCGTCGTAACTCGATTTTCCACCAGGGCATGAGAAACTGGGCGCTCAACT TCGGTCTCGTGTTCGAGACGATACTGGCTGCGATCCTCTCGTATACGCCCGGCATGGACAAGGGCCTGCG CATGTTCCCACTCAAATTCGTTTGGTGGCTGCCAGCCTTGCCGTTCAGCTTGTCCATCTTCGTGTACGAC GAAATTCGTCGTTTCTACTTGAGACGCAACCCAGGTGGCTGGTTAGAGCAAGAAACGTACTATTAGGTCA ACAAATTTATATTTAAAAAGATTAATTAAAAAGAAGAAGGAAAAACTGAAAAAACTGGAGATAAAAAAGA ACCGTAAAAAATAACAAAAAATGAGCATAAAAAAACACACGAAAAAAGATGACGAAGAAGAAGAAGAAAC ACACAGACACACGAAGATGAAAAATACTAGCGGAAAAAATCGTGAAGAAGATAAGAAGCAGTATCTCCCG TCCTCATCGAACTCAATTCCCCCTTGTGCACATTAACATTCACAACCGACAAGTCTCCCCTTCGCATCTA TATAATTATCTCTCACGCACACAGTCACACACGTTTCCCGCTCACGCGCGTATGGATGTTGCCATGGAAA CTTTGTGTAAACGGAGAAAAAAGTCGTACAAACACAAGCATACAGCAGCAACAGCAGTAGCGGCGTGCCT ACAATACAACGCGATCGACTCCGGTTGAACCAACACATTCGCACCCAGCCCACCACCCGTCGTCGTCGTC GTACACTTACACACTCACACACACACACATGATAACATCCGCATACACACATACAAAATCACTCACATAC GCCAGTTGCGCATTTTCGGAGCAGCTAATCGTTATTGAAGAAAAATCCCGCGTTCGTGTTAGTTTTTAGC CACAGGCAGAGACTCTATAGCAGCCTAAAAGCCGAAACGGGAAGAGCGAGAGAGGACATTTTACTAAATT TGAGAAATAAATAATAAACAAGCGAAACAAGTAATCT
GENE -» Aedes aegypti ADP/ATP carrier protein (AaADP)
Database details -» NCBI accession number XM_001649861.1
Target sequence SEQ ID N0.21
Target sequence is shown in BOLD text and flanked by primer sequences, which are UNDERLINED
ACTCGCAACTCGGCTACAACTAGCGCAGCCATCCGGCGTTCATTCTCTTTGGATTGTGCCCTCCGTTCGG TTAGGAAGCTCGCTGCCTTTGATTGCGCTCTGCTGCGTGTGTGTGTGTTGCAAGACTAGAAAGAATCCCC GCAGAAAATGTCTGGAAAGAAGGCTGATCCCTATGGCTTCGCCAAGGATTTCCTGGCTGGTGGAATCTCC GCCGCCGTTTCCAAGACTGCCGTGGCCCCAATTGAGCGCGTCAAGCTGCTGCTCCAGGTTCAGGCTGCCT CCAAGCAGATCGCCGCCGACAAGCAGTACAAAGGTATCGTCGATTGCTTTGTTCGCATCCCCAAGGAACA GGGCTTCGGAGCTTTCTGGAGAGGTAACCTTGCCAACGTGATCCGGTACTTCCCAACCCAGGCGCTGAAC TTCGCCTTCAAGGATGTCTACAAACAGATCTTCTTGGGTGGCGTCGACAAGAACACACAGTTCTGGCGCT ACTTCATGGGTAACTTGGGATCCGGCGGTGCCGCTGGTGCCACCTCGCTGTGCTTCGTCTACCCACTCGA CTTTGCCCGTACCCGTCTGGGCGCCGATGTTGGCCGTGCCGGAGCCGAGCGCGAGTACAACGGTCTGATC GACTGCCTGAAGAAGACCGTCAAGTCCGATGGTCTGATCGGTCTGTACCGTGGATTCAACGTGTCGGTCC AGGGTATCATCATCTATCGTGCTGCCTACTTTGGTTGCTTCGATACTGCCAAGGGAATGCTGCCCGACCC GAAGAACACCTCGATCTTCGTCTCGTGGGCCATCGCTCAGGTTGTAACGACGGCCTCCGGCGTTATCTCC TATCCATTCGATACCGTCAGAAGACGTATGATGATGCAGTCCGGCCGTGCCAAGTCGGAAATCATGTACA AGAACACCCTCGACTGCTGGGTCAAGATCGGCAAGACGGAAGGTTCGTCGGCCTTCTTCAAGGGCGCCTT CTCCAACGTTCTGCGTGGTACTGGTGGCGCTCTTGTGCTCGTGTTCTACGATGAAGTGAAGGCTCTGATG GGTTAGATTTAAGTTTAGCGAAAAAAAAATTAAACTAAAAAAAGTTACAAAAACCAGCTAAAGTAAACTA AACCAATTAAGGTGGAAAATCAGCAGTAAAACCAGTGATCTATTTATTTGACGCTAGAAAGAAATTCACA AGCAAGCACATCTTGCGCGTTATTTGTGTAGAAAAAACTAAAATACCACTCAAAACTGAAATGATGTTCT TACTACCAACCAGGACAAAATTGTAATCAGCCATACGAAAATAAAAGTGTTCTCACGAATCGAACGAAAC AACAGACGAAAACCATTCGTATTTGAGTTGAAAATAGGAAAGACATGTGCACATTCCGTAATATTTCCAT CCGACTCGCAACCCGAATGCTGCAATGTTGTTGCACTCGAGAAATCTCACCAATTTGCCGTGCGAAGTCA TTTCAGAGACCGATTACAAGACAGTAGCTGTGAAATAAAAAAAAAAAAAAAAAAAACGAGCAAACACTCT TCAAGAGTTCCCAAAGACCAGTATAACAATTTGCATGACATGCGATCAAGCCGGGCTTGACTTAACCGAA AGGGCACGATAAGGAAAAAAAGAAGCTTCTGTTTTATGATGCACCTTAACAGACGTTAATTTGCTGAGGA GAATCGAATTGCGAATAATAGTTACAACCTGAGTAAAAAAAAA CONSTRUCT A.aegypti L4440- bTUB-AaNaK-AaADP Tricatamer
Sequence identifier SEQ ID N0.22
Notes bTUB target sequence is shown in BOLD text
AaNaK target sequence is shown in ITALIC text
AaADP target sequence is shown in UNDERLINED text
GAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTA GCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCG GCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCA GATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAG ATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATT GATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCT TAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTT CTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTA CCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAG TTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCT GCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGC TGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAG CTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGA GAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTT GAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGG TTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATT ACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCA ACCTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCGGCAGATCTGATATCATCGATGAATTCGAGCTC CACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCACCGGTTCGGAAATCATCTCCGACGAACATGGAATCGAC GCCACCGGAGCCTACCATGGTGACTCAGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAAGCCTCCGGC GGCAAATACGTGCCACGTGCCGTGCTAGTCGATCTGGAACCCGGTACCATGGACTCCGTCCGCTCGGGGCCATTC GGACAGATCTTCCGCCCGGACAACTTCGTCTTCGGACAGTCCGGTGCCGGTAACAACTGGGCCAAGGGACACTAC ACCGAGGGTGCCGAACTGGTCGATTCAGTGTTGGACGTTGTCCGCAAAGAAGCCGAATCGTGCGACTGCCTGCAA GGATTCCAGCTGACCCACTCGCTCGGAGGTGGTACCGGCTCCGGTATGGGCACACTGTTGATCTCGAAAATCCGC GAAGAATATCCCGACAGAATCATGAACACATACTCAGTTGTCCCCTCGCCAAAAGTATCAGACACCGTCGTAGAA CCGTACAACGCCACCCTCTCAGTGCACCAGCTGGTCGAAAACACCGACGAGACGTACTGTATCGACAATGAAGCC CTGTATGATATCTGCTTCCGCACCCTGAAGCTCACAACCCCAACCTACGGTGATCTGAACCATCTCGTGTCACTG ACCATGTCCGGAGTTACCACCTGCCTGCGTTTCCCTGGTCAATTGAATGCTGATCTCCGAAAACTGGCTGTCAAC ATGGTTCCATTCCCACGTCTGCACTTCTTCATGCCTGGATTTGCCCCACTCACCTCCCGCGGATCGCAACAGTAC CGTGGCTTCGTCTACCCACTCGACTTTGCCCGTACCCGTCTGGGCGCCGATGTTGGCCGTGCCGGAGCCGAGCGC GAGTACAACGGTCTGATCGACTGCCTGAAGAAGACCGTCAAGTCCGATGGTCTGATCGGTCTGTACCGTGGATTC AACGTGTCGGTCCAGGGTATCATCATCTATCGTGCTGCCTACTTTGGTTGCTTCGATACTGCCAAGGGAATGCTG GTGTTCCTCGGTGTGACCTTCTTCGTGATTGCCTTCATCCTCGGCTACCACTGGCTGGACGCCGTTATCTTCCTG ATCGGTATCATTGTCGCCAACGTGCCGGAAGGTCTGCTCGCCACCGTTACCGTCTGTTTGACCCTGACTGCCAAG CGTATGGCCTCGAAGAACTGTTTGGTCAAGAATTTGGAAGCCGTCGAAACCCTCGGATCGACCTCGACCATCTGC TCGGATAAGACCGGTACACTGACCCAGAACCGTATGACTGTCGCCCACATGTGCTAGCCACGTGACGCGTGGATC CCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCCAATTCGC CCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTA CCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCC CTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGG TGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTC TCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTAC GGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTC GCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCT CGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAA AATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTAGGTGGCACTTTTCGGGGAAATGTGCGCGGAAC CCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCA ATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTG CCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGG TTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAG CACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCAT ACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAG AGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACC GAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAA TGAAGCCATACCAAACGAC
GENE Lepeophtheirus salmonis ADP/ATP translocase 1 (LsADP)
Database details NCBI accession number BT077972.1
Target sequence SEQ ID N0.23
Target sequence is shown in BOLD text and flanked by primer sequences, which are UNDERLINED
GGGGGACAGTAGTTTGTAAATTTACAGGGGAACTCATACCTCTTCACCGTCGTCGTTTAAGAACAGTTTG AAATAATGAGCAAGGACTTTGTTTTGGATCTTGTCGCAGGTGGGGTGTCTGCCGCGATATCCAAGACCAT TGTTGCTCCATTGGAACGAATCAAAATTCTCCTCCAAATACAAGATGCTTCCAAGTATATTCCTAAAGAT CAACGCTACACTGGTCTCGTTGACTGTTTTCGTCGAGTGAATGCAGAGCAGGGAACCCTGTCCTTTTGGC GTGGAAACGTTGTGAATGTGGTTCGATACTTCCCCACTCAAGCCTTTAATTTTGCATTTAAGGATAAATA TCAAAAGATATTTTTAGATGGAGTGGATAAAAAGGACTTTTGGAGATTTTTTGCTGGAAATTTAGCTTCT GGCGGTGCTGCTGGAGCAACTTCACTTTGTATTGTATATCCCTTGGATTTTGCACGTACTCGCCTTGGTG CAGACGTTGGGAAGGCTGCAGCGGATAGGGAGTTCAAAGGACTTTTCGACTGCATCGGTAAATGCTACAA AGCTGATGGTCTTGTGCGTGGACTGTATCCTGGTTTCCTCTCCTCTGTACAAGGAATCATTGTTTATCGA GCTATTTATTTCGGTGCCTATGATACTTGCAAACAAATGATAGATAAACCCACATTCGGTACTAAATTTG CCATAGCTCAAACTGTGGCAGCATGCTCCGTCTCAATTGCCTATCCCTTTGACACCGTTCGTCGTCGATT GATGATGATGTCTGGGGAAGGTGAGAAAATGTACAGTGGCACTGTGGATTGTTGGAAAAAAATCGTTAAG GAAGAAGGATCCAGAGCTCTATTCAAAGGCAATTTTACCAATGTTCTCAGGTCTGTCGGATGTGCCTTGG TCCTTGTTCTCTATGATGAAATCATTGTTGTTCTTAAAAGTGCAACATAATTTTTGTACTATGTCATAAA GTCAATGTAGTCTGGCATTTACAATATCGTCATAATGAAAATAATTGTGATATATTCCTGTAATAATTAT TTATGTAATTAAAAAAAAAAAAAAGATATATCATGTTGTCAATCCTAATCGCCAATTACAACTTTCTTCC TACATCAATCATTTATTAATATAATGC
GENE Lepeophtheirus salmonis V-ty pe ATPase unit E (LsvATPe)
Database details NCBI accession number BT120776.1
Target sequence -» SEQ ID N0.24
Target sequence is shown in BOLD text and flanked by primer sequences, which are UNDERLINED
TTCACATATTCTACATTGTCATAATAAGATACACAAGTGTTGGAGATCCTCCTACCTTTCCGTTACTTTG GTTGAGAAATTTCATCTACTCCAACATCCAAGATGTCTTTGAGCGATGCTGACGTTAGCAAGCAGATTAG CCACATGACGGCTTTTATCGAGCAAGAAGCGAATGAAAAAGCTGAGGAAATCGATGCAAAGGCTGAAGAG GAATTCAATATAGAGAAAGGGCGTCTCGTTCAACAACAAAGACTCAAAATCATGGAATACTATGACCGTA AAGAGAAGCAAGTTGAATTGCAAAAGAAAATTCAATCTTCCAACATGCTCAATCAGGCGCGTCTCAAAGT ACTTAAGGCTCGGGATGAGCATGTGGATGAAGTCGTTGAAGAATCACGTAAAAAGCTGGTCCTTATTACG AAGGATAAATCCAAATATTCTAAAATCATAGAGGGTCTAATAGCTCAGGGTTTATGCCAATTGTTAGAGT CAAATGTCACGATTCGTTGCCATCAAAATGATCTCTCTCTGGTGGAGCAAGCCATTTCCGTAGCAGTTAA AAATGTCAAAGATAAAATAAAGAAGGATATAGTTGTTAAAGTTGATAAAGAAAATTTTTTACCACAAGAT AGCTCTGGTGGCATTGAATTATACGCTCAAAGAGGAAGGATAAAGGTGGATAACACCCTTGAGGCTCGCT TGCATTTGATTGCCCAAAATATGATGCCACAGATTCGCACTTCCTTATTCGGCGCTAATCCTAATAGAAA ATTTGATGATTAAAAATATAATTCCTTTTTTTTCTAATTGTAAGATGGCATTTAAAAAAAAACAACAACT CTGATTTGATCGATCAACGGCTTTGTTATTTTGAATAATTAATCATCATATTTATTTGTAGTCAATCATC TTTTTATTCTTTGTTTCGCTGATGAGATCAACCAAGGAGTCGTTTTTTTTAAAATTTAATTTAAAATGTA CTCGTCTTTATCAACAACATTCCTTTTTATGTTTGTCACCCTTTAAAATGATTATAATTTATTTGTTCCA TTATATCGTTATTTATAAATTTAATATTCTTAATAATACATAAATACCAAAATCATAG
GENE Lepeophtheirus salmonis acetylcholinesterase (LsAChE)
Database details -> NCBI accession number KJ132369.1
Target sequence -» SEQ ID N0.25
Target sequence is shown in BOLD text and flanked by primer sequences, which are UNDERLINED
GAGTGCCTCCCATTAAGTTAAACAGTCGACGTTATTTATAGGTCTATTAAATATTGTTTTAGATGTGGAT TCAAGTCCGAAAACACAACTTAGGTCTTTCCTTTGAAAGGATATTAGTGTATTTACTCACATTGTCATGG AGTCTGGGATCCATCGTACAAGAAGATTTGGTGATCACCACAAGAAAAGGAAAGATCCGAGGTGTTACTC TGAAATCTGCAACAAATAAGGAAGTAGATGCATGGTATGGGATACCATACGCACAACCTCCCGTGGGTAA TCTTCGATTTCGTCACCCCAAAGACATTAATGCCTGGGATGGGATGAAAGAAACGACCAAACATCCAAAT TCTTGTATTCAAGTAGTTGATACATTTTTTCCGGGCTTTGAAGGCTCAGAGATGTGGAATACAAATACTG AGCAAAGCGAGGACTGCCTTTACTTAAGTGTTCATGCCCCTAAACCCCGTCCTACAAAATCAGCTGTTCT GGTATGGATCTACGGTGGAGGATTTTATTCTGGAACTTCAACTCTGGAACTCTATGATCCACGAGTTCTT GTGTCAGAAGAAAACATAATCTTCGTCGGCATACAATATCGTGTTGCAAGTTTAGGATTCTTATTCTTTG ATACGGAGGATGTTCCTGGAAATGCGGGATTGTATGATCAAATGATGGCTCTCCAATGGGTAAAGAACAA TATAGAGGCATTTGGTGGTGATCCTGATAAAATCACCATTTTTGGAGAGTCCGCCGGTGGTTGCTCCGTA GCCCTTCATCTCCTTTCTCCACTCTCAAGGAACCTATTCTCTCAAGCCATTATGCAAAGTTCTTCAGCTC TTGTTCCATGGGGAGTCATATCAAAAAAAGAAAGTATCCGTCGTGGTCGAAGACTTGCAGAAGAGATGCG TTGTCCTTATGGTGAAAATAATACCAATGCTATGATTGAATGCCTGCTGCAAAAGGACGCAACAGAGTTG GTCAACCAGGAGTGGAGTGGTACCGTCTTTGGGATTTCAGAGTTCCCATTTGTTCCAATTGTGGATGGAA AATTCATGGATAAAACCCCTGAAAAATCTCTTAAAGAAAAGGACTATAAAAAAACCAACATTTTAATGGG AGTCAATAAGGACGAAGGGAACTTTTTCATCATGTATTATCTTCCAGAACTCTTCAAAAAAAACGAAAAC GTTTATATTAACCGAACAGATTTCATCCGCAGTGTTTCAGATTTGAACATCTATGTGAACAATGCAGGAA GAGAGGCAATAACTTTTGAATACACAGATTGGCTCAATCCAAACGATCCCATAAAAAATAGAGAAGCAAT TGATCGCATGGTCGGTGACTATCAATTCATTTGCCCAACTGCTGACTTTGCTCGTATTTATGCTAGTACA GGAAATAATATATACATGTACTATTTCACTGAGCGATCTTCCACTAGCCCATGGCCAACATGGTCTGGTG TACTTCATGGCGATGAAATTGCTTTTGTTTTTGGAGAGCCCCTAAATACGTCAAAAAATTATGATGATTC AGAAATTGCCTTATCAAAAAGAATAATGAGCTATTGGGCTAATTTTGCAAAAACTGGGAACCCGAATGTT TTGGCTAATGGAAACTACAGCAACAAAATCTGGCCCTTACATACACCAATAAAACAGGAGGTACTTGAAC TAAATGCAAATTATTCTCGAGTTTTTGAGGGGCTTCGAGTTAGAAAATGTGCTTTTTGGAAAACATATCT TCCTAAGCTTTTATCATTAACTTCAAACAATACAAAGTCTGAAGTTGTAACCAATCCGTCATAAAGATTG AAAAACGTCAACTACATTACTGGAGATACACATTCAATGGTATAAATAAATAAATTTAACACTAGCACAA TGATAGACTATAATTAAATATGTTCATACGTACGTACCATCCATCGTATAATAGTTTGTTTTGTTGATAC CAAAAAGACAAAAAGGCTAAATATGTATACCAACTGCAATAAAGATTATTCTCTATAAAAAAAAAAAAAA AAAAAAAAAAAAAAA CONSTRUCT L.salmonis L4440- LsADP-LsvATPe-LsAChETricatamer Sequence identifier SEQ ID N0.26
Notes LsADP target sequence is shown in BOLD text
LsvATPe target sequence is shown in ITALIC text
LsAChE target sequence is shown in UNDERLINED text
GAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTA GCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCG GCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCA GATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAG ATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATT GATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCT TAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTT CTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTA CCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAG TTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCT GCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGC TGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAG CTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGA GAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTT GAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGG TTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATT ACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCA ACCTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCGGCAGATCTGATATCATCGATGAATTCGAGCTC CACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCACCGGTTCTAGCTCAAACTGTGGCAGCATGCTCCGTCTC AATTGCCTATCCCTTTGACACCGTTCGTCGTCGATTGATGATGATGTCTGGGGAAGGTGAGAAAATGTACAGTGG CACTGTGGATTGTTGGAAAAAAATCGTTAAGGAAGAAGGATCCAGAGCTCTATTCAAAGGCAATTTTACCAATGT TCTCAGGTCTGTCGGATGTGCCTTGGTCCTTGTTTGTCTTTGAGCGATGCTGACGTTAGCAAGCAGATTAGCCAC ATGACGGCTTTTATCGAGCAAGAAGCGAATGAAAAAGCTGAGGAAATCGATGCAAAGGCTGAAGAGGAATTCAAT ATAGAGAAAGGGCGTCTCGTTCAACAACAAAGACTCAAAATCATGGAATACTATGACCGTAAAGAGAAGCAAGTT GAATTGCAAAAGAAAATTCAATCTTCCAACATGCTCAATCAGGCGCGTCTCAAAGTACTTAAGGCTCGGGATGAG CArGrGGArGAAGrCGITGGATGGCTCTCCAATGGGTAAAGAACAATATAGAGGCATTTGGTGGTGATCCTGATA AAATCACCATTTTTGGAGAGTCCGCCGGTGGTTGCTCCGTAGCCCTTCATCTCCTTTCTCCACTCTCAAGGAACC TATTCTCTCAAGCCATTATGCAAAGTTCTTCAGCTCTTGTTCCATGGGGAGTCATATCAAAAAAAGAAAGTATCC GTCGTGGTCGAAGGCTAGCCACGTGACGCGTGGATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATAC CGTCGACCTCGAGGGGGGGCCCGGTACCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCG TTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCA GCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACG CGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCC TAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATC GGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTT CACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGAC TCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTT CGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAA TTTAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTA TCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTT CCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGT AAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGA GAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCG TATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGT CACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACAC TGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCA TGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGAC Caenorhabditis elegans eg I -30
NCBI accession number U56864.1
SEQ ID N0.27
Target sequence is shown in BOLD text and flanked by primer sequences, which are UNDERLINED
GTACACACACACCCGCCACCACCACATTTCCACCAACAGAGAGGCATCCCTGTGCGTTGTTGTGTTGTTG TTTTTTTGTGATGTTTATAACTTGACGCCCTCAATCGTCCCACCGAAATACAAAAATTGCATCGAACTTC TATCCTCGCTCTAGCGTGTTCTTCTTGTTCTATTCGCTGGCTTCATCTGCGGCCTTGGTGGCACCTTTTC GGCCGCCATGGCCTGCTGTTTATCCGAAGAGGCTCGCGAGCAGAAGCGAATAAATCAAGAAATTGAGAAG CAGCTTCAGCGTGACAAAAGAAATGCTCGACGAGAACTCAAACTTCTTTTATTGGGGACTGGAGAGTCCG GCAAGTCAACGTTCATCAAGCAGATGCGAATTATCCACGGTCAGGGATATTCGGAAGAGGACAAGCGAGC ACACATTCGACTTGTCTATCAGAACGTGTTTATGGCCATACAGTCTATGATACGAGCGATGGACACATTA GATATAAAGTTTGGTAACGAATCAGAGGAGCTGCAGGAGAAGGCGGCTGTGGTGCGGGAAGTGGATTTCG AGTCGGTGACGTCTTTCGAGGAACCCTACGTGTCGTATATCAAAGAGCTATGGGAGGATTCTGGTATTCA GGAATGTTATGATAGGAGGCGAGAATATCAGCTCACCGATTCAGCCAAATACTATCTCTCCGATCTCCGA CGGCTGGCGGTGCCAGACTATCTGCCAACCGAGCAGGACATTCTGCGTGTTCGTGTGCCAACCACTGGTA TCATTGAATATCCATTTGATTTGGAGCAGATCATCTTTCGAATGGTGGACGTCGGAGGTCAGCGATCAGA AAGGCGGAAGTGGATCCACTGTTTCGAAAATGTCACCTCAATCATGTTCCTGGTGGCGCTTTCCGAGTAT GATCAGGTGTTGGTCGAGTGTGACAACGAGAACCGAATGGAAGAATCGAAAGCTCTGTTCCGAACGATCA TCACGTACCCATGGTTCACCAACTCATCGGTCATTCTATTCCTGAACAAGAAGGATCTGCTCGAGGAGAA GATTCTGTACTCGCATCTCGCTGACTACTTTCCCGAATATGACGGACCCCCACGCGATCCGATCGCCGCC CGCGAGTTTATTCTCAAAATGTTTGTCGACTTGAATCCGGACGCCGACAAGATTATCTACTCTCATTTTA CGTGCGCGACTGATACGGAAAACATTCGGTTCGTGTTCGCCGCCGTCAAAGACACAATTCTACAGCATAA TCTGAAGGAGTACAACTTGGTGTAAGAAGAAAGTCGCATGTCGGATTGGATGATGATGATGATGATCCAT CTCTCTCTCTCTCTCTCTCTCACTGGGTCGAGTGAGACACCACCACCTAAACCTAGGAAACATTTTCTTG TACTCCTTCTAATTTTTGTTTTTTTTTTGCAAAAAACTTTCTCTCTCTGTCTGTCTCTCTCTCCATCTCT TCCTTATTTTCTTATTTTCTCATTTTCCTCCCTAAAACAAATGCTCCTCCCGAATATTCTTTCCATATAA GCACTTTTTTCTTCTTTTTTTGGATGTGCTTTCTGATATAGCTAATGCAAAAAAAAAAAACGG
GENE Caenorhabditis elegans pat-10
Database details NCBI accession number NM_059100.6
Target sequence SEQ ID N0.28
Target sequence is shown in BOLD text and flanked by primer sequences, which are UNDERLINED
ATGGCTGAGGATATCGAAGAGATTCTTGCTGAAATCGACGGATCCCAAATTGAGGAATACCAAAAGTTCT TCGATGCCTTCGACAGAGGAAAGCAAGGATACATCATGGCCACTCAGATCGGTCAAATCATGCATGGAAT GGAACAGGATTTCGATGAGAAGACCCTTCGTAAACTGATCCGCAAGTTCGACGCTGACGGTTCCGGAAAG CTCGAGTTTGACGAGTTCTGCGCTCTCGTGTACACCGTTGCAAACACTGTCGACAAGGAAACATTGGAGA AAGAACTTCGTGAAGCTTTCCGTCTTTTCGACAAGGAGGGTAACGGATATATTTCTCGACCAACTCTGAA GGCTCTTCTCAAAGAAATCGCCGATGACCTCACCGATCAACAACTCGAGGAGGCTGTCGACGAGATTGAC GAGGACGGTTCCGGAAAGATTGAGTTCGAGGAGTTCTGGGAGTTGATGGCTGGAGAGTCTGATTAA GENE Caenorhabditis elegans bli-5
Database details NCBI accession number NM_067371.1
Target sequence -» SEQ ID N0.29
Target sequence is shown in BOLD text and flanked by primer sequences, which are UNDERLINED
ATGGTATCTATCCATAATTCATTCATCTTATTGATGTTAATGATATCAATTTGTTTTTGTGAGAAATGCC TGACCAATGAAGAATGCGATTTGAAATGGCCAGACGCAATATGTGTTCGTGGAAGATGCCGTTGTTCTGA GAATACAATTCGAAAGAAAAGTGCATCAAGAGAATGGGTTTGTTTGGCAACTAATGATGCAACCGGCAAC TCGGGTCCTCCATTGACATGTCCAACTCCGGAAGGAGCTGGATACCAAGTAATGTACCGAAAAGATGGAG AACCGGTGAAATGTTCGAGTAAAAAGAAGCCAGATACGTGTCCAGAAGGATTTGAATGTATTCAGGGATT ATCAATTCTTGGAGCATTGGATGGAGTTTGTTGTCCTGATAGAGCCAAAACATGCGTCCACCCAATATTC GATCATCCGGATGATGGATATCTGTCTAGATGGGGATTCGATGGTGAACAATGTATTGAATTCAAATGGA ATCCCGAAAGGCCGTCATCGGCAAACAATTTCAAAACTCGCGCACATTGTGAGGATTACTGTATCGGTTC GATAAATGGAATTACTAATTATCATCAGTCCAACTTTCATCTTTTCTGA
GENE T.castaneum Na/K ATPase alpha (NaK), [preferred]
Database details -» NCBI accession number XM_008198203.1
Target sequence SEQ ID NO. 113
Target sequence is shown in BOLD UNDERLINED text
ACTTTTAGTGGGTCCGCGCCCGTCGTCGCTGCTTCTAGTGCGATTTGTGTGCAGTGGTCGACATCACA TGAAGTACAGTATTTAACACCACTCCCCGGGATATTATCACACAATCAGCATGGGGGAGTCACGGAGG AAAAATAAGAAGGTCAGGAAAGCGGACGATTTAGATGATTTGAAACAAGAATTGGACATCGATTATCA TAAAATCACCCCAGAAGAATTATATCAGAGATTCCAGACACATCCAGAAAATGGCCTCAGTCATGCGA AAGCGAAAGAGAATTTGGAACGGGACGGACCCAATGCACTCACACCCCCAAAGACTACCCCCGAATGG GTGAAATTTTGTAAAAATCTCTTCGGGGGTTTCGCTCTCTTATTGTGGATCGGCGCCATCCTCTGCTT CATAGCCTATTCTATTCAGGCTAGCACCGTGGAGGAACCAGCCGATGATAATCTTTATCTTGGCATCG TCTTAGCTGCCGTTGTTATCGTTACAGGTATATTTTCTTATTATCAAGAAAGCAAGAGTTCGAAGATT ATGGAGTCGTTCAAAAACATGGTCCCCCAATTCGCTACAGTGATCCGCGAGGGTGAAAAGCTGACCCT CCGCGCGGAGGACCTGGTACTGGGCGACGTGGTCGAGGTGAAATTCGGTGACAGAATCCCAGCCGATA TCCGAATCATCGAATCTCGCGGCTTCAAAGTAGACAACTCATCCTTGACAGGCGAATCCGAACCGCAG TCCCGCAGTCCGGAGTTCACTCACGAGAACCCTCTCGAAACGAAAAACTTGGCGTTCTTCTCGACCAA CGCCGTCGAAGGCACTGCCAAAGGTGTTGTGATTAGTTGTGGTGACAATACCGTGATGGGTCGCATCG CCGGTCTCGCCTCCGGTCTGGACACCGGCGAGACGCCCATCGCCAAAGAAATCCATCATTTCATTCAC CTCATTACTGGCGTGGCTGTTTTCCTCGGAGTTACCTTCTTCGTAATCGCCTTCATCCTCGGCTACCA CTGGCTCGACGCTGTTATTTTCCTCATCGGTATTATCGTGGCGAACGTGCCCGAGGGGCTCCTCGCCA CCGTCACCGTGTGTCTCACCCTCACTGCTAAGAGGATGGCTTCCAAGAACTGCCTCGTGAAGAATCTC GAGGCCGTAGAGACCCTCGGCTCCACAAGCACGATCTGCTCGGACAAGACCGGAACTTTGACCCAAAA CCGGATGACGGTAGCACACATGTGGTTCGACAATCAGATCATTGAAGCCGACACCACTGAAGACCAGT CGGGAGTCCAATACGACCGCACAAGTCCAGGATTCAAAGCTTTGTCGCGCATTGCCACACTTTGCAAC CGGGCTGAGTTCAAAGGGGGGCAGAACGACGTCCCGATCCTTAAACGCGAAGTCAACGGAGACGCCTC TGAAGCCGCTCTCCTCAAATGCATGGAACTGGCTCTGGGCGACGTGATGTCCATCAGACGCAAGAACA AGAAAGTTTGCGAAATTCCCTTCAACTCGACCAACAAATACCAAGTTTCCATCCACGAGAACGAGGAC GCGAGCGATCCTCGCCATATCCTTGTGATGAAGGGCGCTCCTGAACGAATCCTCGAACGCTGCAGCAC GATCTT CATC TGCGGCAAGGAGAAAGTCCTGGATGAGGAAATGAAGGAAGCTTTCAATAACGCC TACT TGGAGTTGGGTGGTTTGGGCGAGCGTGTGCTCGGCTTCTGCGATTTTATGTTGCCCACTGATAAGTAC CCAATTGGGTACAAATTCAATTGCGATGACCCCAACTTCCCGTTGGATGGTTTGAGATTTGTTGGCTT GATGTCCATGATTGATCCTCCCAGAGCTGCAGTGCCTGACGCCGTTGCTAAATGCAGAAGTGCCGGTA TTAAGGTCATTATGGTGACGGGAGATCACCCGATTACGGCCAAGGCTATTGCAAAGTCGGTTGGGATT ATTTCGGAGGGTAACGAAACGGTTGAAGATATTGCTCAACGGTTGAATATTCCTGTCTCGGAAGTCAA CCCGAGGGAAGCCAAAGCTGCCGTTGTTCACGGATCTGATCTCAGAGACCTATCTTCCGATCAATTAG ACGAAATTTTGAGATACCACACTGAAATTGTATTCGCTAGAACCTCGCCGCAACAGAAGTTGATCATC GTCGAGGGGTGCCAACGGATGGGCGCTATTGTCGCCGTGACAGGCGACGGCGTGAACGACTCGCCGGC TTTGAAGAAGGCGGACATCGGTGTGGCCATGGGTATCGCGGGTTCGGATGTGTCCAAGCAAGCCGCCG ACATGATCCTGCTGGACGATAACTTCGCGTCGATCGTGACAGGAGTGGAGGAAGGCCGTTTGATCTTC GATAACTTGAAGAAATCTATTGCCTACACCTTGACCTCAAACATTCCCGAAATCTCGCCTTTCCTTGC TTTCATTTTGTGCGACATTCCTTTGCCTCTCGGTACCGTAACAATTCTGTGCATCGATCTTGGAACTG ACATGGTGCCTGCTATTTCTCTGGCTTACGAAGCCCCGGAGTCCGACATAATGAAACGTCAGCCGCGC GACCCCTATAGGGACAACCTGGTTAATCGCAGGTTGATTTCGATGGCATACGGCCAGATTGGTATGAT TCAAGCAGCTGCTGGTTTCTTCGTGTACTTTGTCATCATGGCTGAGAACGGCTTCCGCCCGACTGACT TGTTCGGTATTCGAAAGCAATGGGACTCGAAAGCTGTCAATGATCTCACAGATTCGTACGGTCAGGAA TGGACTTATCGGGACAGGAAGACATTGGAATACACTTGCCACACTGCATTCTTCGTGTCCATCGTGGT TGTCCAATGGGCCGATTTGATCATTTGTAAGACCCGTCGCAATTCGATCCTCCACCAGGGAATGCGTA ACTGGGCGCTCAACTTTGGTTTGGTTTTCGAAACTGCACTCGCAGCCTTCCTGTCGTACACTCCCGGG ATGGACAAGGGTCTGCGCATGTTCCCGCTCAAGTTTGTGTGGTGGTTGCCTGCAATTCCGTTTATGTT GTCCATCTTCATTTACGACGAAACCCGTCGGTTTTATTTGCGTCGCAATCCAGGAGGTTGGCTGGAAC AGGAGACCTACTATTAAGCGCATCACACCGTTTTGCGTACTGCCACCAGGTGGCACTGCGTCTGCTGC CGCAGGTCACAAATAACAACAAACAAAACAAAACAAAAAATCACCACACTCGATTGGAAGGACTCCGT TTCACCCGCCGTGACGGCGTTGTTCCTTATCGGTCGTTGTGTTGTACAAACAAATCCTGTTGCTATTT CTAGTAAAATTTGCTGCATGCTTACGCTGCAGTCCGTACATTTGTAATTCGAGAGTTTGGTCGTGTGC GAGGGCGAGTGAATGGGTGATAGACCGAGAGCGAGGATGATTGCAAGCGGGGCCAGTTGGATTGGTTG GTTGGTTGGTCTGCAAGAGCAGCAGTAGAGACGCAATAGTGTTTTCATACATTCCAAGTTGAAAACAG TTGCCTTAGAGCCGATGTCGGACTGTGTGCGAGTGGGTGGGGGCGGAGCCTTGACGGACGGCGGTTGG TTGTTGCGCGGCCTTCGGGGCTCCGCCACTGAACGTCTTGAACGAGGTAGTATTATTTAGGCTTTCAA CACTTAGGTTAGCTAGATTGTAACTGTGTTGTTATATCGTGTTAAGTGTCATACCAGTCGTGCTCAAT ACACATGACTACCAACTACTATCACGATTGTAAACGTTTGACATTCGTTTCGTTTGTTGTGTATATAG TTTACGTAACGGGCGGGTAGCAGTTACACTGTGTAGGCAGCACGAGTCCATAATATTGTTTCTAACAT TGTTACGTTACGTGCGGTTAGTTGTTCAACGTTGGAGACACACTTCTGGAGGTCTGCTTCTGTAGAGC CCTATTTTCTTATACTCTCTGATGCGCGCTGCGTTGGTCTGAGACCAGCCGACCACGGTATTGTTATC TTATTATTGTAAATATTTTTAAGTGATCACTTAATTATTTTTGCTTGTGTTCTTTTCACATTCATGTT TTAGTATGTAACGAAGCTGTATAAATTTGGGTTTTAATAAAATGGATGATAGTATTACATTACAAA

Claims

Claims
1. An isolated nucleic acid concatemer comprising at least a first nucleic acid sequence and a second nucleic acid sequence;
wherein the first nucleic acid sequence is capable of down-regulating the expression of a first gene of a target, and the second nucleic acid sequence is capable of down- regulating the expression of a second gene of the target.
2. The isolated nucleic acid concatemer according to claim 1 , further comprising a third nucleic acid sequence, wherein the third nucleic acid sequence is capable of down- regulating the expression of a third gene of the target;
optionally further comprising a fourth nucleic acid sequence, wherein the fourth nucleic acid sequence is capable of down-regulating the expression of a fourth gene of the target;
optionally further comprising a fifth nucleic acid sequence, wherein the fifth nucleic acid sequence is capable of down-regulating the expression of a fifth gene of the target; and optionally further comprising a sixth nucleic acid sequence, wherein the sixth nucleic acid sequence is capable of down-regulating the expression of a sixth gene of the target.
3. The isolated nucleic acid concatemer according to either one of claims 1 or 2 wherein the first and/or second nucleic acid sequence and/or third nucleic acid sequence (if present) and/or fourth nucleic acid sequence (if present) and/or fifth nucleic acid sequence (if present) and/or sixth nucleic acid sequence (if present) comprises a nucleic acid sequence that has 100% sequence identity to at least 18 contiguous nucleotides of the corresponding gene of the target
4. The isolated nucleic acid concatemer according to any one of claims 1 to 3, wherein the target is an organism, or a cell or population of cells derived therefrom, selected from the group comprising:
a member of the Acari subclass, a member of the Arthropoda phylum, a member of the Insecta class, a member of the order Coleoptera), an organism which is not Varroa destructor, an organism which is not Caenorhabditis elegans, Rhipicephalus microplus, Rhipicephalus sanguineus, Ctenocephalides felis, Cimex lectularius, Aedes aegypti, Anopheles gambiae complex, Lepeophtheirus salmonis, Caligus rogercresse, Blattella germanica, Periplaneta Americana, Vespula Vulgaris, Vespro crabro, Vespa mandarinia, Coptotermes formosanus, Incisitermes snyderi, Reticulitermes flavipes, Anobium punctatum, Musca domestica, Tineola bisselliella, Varroa destructor, Galleria mellonella, Achroia grisella, Aethina tumida, Acarapis woodi, Tropilaelaps clareae, Nosema apis, Nosema ceranae, Acyrthosiphon pisum, Tenebrio molitor, Tribolium castaneum, Tribolium confusum, Sitophilus granaries, Anthonomus grandis, Plutella xylostella, Lymantria dispar dispar, Helicoverpa zea, Cornu aspersa, Deroceras reticulatum, Arion hortensis, Tetranychus urticae, Trypanosma brucei, Trypanosma cruzi, Entamoeba histolytica, Toxoplasma gondi, and Giardia intestinalis.
5. The isolated nucleic acid concatemer according to any one of claims 1 to 4, wherein the first, second, third, fourth, fifth and/or sixth gene, if present, is selected from the group consisting of the genes which encode:
a Na+/K+-ATPase subunits, a Vacuolar ATPase subunit, Plasma membrane Calcium ATPase, Sarcoplasmic reticulum Ca2+ ATPase, ADP/ATP- translocase, Sodium-glucose linked transporter, Trehalase, Pyruvate dehydrogenase, Pyruvate kinase, Pyruvate carboxylase, Tubulin, Monoamine oxidase, Acetylcholinesterase, and Phosphodiesterase.
6. The isolated nucleic acid concatemer according to any preceding claim, wherein the target is the V .destructor organism and the first and/or second gene and/or third gene, if present are selected from the group consisting of the genes which encode:
Acetylcholinesterase (AChE; GenBank accession number ADDG01069748.1), Monoamine Oxidase (MOA; GenBank accession number ADDG01053234.1), andvATPase subunit C (vATPc; GenBank accession number ADDG01035752.1).
7. The isolated nucleic acid concatemer according to claim 6, wherein the target is the V .destructor organism and the first and/or second nucleic acid sequence and/or third nucleic acid sequence, if present, comprises a nucleic acid sequence that has 100% sequence identity to at least 18 contiguous nucleotides encoded by a sequence selected from the group consisting of SEQ ID N0.1 , SEQ ID NO.2, and SEQ ID NO.3.
8. The isolated nucleic acid concatemer according to any one of claims 1 to 5, wherein the target is the T.castaneum organism and the first and/or second gene and/or third and/or fourth and/or fifth and/or sixth gene, if present, are selected from the group consisting of the genes which encode: Plasma membrane calcium-transporting ATPase 1 (TcPMCA; NCBI accession number XM_008201630.1), Na/K ATPase alpha (TcNaK; NCBI accession number XM_008198203.1), ADP/ATP translocase (TcADPt; NCBI accession number XM_968164.3) , vATPase subunit E (TcvATPe; NCBI accession number XM_965528.2), Calcium-transporting ATPase sarcoplasmic /endoplasmic reticulum type (TcSERCA; NCBI accession number XM_961690.3), a-tubulin 1 (TcaTUB; NCBI accession number XP_966492.1), and Heat shock protein 90 (TcHSP90; NCBI accession number NP_001094067.1).
9. The isolated nucleic acid concatemer according to claim 8, wherein the target is the T.castaneum organism and the first and/or second nucleic acid sequence and/or third nucleic acid sequence and/or fourth nucleic acid sequence and/or fifth nucleic acid sequence and/or sixth nucleic acid sequence, if present, comprises a nucleic acid sequence that has 100% sequence identity to at least 18 contiguous nucleotides encoded by a sequence selected from the group consisting of SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.1 13, SEQ ID NO.10, SEQ ID NO.11 , SEQ ID N0.12, SEQ ID N0.13, and SEQ ID N0.14.
10. The isolated nucleic acid concatemer according to any one of claims 1 to 5, wherein the target is the A.aegypti organism and the first and/or second gene and/or third gene, if present, are selected from the group consisting of the genes which encode: Tubulin beta chain (AabTub; NCBI accession number XM_001662168.1), Na/K ATPase alpha subunit (AaNaK; NCBI accession number ADDG01053234.1), and A DP/ATP carrier protein
(AaADPt; NCBI accession number XM_001649861.1).
11. The isolated nucleic acid concatemer according to claim 10, wherein the target is the A.aegypti organism and the first and/or second nucleic acid sequence and/or third nucleic acid sequence, if present, comprises a nucleic acid sequence that has 100% sequence identity to at least 18 contiguous nucleotides encoded by a sequence selected from the group consisting of SEQ ID N0.19, SEQ ID NO.20, and SEQ ID NO.21.
12. The isolated nucleic acid concatemer according to any one of claims 1 to 5, wherein the target is the L.salmonis organism and the first and/or second gene and/or third gene, if present, are selected from the group consisting of the genes which encode: ADP/ATP translocase 1 (LsADPt; NCBI accession number BT077972.1), V-type ATPase unit E (LsvATPe; NCBI accession number BT120776.1), and acetylcholinesterase (LsAChE; NCBI accession number KJ 132369.1).
13. The isolated nucleic acid concatemer according to claim 12, wherein the target is the L.salmonis organism and the first and/or second nucleic acid sequence and/or third nucleic acid sequence, if present, comprises a nucleic acid sequence that has 100% sequence identity to at least 18 contiguous nucleotides encoded by a sequence selected from the group consisting of SEQ ID N0.23, SEQ ID N0.24, and SEQ ID N0.25.
14. The isolated nucleic acid concatemer according to any one of claims 1 to 5, wherein the target is the C.elegans organism and the first and/or second gene and/or third gene, if present, are selected from the group consisting of the genes which encode: pat-10 (NCBI accession number NM_059100.6), bli-5 (NCBI accession number NM_067371.1), and egl-30 (NCBI accession number U56864.1).
15. The isolated nucleic acid concatemer according to claim 14, wherein the target is the C.elegans organism and the first and/or second nucleic acid sequence and/or third nucleic acid sequence, if present, comprises a nucleic acid sequence that has 100% sequence identity to at least 18 contiguous nucleotides encoded by a sequence selected from the group consisting of SEQ ID N0.27, SEQ ID N0.28, and SEQ ID N0.29.
16. The isolated nucleic acid concatemer according to any preceding claim, wherein the total length of the concatemer is less than 2000 bases.
17. The isolated nucleic acid concatemer according to any preceding claim, wherein the total length of the concatemer is greater than 500 bases.
18. The isolated nucleic acid concatemer according to any preceding claim, wherein the total length of the concatemer is between 750 and 1500 bases.
19. The isolated nucleic acid concatemer according to any preceding claim, wherein mRNA levels of the targeted genes in the treated target cells or organisms are 40% lower 72 hours after exposure to the concatemer.
20. The isolated nucleic acid concatemer according to any preceding claim, wherein mRNA levels of the targeted genes in the treated target cells or organisms are 80% lower 72 hours after exposure to the concatemer.
21. The isolated nucleic acid concatemer according to any preceding claim, wherein the concatemer causes greater than 30% target mortality, as measured 108 hours after a 12 hour soaking of the mite in a 1.25 g/μΙ solution of the concatemer.
22. The isolated nucleic acid concatemer according to any preceding claim, wherein the concatemer causes greater than 60% target mortality, as measured 108 hours after a 12 hour soaking of the mite in a 1.25 g/μΙ solution of the concatemer.
23. The isolated nucleic acid concatemer according to either one of claims 21 or 22, wherein the mortality is observed in the organisms contacted with the concatamer.
24. The isolated nucleic acid concatemer according to any preceding claim, wherein the nucleic acid concatemer is a dsRNA, antisense RNA, or a ribozyme.
25. The isolated nucleic acid concatemer according to claim 24 wherein the dsRNA is an siRNA, shRNA or miRNA.
26. A nucleic acid construct encoding the isolated nucleic acid concatemer according to any preceding claim.
27. A nucleic acid construct according to claim 26, wherein the nucleic acid construct is a deoxyribonucleic acid encoding a dsRNA nucleic acid concatemer.
28. The nucleic acid construct of either one of claims 26 or claim 27 having the sequence set out in SEQ ID NOs. 4, 15, 22, or 26.
29. A host cell comprising a nucleic acid concatemer according to any one of claims 1 to 25, or the nucleic acid construct according to any one of claims 26 to 28.
30. A composition comprising at least one nucleic acid concatemer according to any one of claims 1 to 25, and/or at least one nucleic acid construct according to any one of claims 26 to 28, in combination with a physiologically or agronomically acceptable excipient, carrier, or diluent.
31. An isolated nucleic acid concatemer according to any one of claims 1 to 25, or composition according to claim 30, for use in a method of:
(i) inhibiting the growth of, or reducing, a population of a target cell / organism;
(ii) treating a disorder associated with a parasitic or infectious target cell / organism; or
(iii) treating a disorder associated with a pathogenic cell population (for example, cancer).
32. Use of an isolated nucleic acid concatemer according to any one of claims 1 to 25, or composition according to claim 30, in the manufacture of a medicament for:
(i) inhibiting the growth of, or reducing, a population of a target cell / organism; (ii) treating a disorder associated with a parasitic or infectious target cell / organism; or
(iii) treating a disorder associated with a pathogenic cell population (for example, cancer).
33. A method of:
(i) inhibiting the growth of, or reducing, a population of a target cell / organism;
(ii) treating a disorder associated with a parasitic or infectious target cell / organism; or
(iii) treating a disorder associated with a pathogenic cell population (for example, cancer).
the method comprising exposing a target cell or organism administering to an isolated nucleic acid concatemer according to any one of claims 1 to 25, or composition according to claim 30.
34. A transgenic plant cell, plant, or part thereof, which expresses a nucleic acid concatemer nucleic acid concatemer according to any one of claims 1 to 25, or which contains a nucleic acid construct according to any one of claims 26 to 28.
PCT/GB2016/050015 2015-01-06 2016-01-05 Enhanced rnai mediated gene regulation WO2016110691A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB201500107 2015-01-06
GB1500107.6 2015-01-06

Publications (1)

Publication Number Publication Date
WO2016110691A1 true WO2016110691A1 (en) 2016-07-14

Family

ID=55069907

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2016/050015 WO2016110691A1 (en) 2015-01-06 2016-01-05 Enhanced rnai mediated gene regulation

Country Status (1)

Country Link
WO (1) WO2016110691A1 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110923252A (en) * 2019-11-20 2020-03-27 天津科技大学 Codon-optimized housefly acetylcholinesterase gene, protein and application
CN111849980A (en) * 2020-06-30 2020-10-30 华南农业大学 MiRNAs for inhibiting activation of plutella xylostella PPO and application thereof
EP3728601A4 (en) * 2018-01-17 2021-03-17 Augmanity Nano Ltd A set of anti-pathogenic nucleic acids, compositions and uses thereof
CN112522278A (en) * 2020-12-29 2021-03-19 华南师范大学 dsRNA (double-stranded ribonucleic acid) designed based on periplaneta americana olfactory receptor gene OR3X, encoding gene, preparation method and application thereof
CN112725345A (en) * 2020-12-29 2021-04-30 华南师范大学 dsRNA designed based on periplaneta americana sex pheromone receptor gene OR5M, coding gene, preparation method and application thereof
CN113481202A (en) * 2021-08-17 2021-10-08 中国林业科学研究院森林生态环境与保护研究所 Spodoptera cunea Rop gene dsRNA as well as bacterial expression solution and application thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006046148A2 (en) * 2004-10-25 2006-05-04 Devgen Nv Rna constructs
WO2006128739A1 (en) * 2005-06-01 2006-12-07 Polyplus-Transfection Sa Oligonucleotides for rna interference and biological applications thereof
WO2011045796A1 (en) * 2009-10-14 2011-04-21 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Compositions for controlling varroa mites in bees
EP2431378A2 (en) * 2009-05-14 2012-03-21 Korea Institute of Science and Technology Method for polymerizing a small oligonucleotide, and use of a high-molecular oligonucleotide prepared by the polymerization method
WO2015001336A2 (en) * 2013-07-02 2015-01-08 The University Court Of The University Of Aberdeen Control of varroa mite infestation

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006046148A2 (en) * 2004-10-25 2006-05-04 Devgen Nv Rna constructs
WO2006128739A1 (en) * 2005-06-01 2006-12-07 Polyplus-Transfection Sa Oligonucleotides for rna interference and biological applications thereof
EP2431378A2 (en) * 2009-05-14 2012-03-21 Korea Institute of Science and Technology Method for polymerizing a small oligonucleotide, and use of a high-molecular oligonucleotide prepared by the polymerization method
WO2011045796A1 (en) * 2009-10-14 2011-04-21 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Compositions for controlling varroa mites in bees
WO2015001336A2 (en) * 2013-07-02 2015-01-08 The University Court Of The University Of Aberdeen Control of varroa mite infestation

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
"supplementary figure S1", November 2009 (2009-11-01), XP002755109, Retrieved from the Internet <URL:http://www.sciencedirect.com/science/article/pii/S0965174809001374> [retrieved on 20160307] *
"Supplementary Material: Tables", 1 November 2009 (2009-11-01), XP055255693, Retrieved from the Internet <URL:http://www.sciencedirect.com/science/MiamiMultiMediaURL/1-s2.0-S0965174809001374/1-s2.0-S0965174809001374-mmc1.doc/271245/html/S0965174809001374/c4ea6edf0d284f57f463ff779a54507d/mmc1.doc> [retrieved on 20160307] *
WHYARD S. ET AL.: "Ingested double-stranded RNAs can act as species-specific insecticides", INSECT BIOCHEMISTRY AND MOLECULAR BIOLOGY, ELSEVIER SCIENCE LTD, GB, vol. 39, no. 11, 1 November 2009 (2009-11-01), pages 824 - 832, XP026777046, ISSN: 0965-1748, [retrieved on 20091006], DOI: 10.1016/J.IBMB.2009.09.007 *

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3728601A4 (en) * 2018-01-17 2021-03-17 Augmanity Nano Ltd A set of anti-pathogenic nucleic acids, compositions and uses thereof
CN110923252A (en) * 2019-11-20 2020-03-27 天津科技大学 Codon-optimized housefly acetylcholinesterase gene, protein and application
CN111849980A (en) * 2020-06-30 2020-10-30 华南农业大学 MiRNAs for inhibiting activation of plutella xylostella PPO and application thereof
CN111849980B (en) * 2020-06-30 2022-03-22 华南农业大学 MiRNAs for inhibiting activation of plutella xylostella PPO and application thereof
CN112522278A (en) * 2020-12-29 2021-03-19 华南师范大学 dsRNA (double-stranded ribonucleic acid) designed based on periplaneta americana olfactory receptor gene OR3X, encoding gene, preparation method and application thereof
CN112725345A (en) * 2020-12-29 2021-04-30 华南师范大学 dsRNA designed based on periplaneta americana sex pheromone receptor gene OR5M, coding gene, preparation method and application thereof
CN112522278B (en) * 2020-12-29 2021-09-28 华南师范大学 dsRNA (double-stranded ribonucleic acid) designed based on periplaneta americana olfactory receptor gene OR3X, encoding gene, preparation method and application thereof
CN112725345B (en) * 2020-12-29 2021-09-28 华南师范大学 dsRNA designed based on periplaneta americana sex pheromone receptor gene OR5M, coding gene, preparation method and application thereof
CN113481202A (en) * 2021-08-17 2021-10-08 中国林业科学研究院森林生态环境与保护研究所 Spodoptera cunea Rop gene dsRNA as well as bacterial expression solution and application thereof
CN113481202B (en) * 2021-08-17 2023-05-16 中国林业科学研究院森林生态环境与保护研究所 Fall webworm Rop gene dsRNA, bacterial expression liquid and application thereof

Similar Documents

Publication Publication Date Title
WO2016110691A1 (en) Enhanced rnai mediated gene regulation
US9932590B2 (en) Control of Varroa mite infestation
JP5530632B2 (en) Pest control method using RNAi
Xue et al. New approaches to agricultural insect pest control based on RNA interference
US20170058278A1 (en) Compositions and methods of using same for controlling pathogenically infected mosquitoes
Darrington et al. Implementing the sterile insect technique with RNA interference–a review
CN101370940A (en) DsRNA as insect control agent
CN104087577A (en) DsRNA as insect control agent
CN106102456B (en) Biological control of insects
JP2019533477A (en) A novel paratransgenic system for biological control of spread mosquitoes
Wen et al. Ingestion of killed bacteria activates antimicrobial peptide genes in Drosophila melanogaster and protects flies from septic infection
Eleftherianos et al. Induced nitric oxide synthesis in the gut of Manduca sexta protects against oral infection by the bacterial pathogen Photorhabdus luminescens
Hun et al. Increased insulin signaling in the Anopheles stephensi fat body regulates metabolism and enhances the host response to both bacterial challenge and Plasmodium falciparum infection
Dung et al. Identification of RNAi-related genes and transgenerational efficiency of RNAi in Artemia franciscana
US10351850B2 (en) Double-stranded ribonucleic acid as control against insects
Wang et al. Insights into the different functions of multiple peptidoglycan recognition proteins in the immune response against bacteria in the mosquito, Armigeres subalbatus
Zhang et al. Advances and prospects of RNAi technologies in insect pest management
Alshukri Novel molecular biopesticides targeting the potassium ion channels of the red flour beetle, Tribolium castaneum (Herbst.)
Kumar et al. RNA interference and its potential applications in aquatic animal health management
Khalil et al. RNAi-mediated mortality of Culex quinquefasciatus using two delivery methods of potential field application
US20220248690A1 (en) Sex-linked rnai insecticide materials and methods
US20240206478A1 (en) Composition targeting v-atpase for controlling frankliniella occidentalis and method of controlling frankliniella occidentalis using same
Karabağ et al. RNAi-Mediated Post-Transcriptional Gene Silencing Strategies in Honey Bees
Li et al. Response of the mosquito immune system and symbiotic bacteria to pathogen infection
Mohammed Targeting the vacuolar ATPase subunits B and C in pink bollworm, Pectinophora gossypiella (Saunders)(Lepidoptera; Gelechiidae)

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16700026

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16700026

Country of ref document: EP

Kind code of ref document: A1