CN115927301B - RNAi-based spodoptera frugiperda control method - Google Patents

Abstract

The invention relates to the technical field of gene technology, in particular to a spodoptera frugiperda control method based on RNAi. The invention takes spodoptera frugiperda V-ATPase as a target, prepares the nucleic acid pesticide capable of preventing and controlling spodoptera frugiperda by artificially constructing the siRNA expression vector, and obviously improves the death rate of spodoptera frugiperda by the method for preventing and controlling pests.

Description

RNAi-based control method for Spodoptera Frugiperda

Technical field

The present invention relates to the technical field of gene technology, and specifically to an RNAi-based control method for Spodoptera frugiperda.

Background technique

Spodoptera frugiperda is an omnivorous agricultural pest that feeds on more than 350 species of plants. It has a wide distribution range and strong adaptability, causing serious harm to agricultural production. Chemical pesticides play an important role in the prevention and control of agricultural pests. However, due to the blind use and abuse of pesticides and other irrational practices, harmful organisms develop drug resistance, which also affects food security, the ecological environment and biological processes. Diversity, etc. have had a negative impact. At present, in order to deal with the above problems, in addition to vigorously promoting the relevant measures of integrated pest management (IPM), it mainly relies on the continuous development of safe, efficient and green pesticides with new mechanisms of action. With in-depth research on the phenomenon and mechanism of RNAi, RNAi technology has gradually entered the fields of agricultural pest control and new pesticide development. Compared with traditional chemical pesticides, RNAi has clearer targets and mechanisms of action. The target biomass is safe and there are no residue problems. It meets the requirements of today's society for the quality and safety of agricultural products and ecological safety. It is a new green pest control strategy with great potential. Nucleic acid pesticides rely on the principle of complementary pairing of base sequences to interact with targets, ultimately blocking the source of target protein production at the mRNA level, and then exhibiting regulatory effects similar to small molecule inhibitors, becoming a new type of post-transcriptional gene Silence control tool. At the same time, because most pests and plants have complete RNAi systems, the gene silencing signals mediated by RNAi in these biological groups will cascade amplify, eventually leading to the non-expression of the target gene and affecting the growth and development of organisms. Nucleic acid pesticides target genes essential for insect growth and development and achieve lethal insecticidal effects by silencing key genes. They are characterized by low dosage, high efficiency and sustainability. In recent years, RNAi has been successfully used in Hemiptera, Lepidoptera, Coleoptera, Diptera, Orthoptera and other species under laboratory conditions. among pests. The U6 promoter is a type of promoter that can mediate siRNA expression and is recognized and transcribed by RNA polymerase III. This type of promoter can drive shRNA to synthesize a large amount of siRNA in the expression vector under appropriate conditions, thereby silencing the target gene. Insect baculoviruses are specific and only infect arthropods. It can invade the body of insects and be replicated and transcribed in the nucleus of the insect. Because its genes can be connected to foreign genes and can be well fused, it becomes an ideal vector. The siRNA expression system of U6 promoter plus shRNA is constructed into the genome of insect baculovirus, which can continuously produce siRNA during the virus proliferation process, thereby achieving continuous interference with the target gene. The new biopesticide developed by combining baculovirus and RNAi not only avoids the disadvantages of traditional nucleic acid pesticides such as high cost, easy degradation, and non-sustainability, but also can speed up the death of the virus after infecting the host, and because Baculovirus can be transmitted between pest populations and can be passed on to the next generation of larvae, making it effective for a long time after one application. It meets the requirements of today's society for the quality and safety of agricultural products and ecological safety, so it is a potential new green Plant protection products.

The existing modes of action of RNAi mainly control pests through the in vitro application of nucleic acid molecules such as injection, feeding, spraying and soaking. However, conventional dsRNA has problems such as easy degradation, high cost, and non-sustainability, and is not suitable for large-scale promotion and application. Baculovirus has shortcomings such as slow insecticide speed and inability to obtain obvious effects in time. These shortcomings make it difficult for most baculovirus insecticides to be promoted on a large scale.

Contents of the invention

The present invention relates to a siRNA, which includes a first strand and a second strand, the first strand and the second strand are complementary and jointly form an RNA dimer, and the sequence of the first strand is SEQ ID NO: 1 or 2 shown.

The present invention also relates to an shRNA, which includes a sense strand fragment and an antisense strand fragment, and a stem-loop structure connecting the sense strand fragment and the antisense strand fragment, and the sequences of the sense strand fragment and the antisense strand fragment are complementary, And the sequence of the sense strand is shown in SEQ ID NO: 1 or 2.

The invention also provides DNA fragments, gene expression cassettes, vectors and host cells of the above-mentioned shRNA.

The invention also provides a method for preparing insect viruses.

Yet another aspect of the invention also provides a host cell containing the DNA fragment as described above, or transformed by the vector as described above.

The present invention also provides a composition for controlling Spodoptera frugiperda, which contains the above-mentioned siRNA, the above-mentioned shRNA, or the above-mentioned vector, and a method for using the composition to control Spodoptera frugiperda.

The target of the siRNA and shRNA provided by the present invention is V-ATPase, which plays an important role in the growth and development of Spodoptera frugiperda. The main physiological function of V-ATPase is to use ATP as energy to mediate H ⁺ transmembrane transport and maintain cells. The normal pH gradient inside and outside forms a transmembrane potential difference, which further mediates the active transport of other substances, and then participates in other important physiological activities of the organism. Inhibition of its function will cause the growth and development of Spodoptera Frugiperda to be inhibited and then die.

Description of drawings

In order to more clearly explain the specific embodiments of the present invention or the technical solutions in the prior art, the accompanying drawings that need to be used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings in the following description The drawings illustrate some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without exerting any creative effort.

Figure 1 shows the comparison results of transcription activities of candidate promoters; the picture shows the fluorescence of sf9 cells 72h after transfection.

Figure 2 shows the synthetic electropherogram of the U61-shA/B gene. Lane M is 2K Plus DNA Marker; lane 1 is U61-shA, and lane 2 is U61-shB.

Figure 3 shows the comparison of mortality rates of 3-instar Spodoptera Frugiperda after feeding on recombinant insect baculovirus nucleic acid pesticides. Lowercase letters indicate significant differences between the treatment and the control (p<0.05).

Figure 4 shows the comparison of mortality and adult emergence rate after feeding on recombinant insect baculovirus nucleic acid pesticides. Lowercase letters indicate significant differences between the treatment and the control (p<0.05).

Figure 5 shows the expression level of the target gene after injection of recombinant insect baculovirus nucleic acid pesticide. Lowercase letters indicate significant differences between the treatment and the control (p<0.05).

Figure 6 is a diagram of poisoning symptoms after ingesting recombinant insect baculovirus nucleic acid pesticides.

Figure 7 shows the inhibition of growth and development of Spodoptera frugiperda larvae by injection of recombinant insect baculovirus.

Detailed ways

Reference will now be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. For example, features illustrated or described as part of one embodiment can be used in another embodiment, to yield still further embodiments.

Unless otherwise defined, all terms (including technical and scientific terms) used to disclose the invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. By way of further guidance, the following definitions are provided to better understand the teachings of the present invention. The terminology used herein in the description of the invention is for the purpose of describing specific embodiments only and is not intended to limit the invention.

The terms "and/or", "or/and" and "and/or" used in this article include any one of two or more related listed items, and also include any of the related listed items. and all combinations, including any two of the related listed items, any more of the related listed items, or a combination of all of the related listed items. It should be noted that when at least three items are connected in combination with at least two conjunctions selected from "and/or", "or/and", "and/or", it should be understood that in this application, the technical solution It undoubtedly includes technical solutions that are all connected by "logical AND", and it also undoubtedly includes technical solutions that are all connected by "logical OR". For example, "A and/or B" includes three parallel solutions: A, B and A+B. For another example, the technical solution of "A, and/or, B, and/or, C, and/or, D" includes any one of A, B, C, and D (that is, they are all connected with "logical OR" technical solution), also includes any and all combinations of A, B, C, and D, that is, including combinations of any two or any three of A, B, C, and D, and also includes A, B, C , four combinations of D (that is, technical solutions that are all connected by "logical AND").

The terms "comprising", "comprising" and "including" as used in this invention are synonymous and are inclusive or open-ended and do not exclude additional, unrecited members, elements or method steps.

Numerical ranges expressed by endpoints herein include all numbers and fractions included within the range, as well as the recited endpoints.

The present invention refers to concentration values, and their meaning includes fluctuations within a certain range. For example, it can fluctuate within the corresponding accuracy range. For example, 2% can allow fluctuation within the range of ±0.1%. For values that are large or do not require too fine control, the meaning is also allowed to include larger fluctuations. For example, 100mM can allow fluctuations within the range of ±1%, ±2%, ±5%, etc.

In the present invention, descriptions such as "plurality" and "multiple" refer to a quantity greater than or equal to 2 unless otherwise specified.

In the present invention, the technical features described in open terms include closed technical solutions composed of the listed features, and also include open technical solutions including the listed features.

In the present invention, "preferable", "better", "better" and "suitable" are only used to describe implementations or examples with better effects. It should be understood that they do not limit the scope of protection of the present invention. In the present invention, "optionally", "optional" and "optional" mean that it is optional, that is, it refers to any one selected from the two parallel solutions of "with" or "without". If there are multiple "optionals" in a technical solution, each "optional" will be independent unless otherwise specified and there is no contradiction or mutual restriction.

The present invention relates to a siRNA, which includes a first strand and a second strand, the first strand and the second strand are complementary and jointly form an RNA dimer, and the sequence of the first strand is SEQ ID NO: 1 or 2 shown.

The present invention also relates to an shRNA, which includes a sense strand fragment and an antisense strand fragment, and a stem-loop structure connecting the sense strand fragment and the antisense strand fragment, and the sequences of the sense strand fragment and the antisense strand fragment are complementary, And the sequence of the sense strand is shown in SEQ ID NO: 1 or 2.

In the present invention, the siRNA, that is, small interfering RNA, is a double-stranded small RNA molecule, which is composed of a completely complementary first strand and a second strand. RNA is processed by specific enzymes). The first strand and the second strand are complementary and jointly form an RNA dimer, and the sequence of the first strand is the same as the target sequence in the Spodoptera frugiperda V-ATPaseA/B gene, or is identical to the target sequence. Sequences that hybridize under high stringency conditions. siRNA is the main component of siRISC and triggers the silencing of its complementary target mRNA.

In the present invention, the shRNA, that is, small hairpin RNA or short hairpin RNA (shRNA), is an RNA sequence with a tight hairpin turn, which includes a sense strand fragment and an antisense strand fragment. As well as the stem-loop structure connecting the sense strand fragment and the antisense strand fragment, it is often used for RNA interference to silence the expression of target genes. The sequences of the sense strand and the antisense strand are complementary, and the sequence of the sense strand fragment is the same as the target sequence in the Spodoptera frugiperda V-ATPaseA/B gene. The hairpin structure of shRNA can be cleaved into siRNA by cellular machinery, and then the siRNA binds to the RNA-induced silencing complex (RISC), which can bind to target mRNAs and degrade them.

RNA interference (RNAi) refers to the specific degradation of intracellular mRNA mediated by endogenous or exogenous double-stranded RNA (dsRNA), resulting in the expression silencing of target genes and the corresponding loss of functional phenotypes. .

In the present invention, "complementary" means capable of hybridizing under stringent conditions. "Hybridization conditions" are classified according to the degree of "stringency" of the conditions used in measuring hybridization. The degree of stringency may be based, for example, on the melting temperature (Tm) of the nucleic acid binding complex or probe. For example, “maximum stringency” typically occurs at about Tm-5°C (5°C below the probe Tm); “high stringency” occurs at about 5°C to 10°C below the Tm; and “medium stringency” occurs at about 5°C to 10°C below the probe Tm. The needle Tm is about 10°C to 20°C; "low stringency" occurs at about 20°C to 5°C below the Tm. Alternatively, or in addition, hybridization conditions may be based on salt or ionic strength conditions of hybridization and/or one or more stringency washes. For example, 6×SSC = very low stringency; 3×SSC = low to medium stringency; 1×SSC = medium stringency; 0.5×SSC = high stringency. Functionally speaking, maximum stringency conditions can be used to determine nucleic acid sequences that are strictly identical or nearly identical to the hybridization probe; high stringency conditions can be used to determine nucleic acid sequences that have about 80% or more sequence identity with the probe. .

For applications requiring high selectivity, it is typically desirable to employ relatively stringent conditions for hybrid formation, for example, selecting relatively low salt and/or high temperature conditions. Hybridization conditions including medium stringency and high stringency are provided by Sambrook et al. (Sambrook, J. et al. (1989) Molecular Cloning, Laboratory Manual, Cold Spring Harbor Press, Plainview, N.Y.).

For convenience of explanation, suitable moderately stringent conditions for detecting the hybridization of the polynucleotide of the present invention with other polynucleotides include: pre-washing with 5×SSC, 0.5% SDS, 1.0mM EDTA (pH8.0) solution; Hybridize overnight at 50-65°C in 5x SSC; then wash twice with 2x, 0.5x and 0.2x SSC containing 0.1% SDS for 20 min each at 65°C. Those skilled in the art will appreciate that hybridization stringency can be readily manipulated, such as by changing the salt content of the hybridization solution and/or the hybridization temperature. For example, in another embodiment, suitable highly stringent hybridization conditions include the conditions described above, except that the hybridization temperature is increased to, for example, 60°C to 65°C or 65°C to 70°C.

Furthermore, the sequence of the stem-loop structure of the shRNA can be conventionally selected in the art, for example, selected from any one of the following sequences: UUCAAGAGA, AUG, CCC, UUCG, CCACC, CUCGAG, AAGCUU and CCACACC.

The invention also relates to DNA fragments encoding shRNA as described above.

The present invention also includes gene expression cassettes of DNA fragments as described above.

The gene expression cassette may contain regulatory elements commonly used in genetic engineering, such as enhancers, promoters, internal ribosome entry sites (IRES), and other expression control elements (such as transcription termination signals, or polyadenylation signals and polymerization signals). U sequence, etc.).

In some embodiments, the nucleotide sequence of the promoter used to drive expression of the DNA fragment in the gene expression cassette is shown in SEQ ID NO: 5.

This promoter is the excellent U6 promoter of Spodoptera frugiperda screened by the inventor, which can effectively improve the expression efficiency of the target gene.

In addition, it should be noted that, in one aspect, useful sequences involved in the present invention include nucleic acid fragments shown in SEQ ID NO: 1 to 5 that have greater than 80%, 85%, 90%, 91%, 92%, Nucleotide sequences that are 93%, 94%, 95%, 96%, 97%, 98% or 99% identical. The term "% identity", in the context of two or more nucleotide sequences or amino acid sequences, refers to two or more sequences or sub-sequences that are identical or have a specific percentage of identical amino acid residues or nucleotides. Sequences, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection. For example, % identity is relative to the entire length of the coding region of the sequences being compared.

For sequence comparisons, typically one sequence is used as a reference sequence and test sequences are compared to this sequence. When using a sequence comparison algorithm, test and reference sequences are input into the computer, subsequence coordinates are specified if necessary, and sequence algorithm program parameters are specified. The sequence comparison algorithm then calculates the percent sequence identity of the test sequence relative to the reference sequence based on the specified program parameters. Percent identity can be determined using search algorithms such as BLAST and PSI-BLAST (Altschul et al., 1990, J Mol Biol 215:3, 403-410; Altschul et al., 1997, Nucleic Acids Res 25:17, 3389-402).

Useful sequences also include modified nucleic acids. Common modifications include 4-acetylcytidine, 5-(carboxyhydroxymethyl)uridine, dihydrouridine, 2'-O-methylpseudouridine, β,D- Galactose Q nucleoside, 2'-O-methylguanosine, inosine, N ⁶ -prenyladenosine, 1-methyladenosine, 1-methylpseudouridine, 1-methylinosine , 2'2-dimethyladenosine, 2-methyladenosine, 2-methylguanosine, 5-methyluridine, 3-methylcytidine, 5-methylcytidine, N ⁶ -methyl Gadenosine, 7-methylguanosine, 5-methylaminomethyluridine, 5-carboxymethylaminomethyluridine, 5-carboxymethylaminomethyl-2-thiouridine, β, D-mannose Q nucleoside, 5-methoxycarbonylmethyl-2-thiouridine, 5-methoxycarbonylmethyluridine, 5-methoxyuridine, 2-thiomethyl- N ⁶ -Prenyladenosine, N-((9-β-D-ribofuranosyl-2-thiomethylpurine-6-Yl)carbamoyl)threonine, N-((9- β-D-ribofuranosyl purine-6-yl)N-methylcarbamoyl)threonine, uridine-5-oxyacetate-methyl ester, wybutoxosine, pseudouridine, Q nucleoside, 2-thiocytidine, 5-methyl-2-thiouridine, 2-thiouridine, 4-thiouridine, 5-thiouridine, N-((9-β -D-ribofuranosyl-6-yl)-carbamoyl)threonine, 2'-O-methyladenosine-5-methyluridine, 2'-O-methyladenosine, 2'-O - One of methylcytidine, wybutosine, 3-(3-amino-3-carboxy-propyl)uridine, N ⁶ -acetyl adenosine and 2-methylthio-N ⁶ -methyladenosine , two or more kinds.

The present invention also relates to vectors containing gene expression cassettes as described above.

When a gene expression cassette (or nucleic acid construct) can enable the transcription or translation of the inserted polynucleotide encoding, or is simply used for preservation, or to increase its ability to infect host cells, it is also called a vector. The vector can be introduced into the host cell through transformation, transduction or transfection, so that the genetic material elements it carries can be expressed in the host cell. Vectors are well known to those skilled in the art, including but not limited to: plasmids; phagemids; cosmids; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC) or P1-derived artificial chromosomes (PAC) ; Phages such as lambda phage or M13 phage and animal viruses, etc. In the present invention, the preferred vector is a virus, more preferably an insect virus, especially various viruses that can infect Spodoptera frugiperda, preferably an insect baculovirus.

The invention also relates to host cells containing a DNA fragment as described above, or transformed with a vector as described above.

The host cell is preferably an insect cell line, such as sf9, Mimic sf9, sf21, HighFive, etc.; in some specific embodiments, the host cell is an sf9 cell.

The present invention also relates to a method for preparing insect viruses as described above, which includes culturing the host cells (especially insect host cells) as described above under appropriate conditions, and collecting the insects thus obtained from the culture supernatant or cell lysate. Virus.

The present invention also relates to a composition for controlling Spodoptera Frugiperda, the active ingredient of which includes the above-mentioned siRNA, the above-mentioned shRNA or the above-mentioned vector.

The nucleic acid components (such as siRNA, shRNA, plasmids, etc.) in the composition can be combined (conjugated) to a synthetic carrier to increase its biological stability and/or bioavailability, thereby causing RNA interference. Synthetic carriers can be inert compounds with natural or engineered affinity. In certain aspects, synthetic carriers comprise a combination of inert chemicals or nanoparticles that when bound and/or alone have a net positive charge or general affinity to bind negatively charged dsRNA. Representative examples include chitosan, liposomes, carbon quantum dots, biodegradable particles derived from plants (such as coconut bran or cereal flour, etc.) or soil (such as calcified clay), and the like. Preferably, the active ingredient is insect virus.

The invention also relates to a method for preventing and controlling Spodoptera Frugiperda, which includes:

Applying a composition as described above such that it is eaten by Spodoptera frugiperda;

The methods of administration include:

Apply the medicine locally or to the whole plant, or coat the plant seeds, or spread it through fertilizer, or spread it through irrigation, or a combination of the above application methods.

Spodoptera frugiperda is an omnivorous pest that can harm a variety of plants, so it is easy to understand. The plants include all hosts of Spodoptera frugiperda, preferably cash crops, such as peanuts, sugar beets, soybeans, papayas, strawberries, sweet potatoes, Amaranth and more than 80 kinds of plants. In some embodiments, the plant is selected from the group consisting of grasses, more preferably rice, sugarcane, wheat, barley, sorghum, ryegrass, sudangrass and corn.

The embodiments of the present invention will be described in detail below with reference to examples. It should be understood that these examples are only used to illustrate the invention and are not intended to limit the scope of the invention. For experimental methods that do not indicate specific conditions in the following examples, priority is given to the guidelines given in the present invention. You can also follow the experimental manuals or conventional conditions in the field. You can also refer to other experimental methods known in the field, or according to the manufacturing methods. Conditions recommended by the manufacturer.

In the following specific examples, the measurement parameters of raw material components are involved. Unless otherwise specified, there may be slight deviations within the range of weighing accuracy. Temperature and time parameters are involved, allowing for acceptable deviations due to instrument testing accuracy or operating accuracy.

Example 1

In this example, siRNA of the V-ATPase gene fragment is connected to the U6 promoter of Spodoptera frugiperda to continuously produce nucleic acid pesticides that can interfere with V-ATPase, which can greatly inhibit the growth and development of Spodoptera frugiperda larvae.

Its specific construction method is as follows:

Cloning of U6 promoter gene:

Extraction of genomic DNA: Use Omega Bio-Tek's E.Z.N.A.Insect DNA Kit to extract Spodoptera frugiperda genomic DNA. The DNA was diluted 10 times and used as a template for target gene amplification.

Design primers: The complete sequence of U6 snRNA gene of Bombyx mori (AY6493 81.1) and the complete sequence of U6 snRNA gene of Drosophila melanogaster (AH004871.1) were used through the online software ClustalOmega (http://www.ebi.ac.uk/Tools/msa/clustalo/ ), analyze their homologous regions, and search Spodoptera frugiperda candidate U6 promoters in the Spodoptera frugiperda genome database, and select the 5'-end 27bp U6 snRNA and the 500-2000bp upstream of the transcription start site. As a candidate sequence for the full-length U6 promoter of Spodoptera frugiperda, when designing primers, the shRNA sequence of the EFFP gene was added to the downstream of the U6 promoter and named u61-shEGFP, u62-shEGFP, u63-shEGFP and u64-shEGFP respectively. The primers designed according to NCBI primerblast are shown in Table 1:

Table 1

PCR amplification:

The PCR amplification system is shown in Table 2:

Table 2

The PCR amplification procedure is:

①94℃ 3min

②94℃ 30s

③55℃ 30s 35cycles

Repeat steps ② and ③ for 35 cycles

④72℃ 2min

⑤72℃ 10min

The amplified product was subjected to 2.0% agarose electrophoresis, and the PCR product was recovered using the DNA purification gel extraction kit (Gel Extraction Kit) of Omega Bio-Tek Company, specifically:

1. Cut the strip containing the DNA band and put it into a centrifuge tube and weigh it. (You need to weigh the empty centrifuge tube first, weigh it again after placing the cut gel, and subtract the two weights to get the weight of the gel).

2. Add the same volume of Binding buffer as the gel (the gel weighs 0.1g, then its volume is regarded as 100 μL), melt in a water bath at 55-65°C for 7 minutes, and mix once every 2-3 minutes.

3. Take 700 μL of the mixed solution obtained in step 2, add it to the HiBind ^TM DNA column (put the adsorption column into a 2 mL collection tube), centrifuge at 12,000 rpm for 1 min at room temperature, pour out the waste liquid in the collection tube, and repeat until all is added. 2 samples.

4. Add 300 μL Binding buffer to the adsorption column, centrifuge at 12,000 rpm for 1 min at room temperature, and discard the waste liquid in the collection tube.

5. Add 700 μL spw wash buffer to the adsorption column, centrifuge at 12 000 rpm for 1 min at room temperature, and discard the filtrate.

6. Repeat step 5.

7. Put the adsorption column back into the collection tube, and centrifuge idling at 12,000 rpm for 1 minute.

8. Transfer the adsorption column into a clean and sterilized centrifuge tube, add 15-30 μL of preheated ddH ₂ O to the middle of the adsorption membrane, and centrifuge at 12,000 rpm for 1 min.

9. Absorb all the solution centrifuged in the previous step into a 1.5 mL centrifuge tube, add it to the adsorption column, and centrifuge for 1 minute. That is, the purified DNA product is obtained. After measuring the concentration, store at -20°C.

Connection carrier:

The PCR product was ligated into the pFastBAC1 vector (purchased from Miaoling Plasmid Platform).

The connection system is as follows:

The connection system was connected at 16°C for 12 hours to obtain the connection product.

Conversion:

1. Thaw DH5α competent cells on ice.

2. Gently mix 10 μL of recombinant product and add to 100 μL of thawed competent cells, incubate on ice for 30 minutes, heat shock at 42°C for 60 seconds, and immediately cool on ice for 2-3 minutes.

3. Add 1 mL of LB liquid culture medium without antibiotics and shake the culture medium at 37°C for 1 hour.

4. Centrifuge at 5000 rpm for 5 minutes, discard 800 μL of supernatant culture medium, shake gently, and spread on a plate (the plate needs to be added with a final concentration of 100 μg/mL ampicillin sodium (Amp) in advance, and incubate upside down at 37°C for 12 hours.

Extract plasmids: Randomly pick 5 white positive clones on LB solid medium into 3.0 mL of LB liquid medium containing 50 mg/mL kanamycin, shake at 200 rpm and 37°C for 10 hours, and amplify the positive clones for verification. Use the (OMEGA) Plasmid mini Kit to extract the plasmid from the bacterial solution with correct sequencing results.

The specific steps are:

1. Take a 1.5mL centrifuge tube, add 1 400 μL of bacterial solution, and centrifuge at 12 000 rpm for 2 minutes at room temperature. Discard the supernatant and repeat until the sample is complete.

2. Add 250 μL of SolutionⅠ mixture and vortex until no white bacteria precipitate.

3. Add 250 μL Solution II to the suspended mixed liquid obtained in step 2, and mix the mixed liquid by gently inverting it 5 times (there is sticky thread on the bottle mouth at this time). This operation should be gentle, avoid violent shaking, and the lysis time should not exceed 5 minutes.

4. Add 350 μL Solution III, and immediately rotate and invert 10-20 times until white floc precipitates. Avoid violent vibrations during this process.

5. Centrifuge at 12 000 rpm for 12 minutes at room temperature.

6. Transfer the supernatant to the filter column (put on a 2mL collection tube), centrifuge at room temperature 12,000rpm for 15min, and discard the filtrate.

7. Add 500 μL of HB Buffer to the filter column, centrifuge at 12,000 rpm for 1.5 min, and discard the filtrate.

8. Add 700 μL DNA Wash Buffer to the filter column, set the rotation speed to 12 000 rpm, centrifuge for 1 min, and discard the filtrate.

9. Repeat step 8.

10. Idle the centrifuge tube and centrifuge at 12,000 rpm for 2.5 minutes.

11. Place the idling filter column on a new centrifuge tube, add sterile water preheated at 65°C, let stand for 1 minute, and then centrifuge at 12,000 rpm for 1.5 minutes. The product obtained by extracting the plasmid was detected by 1% agarose gel electrophoresis to verify the size of the plasmid band and stored at -20°C.

Sequencing: Plasmid pFastBAC1-U6N-shEGFP was sequenced (completed by Beijing Qingke Xinye Biotechnology Co., Ltd.). The pFastBAC1-U6N-shEGFP plasmid template sequence containing the U6N-shEGFP gene is as follows:

Spodoptera frugiperda U61 promoter sequence: SEQ ID NO: 5;

Spodoptera frugiperda U62 promoter sequence: SEQ ID NO: 6;

Spodoptera frugiperda U63 promoter sequence: SEQ ID NO: 7;

Spodoptera frugiperda U64 promoter sequence: SEQ ID NO: 8;

shEGFP sequence: SEQ ID NO:9.

Transform DH10Bac competent cells:

Transfer the obtained product pFastBAC1-U6N-shEGFP into DH10Bac competent cells. The specific steps are as follows:

1. Thaw the entire tube of DH10Bac competent cells on ice.

2. Add 5 μL (1ng/μL) of pFastBAC1-U6N-shEGFP plasmid DNA to the competent cells and mix gently.

3. Incubate the cells on ice for 30 minutes, and heat-shock the cells at 42°C for 45 seconds. Do not shake. Immediately transfer the test tube to ice and keep in a cold bath for 2 minutes.

4. Add 900 μL of liquid LB medium without antibiotics.

5. Incubate for 4 hours on a shaker at 37°C and 225 rpm.

6. Use LB liquid medium (without antibiotics) to prepare, inoculate 100 μL of cells in a medium containing kanamycin (50 μg/mL), gentamicin (7 μg/mL), tetracycline (10 μg/mL), BLuo- gal (100 μg/mL) and IPTG (40 μg/mL) on LB agar plates.

7. Incubate the plate at 37°C for 48 hours and in the refrigerator for 1 hour to develop color.

8. Shake the bacteria: Cultivate the plate at 37°C for 48 hours to select pure single colonies of white spots, add LB liquid culture medium containing 50 μg/mL kanamycin, 70 μg/mL gentamicin, and 10 μg/mL tetracycline, 37°C, 200 rpm Incubate overnight on a shaker.

9. Use universal primers M13F and M13R for PCR identification to identify positive Bacmid DNA.

Use PCR to verify whether the recombinant bacmid contains the target gene (use universal primer M13 for nuclear detection), and then transfect insect sf9 cells after successful detection.

Cell transfection to verify candidate U6 transcriptional activity:

To compare the transcriptional activities of U61/U62/U63/U64 candidate promoters, the vectors Bacmid-EGFP-U61-shEGFP, Bacmid-EGFP-U62-shEGFP, Bacmid-EGFP-U63-shEGFP and Bacmid-EGFP-U64-shEGFP were used, respectively. sf9 cells were co-transfected with Bacmid-EGFP. After 72 hours, the cells in each well were placed under an inverted fluorescence microscope to observe the cell growth and fluorescence intensity of each group in the same field of view (Figure 1). The specific operations are as follows:

Transfect sf9 cells in a 6-well plate, and co-transfect sf9 cells with the constructed Bacmid-U6N-shEGFP and Bacmid-EGFP recombinant vectors (see Table 3 for specific methods). Here's how to do it:

1. Cultivate suspended cells: Pour out the original culture medium and suspended cells in the cell culture flask in the logarithmic growth phase, and add 12 mL of fresh Sf-900 ^TM III SFM culture medium. Use an elbow glass pipette to gently blow off the adherent cells.

2. Cell adhesion: Add 2 mL of cell suspension to a 6-well plate, place it in a 27°C incubator, and culture the cells for at least 1 hour until the number of cells reaches 2 × 10 ⁶ cells/well.

3. Prepare transfection mixture

① Add 1.5 μg of Bacmid plasmid to 150 μL of Sf-900 ^TM III SFM medium, and gently pipet to wet it evenly.

② Take 10 μL of light staining reagent cellfection ¹² and add it to 150 μL of Sf-900 ^TM III SFM medium, and mix gently by pipetting.

③Mix diluted ① and ② gently and let stand at room temperature for 30 minutes.

④ Light staining: After 30 minutes, add the light staining mixture into the 6-well plate, 100 μL per well, mix crosswise, and incubate at 27°C.

Table 3 Transfection components and dosage

Evaluation criteria: The higher the U6 promoter startup efficiency, the higher the interference efficiency of shEGFP on the fluorescent protein EGFP, the lower the expression of EGFP, and the weaker the fluorescence under the microscope; conversely, the worse the U6 promoter startup efficiency, shEGFP The lower the interference efficiency with the fluorescent protein EGFP, the higher the expression level of EGFP, and the stronger the fluorescence under the microscope.

The results showed that the fluorescence signal intensity of Bacmid-EGFP-U61-shEGFP+Bacmid-EGFP was significantly reduced and was the lowest among the four candidate promoters, indicating that the expression of the EGFP gene had decreased, further indicating that the U6 candidate promoter can drive shEGFP in sf9 Successful expression in cells proves that the Spodoptera frugiperda U61 candidate promoter has certain transcriptional activity for hairpin structured RNA. Therefore, the U61 candidate promoter on chromosome 6 of Spodoptera frugiperda was selected for subsequent construction experiments of recombinant vectors.

Enzyme digestion of the pFastBac1-EGFP transfer vector: Double-digest the plasmid with XhoI and HindIII. The digested vector is named pFastBac1-EGFP-. The digested plasmid is gel-cut and recovered, and the recovered product is placed at -20°C. spare.

Design of hairpin structure of V-ATPase A/B subunit: optimal interference fragment of Spodoptera frugiperda V-ATP A/B subunit using online software siDirect (http://design.RNA.jp/) ATPaseA-2 and ATPaseB-2 perform predictive analysis to obtain potential siRNA and design a hairpin structure based on the predicted siRNA.

The best interference fragment of Spodoptera frugiperda gene V-ATPaseA/B

dsV-ATPaseA-2 378bp

AAGACTGTCGTCTCACAGGCTCTGTCCAAGTACTCCAACTCTGACGTCATCATCTACGTCGGATGCGGTGAACGTGGTAACGAGATGTCTGAGGTACTGCGTGACTTCCCCGAGCTGACGGTGGAGATCGAGGGCATGACCGAGTCCATCATGAAGCGTTACCGCGCTCGTCGCCAACACCTCCAACATGCCTGTAGCCGCCCGAGAGGCTTCCATCTACACCGGTATCACCCTCTCCGAGTACTTCCGTGACATGGGTTA CAACGTGTCCATGATGGCTGACTCCACCTCTCGTTGGGCCGAGGCTCTTCGTGAGATCTCAGGTCGTCTGGCTGAGATGCCTGCCGACTCCGGTTACCCCGCCTACCTGGGAGCCCGT

dsV-ATPaseB-2 408bp

AACTCCATCGCTCGTGGTCAGAAGATCCCCATCTTCTCCGCTGCTGGTCTGCCCCACAACGAAATTGCCGCCCAGATCTGTAGACAGGCCGGTCTTGTCAAGATCCCCGGCAAATCAGTGTTGGATGACCACGAGGACAACTTCGCCATCGTGTTCGCCGCTATGGGTGTGAACATGGAAACCGCCCGGTTCTTCAAACAGGACTTCGAAGAGAACGGTTCCATGGAGAACGTGTGCCTGTTCTTGAACTTGGCCAACGACCCTACCATT GAGAGAATTATCACACCCCGTCTGGCTCTTACTGCCGCCGAGTTCTTGGCCTACCAGTGCGAGAAACACGTGTTGGTCATCTTGACTGACATGTCCTCATACGCCGAGGCTCTGCGTGAGGTATCCGCCGCCCGTGAG

The shRNA sequence is as follows:

Cloning of U6-shA/B.

Based on the Spodoptera frugiperda U61 promoter sequence and the hairpin structure sequence of V-ATPase A/B subunits, specific primers containing plasmid homology arms were designed to clone U6-shA/B as shown in the table below. The primers were provided by Beijing Qingke Biotechnology Technology Co., Ltd. Synthetic.

Table 4 U6-shA/B primer series

Note: The homology arm of the sense strand is CGAGCTGTACAAGTTCTAGCTCGAG, and the homology arm of the antisense strand is CTAGTACTTCTCGACAAGCTT.

Construction of recombinant baculovirus transfer vector Bacmid-U61-EGFP-shA/B:

The pFastBac1-EGFP- digested by XhoI and HindIII was connected to U61-shA/B to obtain the pFastBac1-EGFP-U61-shA/B recombinant vector. After transformation, bacterial liquid PCR verification and sequencing were performed. Transfer the correctly sequenced positive plasmid into DH10Bac competent cells, extract the recombinant plasmid Bacmid-U61-shA/B containing the target gene, and use the M13 universal primer to verify the target gene again.

Obtaining the recombinant insect baculovirus: Use the Bac To Bac System to conduct the transfection test of the recombinant insect baculovirus, and transfect the Bacmid-U61-shA/B recombinant plasmid into sf9 cells in a cell culture flask. 2- When the cells begin to rupture on 3 days, collect the culture medium into a 10 mL centrifuge tube, centrifuge at 22°C at 500g for 5 min, put the transferred supernatant into a 5 mL centrifuge tube, and store it at 4°C in the dark, which is the p1 generation. Prepare adherent cells in a 6-well plate, add 300 μL of P1 generation virus drop by drop, and place it in a 27°C incubator. When the cells begin to rupture for 2-3 days, collect the p2 generation virus (the method is the same as that of p1 generation). Add Pn-generation viruses dropwise to a 6-well plate containing adherent cells, culture for 2-3 days, and collect Pn+1-generation viruses.

Example 2 Application of nucleic acid pesticides in killing Spodoptera frugiperda

Its application method is:

(1) Feed the recombinant insect baculovirus and the empty vector baculovirus to third-instar Spodoptera frugiperda larvae at a dosage of 1 mL of baculovirus per 3 g of dry feed.

(2) The mortality rate of larvae in each treatment group was recorded every day until the larvae pupated. After the larvae pupated, the pupation rate and adult emergence rate under different treatment groups were also recorded.

(3) Inject 100 nL of recombinant baculovirus shA/shB, empty vector baculovirus and clean water into the third-instar test worms. Observe the morphological changes and survival of the larvae every day, take out the larvae regularly to detect gene expression, and keep records.

Figure 3 shows the comparison of mortality rates of Spodoptera Frugiperda after feeding on pesticides containing viral nucleic acids. Lowercase letters indicate significant differences between treatments and controls (p<0.05). It can be seen from the figure that the recombinant baculovirus has an inhibitory effect on the growth and development of Spodoptera frugiperda and can significantly reduce the survival rate of larvae. The survival rate of feeding empty vector baculovirus is 43.75%, while the survival rate of feeding recombinant baculovirus The larval survival rate of shA was 18.77%. The survival rate of larvae fed recombinant baculovirus shB was 41.05%, and the survival rate of blank treatment group was 72.2%.

Figure 4 shows the comparison of the pupation rate and adult emergence rate of Spodoptera frugiperda after feeding on pesticides containing viral nucleic acids. 18.75% and 35.40% of the larvae in the recombinant baculovirus shA and shB treatment groups were able to pupate respectively, while in the empty vector In the baculovirus treatment, 43.75% of the larvae pupated, and the pupation rate of the larvae in the clean water treatment group was 72.20%; compared with the 72.20% adult emergence rate in the control group, the adult emergence rate in the baculovirus treatment group was significantly reduced. . And in the empty vector baculovirus treatment, an emergence rate of 35.40% was observed, while the lowest adult emergence rates of 18.75% and 22.95% were observed in the recombinant baculovirus shA and shB treatments, respectively, which were significantly lower than the empty vector baculovirus. .

Figure 5 shows the expression level of the target gene after injection of baculovirus.

Figure 6 is a diagram of poisoning symptoms after ingesting recombinant insect baculovirus nucleic acid pesticides.

Table 5 shows the comparison of changes in body weight and length of Spodoptera frugiperda after injection of recombinant insect baculovirus. Lowercase letters indicate significant differences between the treatment and the control (p<0.05).

table 5

Figure 7 shows the inhibition of growth and development of Spodoptera frugiperda larvae by injection of recombinant insect baculovirus.

Injection of insect baculovirus can cause massive death of larvae. In the treatment groups injected with recombinant insect baculovirus shA and shB, large numbers of larvae began to die on the 3rd day, and all larvae died on the 4th day; in the empty vector group, no larvae died on the 4th day, and some larvae died on the 5th day. Death occurred until the 6th day. There was no death in the blank control group during the observation period.

Injection of baculovirus significantly reduced larval body weight and body length growth. On the first day of injection, there was no significant difference in body weight and body length between each treatment group and the blank control group; significant differences appeared on the third day (P<0.05), in which the average weight and body length increase of the blank control group was 0.1396g and 0.817cm; The weight of the empty vector group increased on average by 0.01465g, and the body length increased by 0.305cm on average; the weight of the recombinant vector shA decreased on average by 0.0063g, and the body length decreased by 0.305cm on average; the weight of the recombinant vector shB decreased on average by 0.00631g, and the body length decreased by 0.243cm on average.

The method of this embodiment is not limited to nucleic acid pesticides targeting V-ATPase A/B subunits. The method of this embodiment can also be used for lethal genes of other insects, and the same technical effect can be achieved.

According to this embodiment, by feeding and injecting the recombinant insect baculovirus of Spodoptera frugiperda, the virus enters the body of Spodoptera frugiperda and causes the silencing of the target gene, affecting the function of plant pests and eventually leading to their death, thereby achieving the prevention and control of plant pests. the goal of. The method of the present invention is a green and environmentally friendly nucleic acid pesticide, which is more environmentally friendly and safer than chemical agents, and has stronger targeting properties. On the other hand, the method is more conducive to controlling Spodoptera Frugiperda than spraying dsRNA.

The method of this embodiment is not limited to insect baculovirus expression vectors. Expression vectors that can infect other harmful organisms can also use the method of this embodiment, and can achieve the same technical effect.

The above-mentioned embodiments only express several implementation modes of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the invention. It should be noted that, for those of ordinary skill in the art, several modifications and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention should be determined by the appended claims, and the description and drawings can be used to interpret the content of the claims.

Claims (10)

1. A gene expression cassette comprising a DNA fragment encoding shRNA and a promoter for driving expression of the DNA fragment,

the shRNA comprises a sense strand segment and an antisense strand segment, and a stem-loop structure connecting the sense strand segment and the antisense strand segment, wherein the sequences of the sense strand segment and the antisense strand segment are complementary, and the sequence of the sense strand is SEQ ID NO:1 or 2;

the nucleotide sequence of the promoter used for driving the expression of the DNA fragment is shown as SEQ ID NO: shown at 5.

2. A vector comprising the gene expression cassette of claim 1.

3. The vector of claim 2, which is an insect virus.

4. A vector according to claim 3 which is an insect baculovirus.

5. A host cell comprising the gene expression cassette of claim 1 or transformed with the vector of any one of claims 2 to 4.

6. The host cell of claim 5, which is a sf9 cell.

7. A composition for controlling spodoptera frugiperda, the active ingredient of which comprises the expression cassette of claim 1 or the vector of any one of claims 2 to 4.

8. A process for producing an insect virus as claimed in claim 3 or 4, which comprises culturing the host cell as claimed in claim 5 or 6 under suitable conditions and collecting the insect virus thus obtained from the culture supernatant or cell lysate.

9. A method of controlling spodoptera frugiperda, comprising:

administering the composition of claim 7 such that it is fed by spodoptera frugiperda;

the method of administration comprises:

the application can be carried out locally or wholly on the plants, or coated on the plant seeds, or transmitted by fertilizer, or transmitted by irrigation, or a combination of the above application methods.

10. The method of claim 9, wherein the plant is selected from the group consisting of grasses.