CN115927301B

CN115927301B - RNAi-based spodoptera frugiperda control method

Info

Publication number: CN115927301B
Application number: CN202210793393.0A
Authority: CN
Inventors: 祁志军; 白杉杉; 姜永淦; 陈文旭; 张玄鹤; 陈枫华
Original assignee: Shaanxi Guyu Yunding Agricultural Development Co ltd; Northwest A&F University
Current assignee: Shaanxi Guyu Yunding Agricultural Development Co ltd; Northwest A&F University
Priority date: 2022-07-05
Filing date: 2022-07-05
Publication date: 2024-02-23
Anticipated expiration: 2042-07-05
Also published as: CN115927301A

Abstract

The invention relates to the technical field of gene technology, in particular to a spodoptera frugiperda control method based on RNAi. The invention takes spodoptera frugiperda V-ATPase as a target, prepares the nucleic acid pesticide capable of preventing and controlling spodoptera frugiperda by artificially constructing the siRNA expression vector, and obviously improves the death rate of spodoptera frugiperda by the method for preventing and controlling pests.

Description

RNAi-based spodoptera frugiperda control method

Technical Field

The invention relates to the technical field of gene technology, in particular to a spodoptera frugiperda control method based on RNAi.

Background

Spodoptera frugiperda (Spodoptera frugiperda) is a omnix insect pest which feeds more than 350 plants, has wide distribution range and extremely strong adaptability, and causes serious harm to agricultural production. Chemical pesticides play an important role in the process of preventing and controlling agricultural pests, but the pests generate drug resistance due to unreasonable operations such as blind use and abuse of pesticides, and meanwhile, the chemical pesticides have negative effects on grain safety, ecological environment, biodiversity and the like. Currently, in order to cope with the above problems, besides the related measures of the comprehensive pest control (IPM), the development of safe and efficient green pesticides with novel action mechanisms is mainly dependent on continuous development. With the intensive research of RNAi phenomena and mechanisms, RNAi technology has gradually moved into the fields of agricultural pest control, novel pesticide development and the like, compared with traditional chemical pesticides, RNAi has more definite action targets and action mechanisms, is safe to non-target organisms such as mammals and has no residual problems, meets the requirements of the current society on the quality safety and ecological safety of agricultural products, and is a novel potential green pest control strategy. The nucleic acid pesticide realizes interaction with a target by means of a base sequence complementary pairing principle, and finally blocks the source of target protein production from the mRNA level, so that the nucleic acid pesticide has a similar regulation effect as a small molecule inhibitor and becomes a novel posttranscriptional gene silencing regulation tool. Meanwhile, most pests and plants have perfect RNAi systems, and gene silencing signals mediated by RNAi in the biological groups are amplified in a cascade manner, so that the target genes are not expressed, and the biological growth and development are affected. The nucleic acid pesticide takes the essential gene for the growth and development of insects as a target, achieves the killing effect of lethal level by silencing the key gene, and has the characteristics of low dosage, high efficiency and sustainability. In recent years, RNAi has been successfully applied to species of pests of the order Hemiptera (hepaptera), lepidoptera (Lepidoptera), coleoptera (Coleoptera), diptera (Diptera), and Orthoptera (Orthoptera) under laboratory conditions. The U6 promoter is a class of promoters capable of mediating siRNA expression, which is recognized and transcribed by RNA polymerase III. The promoter can drive shRNA to synthesize a large amount of siRNA in an expression vector under proper conditions, so that the target gene is silenced. Insect baculoviruses are specific and infect only arthropods. Can invade the insect body and replicate and transcribe in the nucleus of the insect, and the gene can be connected with exogenous gene and can be fused well, so that it becomes ideal carrier. The siRNA expression system of the U6 promoter and the shRNA is constructed into the insect baculovirus genome, so that siRNA can be continuously generated in the virus proliferation process, and the continuous interference on the target gene is realized. The novel biological pesticide developed by combining baculovirus and RNAi avoids the problems of high cost, easy degradation, no persistence and the like of the traditional nucleic acid pesticide, can accelerate death after virus infects hosts, and can be inherited to next generation larvae as the baculovirus can infect among pest populations, so that the purpose of once application for a long time is achieved, and the novel biological pesticide meets the requirements of the current society on agricultural product quality safety and ecological safety, thereby being a potential novel green plant protection product.

The existing RNAi action mode is mainly used for pest control by injecting, feeding, spraying, soaking and other ways of applying nucleic acid molecules. However, the conventional dsRNA has the problems of easy degradation, high cost, no persistence and the like, and is not suitable for large-area popularization and application. Baculoviruses have the defects of slow insecticidal speed, incapability of obtaining obvious effects in time and the like, and most baculovirus insecticides are difficult to popularize in a large area.

Disclosure of Invention

The present invention relates to an siRNA comprising a first strand and a second strand, said first strand and second strand being complementary together to form an RNA dimer, and the sequence of said first strand is SEQ ID NO:1 or 2.

The invention also relates to a shRNA comprising a sense strand segment and an antisense strand segment, and a stem-loop structure connecting the sense strand segment and the antisense strand segment, wherein the sequences of the sense strand segment and the antisense strand segment are complementary, and the sequence of the sense strand is SEQ ID NO:1 or 2.

The invention also provides a DNA fragment, a gene expression cassette, a vector and a host cell of the shRNA.

The invention also provides a preparation method of the insect virus.

In a further aspect the invention provides a host cell comprising a DNA fragment as described above, or transformed with a vector as described above.

The invention also provides a composition for preventing spodoptera frugiperda comprising the siRNA as described above, the shRNA as described above or the vector as described above, and a method for preventing spodoptera frugiperda using the composition.

The siRNA and shRNA provided by the invention have the target point of V-ATPase playing an important function in the growth and development process of spodoptera frugiperda, and the main physiological function of V-ATPase is to mediate H by taking ATP as energy ⁺ The transmembrane transport maintains the normal pH gradient inside and outside the cell, forms a transmembrane potential difference, further mediates the active transport of other substances, further participates in other important physiological activities of organisms, and the growth and development of spodoptera frugiperda can be inhibited and further die due to the inhibition of the functions of the spodoptera frugiperda.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the description of the embodiments or the prior art will be briefly described, and it is obvious that the drawings in the description below are some embodiments of the present invention, and other drawings can be obtained according to the drawings without inventive effort for a person skilled in the art.

FIG. 1 is a comparison of transcriptional activity of candidate promoters; the figure shows the fluorescence of 72h sf9 cells after transfection.

FIG. 2 is a synthetic electrophoretogram of the U61-shA/B gene, lane M being 2K Plus DNA Marker; lane 1 is U61-shA and lane 2 is U61-shB.

Figure 3 is a mortality comparison of spodoptera 3-year old after feeding the recombinant insect baculovirus nucleic acid pesticide, with lower case letters indicating significant differences in treatment versus control (p < 0.05).

FIG. 4 is a comparison of mortality and adult eclosion rates after ingestion of recombinant insect baculovirus nucleic acid pesticides, with lower case letters indicating significant differences between treatment and control (p < 0.05).

FIG. 5 shows the expression level of the target gene after injection of recombinant insect baculovirus nucleic acid pesticides, with the lower case indicating a significant difference between the treatment and the control (p < 0.05).

FIG. 6 is a diagram showing symptoms of poisoning after ingestion of recombinant insect baculovirus nucleic acid pesticides.

FIG. 7 is a graph showing growth inhibition of spodoptera frugiperda larvae by injection of recombinant insect baculovirus.

Detailed Description

Reference now will be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. Indeed, it will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the scope or spirit of the invention. For example, features illustrated or described as part of one embodiment can be used on another embodiment to yield still a further embodiment.

Unless otherwise defined, all terms (including technical and scientific terms) used to describe the invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. By way of further guidance, the following definitions are used to better understand the teachings of the present invention. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

The term "and/or," "and/or," as used herein, includes any one of two or more of the listed items in relation to each other, as well as any and all combinations of the listed items in relation to each other, including any two of the listed items in relation to each other, any more of the listed items in relation to each other, or all combinations of the listed items in relation to each other. It should be noted that, when at least three items are connected by a combination of at least two conjunctions selected from "and/or", "or/and", "and/or", it should be understood that, in this application, the technical solutions certainly include technical solutions that all use "logical and" connection, and also certainly include technical solutions that all use "logical or" connection. For example, "a and/or B" includes three parallel schemes A, B and a+b. For another example, the technical schemes of "a, and/or B, and/or C, and/or D" include any one of A, B, C, D (i.e., the technical scheme of "logical or" connection), and also include any and all combinations of A, B, C, D, i.e., any two or three of A, B, C, D, and also include four combinations of A, B, C, D (i.e., the technical scheme of "logical and" connection).

The terms "comprising," "including," and "comprising," as used herein, are synonymous, inclusive or open-ended, and do not exclude additional, unrecited members, elements, or method steps.

The recitation of numerical ranges by endpoints of the present invention includes all numbers and fractions subsumed within that range, as well as the recited endpoint.

Concentration values are referred to in this invention, the meaning of which includes fluctuations within a certain range. For example, it may fluctuate within a corresponding accuracy range. For example, 2%, may allow fluctuations within + -0.1%. For values that are larger or do not require finer control, it is also permissible for the meaning to include larger fluctuations. For example, 100mM, fluctuations in the range of.+ -. 1%,.+ -. 2%,.+ -. 5%, etc. can be tolerated.

In the present invention, the terms "plurality", and the like refer to, unless otherwise specified, 2 or more in number.

In the invention, the technical characteristics described in an open mode comprise a closed technical scheme composed of the listed characteristics and also comprise an open technical scheme comprising the listed characteristics.

In the present invention, "preferred", "better", "preferred" are merely embodiments or examples which are better described, and it should be understood that they do not limit the scope of the present invention. In the present invention, "optional" means optional or not, that is, means any one selected from two parallel schemes of "with" or "without". If multiple "alternatives" occur in a technical solution, if no particular description exists and there is no contradiction or mutual constraint, then each "alternative" is independent.

In the present invention, the siRNA, i.e. small interference RNA (small interfering RNA), is a double-stranded small RNA molecule consisting of a first strand and a second strand that are perfectly complementary, processed by Dicer (an enzyme in RNAase iii family that is specific for double-stranded RNA). The first strand and the second strand are complementary together to form an RNA dimer, and the sequence of the first strand is identical to or hybridizes to a target sequence in the Spodoptera frugiperda V-ATPaseA/B gene under high stringency conditions. siRNA is a major member of sirrisc, triggering silencing of target mRNA complementary thereto.

In the present invention, the shRNA, i.e., small hairpin or short hairpin RNA (small hairpin RNA or shorthairpin RNA, shRNA), is an RNA sequence with a tight hairpin loop (tight hairpin turn) comprising a sense strand segment, an antisense strand segment, and a stem loop structure connecting the sense strand segment and the antisense strand segment, is often used for RNA interference silencing expression of a target gene. Wherein the sequences of the sense and antisense strands are complementary and the sequence of the sense strand fragment is identical to the target sequence in the Spodoptera frugiperda V-ATPaseA/B gene. The hairpin structure of shRNA can be cleaved by cellular mechanisms into siRNA, which then binds to RNA-induced silencing complexes (RNA-inducedsilencing complex, RISC) that are capable of binding to and degrading the desired mRNAs.

RNA interference (RNAinterference, RNAi) refers to the phenomenon that endogenous or exogenous double-stranded RNA (dsRNA) mediates specific degradation of intracellular mRNA, thereby leading to silencing of target gene expression and corresponding loss of functional phenotype.

In the present invention, "complementary" means that hybridization can be performed under stringent conditions. "hybridization conditions" are classified according to the degree of "stringency" of the conditions used in measuring hybridization. The degree of stringency can be based on, for example, the melting temperature (Tm) of the nucleic acid binding complex or probe. For example, "maximum stringency" typically occurs at about Tm-5 ℃ (5 ℃ below the Tm of the probe); "high stringency" occurs about 5 ℃ to 10 ℃ below Tm; "moderate stringency" occurs about 10 ℃ to 20 ℃ below the Tm of the probe; "Low stringency" occurs about 20℃to 5℃below Tm. Alternatively, or in addition, hybridization conditions may be based on salt or ionic strength conditions of hybridization and/or one or more stringent washes. For example, 6 x SSC = very low stringency; 3 x SSC = low to medium stringency; 1 x SSC = medium stringency; 0.5 x SSC = higher stringency. Functionally, maximum stringency conditions can be used to determine nucleic acid sequences that are identical or nearly identical to the hybridization probes; while higher stringency conditions are used to determine nucleic acid sequences that have about 80% or more sequence identity to the probe.

For applications requiring high selectivity, it is typically desirable to employ relatively stringent conditions to form hybrids, e.g., to select relatively low salt and/or high temperature conditions. Sambrook et al (Sambrook, J. Et al (1989) molecular cloning, A laboratory Manual, cold Spring Harbor Press, planview, N.Y.), provide hybridization conditions including medium and high stringency.

For ease of illustration, suitable moderately stringent conditions for detecting hybridization of a polynucleotide of the invention with other polynucleotides include: pre-washed with 5 XSSC, 0.5% SDS, 1.0mM EDTA (pH 8.0) solution; hybridization in 5 XSSC at 50-65℃overnight; followed by washing twice with 2×, 0.5× and 0.2×ssc each containing 0.1% sds at 65 ℃ for 20 minutes. It will be appreciated by those skilled in the art that hybridization stringency can be readily manipulated, such as by altering the salt content of the hybridization solution and/or the hybridization temperature. For example, in another embodiment, suitable high stringency hybridization conditions include those described above, except that the hybridization temperature is raised, for example, to 60℃to 65℃or 65℃to 70 ℃.

Further, the sequence of the stem-loop structure of the shRNA may be a routine choice in the art, e.g., selected from any one of the following sequences: UUCAAGAGA, AUG, CCC, UUCG, CCACC, CUCGAG, AAGCUU and CCACACC.

The invention also relates to DNA fragments encoding shRNA as described above.

The invention also comprises a gene expression cassette comprising a DNA fragment as described above.

Regulatory elements commonly used in genetic engineering, such as enhancers, promoters, internal Ribosome Entry Sites (IRES), and other expression control elements (e.g., transcription termination signals, or polyadenylation signals, and poly U sequences, etc.), may be included in a gene expression cassette.

In some embodiments, the nucleotide sequence of the promoter used to drive expression of the DNA fragment in the gene expression cassette is set forth in SEQ ID NO: shown at 5.

The promoter is a U6 promoter of spodoptera frugiperda with excellent effect, which is obtained by screening by the inventor, and can effectively improve the expression efficiency of a target gene.

In addition, in one aspect, sequences useful in the present invention include those that correspond to SEQ ID NO: 1-5 has a nucleotide sequence that is greater than 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical. The term "% identity" in the context of two or more nucleotide sequences or amino acid sequences refers to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection. For example,% identity is the entire length of the coding region relative to the sequences to be compared.

For sequence comparison, typically one sequence is used as a reference sequence, and the test sequence is compared to that sequence. When using a sequence comparison algorithm, the test sequence and reference sequence are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity of the test sequence relative to the reference sequence based on the specified program parameters. The percent identity can be determined using search algorithms such as BLAST and PSI-BLAST (Altschul et al, 1990, JMol Biol 215:3,403-410;Altschul et al, 1997,Nucleic Acids Res25:17,3389-402).

Useful sequences also include modified nucleic acids, common modifications include 4-acetylcytidine, 5- (carboxylmethyl) uridine, dihydrouridine, 2 '-O-methyl pseudouridine, beta, D-galactoQ nucleoside, 2' -O-methyl guanosine, inosine, N ⁶ -isopentenyl adenosine, 1-methyladenosine, 1-methylpseuduridines, 1-methylainosine, 2' 2-dimethyladenosine, 2-methyladenosine, 2-methylguanosine, 5-methyluridine, 3-methylcytidine, 5-methylcytidine, N ⁶ -methyladenosine, 7-methylguanosine, 5-methylaminomethyluridine, 5-carboxymethyl aminomethyluridine, 5-carboxymethyl aminomethyl-2-thiouridine, beta, D-mannosyl Q-nucleoside, 5-methoxycarbonylmethyl-2-thiouridine, 5-methoxycarbonylmethyluridine, 5-methoxyuridine, 2-thiomethyl-N ⁶ -isopentenyl adenosine, N- ((9-beta-D-ribofuranosyl-2-thiomethyl-purin-6-Yl) carbamoyl) threonine, N- ((9-beta-D-ribofuranosyl-6-Yl) N-methylcarbamoyl) threonine, uridine-5-oxoacetic acid-methyl ester, uridine-5-oxoacetic acid, wybutoxosine, pseudouridine, Q nucleoside, 2-thiocytidine, 5-methyl-2-thiouridine, 4-thiouridine, 5-thiouridine, N- ((9-beta-D-ribofuranosyl-6-Yl) -carbamoyl) threonine, 2 '-O-methyladenosine-5-methyluridine, 2' -O-methylcytidine, wybutosine, 3- (3-amino-3-carboxy-propyl) uridine, N ⁶ -acetyl adenosine and 2-methylthio-N ⁶ -one, two or more of methyladenosine.

The invention also relates to vectors containing the gene expression cassettes described above.

A gene expression cassette (or nucleic acid construct) is also referred to as a vector when it enables transcription or translation of the inserted polynucleotide encoding, or simply for preservation, or to increase its ability to infect a host cell. The vector may be introduced into a host cell by transformation, transduction or transfection such that the genetic material elements carried thereby are expressed in the host cell. Vectors are well known to those skilled in the art and include, but are not limited to: a plasmid; phagemid; a cosmid; artificial chromosomes, such as Yeast Artificial Chromosome (YAC), bacterial Artificial Chromosome (BAC), or P1-derived artificial chromosome (PAC); phages such as lambda phage or M13 phage, animal viruses, etc. In the present invention, the preferred vector is a virus, more preferably an insect virus, especially various viruses capable of infecting Spodoptera frugiperda, preferably an insect baculovirus.

The invention also relates to a host cell containing a DNA fragment as described above or transformed with a vector as described above.

The host cell is preferably an insect cell line, such as sf9, mic sf9, sf21, highFive, etc.; in some specific embodiments, the host cell is a sf9 cell.

The invention also relates to a method for the preparation of an insect virus as described above, comprising culturing a host cell as described above (in particular an insect host cell) under suitable conditions and collecting the insect virus thus obtained from the culture supernatant or cell lysate.

The invention also relates to a composition for controlling spodoptera frugiperda, the active ingredient of which comprises the siRNA as described above, the shRNA as described above or the vector as described above.

The nucleic acid components of the composition (e.g., siRNA, shRNA, plasmid, etc.) can be bound (conjugated) to a synthetic carrier to increase their biostability and/or bioavailability, thereby causing RNA interference. The synthetic carrier may be an inert compound with natural or engineered affinity, and in certain aspects, the synthetic carrier comprises a combination of inert chemicals or nanoparticles that have a net positive charge or general affinity to bind negatively charged dsRNA upon binding and/or alone. Representative examples include chitosan, liposomes, carbon quantum dots, biodegradable particles of plant (e.g., coconut coir or cereal flour, etc.) or soil (e.g., calcified clay) origin, and the like. Preferably, the active ingredient is an insect virus.

The invention also relates to a method for controlling spodoptera frugiperda, comprising the following steps:

administering a composition as described above such that it is fed by spodoptera frugiperda;

the method of administration comprises:

the application can be carried out locally or wholly on the plants, or coated on the plant seeds, or transmitted by fertilizer, or transmitted by irrigation, or a combination of the above application methods.

Spodoptera frugiperda belongs to a omnix pest that can harm a variety of plants, and thus it is readily understood that the plants include all hosts of spodoptera frugiperda, preferably commercial crops such as more than 80 plants of peanut, beet, soybean, papaya, strawberry, pachyrhizus, amaranth, and the like. In some embodiments, the plant is selected from the group consisting of gramineous plants, more preferably rice, sugarcane, wheat, barley, sorghum, ryegrass, sudan grass, and maize.

Embodiments of the present invention will be described in detail below with reference to examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples, in which specific conditions are not noted, are preferably referred to in the guidelines given in the present invention, and may be according to the experimental manuals or conventional conditions in the art, and may be referred to other experimental methods known in the art, or according to the conditions suggested by the manufacturer.

In the specific examples described below, the measurement parameters relating to the raw material components, unless otherwise specified, may have fine deviations within the accuracy of weighing. Temperature and time parameters are involved, allowing acceptable deviations from instrument testing accuracy or operational accuracy.

Example 1

In the embodiment, the siRNA of the V-ATPase gene fragment is connected with the U6 promoter of spodoptera frugiperda to continuously generate the nucleic acid pesticide capable of interfering with the V-ATPase, so that the growth and development of spodoptera frugiperda larvae can be greatly inhibited.

The concrete construction method is as follows:

cloning of the U6 promoter gene:

extraction of genomic DNA: spodoptera frugiperda genomic DNA was extracted using E.Z.N.A.instruction DNA Kit from Omega Bio-Tek company, and the DNA was diluted 10-fold and used as a template for amplification of the target gene.

Designing a primer: the complete sequence of the silkworm U6snRNA gene (AY 6493.1) is compared with the complete sequence of the fruit fly U6snRNA gene (AH 004871.1) by on-line software ClustalOmega (http:// www.ebi.ac.uk/Tools/msa/clustalo /), the homologous regions of the sequences are analyzed, the U6 promoter of the spodoptera frugiperda candidate is searched in a spodoptera frugiperda genome database, the U6 promoter candidate sequence with the 5' -end 27bp of the U6snRNA and 500-2000bp upstream of the transcription initiation site thereof is selected and taken as the full-length U6 promoter candidate sequence of the spodoptera frugiperda respectively, and the shRNA sequence of the EFFP gene is added to the U6 promoter downstream and named as U61-shEGFP, U62-shEGFP, U63-shEGFP and U64-shEGFP respectively when designing primers. Primers were designed according to NCBI primer blast as shown in table 1:

TABLE 1

And (3) PCR amplification:

the PCR amplification system is shown in Table 2:

TABLE 2

The PCR amplification procedure was:

①94℃ 3min

②94℃ 30s

③55℃ 30s 35cycles

repeating steps (2) and (3) for 35 cycles

④72℃ 2min

⑤72℃ 10min

The amplified products were subjected to 2.0% agarose electrophoresis, and PCR products were recovered using a DNA purification gel recovery kit (Gel Extraction Kit) from Omega Bio-Tek company, specifically:

1. the strip containing the DNA bands was cut out into a centrifuge tube and weighed. (the weight of the centrifuge tube is required to be firstly weighed, the centrifuge tube is weighed again after the cut gel is put in, and the weight of the gel is obtained by subtracting the weight of the centrifuge tube from the weight of the cut gel.

2. Binding buffer (the gel weight is 0.1g, the volume is 100. Mu.L) with the same volume as the gel is added, and the mixture is melted in a water bath at 55-65 ℃ for 7min and uniformly mixed for 2-3min.

3. Sucking 700. Mu.L of the mixture obtained in step 2, and adding HiBind ^TM In the DNA column (adsorption column placed in 2mL collection tube), the mixture was centrifuged at 12 rpm for 1min at room temperature, and the waste liquid in the collection tube was poured out, and the procedure was repeated until all the samples of 2 were added.

4. 300. Mu.L of Binding buffer was added to the column, centrifuged at 12 rpm for 1min at room temperature, and the waste liquid in the collection tube was discarded.

5. The mixture was applied to a column at 700 mu L spw wash buffer, centrifuged at 12 rpm for 1min at room temperature, and the filtrate was discarded.

6. And (5) repeating the step 5.

7. The column was replaced in the collection tube and centrifuged at 12 rpm at idle for 1min.

8. Transferring the adsorption column into a clean and sterilized centrifuge tube, adding 15-30 μl preheated ddH at the middle part of the adsorption membrane ₂ O,12 rpm for 1min.

9. And (3) adding the solution which is centrifuged to the 1.5mL centrifuge tube in the last step into an adsorption column after all the solution is sucked, and centrifuging for 1min. Thus obtaining purified DNA product. After concentration measurement, the mixture was stored at-20 ℃.

And (3) connecting a carrier:

the PCR product was ligated into the pFastBAC1 vector (purchased from vast Programme plasmid platform).

The connection system is as follows:

and (3) connecting the connecting system at 16 ℃ for 12 hours to obtain a connecting product.

Conversion:

1. DH 5. Alpha. Competent cells were thawed on ice.

2. 10. Mu.L of the recombinant product was gently mixed and added to 100. Mu.L of the competence after thawing, incubated on ice for 30min, heat-shocked at 42℃for 60s, and immediately cooled on ice for 2-3min.

3. 1mL of LB liquid medium without antibiotics is added, and the bacteria are shaken for 1h at 37 ℃.

After centrifugation at 4.5000rpm for 5min, 800. Mu.L of the supernatant medium was discarded, the medium was gently shaken and plated (plates were subjected to inversion culture at 37℃for 12h with the final concentration of 100. Mu.g/mL ampicillin sodium (Amp) added in advance).

Extracting plasmids: randomly picking 5 white positive clones on LB solid medium, adding the white positive clones into 3.0mL of LB liquid medium containing 50mg/mL kanamycin, shaking at 200rpm and 37 ℃ for 10 hours, amplifying and verifying the positive clones, and extracting plasmids from bacterial liquid with correct sequencing results through an (OMEGA) Plasmid mini Kit.

The method comprises the following specific steps:

1. 1.5mL of the tube was added to 1. Mu.L of the bacterial liquid, and the mixture was centrifuged at 12,000 rpm for 2 minutes at room temperature. The supernatant was discarded and repeated until the sample was complete.

2. 250 μl of Solution I mixture was added and vortexed until no white bacteria precipitate.

3. To the suspended mixed liquid obtained in step 2, 250. Mu.L of Solution II was added, and the mixed liquid was gently mixed by inversion for 5 times (at this time, the bottle mouth had sticky threads). The operation is gentle, severe shaking is avoided and the lysis time cannot exceed 5min.

4. 350. Mu.L of Solution III was added, followed immediately by 10-20 spin inversions until a white floc precipitate formed. This process avoids severe oscillations.

5. Centrifuge at 12min at 12 000rpm at room temperature.

6. The supernatant was transferred to a filter column (fitted with a 2mL collection tube), centrifuged at 12 rpm for 15min at room temperature, and the filtrate was discarded.

7. Add 500. Mu.L HB Buffer to the filter column and centrifuge at 12.000 rpm for 1.5min, discard the filtrate.

8. The mixture was applied to a filter column at 700. Mu. L DNA Wash Buffer, the rotation speed was set at 12,000 rpm, the mixture was centrifuged for 1min, and the filtrate was discarded.

9. And (8) repeating the step 8.

10. The tube was centrifuged at 12 rpm for 2.5min at idle.

11. Placing the filter column after idling on a new centrifuge tube, adding sterile water preheated at 65 ℃, standing for 1min, and centrifuging at 12 000rpm for 1.5min. The plasmid-extracted product was subjected to 1% agarose gel electrophoresis to verify the size of the plasmid band, and stored at-20 ℃.

Sequencing: the plasmid pFastBAC1-U6N-shEGFP was sequenced (completed by Beijing engine information Biotechnology Co., ltd.) and the pFastBAC1-U6N-shEGFP plasmid template sequence containing the U6N-shEGFP gene was as follows:

spodoptera frugiperda U61 promoter sequence: SEQ ID NO:5 is shown in the figure;

spodoptera frugiperda U62 promoter sequence: SEQ ID NO:6 is shown in the figure;

spodoptera frugiperda U63 promoter sequence: SEQ ID NO: shown in figure 7;

spodoptera frugiperda U64 promoter sequence: SEQ ID NO: shown as 8;

shEGFP sequence: SEQ ID NO: shown at 9.

Transformation of DH10Bac competent cells:

the obtained product pFastBAC1-U6N-shEGFP is transferred into DH10Bac competent cells, and the specific steps are as follows:

1. whole tubes of DH10Bac competent cells were thawed on ice.

2. mu.L (1 ng/. Mu.L) of pFastBAC1-U6N-shEGFP plasmid DNA was added to competent cells, and gently mixed.

3. The cells were incubated on ice for 30min, thermally shocked at 42℃for 45s, and immediately transferred to ice without shaking, and cold-bathed for 2min.

4. 900. Mu.L of liquid LB medium without antibiotics was added.

The culture was carried out at 5.37℃for 4 hours with shaking at 225 rpm.

6. Prepared using LB liquid medium (without antibiotics), 100. Mu.L of cells were inoculated on LB agar plates containing kanamycin (50. Mu.g/mL), gentamicin (7. Mu.g/mL), tetracycline (10. Mu.g/mL), BLuo-gal (100. Mu.g/mL) and IPTG (40. Mu.g/mL).

7. The plates were incubated at 37℃for 48h and the refrigerator for 1h.

8. Shaking: pure white spot single colonies were selected by culturing at 37℃for 48 hours on a plate, and added to LB liquid medium containing 50. Mu.g/mL kanamycin, 70. Mu.g/mL gentamicin, and 10. Mu.g/mL tetracycline, and shake cultured overnight at 37℃at 200 rpm.

9. PCR identification was performed using the universal primers M13F and M13R, identifying positive Bacmid DNA.

PCR was used to verify whether the recombinant bacmid contained the gene of interest (using the universal primer M13 nuclear assay), and insect sf9 cells were transfected after successful detection.

Cell transfection validated candidate U6 transcriptional activity:

to compare the transcriptional activity of the U61/U62/U63/U64 candidate promoters, the vectors Bacmid-EGFP-U61-shEGFP, bacmid-EGFP-U62-shEGFP, bacmid-EGFP-U63-shEGFP and Bacmid-EGFP-U64-shEGFP were co-transfected with sf9 cells, respectively, and after 72 hours, each well was placed under an inverted fluorescence microscope to observe the growth of the cells and the fluorescence intensity of each group under the same field of view (FIG. 1). The specific operation is as follows:

transfection of sf9 cells was performed in 6-well plates, and sf9 cells were co-transfected with the constructed Bacmid-U6N-shEGFP and Bacmid-EGFP recombinant vectors (see Table 3 for details). The operation is as follows:

1. culturing suspension cells: the original culture medium and suspended cells in the cell culture flask in logarithmic growth phase are poured out, and 12mL of fresh Sf-900 is added ^TM III SFM medium. The adherent cells were gently blown down with an elbow glass pipette.

2. Cell attachment: adding 2mL of cell suspension into 6-well plate, placing into 27 deg.C incubator, and culturing cell wall-attached for at least 1 hr to make cell number reach 2×10 ⁶ Cells/wells.

3. Preparing transfection mixture

(1) 1.5. Mu.g of Bacmid plasmid was pipetted into 150. Mu.L of Sf-900 ^TM In the III SFM culture medium, gentle blowing and wetting are carried out.

(2) 10 mu L of light dyeing reagent cellfection is sucked ¹² Added to 150. Mu.L of Sf-900 ^TM In the III SFM culture medium, gentle blowing and mixing are carried out.

(3) Mixing diluted components (1) and (2) gently, and standing at room temperature for 30min.

(4) Light dyeing: after 30min, the light dye mixture was added to 6-well plates at 100. Mu.L per well, mixed crosswise, and incubated at 27 ℃.

TABLE 3 transfection Components and amounts

Evaluation criteria: the higher the starting efficiency of the U6 promoter is, the higher the interference efficiency of the shEGFP on the fluorescent protein EGFP is, the lower the expression quantity of the EGFP is, and the weaker the fluorescence is under a microscope; conversely, the worse the U6 promoter is, the lower the interference efficiency of the shEGFP on the fluorescent protein EGFP is, the higher the expression quantity of the EGFP is, and the stronger the fluorescence is under a microscope.

The result shows that the fluorescence signal intensity of Bacmid-EGFP-U61-shEGFP+Bacmid-EGFP is obviously reduced and is the lowest in four candidate promoters, which indicates that the expression quantity of EGFP genes is reduced, and further indicates that the U6 candidate promoter can drive shEGFP to successfully express in sf9 cells, namely, the spodoptera frugiperda U61 candidate promoter has a certain transcriptional activity on hairpin RNA. Thus, the U61 candidate promoter on spodoptera frugiperda chromosome 6 was selected for subsequent construction experiments of recombinant vectors.

Cleavage of the pFastBac1-EGFP transfer vector: the plasmid was digested with XhoI and HindIII, the digested vector was designated pFastBac1-EGFP-, and the digested plasmid was digested and recovered, and the recovered product was placed at-20deg.C for use.

Design of V-ATPase A/B subunit hairpin structure: the optimal interference fragments ATPaseA-2 and ATPaseB-2 of the Spodoptera frugiperda V-ATP A/B subunit were predicted using on-line software siDirect (http:// design. RNA. Jp /), to obtain potential siRNAs and design hairpin structures based on the predicted siRNAs.

Optimal interference fragment of spodoptera frugiperda gene V-ATPaseA/B

dsV-ATPaseA-2 378bp

AAGACTGTCGTCTCACAGGCTCTGTCCAAGTACTCCAACTCTGACGTCATCATCTACGTCGGATGCGGTGAACGTGGTAACGAGATGTCTGAGGTACTGCGTGACTTCCCCGAGCTGACGGTGGAGATCGAGGGCATGACCGAGTCCATCATGAAGCGTACCGCGCTCGTCGCCAACACCTCCAACATGCCTGTAGCCGCCCGAGAGGCTTCCATCTACACCGGTATCACCCTCTCCGAGTACTTCCGTGACATGGGTTACAACGTGTCCATGATGGCTGACTCCACCTCTCGTTGGGCCGAGGCTCTTCGTGAGATCTCAGGTCGTCTGGCTGAGATGCCTGCCGACTCCGGTTACCCCGCCTACCTGGGAGCCCGT

dsV-ATPaseB-2 408bp

AACTCCATCGCTCGTGGTCAGAAGATCCCCATCTTCTCCGCTGCTGGTCTGCCCCACAACGAAATTGCCGCCCAGATCTGTAGACAGGCCGGTCTTGTCAAGATCCCCGGCAAATCAGTGTTGGATGACCACGAGGACAACTTCGCCATCGTGTTCGCCGCTATGGGTGTGAACATGGAAACCGCCCGGTTCTTCAAACAGGACTTCGAAGAGAACGGTTCCATGGAGAACGTGTGCCTGTTCTTGAACTTGGCCAACGACCCTACCATTGAGAGAATTATCACACCCCGTCTGGCTCTTACTGCCGCCGAGTTCTTGGCCTACCAGTGCGAGAAACACGTGTTGGTCATCTTGACTGACATGTCCTCATACGCCGAGGCTCTGCGTGAGGTATCCGCCGCCCGTGAG

The shRNA sequence is as follows:

cloning of U6-shA/B.

The specific primer clone U6-shA/B containing plasmid homology arms is designed according to the sequence of the spodoptera frugiperda U61 promoter and the hairpin structure sequence of the V-ATPase A/B subunit, and the primers are synthesized by Beijing qing family biotechnology Co.

TABLE 4 U6-shA/B primer series

Note that: the sense strand homology arm is CGAGCTGTACAAGTTCTAGCTCGAG and the antisense strand homology arm is CTAGTACTTCTCGACAAGCTT.

Construction of recombinant baculovirus transfer vector Bacmid-U61-EGFP-shA/B:

and (3) connecting the pFastBac 1-EGFP-after XhoI and HindIII enzyme digestion with U61-shA/B to obtain a pFastBac1-EGFP-U61-shA/B recombinant vector, and carrying out bacterial liquid PCR verification and sequencing after transformation. And transferring positive plasmids with correct sequencing into DH10Bac competent cells, extracting recombinant plasmids Bacmid-U61-shA/B containing the target genes, and re-verifying the target genes by using M13 universal primers.

Obtaining recombinant insect baculovirus: and (3) carrying out a recombinant insect baculovirus transfection test by using Bac To Bac System, carrying out transfection of Bacmid-U61-shA/B recombinant plasmid into sf9 cells in a cell culture bottle, collecting culture solution into a 10mL centrifuge tube after 2-3d of transfection when the cells begin to rupture, centrifuging at 22 ℃ with 500g for 5min, loading the removed supernatant into the 5mL centrifuge tube, and storing at 4 ℃ in a dark place to obtain p1 generation. Adherent cells were prepared in 6-well plates, 300. Mu.L of the P1-generation virus was added dropwise, and the cells were placed in a incubator at 27℃until they began to rupture for 2-3 days, and the P2-generation virus was collected (method same as P1 generation). Pn generation virus is added dropwise into a 6-well plate containing adherent cells, cultured for 2-3d, and Pn+1 generation virus is collected.

Example 2 application of nucleic acid insecticide to killing spodoptera frugiperda

The application method comprises the following steps:

(1) Recombinant insect baculovirus and empty vector baculovirus were fed to spodoptera frugiperda larvae at an amount of 1mL baculovirus per 3g of the oven dried feed, respectively.

(2) The mortality of the larvae of each treatment group was recorded every day until the larvae pupate, and the pupation rate and the adult eclosion rate under different treatment groups after the pupation of the larvae were recorded.

(3) Injecting 100nL recombinant baculovirus shA/shB, empty vector baculovirus and clear water into 3-year-old test insects, observing the morphological change and survival condition of larvae every day, taking out the larvae periodically to detect the gene expression condition, and recording.

Fig. 3 is a comparison of mortality after spodoptera frugiperda ingests a pesticide containing viral nucleic acid, with lower case letters indicating significant differences between treatment and control (p < 0.05). As can be seen from the figures: the recombinant baculovirus has growth and development inhibition effect on spodoptera frugiperda, can obviously reduce the survival rate of larvae, the survival rate of baculovirus fed with empty vector is 43.75%, and the survival rate of larvae fed with recombinant baculovirus shA is 18.77%. The survival rate of larvae fed recombinant baculovirus shB was 41.05% and the survival rate of the blank treatment group was 72.2%.

FIG. 4 shows a comparison of pupation rate and adult emergence rate of spodoptera frugiperda fed with a viral nucleic acid containing pesticide, 18.75% and 35.40% of larvae in the recombinant baculovirus shA and shB treatment groups, respectively, being able to pupate, while 43.75% of larvae in the empty vector baculovirus treatment group, and 72.20% of larvae in the clear water treatment group; the adult emergence rate of the baculovirus treated group was significantly reduced compared to the control group 72.20%. And 35.40% emergence rate was observed in empty vector baculovirus treatment, while the lowest adult emergence rates were 18.75% and 22.95% respectively observed in recombinant baculovirus shA and shB treatment, significantly lower than in empty vector baculovirus.

FIG. 5 shows the expression level of the objective gene after injection of baculovirus.

Table 5 is a comparison of spodoptera frugiperda body weight length changes after injection of recombinant insect baculovirus, with lower case letters indicating significant differences (p < 0.05) between treatment and control.

TABLE 5

The injection of the insect baculovirus can cause massive death of larvae, and the injection of the recombinant insect baculovirus shA and shB treatment group larvae all begin to die in massive death at 3d, and all die in 4 d; the empty vector group has no death of larvae at the 4 th day, and part of larvae at the 5 th day have death phenomenon until all larvae at the 6 th day die; the blank group did not die during the observation period.

Baculovirus injection can significantly reduce the weight and growth of larvae. There was no significant difference in body weight and body length between each treatment group and the blank group on the first day of injection; significant differences (P < 0.05) occurred on the third day, with average increase in body weight of 0.1396g and average increase in body length of 0.817cm for the placebo group; the weight of the empty carrier group increases by 0.01465g and the length of the empty carrier group increases by 0.305cm; the recombinant vector shA has average weight reduction of 0.0063g and average body length reduction of 0.305cm; recombinant vector shB had an average body weight loss of 0.00631g and an average body length loss of 0.243cm.

The method of this example is not limited to nucleic acid pesticides targeting the V-ATPase a/B subunit, but other insect lethal genes may be employed, and the same technical effects may be achieved.

According to the embodiment, after the spodoptera frugiperda recombinant insect baculovirus is fed and injected, the virus enters the spodoptera frugiperda body to silence the target gene, so that the function of the plant pests is affected, and the plant pests are finally killed, thereby achieving the purpose of preventing and controlling the plant pests. The method disclosed by the invention is environment-friendly nucleic acid pesticide, is more environment-friendly and safer than chemical agents, and is stronger in targeting property, and on the other hand, compared with spraying dsRNA, the method is more beneficial to preventing and controlling spodoptera frugiperda.

The method of the embodiment is not limited to the insect baculovirus expression vector, and can infect other pest expression vectors, and the method of the embodiment can be adopted, and the same technical effect can be achieved.

The above examples illustrate only a few embodiments of the invention, which are described in detail and are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. The scope of the invention is therefore intended to be covered by the appended claims, and the description and drawings may be interpreted in accordance with the contents of the claims.

Claims

1. A gene expression cassette comprising a DNA fragment encoding shRNA and a promoter for driving expression of the DNA fragment,

the shRNA comprises a sense strand segment and an antisense strand segment, and a stem-loop structure connecting the sense strand segment and the antisense strand segment, wherein the sequences of the sense strand segment and the antisense strand segment are complementary, and the sequence of the sense strand is SEQ ID NO:1 or 2;

the nucleotide sequence of the promoter used for driving the expression of the DNA fragment is shown as SEQ ID NO: shown at 5.

2. A vector comprising the gene expression cassette of claim 1.

3. The vector of claim 2, which is an insect virus.

4. A vector according to claim 3 which is an insect baculovirus.

5. A host cell comprising the gene expression cassette of claim 1 or transformed with the vector of any one of claims 2 to 4.

6. The host cell of claim 5, which is a sf9 cell.

7. A composition for controlling spodoptera frugiperda, the active ingredient of which comprises the expression cassette of claim 1 or the vector of any one of claims 2 to 4.

8. A process for producing an insect virus as claimed in claim 3 or 4, which comprises culturing the host cell as claimed in claim 5 or 6 under suitable conditions and collecting the insect virus thus obtained from the culture supernatant or cell lysate.

9. A method of controlling spodoptera frugiperda, comprising:

administering the composition of claim 7 such that it is fed by spodoptera frugiperda;

the method of administration comprises:

10. The method of claim 9, wherein the plant is selected from the group consisting of grasses.