CN113430200B - Hypha cunea Yang vATPase A gene dsRNA, bacterial expression liquid thereof and application - Google Patents

Abstract

The invention discloses a hypha cunea Yang vATPase A gene dsRNA and a bacterial expression solution thereof, wherein the nucleotide sequence of the dsRNA fragment of the vATPase A gene is shown as SEQ ID NO. 2. The method for preventing and treating fall webworm by using the bacterial expression liquid has the advantages of strong feasibility, convenient operation, good effectiveness and sensitivity, high insecticidal efficiency, environmental friendliness and the like, and has good application prospect.

Description

Hypha cunea Yang vATPase A gene dsRNA, bacterial expression liquid thereof and application

Technical Field

The application relates to the technical field of molecular biology, in particular to a hyphantria cunea vATPase A gene dsRNA, and a bacterial expression bacterial liquid and application thereof.

Background

The fall webworm (Hypophantria cunea), also known as fall caterpillar, belongs to Lepidoptera and Hypophthalidae (Lepidotera: Arctidae), and is an extremely dangerous foreign invasion forest pest in China. Since the first discovery in China in 1979, the fall webworm has caused huge economic loss and serious ecological threat to the agriculture and forestry ecosystem in China. The fall webworm has the characteristics of strong reproductive capacity, miscellaneous eating habits, large eating quantity, strong adaptability and the like. The average female white moth egg laying rate is 800-. The insect can eat almost all kinds of cultivated trees, flowers and crops, the larva can eat leaves in a social form, after the terminal 4 th instar enters a binge eating period, the adult forest can be seriously damaged at one night, and the insect has strong disaster. In addition, the fall webworm also has strong temperature tolerance and ecological adaptability, can bear the temperature as low as-16 ℃ and as high as 40 ℃, has strong diffusion capacity, and can fly over 7 kilometers and at most 23 kilometers evenly within 12 hours. Due to the characteristics, the fall webworms are extremely easy to outbreak and cause disasters, and once the fall webworms invade a new habitat, the fall webworms are difficult to be thoroughly eliminated, and the ecological safety of China is seriously threatened.

RNA interference (RNAi) is a post-transcriptional gene silencing mechanism triggered by the entry of double-stranded RNA (dsRNA) into cells, which effectively leads to pest death by silencing specific lethal genes. Although the RNAi technology has a wide application prospect as a new means for pest control, numerous studies find that the RNAi efficiency of different insects is obviously different, generally, the RNAi efficiency of insects such as Coleoptera, Orthoptera and the like is high, but the RNAi efficiency of Lepidoptera insects is very low (Wang, et al, "Variation in RNAi efficiency amplifying insects is effective to dsRNA deletion in vivo". Insect Biochemistry and Molecular Biology,77,1-9,2016; Terenius, et al, "RNA interference in Lepidoptera: An overview of social and environmental characteristics and for experimental purposes". Journal of Insect physiology.57(2), 245,2011) and the application of RNAi technology in Lepidoptera pest control seriously affects the application of RNAi technology in Lepidoptera pest control. Among the many factors that affect the efficiency of RNAi, one of the known factors is the stability of dsRNA, and maintaining the effectiveness of RNAi must avoid degradation of dsRNA, such as double-stranded RNA degrading enzymes (dsRNases), which are a class of dsRNA-specific degrading enzymes, Expression of dsRNase genes has been currently detected in different tissues of lepidopteran insects such as Bombx mobile, Spodoptera litura (Liu, et al), "Bombx mobile DNA/RNA non-specific genes: Expression of infectious in insects culture cells, subellicular localization and functional assays". Journal of Insect physiology.58(8), 1166. 1176,2012,. Penga, et al,. Identification and characterization.32. polypeptide, strain and strain 3886 (Biochemical and strain). It was found that the activity of dsRNases in lepidopteran insects is higher than that of other groups of insects (Kun Yan Zhu and Subba Red Palli, "Mechanisms, applications, and changes of infection RNA interference". Annual Review of Entomology, 65,293 and 311,2020), and that degradation of dsRNases may be a major factor limiting the RNAi efficiency of lepidopteran insects. Therefore, RNAi is difficult to realize in lepidoptera insects, and efficient RNAi target genes are rarely reported in the control of lepidoptera pests.

As an important quarantine pest, the control of the fall webworm is mainly chemical control at present, so that the negative influence on the ecological environment is caused, biological control measures such as parasitic natural enemies, sex attractants and the like are also used, but the problems of low efficiency, high cost and the like exist totally, and the report of the RNAi target gene with high efficient insecticidal activity of the fall webworm does not exist at home and abroad at present. Although patent application CN 111944824A discloses application of a tachykinin receptor gene and dsRNA of the fall webworm in the fall webworm control, the dsRNA is ingested by an injection method in the application and cannot be applied on a large scale in the actual forest control, and the tachykinin receptor gene and the dsRNA in the application can only reduce the food intake and hunger-resistant capability of the fall webworm larva, weaken the life of the fall webworm, and achieve no lethal effect, and have general control effect. Yan Xiaoping (Biochemical characterization and functional research of the chitin deacetylase HcCDAs of fall webworms, university of Hebei agriculture (academic paper), 2018) can achieve more than 80% of larval mortality by injecting dsRNA of the chitin deacetylase gene of fall webworms into 5-instar larvae of the fall webworms, but the injection dose is 10ug, and the injection dose is too high to be realized in actual pest control. Wangyue ('RNA interference-based fall webworm gene function research and transcriptome analysis', China forestry science research institute (academic paper), 2018) constructs an HT115 strain expression system of fall webworm chitinase gene dsRNA, but after the recombinant bacteria are fed, the deformed phenotype and the change of pupation rate and death rate are not generated, only the weight of larvae is obviously reduced, and the prevention and treatment effect is not ideal.

vATPase is one of the most conserved enzymes in eukaryotes, and acts as a proton pump in organelles, and energy produced by hydrolysis of ATP will transport H in the lumen of the midgut⁺Transported into cells, and maintain the alkaline environment in the lumen of the midgut, playing an important role in the growth, development and reproduction of insects. The VATPase A subunit is one of the important domains in the VATPase complex, and the mortality of Coleoptera insects such as Aetifena temida (Powell et al, "systematic RNAi in the small fruit axle of the Murray (Coleoptera: Nitidulidae), a serous Pest of the European canal bee apex vaccine". Pest Management Science,73(1),53-63,2017) and Cryptoptera (patent CN110951730A) can be increased by injecting or directly feeding dsRNA of the VATPase A gene, but lepidopteran insects such as Danausus et al, "diagnosis ridge copy comment of v-ATPase A dsRNAs on monch". Burtflavian gene ". Freylavian, RNAi.A.242 is insensitive to RNAi of the V ATPase A gene, 2018, 2017, 242. At present, no method for feeding a bacterium expression solution for expressing vATPase A gene dsRNA is reported in the control of lepidoptera pests, particularly fall webworms.

Disclosure of Invention

In order to overcome the defects and the defects of the existing prevention and control technology of the lepidoptera pest fall webworm, the invention provides fall webworm vATPase A gene dsRNA, and the nucleotide sequence of the dsRNA is shown as SEQ ID NO. 2.

The invention also provides a bacterial expression solution for expressing the dsRNA, and the preparation method of the bacterial expression solution comprises the following steps:

(1) using fall webworm cDNA as a template, and performing PCR amplification by using a dsHcvATPase A primer to obtain the dsRNA fragment, wherein the sequence of the dsHcvATPase A primer is shown as SEQ ID NO.10 and 11;

(2) connecting the dsRNA segment to a linear plasmid to construct a recombinant vector;

(3) introducing a recombinant expression vector containing the dsRNA segment into a bacterium competent cell for culture;

(4) dsRNA production is induced by IPTG, and bacterial liquid is cultured and collected.

Further, the plasmid is linearized L4440, and the bacterium is Escherichia coli HT 115.

The invention also provides application of the dsRNA or the bacterial expression solution in preventing and treating fall webworm.

Furthermore, the control of the fall webworm can be realized by feeding or spraying bacterial expression liquid for expressing vATPase A gene dsRNA.

The control of the fall webworms is realized by feeding artificial feed mixed with bacterial expression liquid for expressing vATPase A gene dsRNA, and the control method specifically comprises the following steps: cutting the prepared artificial feed into blocks of 0.5x0.5x0.5cm size per 30g, and spraying dsRNA expressing vATPase A gene with the concentration of 10⁷5mL of CFU/mL HT115 bacterial liquid is air-dried at normal temperature for 1h, and then fed.

Or directly spraying a bacterial expression solution for expressing vATPase A gene dsRNA on a plant to realize the control of the fall webworm, wherein the bacterial expression solution is HT115 bacterial solution.

The beneficial effects of the invention include:

the invention obtains a gene vATPase A of the American white moth RNAi high-efficiency lethal target gene, develops a technology capable of efficiently preventing and controlling the American white moth based on the gene vATPase A, adopts recombinant plasmids to express a large amount of needed exogenous target dsRNA in escherichia coli HT115, has high lethal capability on the American white moth after continuously feeding escherichia coli HT115 bacterial liquid of IPTG induced expression target dsRNA, and has obvious inhibition effect on the growth and development of the American white moth. Compared with the in vitro transcription and chemical synthesis method of the kit adopted in the prior art, the invention can greatly reduce the experiment cost.

Drawings

FIG. 1 is an electrophoretogram of a gene of fall webworm vATPase A;

FIG. 2 is a graph showing the larval mortality rate of normal-growing larvae (control), control and treatment groups (dsHcvATPase A) after injection of the fall webworm dsHcvATPase A at 8d to 13 d;

FIG. 3 is a graphical representation of the phenotypic differences at pupation stage 13d after injection of the hyphantria cunea dsHcvATPase A, normal growing larvae (control), dsGFP control injected (dsGFP) and dsHcvATPase A treated (dsHcvATPase A);

FIG. 4 is a graph showing the relative expression levels of vATPase A gene in normal growth larvae (control), control and treatment groups (dsHcvATPase A) 48h after injection of the fall webworm dsHcvATPase A;

FIG. 5 shows mortality and pupation rates of larvae from 12d to 18d after feeding E.coli inoculum expressing the hyphae of fall webworm dsHcvATPase A, control group larvae (control) and treated group (dsHcvATPase A) with dsHcvATPase A inoculum.

Detailed Description

The present invention will be further illustrated and described with reference to the following examples, but the examples described are only a part of the examples of the present invention, and not all of the examples. All other inventions and embodiments based on the present invention and obtained by a person of ordinary skill in the art without any creative effort belong to the protection scope of the present invention.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 full-Length cloning of the Gene of the hyphantria cunea vATPaseA

(1) The hyphantria cunea larvae are taken, and the total RNA of the hyphantria cunea is extracted by a Trizol Plus reagent (Ambion, Austin, TX, USA) method.

(2) First strand cDNA was synthesized using the Reverse Transcription kit GoScript Reverse Transcription System kit (Promega, Madison, Wis., USA) with the Reverse Transcription System: total RNA 1. mu.g, oligo (dT)₁₅Primer(500μg/ml)0.5μL，GoScriptTM 5X Reaction Buffer 4μL，MgCl₂(25mM)1μL，Random Primers(500μ g/ml)0.5μL，PCR Nucleotide Mix 1μL，Recombinant

Ribonucleae Inhibitor 0.4. mu.L, GoScriptTM Reverse Transcriptase 1. mu.L, Nuclear-Free Water make-up 20. mu.L. The reaction conditions are 42 deg.C, 15min, 70 deg.C, 15 min.

(3) Primers were designed on both sides of the gene coding region sequence according to the fall webworm larva transcriptome sequence. Primers were designed using Primer5 software to give forward and reverse primers.

A forward primer: ATGAAAGTTGCAGAATGTG (SEQ ID NO.4 in the sequence Listing)

Reverse primer: TTAGTCCTCGAGGTTGC (SEQ ID NO.5 in the sequence Listing)

And (3) taking the first strand of the cDNA obtained by reverse transcription as a template, and amplifying by PCR to obtain a target product fragment. The PCR reaction system is as follows: cDNA 2. mu.L, Buffer (Mg)²⁺Plus)5μL，dNTP Mixture 8 μL，Forward Primer 2μL，Reverse Primer 2μL，

Max DNA Polymerase 0.5. mu.L, plus ddH₂O to 100. mu.L. The reaction conditions are 94 ℃ for 1 min; 30s at 94 ℃, 30s at 55 ℃, 1min at 72 ℃ and 35 cycles; 10min at 72 ℃.

(4) The PCR products were subjected to agarose gel electrophoresis, and the results are shown in FIG. 1. And (4) purifying and recovering the target product by using a DNA purification kit (Tiangen). After recovery, the product was ligated to pEASY-Blunt vector (TransGen, Beijing, China), transferred to DH5 alpha competent cells (TransGen, Beijing, China), spread on Amp-resistant selection medium, positive single colonies were picked up in Amp-resistant liquid LB medium and sent to the company (Sangon Biotech, Co., Ltd., Beijing, China) for sequencing.

(5) And comparing the sequencing result with an NCBI database to obtain a sequence fragment of the fall webworm vATPaseA gene, wherein the specific nucleotide sequence is shown as SEQ ID NO.1 in the sequence table. The sequencing result verifies that the correct plasmid is the plasmid with the sequence of SEQ ID NO. 1.

Example 2 Synthesis of dsRNA of the Gene of fall webworm vATPaseA

(1) The plasmid (plasmid having the sequence of SEQ ID NO. 1) whose sequencing result confirmed the correctness was continuously subjected to PCR amplification using dsRNA primer having the sequence of T7 promoter, and the amplification method and system were referred to the above step (3) of example 1. The amplification product is recovered and purified according to the method of recovering and purifying the amplification product described in step (4) of example 1.

The PCR amplification primers are as follows:

taatacgactcactataggTGGTGCTGGAGACGGAGTT (SEQ ID NO.6 in the sequence Listing)

taatacgactcactataggCCACAGGCATGTTGGAGGT (SEQ ID NO.7 in the sequence Listing)

(2) And (2) purifying and recovering the PCR amplification product obtained in the step (1) to obtain a dsRNA in-vitro transcription template.

In vitro synthesis of dsRNA T7 RiboMAXTM Express RNAi systems kit (Promega, Madison, WI, USA) was used in the reaction System: RiboMAXTM Express T72X Buffer 10. mu.L, linear DNA template about 1. mu.g, Enzyme Mix, T7 Express 2. mu.L, make up nuclease free water to 20. mu.L. Gently mixed and incubated at 37 ℃ for 3 h.

(3) Annealing of double-stranded RNA was achieved by mixing equal volumes of complementary RNA reaction solutions, incubating at 70 ℃ for 10 minutes, and slowly cooling to room temperature (about 20 min). mu.L of RNase was added to 199. mu.L of nuclease-free water to dilute the attached RNase solution (1: 200). mu.L of freshly diluted RNase solution and 1. mu.L of RQ1 RNase-Free DNase were added, respectively, and incubated at 37 ℃ for 30 minutes to remove all remaining single-stranded RNA and DNA template, leaving only double-stranded RNA.

(4) 0.1 volume of 3M sodium acetate (pH 5.2) and 1 volume of isopropanol were added, mixed well and placed on ice for 5 minutes. 12000rpm, 4 ℃ centrifugal 10 minutes, the centrifugal tube bottom visible white precipitate. The supernatant was discarded, the pellet was washed with 0.5mL of 70% cold ethanol, air-dried at room temperature, and then dissolved in 4 volumes of nuclease-free water to obtain purified dsRNA, which was stored at-80 ℃ for further use.

(5) 1 microliter of synthesized dsRNA is taken to carry out a 1% agarose gel electrophoresis experiment, the voltage condition of electrophoresis is 120 volts, the time is 15 minutes, the used buffer solution needs DEPC processing water to be prepared, the spotting needs to use an RNAase-free gun head, a single clear band (the specific nucleotide sequence of the band is shown as SEQ ID NO.2 in a sequence table) is arranged on the dsRNA segment dsHcvATPaseA at about 393bp, and the band can be used for subsequent experiments.

Example 3 growth inhibition of larvae by dsHcvATPaseA injection

(1) Selecting 4-year-old larvae of fall webworms with normal growth, consistent development and the same size, starving for 12h, placing 4-5 larvae in a culture dish before injection, carrying out cold anesthesia for 2-3 min in a refrigerator at-20 ℃, taking out and placing on an ice tray, and injecting 6 mu g of dsHcvATPase A obtained in example 2 to the abdominal internode membrane of the larvae by using a micro-injector before the larvae do not return to autonomous movement. Injecting under a stereoscope, observing whether the injected liquid completely enters the polypide and has no leakage phenomenon, placing the larvae which are successfully injected and do not cause obvious mechanical damage in a new culture dish for self recovery, taking out the larvae which die due to non-experimental factors after 2h, continuously feeding the rest larvae according to normal conditions, and performing subsequent observation and sampling treatment. The experiment was performed with 2 control groups, normal growing larvae (control) and larvae injected with exogenous dsGFP fragment (exogenous dsGFP fragment is an exogenous fragment amplified from pGFP plasmid, as a control, size 678bp, nucleotide sequence of dsGFP fragment is shown in SEQ ID NO. 3.) (dsGFP). Each treatment was injected with 30 larvae, one biological replicate for 10, and larval mortality was investigated starting 8 days after injection.

(2) As shown in FIG. 2, the mortality rates of normal grown larvae (control) and dsGFP-injected larvae were not different, but from 11 days after treatment, the mortality rate of dsHcvATPase A-injected larvae was significantly higher than that of the control group, and the mortality rate of larvae reached 74% at 13 days after treatment, which was 5 times that of normal grown larvae and 4 times that of dsGFP-injected larvae. Pupation stage hyphantria cunea phenotype as shown in fig. 3, both normal growing (control) and dsGFP injected larvae can pupate normally, but dshcvvatpase a injected larvae cannot pupate until death.

Example 4 injection of dsHcvATPaseA inhibits vATPaseA Gene expression in white moth

(1) Samples were taken 48h after dshcva atpase a injection and 3 larvae (3 biological replicates) were removed from each treatment group. RNA of the fall webworm was collected by extraction and then reverse-transcribed into cDNA in the same manner as in steps (1) and (2) of example 1.

(2) RT-qPCR primers are designed by using Primer5 software according to the sequence of SEQ ID NO.1, and the relative expression quantity detection of vATPase A genes is carried out. qPCR assays were performed using the superfeal PreMix Plus (SYBR Green) kit (skyhoot). The reaction system was (20 μ L): 2 XSuperReal PreMix Plus 10. mu.L, forward primer (10. mu.M) 0.6. mu.L, reverse primer (10. mu.M) 0.6. mu.L, cDNA template 1. mu.L, nucleic-Free Water make-up 20. mu.L. The reaction conditions were 95 ℃ for 3 min, 95 ℃ for 30s, 60 ℃ for 30s, 40 cycles, 3 technical replicates per sample, and the reaction was carried out in a Bio-Rad (CFX96 Touch) instrument.

The RT-qPCR primer is as follows:

f: GCACAAGATGATTGTACCGCC (SEQ ID NO.8 in the sequence Listing)

R: ACTTCTCGCCGTCGAACTCC (SEQ ID NO.9 in the sequence Listing)

(3) The experimental result is shown in fig. 4, after 48h of dsRNA injection, there is no significant difference between the exogenous dsGFP injection treatment (control group) and the normally bred larvae (control group), and the expression of the vtpase a gene in the larvae injected with dshcvtpase a is significantly lower than that in the control group, which indicates that the strong RNAi effect can be induced in the fall webworm by injecting dshcvtpase a, resulting in the significant reduction of the expression level of the va gene in vivo, and further resulting in the death or the inhibition of the development of the fall webworm larvae.

Example 5 preparation of bacterial expression bacterial solution expressing the Gene of hyphantria cunea vATPase A

(1) Two sites were selected on the L4440 plasmid (Addgene, Inc.), Bgl II (AGATCT) and Pst I (CTGCAG), and PCR amplification was performed using the hypha moth cDNA as a template and dsHcvATPase A primers with the corresponding cleavage site and the protective base, and the amplification method and system were as described in step (3) of example 1 above. The amplification product is recovered and purified according to the method of recovering and purifying the amplification product described in step (4) of example 1.

The dsHcvATPase A primer is as follows:

GAAGATCTTCTGGTGCTGGAGACGGAGTT (SEQ ID NO.10 in the sequence Listing)

AACTGCAGAACCAATGCATTGGCCACAGGCATGTTGGAGGT (SEQ ID NO.11 in the sequence Listing)

(2) The L4440 vector is linearized by Bgl II and Pst I (Takara) according to the sequences of two enzyme cutting sites, the details of the reaction system of enzyme cutting are shown in the specification, and after the enzyme cutting reaction is finished, the linearized L4440 vector is recovered by using a DNA purification recovery kit (Tiangen). Recombinant vectors were constructed by ligating purified dsHcvATPaseA fragments with linearized L4440 vector using T4 DNA ligase (TransGen Biotech) overnight at 4 ℃. Then, the recombinant expression vector containing dsHcvATPase A is introduced into HT115 competent cells, placed on ice and placed for 30min, then heat shock is carried out for 1min at 42 ℃, the cells are kept still on ice for 2min, then 500 mu L of LB liquid culture medium without ampicillin is added, the cells are cultured for 1h at 37 ℃ and 200rpm, then LB flat plates containing ampicillin and tetracycline are used for overnight culture, and positive clones are verified, so that bacterial expression bacteria liquid for successfully expressing hypha RNA of the hypha cunea virATPase A gene is obtained. HT 115-expressing strain expressing the recombinant vector was shake-cultured overnight at 1:100 in LB liquid medium containing ampicillin (100. mu.g/mL) and tetracycline (10. mu.g/mL), and shake-cultured at 37 ℃ for 3.5 hours to OD₆₀₀Reaching 0.4-0.5), adding IPTG (final concentration of 1mM) to induce dsRNA to generate, and continuously culturing for 5h under the same condition to collect bacterial liquid for later use. RNA was extracted by the TRIzol method (Trizol Plus reagent, USA), and 1% agarose gel electrophoresis was used to verify whether dsRNA was successfully induced.

Example 6 control Effect of feeding dsHcvATPaseA-expressing bacterial suspension on fall webworm

(1) Cutting the prepared artificial feed into blocks with the size of about 0.5x0.5x0.5cm per 30g, and spraying 5mL (the concentration is about 10) of HT115 bacterial liquid for successfully expressing dsHcvATPase A⁷CFU/mL), the bacterial liquid preparation method is the same as example 5, and the larvae are fed after being air-dried for 1 hour at room temperature.

(2) Selecting 3-instar larvae of fall webworm with normal growth, consistent growth and same size, adding the above feed for normal feeding, and using HT115 bacterial liquid transferred into L4440 empty vector with same concentration as control. Each 90 larvae (30 were one biological replicate, 3 biological replicates) were treated and fed until larvae pupate. Larval mortality and pupation rates were investigated 12d after treatment.

(3) The experimental result is shown in fig. 5, after the HT115 bacterial liquid expressing dshcvvatpase a is continuously fed for 15d, the mortality rate of the fall webworm larvae reaches 66% (1.6 times of that of the control group, and the pupation rate of the 18d larvae after feeding is 33% and 0.6 times of that of the control group), which indicates that the HT115 bacterial liquid expressing dshcvvatpase a can effectively inhibit the growth and development of the fall webworm larvae.

Sequence listing

<110> institute for forest ecological environment and protection of China institute for forestry science and research

<120> hypha cunea moth vATPase A gene dsRNA, bacterial expression bacterial liquid thereof and application

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1932

<212> DNA

<213> Hyphantria cunea (Hypphantia cunea)

<400> 1

atgaaagttg cagaatgtgc tacatttaat cgttattgta agttaaaatt ttataccggc 60

aggttaaaga ataaattatt caagatggcg tcggattatc agaccatcgc caatgaagag 120

aatgaggaga agttcggata tgtctttgct gtatccggtc ctgtcgtaac ggcagagaaa 180

atgtccggat cagctatgta cgagttggtg cgtgtaggct acaatgagtt ggtaggagag 240

atcattcgtc ttgaaggtga catggctacc atccaggtat acgaagaaac ctcaggtgta 300

acagttggtg accccgtact gcgtactggc aagcccttgt cagtagaatt gggtcctggt 360

attttgggct ccatctttga cggtatccag cgtcccctga aagacattaa cgagctcacc 420

cagtccattt acatccctaa gggtgtcaac gtgccttcct tggctcgtga tgtcagctgg 480

gaatttaacc cactagaagt caaagtggga tctcacatca ctggaggaga cttgtatggt 540

atcgtgcatg agaacaccct agtgaagcac aagatgattg taccgcctaa ggccaagggt 600

accgtcacat acatcgcgcc ttctggcaac tacagatgca ctgacgtggt gctggagacg 660

gagttcgacg gcgagaagtc gtcgtacacc atgttgcaag tgtggcctgt gcgtcagccc 720

cggcccgtgg cggagaagat gccggccaac caccccctgc tcactggaca gcgtgtgctc 780

gactctctct tcccttgtgt ccagggtggt accacagcca tccccggagc cttcggttgc 840

ggcaagactg tcatctcaca ggctctgtcc aagtactcca actctgatgt catcatctac 900

gtcggatgcg gcgagcgtgg taacgaaatg tctgaagtat tgcgggactt ccccgagctg 960

acggtggaga tcgaaggagt gacagagtcc atcatgaagc gtaccgcgct ggtcgccaac 1020

acctccaaca tgcctgtggc cgcccgagag gcttccatct ataccggtat caccctttcc 1080

gagtacttcc gtgacatggg ttaccacgtg tccatgatgg ccgactccac gtcccgttgg 1140

gccgaagccc tgcgtgagat ctcgggtcgt ctggcggaga tgccggccga ctcgggctac 1200

cccgcctacc tcggggccag gctcgcctcc ttctacgagc gagctggacg cgtcaagtgt 1260

ctgggcaacc ccgacaggga aggctccgtg tccatcgtgg gcgccgtgtc cccgccgggc 1320

ggcgacttct ccgaccccgt gacggccgcc acgctgggca tcgtgcaggt gttctggggc 1380

ctggacaaga agctggcgca gcggaagcac ttcccctcca tcaactggct catctcctac 1440

agcaagtaca tgcgcgccct ggacgacttc tacgacaaga actaccccga gttcgtccct 1500

ctcaggacca aggtcaagga gatcctccaa gaagaagaag acttatcaga aatcgtacag 1560

ttggtcggta aggcgtccct ggccgagacc gacaagatca cactcgaggt cgccaagcta 1620

ctcaaggacg acttcttgca acagaacagc tactcggcgt acgacaggtt ctgtccgttc 1680

tacaagacgt gcggcatgct gaagaacatc atcgcgttct acgacatgtc gcgccacgcc 1740

gtggagtcca cggcgcagtc cgacaacaag gtcacgtgga acgtcatccg cgacgccatg 1800

ggcaacgtgc tctacacgct ctcctccatg aagttcaagg accccgtaaa agagggagaa 1860

gctaagatca aggcagattt cgaccaactg ctagaggaca tgtccgccgc cttccgcaac 1920

ctcgaggact aa 1932

<210> 2

<211> 393

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tggtgctgga gacggagttc gacggcgaga agtcgtcgta caccatgttg caagtgtggc 60

ctgtgcgtca gccccggccc gtggcggaga agatgccggc caaccacccc ctgctcactg 120

gacagcgtgt gctcgactct ctcttccctt gtgtccaggg tggtaccaca gccatccccg 180

gagccttcgg ttgcggcaag actgtcatct cacaggctct gtccaagtac tccaactctg 240

atgtcatcat ctacgtcgga tgcggcgagc gtggtaacga aatgtctgaa gtattgcggg 300

acttccccga gctgacggtg gagatcgaag gagtgacaga gtccatcatg aagcgtaccg 360

cgctggtcgc caacacctcc aacatgcctg tgg 393

<210> 3

<211> 678

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tgagcaaggg cgaggagctg ttcaccgggg tggtgcccat cctggtcgag ctggacggcg 60

acgtaaacgg ccacaagttc agcgtgtccg gcgagggcga gggcgatgcc acctacggca 120

agctgaccct gaagttcatc tgcaccaccg gcaagctgcc cgtgccctgg cccaccctcg 180

tgaccaccct gacctacggc gtgcagtgct tcagccgcta ccccgaccac atgaagcagc 240

acgacttctt caagtccgcc atgcccgaag gctacgtcca ggagcgcacc atcttcttca 300

aggacgacgg caactacaag acccgcgccg aggtgaagtt cgagggcgac accctggtga 360

accgcatcga gctgaagggc atcgacttca aggaggacgg caacatcctg gggcacaagc 420

tggagtacaa ctacaacagc cacaacgtct atatcatggc cgacaagcag aagaacggca 480

tcaaggtgaa cttcaagatc cgccacaaca tcgaggacgg cagcgtgcag ctcgccgacc 540

actaccagca gaacaccccc atcggcgacg gccccgtgct gctgcccgac aaccactacc 600

tgagcaccca gtccgccctg agcaaagacc ccaacgagaa gcgcgatcac atggtcctgc 660

tggagttcgt gaccgccg 678

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgaaagttg cagaatgtg 19

<210> 5

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ttagtcctcg aggttgc 17

<210> 6

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

taatacgact cactataggt ggtgctggag acggagtt 38

<210> 7

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

taatacgact cactataggc cacaggcatg ttggaggt 38

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gcacaagatg attgtaccgc c 21

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

acttctcgcc gtcgaactcc 20

<210> 10

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gaagatcttc tggtgctgga gacggagtt 29

<210> 11

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

aactgcagaa ccaatgcatt ggccacaggc atgttggagg t 41

Claims (9)

1. The hyphantria cunea vATPase A gene dsRNA is characterized in that the nucleotide sequence of the dsRNA segment is shown as SEQ ID NO. 2.

2. A bacterial expression fluid expressing the dsRNA of claim 1, prepared by a method comprising:

(1) using fall webworm cDNA as a template, and performing PCR amplification by using a dsHcvATPase A primer to obtain the dsRNA fragment, wherein the sequence of the dsHcvATPase A primer is shown as SEQ ID NO.10 and 11;

(2) connecting the dsRNA segment to a linear plasmid L4440 to construct a recombinant vector;

(3) introducing the recombinant expression vector containing the dsRNA segment into escherichia coli HT115 for culture;

(4) dsRNA production is induced by IPTG, and bacterial liquid is cultured and collected.

3. The bacterial expression fluid of claim 2, wherein the plasmid is linearized L4440 and/or the bacterium is e.

4. Use of the dsRNA of claim 1 or the bacterial expression fluid of claim 2 for controlling fall webworm.

5. The use as claimed in claim 4, wherein control of fall webworm is achieved by feeding or spraying a bacterial expression solution expressing vATPase A gene dsRNA.

6. The use of claim 5, wherein the control of fall webworm is achieved by feeding artificial feed mixed with bacterial expression solution expressing vATPase A gene dsRNA.

7. The use as claimed in claim 6, wherein the prepared artificial feed is cut into 0.5 X0.5X0.5cm-sized blocks per 30g, and the dsRNA expressing vATPase A gene is sprayed at a concentration of 10⁷5mL of CFU/mL HT115 bacterial liquid is dried for 1h at normal temperature and fed.

8. The application of claim 5, wherein the control of the fall webworm is realized by directly spraying a bacterial expression solution for expressing vATPase A gene dsRNA on a plant.

9. The use of claim 8, wherein the bacterial expression fluid is Escherichia coli HT115 bacterial fluid.

Images