CN113481202B

CN113481202B - Fall webworm Rop gene dsRNA, bacterial expression liquid and application thereof

Info

Publication number: CN113481202B
Application number: CN202110941952.3A
Authority: CN
Inventors: 张真; 张珣; 张苏芳; 樊智智; 孔祥波; 刘福; 方加兴
Original assignee: Research Institute of Forest Ecology Environment and Protection of Chinese Academy of Forestry
Current assignee: Research Institute of Forest Ecology Environment and Protection of Chinese Academy of Forestry
Priority date: 2021-08-17
Filing date: 2021-08-17
Publication date: 2023-05-16
Anticipated expiration: 2041-08-17
Also published as: CN113481202A

Abstract

The invention discloses a fall webworm Rop gene dsRNA, bacterial expression liquid and application thereof, wherein the nucleotide sequence of the Rop gene dsRNA fragment is shown as SEQ ID NO. 2. The method for preventing and controlling the fall webworm by using the bacterial expression liquid has the advantages of strong feasibility, convenient operation, good effectiveness and sensitivity, high insecticidal efficiency, environmental friendliness and the like, and has good application prospect.

Description

Fall webworm Rop gene dsRNA, bacterial expression liquid and application thereof

Technical Field

The application relates to the technical field of molecular biology, in particular to fall webworm Rop gene dsRNA, bacterial expression liquid and application thereof.

Background

The fall webworm (Hyphantrichia cunea) belongs to Lepidoptera Lupulaceae, is extremely dangerous foreign invasion forestry pests in China, has very wide host plants, can feed almost all kinds of cultivated trees, flowers and crops, and has great food consumption and extremely strong adaptability, and larvae feed on leaves in a population form. The adult reproductive capacity is strong, the average number of eggs laid by each female is 800-900, and the maximum number can reach more than 2000. Meanwhile, the adult diffusion capability is extremely strong, and the male worms can fly more than 7 kilometers in average within 12 hours and can fly more than 23 kilometers at maximum. The characteristics cause that the fall webworm is extremely easy to outbreak and disaster, since the fall webworm is discovered in 1979 for the first time in China, huge economic loss and serious ecological threat are caused to the agriculture and forestry ecological system in China, once the fall webworm invades a new suitable place, the fall webworm is difficult to thoroughly destroy, and the ecological safety in China is seriously threatened.

RNA interference (RNAi) is a posttranscriptional gene silencing mechanism initiated by double-stranded RNA (dsRNA) into cells, effectively leading to pest death by silencing specific lethal genes. Although RNAi technology has wide application prospect as a new means of pest control, a plurality of researches find that RNAi efficiency of different insects is obviously different, and usually RNAi efficiency of coleoptera, orthoptera and other insects is higher, while RNAi efficiency of lepidoptera insects is very low (Wang, et al, "Variation in RNAi efficacy among insect species is attributable to dsRNA degradation in vivo". Insect Biochemistry and Molecular Biology,77,1-9,2016;Terenius,et al., "RNA interference in Lepidoptera: an overview of successful and unsuccessful studies and implications for experimental design". Journal of Insect Physiology.57 (2), 231-245, 2011), which seriously influences application of RNAi technology in lepidoptera pest control. Among the many factors affecting RNAi efficiency, one of the known factors is the stability of dsRNA, and the maintenance of RNAi effectiveness must be prevented from degradation of dsRNA, e.g., double stranded RNA degrading enzyme (dsRNA degrading enzyme, dsRNase) is a class of dsRNA-specific degrading enzyme, and expression of dsRNase genes has been currently detected in different tissues of lepidopterans such as Bombyx mori, spodoptera litura (Liu et al, "Bombyx mori DNA/RNA non-specific nuclease: expression of isoforms in insect culture cells, subcellular localization and functional assays', journal of Insect Physiology.58 (8), 1166-1176,2012;Penga,et al," "Identification and characterization of multiple dsRNases from a lepidopteran insect, the tobacco cutworm, spodoptera litura (Lepidote: noctada)", pesticide Biochemistry and Physiology.162,86-95,2020). It was found that dsRNase was more active in lepidopteran insects than in other populations of insects (Kun Yan Zhu and Subba Reddy Palli, "organs, applications, and challenges of insect RNA interference". Annual Review of Entomology,65,293-311,2020), degradation of dsRNase might be a major factor limiting lepidopteran insect RNAi efficiency. Therefore, RNAi is difficult to achieve in lepidopteran insects, and there are few reports of high-efficiency RNAi target genes in lepidopteran insect control.

As important quarantine pests, the control of the fall webworm is mainly chemical control at present, which causes negative influence on ecological environment, and although biological control measures such as parasitic natural enemies, sex attractants and the like are utilized, the problems of low efficiency, high cost and the like generally exist, and no RNAi target gene with high-efficiency insecticidal activity of the fall webworm is reported at home and abroad at present. Patent application CN 111944824A discloses application of a fall webworm tachykinin receptor gene and dsRNA in fall webworm prevention and treatment, but the application adopts an injection method to ingest the dsRNA, so that large-scale application cannot be realized in actual woodland prevention and treatment, and the fall webworm rapid kinin receptor gene and the dsRNA in the patent application can only reduce feed intake and hunger resistance of fall webworm larvae, weaken the vitality of fall webworm, and have no lethal effect and general prevention and treatment effect. Xiaoping (biochemical characteristic analysis and functional study of fall webworm chitin deacetylase HcCDAs, university of agriculture in Hebei (academic paper), 2018.) by injecting dsRNA of fall webworm chitin deacetylase gene into fall webworm 5-year larva, the larva mortality rate of more than 80% can be achieved, but the injection dose is 10ug, and the dose is too high to be achieved in actual pest control. Wang Yue (American white moth gene function research and transcriptome analysis based on RNA interference, chinese forestry science institute (academic paper), 2018) constructs an HT115 strain expression system of the American white moth chitinase gene dsRNA, but after the recombinant bacteria are fed, no variation of malformed phenotype, pupation rate and death rate is generated, only the body weight of the larvae is obviously reduced, and the control effect is not ideal.

Rop proteins are involved in intracellular vesicle transport, as Drosophila's Rop is a homolog of the yeast Sec.1 protein and is critical for vesicle transport and membrane fusion (Fujita, Y.et al., "Phosphorylation of Munc-18/n-Sec1/rbSec1 by protein kinase C-Its implication in regulating the interaction of Munc-18/n-Sec1/rbSec1 with synthaxin". Journal of Biological Chemistry,271 (13): 7265-7268, 1996). The Rop gene has important regulation and control effects on maintaining cell activity, and can indirectly influence physiological processes such as development, growth, reproduction, metabolism and the like of insects. At present, no report is made on the prevention and treatment of fall webworm, a major quarantine pest, by inhibiting the transcription level of insect Rop genes.

Disclosure of Invention

In order to overcome the defects and the shortcomings of the existing lepidoptera pest fall webworm control technology, the invention provides fall webworm Rop gene dsRNA, and the nucleotide sequence of the fall webworm Rop gene dsRNA is shown as SEQ ID NO. 2.

The invention also provides a bacterial expression liquid for expressing the dsRNA, and the preparation method of the bacterial expression liquid comprises the following steps:

(1) PCR amplification is carried out by using a dsHcRop primer with the sequence shown in SEQ ID NO.10 and 11 by using the fall webworm cDNA as a template to obtain the dsRNA fragment;

(2) Ligating the dsRNA fragment to a linear plasmid to construct a recombinant vector;

(3) Introducing a recombinant expression vector containing the dsRNA fragment into a bacterial competent cell for culture;

(4) dsRNA production was induced by IPTG, and the bacterial liquid was collected by culture.

Further, the plasmid was linearized L4440 and the bacterium was escherichia coli HT115.

The invention also provides application of the dsRNA or the bacterial expression liquid in preventing and controlling fall webworm.

Furthermore, the control of fall webworm is realized by feeding or spraying a bacterial expression liquid of dsRNA expressing the Rop gene.

The control of fall webworm is realized by feeding artificial feed mixed with bacterial expression liquid for expressing Rop gene dsRNA, and the method specifically comprises the following steps: cutting the prepared artificial feed into blocks with the size of about 0.5x0.5x0.5cm per 30g, and spraying the dsRNA for expressing the Rop gene with the concentration of 10 ⁷ And 5mL of HT115 bacterial liquid of CFU/mL, and feeding after air drying for 1h at normal temperature.

Or directly spraying bacterial expression liquid for expressing the Rop gene dsRNA on plants to prevent and treat fall webworm, wherein the bacterial expression liquid is escherichia coli HT115 bacterial liquid.

The beneficial effects of the invention include:

the invention screens and obtains a fall webworm RNAi efficient lethal target gene Rop gene, and develops a technology capable of efficiently preventing fall webworm based on the Rop gene, the invention adopts recombinant plasmid to express a large amount of required exogenous target dsRNA in escherichia coli HT115, and after continuously feeding escherichia coli HT115 bacterial liquid of IPTG induced expression target dsRNA, the invention has high lethal capacity on fall webworm, and has obvious inhibition effect on growth and development of fall webworm, and the method for preventing and controlling fall webworm by adopting the bacterial expression liquid has the advantages of strong feasibility, convenient operation, good effectiveness and sensitivity, high insecticidal efficiency, environmental friendliness and the like, and has good application prospect. Compared with the in-vitro transcription and chemical synthesis methods of the kit adopted in the prior art, the invention can greatly reduce the experimental cost.

Drawings

FIG. 1 is an electrophoresis chart of fall webworm Rop gene;

fig. 2 shows larval mortality of 8d to 13d after injection of fall webworm dsHcRop, normal growth larvae (control), dsGFP control group (dsGFP) and dsHcRop treatment group (dsHcRop);

FIG. 3 shows the phenotypic differences in pupation phase of the fall webworm dsHcRop-injected 13d, normal growth larvae (control), dsGFP-injected control (dsGFP) and dsHcRop-injected treated group (dsHcRop);

FIG. 4 shows the relative expression levels of the Rop gene in normally grown larvae (control), dsGFP-injected control (dsGFP) and dsHcRop-injected treated (dsHcRop) larvae 48h after injection of dsRNA of fall webworm Rop gene;

fig. 5 shows mortality and pupation rates of larvae from 12d to 18d after feeding with E.coli broth expressing fall webworm dsHcRop, control and dsHcRop broth treated (dsHcRop) larvae.

Detailed Description

The present invention is further illustrated and described below with reference to the following examples, which are but some, but not all, examples of the invention. All other inventions and embodiments, based on this invention and described herein, which would be apparent to one of ordinary skill in the art without undue burden are within the scope of this invention.

The experimental methods used in the following examples are conventional methods unless otherwise specified.

Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

EXAMPLE 1 full-length cloning of fall webworm Rop Gene

(1) The method comprises the steps of taking fall webworm larvae, and extracting total RNA of fall webworm by adopting a TRIzol method (Trizol Plus reagent, ambion, austin, TX, USA).

(2) The first strand cDNA was synthesized using a reverse transcription kit GoScriptTM Reverse Transcription System kit (Promega, madison, wis., USA) in the reverse transcription system: total RNA 1 μg, oligo (dT) ₁₅ Primer(500μg/ml)0.5μL，GoScriptTM 5X Reaction Buffer 4μL，MgCl ₂ (25mM)1μL，Random Primers(500μg/ml)0.5μL，PCR Nucleotide Mix 1μL，Recombinant

Ribonuclease Inhibitor 0.4. Mu.L, goScriptTM Reverse Transcriptase. Mu.L, nuclease-Free Water make up 20. Mu.L. The reaction conditions were 42℃for 15min,70℃for 15min.

(3) Primers are designed on two sides of the gene coding region sequence according to the fall webworm larva transcriptome sequence. Primers were designed using Primer5 software to obtain forward and reverse primers.

Forward primer: ATGTATAATCCTGCTCTTGCC (SEQ ID NO. 4)

Reverse primer: TTAGGCGGTTAGAGAGCTCAA (SEQ ID NO. 5)

And (3) using the first strand of the cDNA obtained by reverse transcription as a template, and obtaining a target product fragment through PCR amplification. The PCR reaction system is as follows: cDNA 2. Mu.L, buffer (Mg ²⁺ Plus)5μL，dNTP Mixture 8μL，Forward Primer 2μL，Reverse Primer2μL，

Max DNA Polymerase 0.5.5. Mu.L, add ddH ₂ O to 100. Mu.L. The reaction condition is 94 ℃ for 1min;94℃30s,55℃30s,72℃1min,35 cycles; and at 72℃for 10min.

(4) The PCR products were subjected to agarose gel electrophoresis, and the results are shown in FIG. 1. And purifying and recovering the target product by using a DNA purification kit (Tiangen). After recovery, the product was ligated with pEASY-Blunt vector (TransGen, beijing, china), transferred into DH 5. Alpha. Competent cells (TransGen, beijing, china), plated onto Amp-resistant screening medium, and positive single colonies were picked up in Amp-resistant liquid LB medium and sent to the company (Sangon Biotech, co., ltd., beijing, china) for sequencing.

(5) And comparing the sequencing result through NCBI database to obtain the sequence fragment of the fall webworm Rop gene, wherein the specific nucleotide sequence is shown as SEQ ID NO.1 in the sequence table. The sequencing result verifies that the correct plasmid is the plasmid with the sequence of SEQ ID NO. 1.

EXAMPLE 2 Synthesis of fall webworm Rop Gene dsRNA

(1) The plasmid with the correct sequence as verified by the sequencing (plasmid with SEQ ID NO. 1) was continued to be PCR amplified with the dsRNA primer with the T7 promoter sequence, the amplification method and system being described above with reference to step (3) of example 1. The amplification product was recovered and purified, and the recovery and purification method was referred to in step (4) of example 1.

The PCR amplification primers are as follows:

f taatacgactcactataggGCACGCCCAACTCGACCCCT (SEQ ID NO. 6)

R taatacgactcactataggCGCCGCCAACTACGAAAACA (SEQ ID NO. 7)

(2) And (3) purifying and recovering the PCR amplification product obtained in the step (1) to obtain the template for in vitro transcription of the dsRNA.

The dsRNA was synthesized in vitro using the T7 RiboMAXTM Express RNAi System kit (Promega, madison, wis., USA) with the following reaction system: riboMAXTM Express T7 2 XBuffer 10. Mu.L, linear DNA template about 1. Mu.g, enzyme mix, T7 Express 2. Mu.L, make up nuclease free water to 20. Mu.L. Mix gently and incubate at 37℃for 3h.

(3) Annealing of double stranded RNA can be achieved by mixing equal volumes of complementary RNA reaction solution, then incubating for 10 minutes at 70℃strip, and slowly cooling to room temperature (about 20 min). mu.L of RNase was added to 199. Mu.L of nuclease-free water to dilute the attached RNase solution (1:200). 1. Mu.L of freshly diluted RNase solution and 1. Mu.L of RQ1 RNase-Free DNase were added, respectively, and incubated at 37℃for 30 minutes to remove all remaining single stranded RNA and DNA template, leaving only double stranded RNA.

(4) 0.1 volume of 3M sodium acetate (pH 5.2) and 1 volume of isopropanol were added, mixed well and placed on ice for 5 minutes. Centrifugation was carried out at 12000rpm at 4℃for 10 minutes, and a white precipitate was visible at the bottom of the tube. The supernatant was discarded, the pellet was washed with 0.5mL of 70% cold ethanol, and after air-drying at room temperature, purified dsRNA was obtained by dissolving with 4 volumes of nuclease-free water and stored at-80℃until use.

(5) 1 mu L of synthesized dsRNA is taken for 1% agarose gel electrophoresis experiments, the electrophoresis voltage condition is 120V, the time is 15 minutes, the buffer solution is prepared by DEPC treatment water, the RNAase-free gun head is used for sample application, the dsHcRop of the dsRNA fragment has a single clear band (the specific nucleotide sequence of the dsRNA fragment is shown as SEQ ID NO.2 in a sequence table) of about 350bp, and the dsHcRop can be used for subsequent experiments.

EXAMPLE 3 growth inhibition of larvae by dsHcRop injection

(1) The larvae of fall webworm with the 4-instar larvae which grow normally, develop consistently and have the same size are selected, starvation treatment is carried out for 12 hours, 4-5 larvae are placed in a culture dish before injection, are subjected to cold anesthesia for 2-3min in a refrigerator at the temperature of minus 20 ℃, are placed on an ice dish after being taken out, and are injected with 6 mug of dsHcRop obtained in the example 2 at the abdominal internode of the larvae before the larvae do not resume autonomous action. The injection is carried out under a stereoscopic vision, whether the injected liquid completely enters the insect body or not is observed, the larvae which are successfully injected and do not cause obvious mechanical damage are placed in a new culture dish for self recovery, the larvae which die due to non-experimental factors are taken out after 2 hours, the remaining larvae are continuously fed according to normal conditions, and subsequent observation and sampling treatment are carried out. The experiment was carried out with 2 control groups, namely normal growth larvae (control) and larvae (dsGFP) injected with exogenous dsGFP fragment (exogenous dsGFP fragment is an exogenous fragment amplified from pGFP plasmid, as control, with a size of 678bp, the nucleotide sequence of the dsGFP fragment is shown as SEQ ID NO. 3). Each treatment was injected with 30 larvae, 10 for one biological repeat, and the larvae mortality was investigated starting 8 days after injection.

(2) The experimental results are shown in figure 2, where there is no difference in the mortality of normally grown larvae (control) and dsGFP-injected larvae, but 10d after treatment, dsHcRop injected larvae had significantly higher mortality than control group, 2.3 and 1.8 times that of normally grown larvae and dsGFP injected larvae, respectively. The pupation stage fall webworm phenotype is shown in figure 3, both normally grown larvae (control) and larvae injected with dsGFP can normally pupate, but larvae injected with dsHcRop appear malformed pupae.

EXAMPLE 4 injection of dsHcRop to inhibit expression of Rop Gene in fall webworm

(1) Samples were taken separately 48h after dsHcRop injection, 3 larvae per treatment group (3 biological replicates). The RNA of fall webworm was collected and then reverse transcribed into cDNA, and the experimental method was the same as in steps (1) and (2) of example 1.

(2) According to the SEQ ID NO.1 sequence, RT-qPCR primers are designed by using Primer5 software, and the relative expression quantity of the Rop gene is detected. qPCR detection was performed using the SuperReal PreMix Plus (SYBRGreen) kit (Tiangen). The reaction system was (20. Mu.L): 2X SuperReal PreMix Plus 10. Mu.L, forward primer (10. Mu.M) 0.6. Mu.L, reverse primer (10. Mu.M) 0.6. Mu.L, cDNA template 1. Mu.L, nucleic-Free Water make up 20. Mu.L. The reaction conditions were 95℃for 3min,95℃for 30s,60℃for 30s,40 cycles, 3 technical replicates per sample, and the reaction was performed in a Bio-Rad (CFX 96 Touch) instrument.

The RT-qPCR primer is as follows:

f: GGAACAGATGCTGAAGGCGAGA (SEQ ID NO. 8)

R: CAGATTCTCCTCCGAAATGCCG (SEQ ID NO. 9)

(3) As shown in fig. 4, after dsRNA injection for 48 hours, the exogenous dsGFP injection treatment was not significantly different from the larvae normally raised, and the expression of the Rop gene in the larvae injected with dsHcRop was significantly lower than that in the control group, indicating that the injection of dsHcRop could cause a strong RNAi effect in the fall webworm, resulting in a significant decrease in the expression level of the Rop gene in the fall webworm, and further in death or inhibition of development of the fall webworm larvae.

Example 5 preparation of bacterial expression liquid for dsRNA expressing fall webworm Rop Gene

(1) Two cleavage sites, bgl II (AGATCT) and PstI (CTGCAG), were selected on the L4440 plasmid (Addgene Corp.) and PCR amplification was performed using the fall webworm cDNA as a template, using dsHcRop primers with the corresponding cleavage site and protecting base, as described above with reference to step (3) of example 1. The amplification product was recovered and purified, and the recovery and purification method was referred to in step (4) of example 1.

The dsHcRop primer is:

f GAAGATCTTCGCACGCCCAACTCGACCCCT (SEQ ID NO. 10)

R AACTGCAGAACCAATGCATTGGCGCCGCCAACTACGAAAACA (SEQ ID NO. 11)

(2) The L4440 vector was linearized according to the sequences of the two cleavage sites using BglII and PstI (Takara), the cleavage reaction system is described in detail in the specification, and after the cleavage reaction was completed, the linearized L4440 vector was recovered using a DNA purification recovery kit (Tiangen). Purified was ligated overnight at 4℃with T4 DNA ligase (TransGenBiotech)The dsHcRop fragment was combined with linearized L4440 vector to construct a recombinant vector. Then, the recombinant expression vector containing dsHcRop is introduced into HT115 competent cells, placed on ice for 30min, then heated at 42 ℃ for 1min, placed on ice for 2min, then 500 mu L of LB liquid medium without ampicillin is added, and the culture is carried out for 1h at 37 ℃ and 200rpm, and then LB plates containing ampicillin and tetracycline are used for overnight culture, positive clones are verified, and bacterial expression bacterial liquid for successfully expressing the fall webworm Rop gene dsRNA is obtained. HT115 expression strain of overnight shake-culturing expression recombinant vector, inoculating at 1:100 into LB liquid medium containing ampicillin (100 μg/mL) and tetracycline (10 μg/mL), shake-culturing at 37deg.C for 3.5h to OD ₆₀₀ Reaching 0.4-0.5), adding IPTG (final concentration 1 mM) to induce the generation of dsRNA, and culturing under the same condition for 5 hours to collect bacterial liquid for later use. RNA was extracted by TRIzol method (Trizol Plus reagent, USA) and 1% agarose gel electrophoresis was used to verify whether dsRNA induction was successful.

EXAMPLE 6 control Effect of feeding of bacterial liquid expressing dsHcRop on fall webworm

(1) Cutting the prepared artificial feed into blocks of about 0.5x0.5x0.5cm each 30g, and spraying 5mL (about 10 concentration) of HT115 bacterial liquid for successfully expressing dsHcRop ⁷ CFU/mL), the preparation method of the bacterial liquid is the same as that of example 5, and larvae are fed after the bacterial liquid is air-dried for 1h at room temperature.

(2) And (3) selecting larvae of fall webworm with normal growth, consistent development and same size, adding the feed for normal feeding, and taking HT115 bacterial liquid transferred into L4440 empty vector with the same concentration as a control. Each treatment of 90 larvae (30 for one biological repeat, 3 biological repeats) was fed to the larvae pupation. The larval mortality and pupation rate were investigated 12d after treatment.

(3) As shown in FIG. 5, after the HT115 bacteria liquid expressing dsHcRop is continuously fed for 14d, the death rate of the fall webworm larva reaches 65%, which is 1.6 times of that of the control group, the pupation rate of the 18d larva after feeding is 35%, which is 0.6 times of that of the control group, so that the growth and development of the fall webworm larva can be effectively inhibited by continuously feeding the HT115 bacteria liquid expressing dsHcRop.

Sequence listing

<110> institute of forestry and ecological environment and protection of China

<120> fall webworm Rop gene dsRNA, bacterial expression liquid and application thereof

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1287

<212> DNA

<213> fall webworm (Hyphantria cunea)

<400> 1

atgtataatc ctgctcttgc ccaaactcgg aatggcaata tggaacgtat cgccgaacaa 60

attgccacgc tttgtgccac acttggagaa tatccttctg tgcgttatcg cagtgactgg 120

gaacggaatt tggacctggc tcagctcatc cagcaaaaac ttgatgccta caaggctgat 180

gaaccaacta tgggagaggg tccagagaag gcgcgatccc aacttctcgt tctagatcgc 240

ggattcgact gtgtatctcc attactgcat gaactgactc ttcaagctat ggcatatgat 300

cttctgccta ttgagaatga tgtttataag tatgatgttt ccggaaacat caaagaagtc 360

ttgttggatg agaatgatga actgtgggtg gatttacgtc atcaacacat tgcggtggtg 420

tccacatctg taacaaagaa cttgaagaaa tttacagaat ccaagcgcat gggtggaggc 480

gataagcagt ctatgcgtga cttgtcgcag atgatcaaaa agatgcccca gtatcagaag 540

gaactatcca aatacgctac acatctgcgc ttagccgagg attgtatgaa atcctaccaa 600

ggctatgtgg acaagctgtg caaggtggaa caggatttgg caatgggaac agatgctgaa 660

ggcgagaaaa tcaaagatca catgagaagt attgtaccag tgcttctaga ccaaactgtg 720

gtgaacttca acaagatgcg catcattgcg ttgtacatca tgtccaagaa cggcatttcg 780

gaggagaatc tgaacaaact tgtaacgcac gcccaactcg acccctcaga caagcagaca 840

ctgttgaacc ttgccaacct cggtcttaac gtcgttattg atggtaatag gaagaagcaa 900

taccaaatca caaggaagga aagaattact gaacaaacct accaaatgtc cagatggacg 960

ccagttatca aggatattat ggaagatgcc attgaagata aactggatca acgtcattat 1020

ccgttcctgg ctggtcgcgc gcaaacgtca ggataccaag cacctactag cgtacgctac 1080

ggacactggc ataaggataa ggcccagcaa actattaaga atgtgccgcg tttgattgtt 1140

ttcgtagttg gcggcgtatg cttctctgaa attcgctgcg cctacgaagt tactgctgca 1200

ctcaagaact gggaggtcat tgttggctca tcacacatac tgacgccaga gaacttcctc 1260

tcagacttga gctctctaac cgcctaa 1287

<210> 2

<211> 350

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

gcacgcccaa ctcgacccct cagacaagca gacactgttg aaccttgcca acctcggtct 60

taacgtcgtt attgatggta ataggaagaa gcaataccaa atcacaagga aggaaagaat 120

tactgaacaa acctaccaaa tgtccagatg gacgccagtt atcaaggata ttatggaaga 180

tgccattgaa gataaactgg atcaacgtca ttatccgttc ctggctggtc gcgcgcaaac 240

gtcaggatac caagcaccta ctagcgtacg ctacggacac tggcataagg ataaggccca 300

gcaaactatt aagaatgtgc cgcgtttgat tgttttcgta gttggcggcg 350

<210> 3

<211> 678

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

tgagcaaggg cgaggagctg ttcaccgggg tggtgcccat cctggtcgag ctggacggcg 60

acgtaaacgg ccacaagttc agcgtgtccg gcgagggcga gggcgatgcc acctacggca 120

agctgaccct gaagttcatc tgcaccaccg gcaagctgcc cgtgccctgg cccaccctcg 180

tgaccaccct gacctacggc gtgcagtgct tcagccgcta ccccgaccac atgaagcagc 240

acgacttctt caagtccgcc atgcccgaag gctacgtcca ggagcgcacc atcttcttca 300

aggacgacgg caactacaag acccgcgccg aggtgaagtt cgagggcgac accctggtga 360

accgcatcga gctgaagggc atcgacttca aggaggacgg caacatcctg gggcacaagc 420

tggagtacaa ctacaacagc cacaacgtct atatcatggc cgacaagcag aagaacggca 480

tcaaggtgaa cttcaagatc cgccacaaca tcgaggacgg cagcgtgcag ctcgccgacc 540

actaccagca gaacaccccc atcggcgacg gccccgtgct gctgcccgac aaccactacc 600

tgagcaccca gtccgccctg agcaaagacc ccaacgagaa gcgcgatcac atggtcctgc 660

tggagttcgt gaccgccg 678

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

atgtataatc ctgctcttgc c 21

<210> 5

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

ttaggcggtt agagagctca a 21

<210> 6

<211> 39

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

taatacgact cactataggg cacgcccaac tcgacccct 39

<210> 7

<211> 39

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

taatacgact cactataggc gccgccaact acgaaaaca 39

<210> 8

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

ggaacagatg ctgaaggcga ga 22

<210> 9

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

cagattctcc tccgaaatgc cg 22

<210> 10

<211> 30

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

gaagatcttc gcacgcccaa ctcgacccct 30

<210> 11

<211> 42

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

aactgcagaa ccaatgcatt ggcgccgcca actacgaaaa ca 42

Claims

1. The fall webworm Rop gene dsRNA is characterized in that the nucleotide sequence of the dsRNA fragment is shown as SEQ ID NO. 2.

2. A bacterial expression fluid for expressing the dsRNA of claim 1, wherein the method of preparing the bacterial expression fluid comprises:

3. The bacterial expression liquid according to claim 2, wherein the plasmid is linearized L4440 and/or the bacterium is escherichia coli HT115.

4. Use of the dsRNA of claim 1 or the bacterial expression fluid of claim 2 for controlling fall webworm.

5. The use according to claim 4, wherein the control of fall webworm is achieved by feeding or spraying a bacterial expression liquid expressing the Rop gene dsRNA.

6. The use according to claim 5, wherein the control of fall webworm is achieved by feeding an artificial feed mixed with a bacterial expression liquid expressing the Rop gene dsRNA.

7. The use according to claim 6, wherein the prepared artificial feed is cut into blocks of 0.5x0.5x0.5cm size per 30g, and the concentration of dsRNA expressing Rop gene is 10 by spraying ⁷ And 5mL of HT115 bacterial liquid of CFU/mL, and feeding after air drying for 1h at normal temperature.

8. The use according to claim 5, wherein the control of fall webworm is achieved by spraying directly onto the plants a bacterial expression liquid expressing the Rop gene dsRNA.

9. The use according to claim 8, wherein the bacterial expression fluid is an e.coli HT115 fluid.