CN108441496B - shRNA sequence for inhibiting chicken SOX5 gene expression and application thereof - Google Patents

Abstract

The invention discloses a shRNA sequence for inhibiting chicken SOX5 gene expression and application thereof, wherein the shRNA sequences are SOX1312, SOX1635 and SOX628 respectively, a SOX1312-a sense strand and a SOX1312-b antisense strand are respectively shown as SEQ ID NO. 1 and SEQ ID NO. 2, a SOX1635-a sense strand and a SOX1635-b antisense strand are respectively shown as SEQ ID NO. 3 and SEQ ID NO. 4, and a SOX628-a sense strand and a SOX628-b antisense strand are respectively shown as SEQ ID NO. 5 and SEQ ID NO. 6. The three shRNA sequences can effectively reduce the expression level of the chicken SOX5 gene, and the inhibition efficiency at the gene level is respectively 62%, 80% and 90%.

Description

shRNA sequence for inhibiting chicken SOX5 gene expression and application thereof

Technical Field

The invention relates to the technical field of biological medicines, in particular to a shRNA sequence for inhibiting chicken SOX5 gene expression and application thereof.

Background

The SOX gene family is a gene family formed by related genes of sex-determining region of Y chromosome, and encodes a series of transcription factors of the SOX family. The SOX gene family is divided into 9 types in human and mouse, and is widely involved in early embryo and nerve development process in the individual development process. The SOX5 gene belongs to SOXD gene family, and research proves that the coded transcription factor is involved in regulating cell growth, proliferation and differentiation in the process of chondrogenesis. However, in chickens, there are only few reports on the function of the gene.

RNAi interference technology is an important technology for researching gene functions, expression of targeted gene mRNA can be inhibited by designing interference fragments, and the gene functions can be presumed through cell phenotype or other related gene changes. Short hairpin RNAs (shRNAs) are DNA molecules that can be cloned into expression vectors and express short interfering RNAs (siRNAs, 19-21 nucleotide double-stranded RNAs), comprising two short inverted repeats separated by a loop sequence, controlled by a poliII promoter, followed by 5-6 Ts as transcription terminators for RNA polymerase III. The short interfering RNA is delivered into cells or living tissues through a vector, is cut into siRNA by a cellular mechanism, and the siRNA plays a role in silencing the expression of a target gene. Lentiviruses are widely used in gene expression studies with their low transfection conditions (transfectable dividing and non-dividing cells) and high transfection efficiency.

With the continuous and deep development of RNA interference technology, the shRNA designed and synthesized is constructed to a lentivirus expression system, so as to infect specific target cells, specifically silence the expression of related genes, become one of the most effective means for researching gene functions, and also be an effective way for targeted gene therapy. The shRNA lentivirus expression system effectively overcomes the defects of low transfection efficiency, short duration and the like of the prior artificially synthesized siRNA, and has gradually developed into one of effective ways for researching gene functions in primary cells and in vivo.

Disclosure of Invention

In view of the above, the invention aims to provide a shRNA sequence for inhibiting the expression of a chicken SOX5 gene and an application thereof, wherein the shRNA interference sequence can effectively reduce the expression quantity of the chicken SOX5 gene and has a wide application prospect in functional research of the chicken SOX5 gene.

Based on the above purpose, the shRNA sequence for inhibiting the expression of the chicken SOX5 gene provided by the invention comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand are shown as follows:

SOX1312-a sense strand:

5'-CCGGCGGCAGATGAAGGAGCAACTTCTCGAGAAGTTGCTCCTTCATCTGCCGTTTTTG-3', which is shown in SEQ ID NO: 1;

SOX1312-b antisense strand:

5'-AATTCAAAAACGGCAGATGAAGGAGCAACTTCTCGAGAAGTTGCT CCTTCATCTGCCG-3', which is shown in SEQ ID NO. 2;

wherein CTCGAG is a loop sequence.

The invention also provides a shRNA sequence for inhibiting the expression of the chicken SOX5 gene, which comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand have the following sequences:

SOX1635-a sense strand:

5'-CCGGGAGGAAGATCCTTCAAGCCTTCTCGAGAAGGCTTGAAGGATCTTCCTCTTTTTG-3', which is represented by SEQ ID NO. 3;

SOX1635-b antisense strand:

5'-AATTCAAAAAGAGGAAGATCCTTCAAGCCTTCTCGAGAAGGCTTGAAGGATCTTCCTC-3', which is represented by SEQ ID NO. 4;

wherein CTCGAG is a loop sequence.

The invention also provides a shRNA sequence for inhibiting the expression of the chicken SOX5 gene, which comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand have the following sequences:

SOX628-a sense strand:

5'-CCGGCAGGAACAGATTGCAAGACAACTCGAGTTGTCTTGCAATCTGTTCCTGTTTTTG-3', which is represented by SEQ ID NO. 5;

SOX628-b antisense strand:

5'-AATTCAAAAACAGGAACAGATTGCAAGACAACTCGAGTTGTCTTGCAATCTGTTCCTG-3', which is represented by SEQ ID NO. 6;

wherein CTCGAG is a loop sequence.

According to the invention, 3 interference sequences aiming at the chicken SOX5 gene are designed according to the mRNA sequence (NM-001004385) of the chicken SOX5 gene and the primer design principle of shRNA in a GenBank database (http:// www.ncbi.nlm.nih.gov/GenBank), and a universal negative control sequence is adopted as a control shRNA sequence expressed by the non-target SOX5 gene.

The 3 interfering sequences against the chicken SOX5 gene were named: SOX1312, SOX1635 and SOX628, the information of these three interference sequences is as follows:

SOX1312-a sense strand:

5'-CCGGCGGCAGATGAAGGAGCAACTTCTCGAGAAGTTGCTCCTTCATCTGCCGTTTTTG-3', which is shown in SEQ ID NO: 1; the sense strand of SOX1312-a is also the upstream primer corresponding to the interference sequence of SOX 1312;

SOX1312-b antisense strand:

5'-AATTCAAAAACGGCAGATGAAGGAGCAACTTCTCGAGAAGTTGCTCCTTCATCTGCCG-3', which is shown in SEQ ID NO. 2; the SOX1312-b antisense strand is also a downstream primer corresponding to the SOX1312 interference sequence;

CCGG (AgeI cleavage site) is added to the 5 'end of the sense strand of SOX1312-a, and AATTC (EcoRI cleavage site) is added to the 5' end of the antisense strand of SOX 1312-b.

SOX1635-a sense strand:

5'-CCGGGAGGAAGATCCTTCAAGCCTTCTCGAGAAGGCTTGAAGGATCTTCCTCTTTTTG-3', which is represented by SEQ ID NO. 3; the SOX1635-a sense strand is also an upstream primer corresponding to the SOX1635 interference sequence;

SOX1635-b antisense strand:

5'-AATTCAAAAAGAGGAAGATCCTTCAAGCCTTCTCGAGAAGGCTTGAAGGATCTTCCTC-3', which is represented by SEQ ID NO. 4; the SOX1635-b antisense strand is also a downstream primer corresponding to the SOX1635 interference sequence;

CCGG (AgeI restriction site) is added to the 5 'end of the SOX1635-a sense strand, and AATTC (EcoRI restriction site) is added to the 5' end of the SOX1635-b antisense strand.

SOX628-a sense strand:

5'-CCGGCAGGAACAGATTGCAAGACAACTCGAGTTGTCTTGCAATCTGTTCCTGTTTTTG-3', which is represented by SEQ ID NO. 5; the sense strand of SOX628-a is also the upstream primer corresponding to the interference sequence of SOX 628;

SOX628-b antisense strand:

5'-AATTCAAAAACAGGAACAGATTGCAAGACAACTCGAGTTGTCTTGCAATCTGTTCCTG-3', which is represented by SEQ ID NO. 6; the SOX628-b antisense strand is also the downstream primer corresponding to the SOX628 interference sequence.

CCGG (AgeI restriction site) is added to the 5 'end of the SOX628-a sense strand, and AATTC (EcoRI restriction site) is added to the 5' end of the SOX628-b antisense strand.

Information on control shRNA sequences is shown below:

control-a sense strand:

5'-CCGGTTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTTG-3', which is represented by SEQ ID NO: 7; the control-a sense strand is also an upstream primer corresponding to the control shRNA;

control-b antisense strand:

5'-AATTCAAAAATTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAA-3', which is represented by SEQ ID NO: 8; the control-b antisense strand is also the downstream primer corresponding to the control shRNA.

Conventionally annealing the designed interference sequence and a reference shRNA primer to synthesize a double strand to obtain an annealed fragment; double enzyme digestion of GV248 plasmid, the annealing segments are respectively connected with the GV248 vector after enzyme digestion; the ligation product is transformed into competent cells. And selecting a single colony for PCR and sequencing identification to obtain positive clone and plasmid.

The invention transfects the control and the tool vector plasmid GV248 carrying 3 interference genes, the virus packaging auxiliary plasmid (Helper 1.0) and the virus packaging auxiliary plasmid (Helper 2.0) into the chicken embryo fibroblast line respectively, and the results show that: the expression of the SOX5 gene can be obviously reduced by SOX628, SOX1635 and SOX1312, the interference effect of the SOX1312 is the best, and the expression level of the SOX5 gene in the chick embryo fibroblast cell line is reduced by 90%; the interference effect of the SOX1635 is the second time, so that the expression level of the SOX5 gene in the chick embryo fibroblast line is reduced by 80 percent; SOX628 reduced the expression of SOX5 gene by 62% in the chick embryo fibroblast cell line. Meanwhile, in the chick embryo fibroblast cell line transfected with SOX1312, cell proliferation was significantly arrested at 24h after transfection.

The results show that the SOX628, SOX1635 and SOX1312 designed by the invention can effectively inhibit the expression of the chicken SOX5 gene. Therefore, the invention also provides application of the shRNA sequence in inhibiting the expression of the chicken SOX5 gene.

On the other hand, the invention also provides a lentiviral expression vector, wherein the lentiviral expression vector contains the shRNA sequence for inhibiting the expression of the chicken SOX5 gene.

Further, the invention also provides a construction method of the lentivirus expression vector, which is characterized by comprising the following steps:

(1) respectively synthesizing a sense strand and an antisense strand of shRNA sequence for inhibiting the expression of the chicken SOX5 gene;

(2) mixing the sense strand sequence and the antisense strand sequence, and annealing to form double-stranded DNA with sticky ends;

(3) carrying out double enzyme digestion on the lentiviral vector to obtain a linearized lentiviral vector;

(4) and (3) connecting the double-stranded DNA in the step (2) with the linearized lentiviral vector in the step (3), transferring into escherichia coli competent cells, coating the escherichia coli competent cells on a plate containing antibiotics, and selecting a single clone on the plate for sequencing verification to construct the lentiviral expression vector.

In some embodiments of the invention, the lentiviral vector is a GV248 vector.

Furthermore, the invention also provides application of the lentiviral expression vector in inhibiting the expression of the chicken SOX5 gene.

Compared with the prior art, the invention has the following beneficial effects:

the invention reports shRNA sequence for inhibiting chicken SOX5 gene expression for the first time, and constructs a corresponding shRNA lentiviral expression vector. The three shRNA sequences (SOX 628, SOX1635 and SOX1312 respectively) can effectively reduce the expression quantity of the chicken SOX5 gene, and the inhibition efficiency at the gene level is respectively 62%, 80% and 90%. The shRNA for inhibiting the expression of the chicken SOX5 gene is constructed on a lentiviral vector and is suitable for in vivo and in vitro researches. Meanwhile, the method has important scientific significance and application prospect for deeply researching the functions of the chicken SOX5 gene and the like.

Drawings

FIG. 1 is a map of the GV248 vector in an example of the present invention;

FIG. 2 is a map of the cleavage electrophoresis of the Vector, wherein # 1: GV112 Vector, # 2: GV112 Vector cleaved with Age I and EcoRI, # 3: 1kb DNA L adder (bands: 10kb, 8kb, 6kb, 5kb, 4kb, 3.5kb, 3kb, 2.5kb, 2kb, 1.5kb, 1kb, 750bp, 500bp, 250bp from top to bottom);

FIG. 3 is a map of the pHelper 1.0 vector;

FIG. 4 is a map of the pHelper 2.0 vector;

FIG. 5 shows transfection of chicken embryo fibroblast cell lines with lentiviral packaging vectors; wherein, FIG. 5A shows the chicken embryo fibroblast cell line transfected with lentivirus packaging vector, and FIG. 5B shows the chicken embryo fibroblast cell line transfected with any lentivirus;

FIG. 6 shows the expression of SOX5 gene in chick embryo fibroblast cell line 72 hours after transfection of lentivirus expressing the interfering sequence;

FIG. 7 shows the proliferation of a chicken embryo fibroblast cell line transfected with the SOX1312 sequence.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is described in further detail below with reference to specific embodiments and accompanying drawings.

Example 1 preparation of RNAi lentivirus clones

(1) Three interfering sequences were designed against the sequence information (NM-001004385) of the chicken SOX5 gene in the GenBank database (http:// www.ncbi.nlm.nih.gov/GenBank), the sequence information being shown in Table 1.

TABLE 1

Name	5’	STEM	Loop	STEM	3’
						SOX628	CCGG	CAGGAACAGATTGCAAGACAA	CTCGAG	TTGTCTTGCAATCTGTTCCTG	TTTTTG
SOX1635	CCGG	GAGGAAGATCCTTCAAGCCTT	CTCGAG	AAGGCTTGAAGGATCTTCCTC	TTTTTG
						SOX1312	CCGG	CGGCAGATGAAGGAGCAACTT	CTCGAG	AAGTTGCTCCTTCATCTGCCG	TTTTTG
Control	CCGG	TTCTCCGAACGTGTCACGT	CTCGAG	ACGTGACACGTTCGGAGAA	TTTTTG

(2) Obtaining linearized vector by digestion with restriction endonucleases

Vector name of lentiviral vector of interest: GV248, vector map is shown in FIG. 1.

A50. mu. L enzyme digestion system was prepared according to Table 2 below, various reagents were sequentially added in the order listed, gently pipetted and mixed, centrifuged briefly, reacted at 37 ℃ for 3 hours or overnight, and the vector digestion product was subjected to agarose gel electrophoresis, see FIG. 2, to recover the bands.

TABLE 2

Reagent	Volume (mu L)
		ddH2O	41
10×cutsmart buffer	5
		Purified plasmid DNA (1. mu.g/. mu. L)	2
Age I(10U/μL)	1
		EcoRI	1
Total up to	50

(3) Viral vector construction framework

TABLE 3

And designing shRNA interference sequences according to the selected target sequences, and adding appropriate restriction enzyme cutting sites at two ends to complete vector construction. CCGG (AgeI cleavage site) was added to the 5 'end of the sense strand, AATTC (EcoRI cleavage site) was added to the 5' end of the antisense strand, G: complementary sequence of enzyme cutting site. In addition, a TTTTT termination signal was added to the 3 '-end of the sense strand, and a termination signal complementary sequence was added to the 5' -end of the antisense strand.

(4) Synthesis of Single-Strand primers

TABLE 4

NO.	Sequence(5’-3’)
		SOX628-a	CCGGCAGGAACAGATTGCAAGACAACTCGAGTTGTCTTGCAATCTGTTCCTGTTTTTG
SOX628-b	AATTCAAAAACAGGAACAGATTGCAAGACAACTCGAGTTGTCTTGCAATCTGTTCCTG
		SOX1635-a	CCGGGAGGAAGATCCTTCAAGCCTTCTCGAGAAGGCTTGAAGGATCTTCCTCTTTTTG
SOX1635-b	AATTCAAAAAGAGGAAGATCCTTCAAGCCTTCTCGAGAAGGCTTGAAGGATCTTCCTC
		SOX1312-a	CCGGCGGCAGATGAAGGAGCAACTTCTCGAGAAGTTGCTCCTTCATCTGCCGTTTTTG
SOX1312-b	AATTCAAAAACGGCAGATGAAGGAGCAACTTCTCGAGAAGTTGCTCCTTCATCTGCCG
		Control-a	CCGGTTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTTG
Control-b	AATTCAAAAATTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAA

(5) Annealing the primers to form double-stranded DNA

The synthesized pair primer dry powder is dissolved in annealing buffer solution, water bath is carried out at 90 ℃ for 15min, the mixture is naturally cooled to room temperature, and the pairing result is shown in table 4. The primer is annealed to form double-stranded DNA with a sticky end, and the double-stranded DNA with the sticky end and the two ends of the linearized cloning vector contain the same enzyme cutting sites.

(6) The annealed product is bonded to the carrier

The double-cut linearized vector and the annealed double-stranded DNA are ligated by T4DNA ligase, either at 16 ℃ for 1-3h, or overnight. The reaction system is shown in table 5 below.

TABLE 5

Reagent	Volume (mu L)
		Linearized vector (100 ng/. mu. L)	1
Double-stranded DNA (100 ng/. mu. L)	1
		10 × T4DNA ligase buffer	2
T4 DNA ligase	1
		ddH2O	15

(7) Transformation of

Adding 10 mu L ligation reaction product into 100 mu L competent cells, uniformly mixing under the number of the tube walls, placing on ice for 30min, performing heat shock at 42 ℃ for 90s, incubating in ice-water bath for 2min, adding 500 mu L L B culture medium, placing on a shaker at 37 ℃ for shaking culture for 1h, uniformly coating a proper amount of bacterial liquid on a flat plate containing antibiotics, and performing inverted culture in a constant temperature incubator for 12-16 h.

(8) Colony PCR identification

And (3) selecting single colonies on the plate for PCR identification, sequencing positive clones and analyzing results, preparing a reaction system, shaking and uniformly mixing, centrifuging for a short time, selecting single colonies into a 20 mu L identification system by using a sterile gun head in a super-clean workbench, blowing and uniformly mixing, and placing in a PCR instrument for reaction.

TABLE 6 PCR reaction System

Reagent	Volume (mu L)
		ddH2O	9.2
2×Taq Plus Master Mix	10
		Upstream primer (10. mu.M)	0.4
Downstream primer (10. mu.M)	0.4
		Single colony	-
Total	20

TABLE 7 PCR reaction conditions

(8) According to the PCR result, the identified positive clone transformant is inoculated in L B liquid culture medium containing ampicillin, cultured for 12-16h at 37 ℃, and an appropriate amount of bacterial liquid is taken for sequencing verification.

(9) Plasmid extraction

Transferring the correctly sequenced bacterium liquid into 10m L liquid medium containing L B ampicillin, culturing at 37 ℃ overnight, and performing plasmid extraction by using a small-extraction medium-amount kit of Tiangen endotoxin-free plasmid, wherein the detailed steps are as follows:

1. collecting overnight cultured bacteria liquid in a marked 5m L centrifuge tube, centrifuging at 12000rpm for 2min, and collecting bacteria;

2. discarding the supernatant, adding 250 mu L cell resuspension, and fully oscillating to make the bacterium block uniformly suspended;

3. adding 250 μ L cell lysate, adding 10 μ L proteinase K, reversing for 5-6 times, mixing, standing for 1-2min to allow thallus to be lysed and clarified;

4. adding 350 μ L neutralizing solution, turning upside down, mixing to completely separate out protein, and standing in ice bath for 5 min;

5.10000rpm for 10min, discarding protein, collecting supernatant in another clean sterile 1.5m L EP tube;

centrifuging at 6.12000rpm for 5min while preparing labeled recovery column, transferring supernatant into the recovery column, centrifuging at 12000rpm for 1min, and discarding lower layer waste liquid;

7. adding a rinsing liquid prepared in advance with the speed of 600 mu L, centrifuging at 12000rpm for 1min, discarding the lower layer waste liquid, repeating the steps, and performing idle separation at 12000rpm for 2min to further remove the residual rinsing liquid;

8. transferring the recovery column to a new 1.5m L EP tube in a super clean bench, standing for 10-20min, and naturally drying;

9. adding 95 mu L nucleic-Free Water into the recovery column, standing for 2min, centrifuging at 12000rpm for 2min, collecting the sample, numbering, electrophoresing, measuring the concentration, and performing quality inspection.

Example 2 Lentiviral packaging and quality testing

Viral packaging involves a total of three plasmids, respectively, the tool vector plasmid GV248 (see example 1), the viral packaging Helper plasmid (Helper 1.0) and the viral packaging Helper plasmid (Helper 2.0) carrying the target sequence, as shown in FIGS. 3 and 4, respectively.

1. Preparation of plasmids

Three kinds of plasmid DNA in a lentivirus packaging system are extracted by a plasmid extraction kit of Qiagen company, the plasmid DNA is dissolved in sterilized TE, and the concentration and the purity of the plasmid DNA are determined by an ultraviolet absorption method, so that the A260/A280 of the improved plasmid DNA is ensured to be between 1.8 and 2.0.

2. Plasmid transfection and lentivirus harvesting

(1) 24h before transfection, 293T cells in the logarithmic growth phase were trypsinized and cell density was adjusted to about 5 × 10 in medium containing 10% serum⁶Cells/15 m L, reseeded in 10cm diameter cell culture dish, 37 deg.C, 5% CO₂Culturing in an incubator. The cell is used for transfection when the cell density reaches 70-80% after 24 hours;

(2) replacing the medium with a serum-free medium 2h before transfection;

(3) adding the prepared DNA solutions (20 μ g of GV vector plasmid, 15 μ g of pHelper 1.0 vector plasmid, and 10 μ g of pHelper 2.0 vector plasmid) into a sterilized centrifuge tube, mixing uniformly with Gicky transfection reagent with different volumes, adjusting the total volume to 1m L, and incubating at room temperature for 15 min;

(4) the mixed solution is slowly dripped into 293T cell culture solution, mixed evenly and treated at 37 ℃ with 5% CO₂Culturing in a cell culture box;

(5) culturing for 6h, discarding the culture medium containing the transfection mixture, adding 10m of L PBS solution for washing once, gently shaking the culture dish to wash the residual transfection mixture, and then pouring out;

(6) cell culture medium 20m L containing 10% serum was slowly added at 37 deg.C with 5% CO₂Culturing in the incubator for 48-72 h.

3. Lentiviral concentration and purification

(1) Collecting 293T cell supernatant 48h after transfection (which can be counted as 0h after transfection) according to cell states;

(2) centrifuging at 4000g for 10min at 4 deg.C to remove cell debris;

(3) the supernatant was filtered through a 0.45 μm filter into a 40m L ultracentrifuge tube;

(4) respectively balancing samples, putting the ultracentrifuge tubes with virus supernatant into a Beckman ultracentrifuge one by one, centrifuging at 25000rpm for 2h, and controlling the centrifugation temperature at 4 ℃;

(5) after centrifugation is finished, removing supernatant, removing liquid remained on the tube wall, adding virus preservation solution (which can be replaced by PBS (phosphate buffer solution) for cell-stopping culture medium), and lightly and repeatedly blowing and resuspending;

(6) after full dissolution, centrifuging at high speed 10000rpm for 5min, and taking and packaging the supernatant;

(7) preparing a sample to be detected.

4. Lentiviral quality detection

① physical index detection

1) And (3) color judgment: judging by naked eyes, wherein the lentivirus preservation solution is in a pink clear liquid state;

2) determining viscosity by slowly absorbing 50 μ L slow virus preservation liquid by using a 20-200 μ L pipette without obvious viscous feeling or liquid absorption hysteresis;

② sterility testing

The virus is added into 293T cells for verification, microscopic examination is carried out after normal culture is carried out for 24h, the condition of any bacteria and fungus pollution is avoided, meanwhile, no obvious particles exist in cell gaps according to an empty cell group, and a culture medium is clear and transparent.

③ Titer assay

1) The day before the measurementUsing 293T adherent cell plating, 96-well plates, 4 × 10 per well⁴Individual cells, volume 100 μ L;

2) preparing 7-10 sterile EP tubes according to the expected titer of the virus, and adding 90 mu L serum-free medium into each tube;

3) adding 10 mu L of virus stock solution to be measured into a first tube, uniformly mixing, adding 10 mu L into a second tube, and continuing the same operation until the last tube;

4) selecting required cell holes, discarding 90 mu L culture medium, adding 90 mu L diluted virus solution, and culturing in an incubator;

5) after 24h, complete medium 100 μ L was added, carefully handled, without blowing up the cells;

6) after 4 days, the fluorescent expression was observed, and the number of fluorescent cells decreased with increasing dilution factor.

Example 3 Lentiviral infection of chick embryo fibroblast cell line

The lentiviral particles of the 3 shRNA recombinant lentiviruses and the control shRNA are transfected into a chicken embryo fibroblast cell line (DF-1), the cell expresses SOX5 gene, and the infection efficiency of different shRNAs is detected by using a fluorescence microscope technology.

(1) Grouping tests: the assay was divided into 5 groups, including those not transfected with any lentivirus (blank control), those transfected with the SOX628 interference sequence, those transfected with the SOX1635 interference sequence, those transfected with the SOX1312 interference sequence, and those transfected with the control non-targeting sequence (control), all of which had the same cell number and culture conditions.

(2) Cell infection test method comprises subjecting chicken embryo fibroblast cell line 1 × 10⁶Inoculating cells/well in 6-well plate, mixing, and adding 5% CO at 37 deg.C₂Culturing in incubator for 24 hr, changing to antibiotic-free culture medium after 24 hr, adding lentivirus into lentivirus stock solution at MOI of 10, adding Polybrene (Polybrene) with final concentration of 0.5 μ g/m L to promote lentivirus infection, and culturing at 37 deg.C with 5% CO₂Culturing for 6h under the condition, replacing the culture medium, and then continuously culturing for 96 h.

(3) 48h after cell infection, the cells were observed and photographed using a fluorescence microscope, while the total cells were observed and photographed using a bright field. As shown in FIG. 5, the infection efficiency of each group of cells at 48h was more than 70%. The above shows that the lentiviruses containing three designed interference sequences and a control sequence can effectively infect the chicken embryo fibroblast cell line.

Example 4 inhibition of SOX5 Gene expression in Chicken embryo fibroblast cell line by recombinant lentivirus

The effect of three shRNAs on the expression level of SOX5 gene in the chicken embryo fibroblast cell line was detected by real-time PCR.

(1) Grouping tests: the assay was divided into 5 groups, including those not transfected with any lentivirus (blank control), those transfected with the SOX628 interference sequence, those transfected with the SOX1635 interference sequence, those transfected with the SOX1312 interference sequence, and those transfected with the control non-targeting sequence (control), all of which had the same cell number and culture conditions.

(2) RNA extraction and Real-time PCR detection, namely after cells are infected for 72 hours, adopting TrizolA + to crack the cells, adopting a chloroform-isopropanol method to extract total RNA of each group of cells, and carrying out reverse transcription on the extracted mRNA into cDNA under the condition that the temperature is 37 ℃ for 60min, taking the cDNA of each group of cells as a template, taking β -actin as an internal reference, and adopting Real-time PCR to detect the expression of the SOX5 gene.

As shown in fig. 6, all three shRNA sequences showed inhibition of SOX5 gene expression in chicken embryo fibroblasts, SOX628, SOX1635 and SOX1312 were able to significantly reduce SOX5 gene expression compared with non-targeted control sequences, wherein SOX1312 interfered the best, and inhibition efficiency at gene level was 62%, 80% and 90%, respectively.

Example 5 Effect of SOX1312 inhibiting expression of SOX5 Gene on chick embryo fibroblast proliferation

The CCK8 kit is adopted to detect the cell number of the chicken embryo fibroblasts at different time to measure the influence of the SOX1312 inhibiting the expression of the SOX5 gene on the proliferation of the chicken embryo fibroblasts, and the specific method is as follows:

at 2 × 10⁴The number of cells per well was seeded in 96-well plates, 10 wells per group,spreading 6 plates in total, and standing at 37 deg.C with 5% CO₂Culturing in an incubator. After 24h, each plate of chick embryo fibroblasts was infected with a lentivirus transfected with an SOX1312 interference sequence and a lentivirus transfected with a control non-targeting sequence, and the number of cells was measured at 0h, 24h, 48h, 72h and 96h after infection by using a CCK8 kit, and the results are shown in FIG. 7. Cell proliferation was found to be significantly arrested at 24h post-transfection in the test group compared to the control group.

From the above, the invention reports the shRNA sequence for inhibiting the expression of the chicken SOX5 gene for the first time, and constructs the corresponding shRNA lentiviral expression vector. The three shRNA sequences (SOX 628, SOX1635 and SOX1312 respectively) can effectively reduce the expression quantity of the chicken SOX5 gene, and the inhibition efficiency at the gene level is respectively 62%, 80% and 90%. The shRNA for inhibiting the expression of the chicken SOX5 gene is constructed on a lentiviral vector and is suitable for in vivo and in vitro researches. Meanwhile, the method has important scientific significance and application prospect for deeply researching the functions of the chicken SOX5 gene and the like.

Those of ordinary skill in the art will understand that: the discussion of any embodiment above is meant to be exemplary only, and is not intended to intimate that the scope of the disclosure, including the claims, is limited to these examples; within the idea of the invention, also technical features in the above embodiments or in different embodiments may be combined and there are many other variations of the different aspects of the invention as described above, which are not provided in detail for the sake of brevity. Therefore, any omissions, modifications, substitutions, improvements and the like that may be made without departing from the spirit and principles of the invention are intended to be included within the scope of the invention.

Sequence listing

<110> Beijing animal husbandry and veterinary institute of Chinese academy of agricultural sciences

<120> shRNA sequence for inhibiting chicken SOX5 gene expression and application thereof

<130>FI180097

<160>8

<170>PatentIn version 3.5

<210>1

<211>58

<212> Artificial sequence

<223> SOX1312-a sense chain

<400>1

ccggcggcag atgaaggagc aacttctcga gaagttgctc cttcatctgc cgtttttg 58

<210>2

<211>58

<212> Artificial sequence

<223> SOX1312-b antisense strand

<400>2

aattcaaaaa cggcagatga aggagcaact tctcgagaag ttgctccttc atctgccg 58

<210>3

<211>58

<212> Artificial sequence

<223> SOX1635-a sense chain

<400>3

ccgggaggaa gatccttcaa gccttctcga gaaggcttga aggatcttcc tctttttg 58

<210>4

<211>58

<212> Artificial sequence

<223> SOX1635-b antisense strand

<400>4

aattcaaaaa gaggaagatc cttcaagcct tctcgagaag gcttgaagga tcttcctc 58

<210>5

<211>58

<212> Artificial sequence

<223> SOX628-a sense strand

<400>5

ccggcaggaa cagattgcaa gacaactcga gttgtcttgc aatctgttcc tgtttttg 58

<210>6

<211>58

<212> Artificial sequence

<223> SOX628-b antisense strand

<400>6

aattcaaaaa caggaacaga ttgcaagaca actcgagttg tcttgcaatc tgttcctg 58

<210>7

<211>54

<212> Artificial sequence

<223> control-a sense Strand

<400>7

ccggttctcc gaacgtgtca cgtctcgaga cgtgacacgttcggagaatt tttg 54

<210>8

<211>57

<212> Artificial sequence

<223> control-b antisense strand

<400>8

aattcaaaaa ttctccgaac gtgtcacgtt ctcttgaaac gtgacacgtt cggagaa 57

Claims (6)

1. An shRNA sequence for inhibiting the expression of chicken SOX5 gene, which is characterized by comprising a sense strand and an antisense strand, wherein the sequences of the sense strand and the antisense strand are shown as follows:

SOX1312-a sense strand:

5'-CCGGCGGCAGATGAAGGAGCAACTTCTCGAGAAGTTGCTCCTTCATCTGCCGTTTTTG-3', which is represented by SEQ ID NO: 1;

SOX1312-b antisense strand:

5'-AATTCAAAAACGGCAGATGAAGGAGCAACTTCTCGAGAAGTTGCTCCTTCATCTGCCG-3', which is represented by SEQ ID NO. 2;

wherein CTCGAG is a loop sequence.

2. An shRNA sequence for inhibiting the expression of chicken SOX5 gene, which is characterized by comprising a sense strand and an antisense strand, wherein the sequences of the sense strand and the antisense strand are shown as follows:

SOX1635-a sense strand:

5'-CCGGGAGGAAGATCCTTCAAGCCTTCTCGAGAAGGCTTGAAGGATCTTCCTCTTTTTG-3', which is represented by SEQ ID NO. 3;

SOX1635-b antisense strand:

5'-AATTCAAAAAGAGGAAGATCCTTCAAGCCTTCTCGAGAAGGCTTGAAGGATCTTCCTC-3', which is represented by SEQ ID NO. 4.

3. An shRNA sequence for inhibiting the expression of chicken SOX5 gene, which is characterized by comprising a sense strand and an antisense strand, wherein the sequences of the sense strand and the antisense strand are shown as follows:

SOX628-a sense strand:

5'-CCGGCAGGAACAGATTGCAAGACAACTCGAGTTGTCTTGCAATCTGTTCCTGTTTTTG-3', which is represented by SEQ ID NO: 5;

SOX628-b antisense strand:

5'-AATTCAAAAACAGGAACAGATTGCAAGACAACTCGAGTTGTCTTGCAATCTGTTCCTG-3', which is represented by SEQ ID NO. 6.

4. A lentiviral expression vector comprising the shRNA sequence for inhibiting the expression of the chicken SOX5 gene according to any one of claims 1 to 3.

5. A method of constructing the lentiviral expression vector of claim 4, comprising the steps of:

(1) respectively synthesizing a sense strand and an antisense strand of shRNA sequence for inhibiting the expression of the chicken SOX5 gene;

(2) mixing the sense strand sequence and the antisense strand sequence, and annealing to form double-stranded DNA with sticky ends;

(3) carrying out double enzyme digestion on the lentiviral vector to obtain a linearized lentiviral vector;

(4) and (3) connecting the double-stranded DNA in the step (2) with the linearized lentiviral vector in the step (3), transferring into escherichia coli competent cells, coating the escherichia coli competent cells on a plate containing antibiotics, and selecting a single clone on the plate for sequencing verification to construct the lentiviral expression vector.

6. The method of claim 5, wherein the lentiviral vector is a GV248 vector.

Images