CN105200059B - The siRNA of targeted inhibition mouse UCP2 gene expressions and its structure of expression vector - Google Patents
The siRNA of targeted inhibition mouse UCP2 gene expressions and its structure of expression vector Download PDFInfo
- Publication number
- CN105200059B CN105200059B CN201510684316.1A CN201510684316A CN105200059B CN 105200059 B CN105200059 B CN 105200059B CN 201510684316 A CN201510684316 A CN 201510684316A CN 105200059 B CN105200059 B CN 105200059B
- Authority
- CN
- China
- Prior art keywords
- neural stem
- ucp2
- sirna
- shrna
- gene expressions
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to the RNA interference recombinant lentivirus vectors and its structure of targeted inhibition mouse neural stem cells UCP2 gene expressions, it is the recombined lentivirus vector pNL EGFP/CMV/WPREdU3 sh mUCP2 constructed for mouse neural stem cells UCP2 genes, second generation slow virus packaging plasmid pCD/NL BH*DDD and memebrane protein expression plasmid pLTR G cotransfection 293T cells are combined with the recombined lentivirus vector again, obtain the recombined lentivirus vector of the packaging.With the primary neural stem cell of recombined lentivirus vector transfected that the present invention obtains, it efficiently specificity can inhibit mouse neural stem cells UCP2 gene expressions, good experiment basis is established for the further functional study in relation to mouse UCP2 genes.
Description
Technical field
The invention belongs to technical field of bioengineering, are related to a kind of RNAi weights for mouse neural stem cells UCP2 genes
The structure of group Lentiviral and the expression vector.Recombinant slow virus of the present invention can be applied to neural tube malformation
In the research of pathogenesis.
Background technology
Neural tube malformation (Neural Tube Defects, NTDs) refers to central nervous system for main site of pathological change
Congenital birth defect disease, Shanxi Province of China incidence highest, statistical result is up to 19.9 ‰.The high discovery of NTDs as,
The main reason for as many countries and regions baby lifelong disabilities in the whole world with death.
The closing process of nerve channel is adjusted by the stringent control of gene and environmental factor.According to applicant's grinding in recent years
Study carefully result and literature search, uncoupling protein-3 (uncoupling protein 2, UCP2) and the relationship of neural tube malformation exist
Preliminary related conclusions have been obtained in census of population's research, and it is the candidate gene of NTDs to prompt UCP2 genes.Based on above-mentioned knot
By applicant's mouse neural stem cells to be utilized prove that it occurs for UCP2 and NTDs (closer to body early embryo nerve solencyte)
Between contact, and explore its mechanism for causing neural tube malformation.Neural stem cell is a kind of to be difficult to transfect using conventional method
Cell, therefore be badly in need of meeting the research of subsequent experimental using a kind of higher method of transfection efficiency.Above-mentioned technology platform is built
It is vertical, it will thus provide a UCP2 gene functional research model, and play a significant role in follow-up mechanism research.But at present for small
The siRNA of mouse neural stem cell UCP2 genes yet there are no research report.
RNA interference (RNAi) is expressed using the internal specific gene of efficient, the special blocking of double-stranded RNA, and purpose base is promoted
The process of producer silence due to mRNA degrades.RNAi is in initial period, and (electricity turns, virus infects etc.) introduces in various ways
Double-stranded RNA (dsRNA) the small molecules interference RNA segment (siRNA) of 21~23nt is gradually cut by Dicer enzymes.SiRNA is bis-
Chain is combined to form RNA induction silencing complex (RISC) with ribozyme compound, and siRNA is denaturalized in RISC, and positive-sense strand is detached from, antisense
Chain induces target mrna degradation still on the compositions and RISC being guided to be combined with homologous target RNA, to blocking gene table
It reaches.SiRNA is also used as a kind of special primer, under the RNA polymerase effect that RNA is relied on, is closed by template of said target mrna
At dsRNA molecules, the latter can enter above-mentioned cycle again.The dsRNA of new life synthesizes and degrades repeatedly, is constantly formed newly
SiRNA makes said target mrna constantly reduce, and leads to target gene silence, and RNAi phenomenons are presented.
SiRNA is the main effects object of RNA interference.So far mammal cell RNA i technology paths can pass through two kinds of sides
Formula carries out：1) siRNA fragment for directly preparing 21~23nt, mammalian cell is transferred to by siRNA.2) by short hairpin
The DNA expression vectors of RNA (shRNA) are transferred to cell, and expression generates shRNA, siRNA is obtained after Dicer is cut.The former is not
Suitable for prolonged research project, and the latter's sustainable long period, be conducive to subsequent experiment and carry out.
The effect of RNAi inhibition of gene expression is largely limited by rotaring transfecting mode, transfection efficiency, is solved the problems, such as
Key be the suitable vectors into cells of selection.At present there are three types of the lead-in modes of siRNA, 1) siRNAs turns of chemical synthesis
Dye interference, 2) shRNA siRNA expression vectors, 3) viral vectors method.First two method efficiency of infection is low, in particular for liposome
The cell of interference effect difference, such as neural stem cell.
Slow virus carrier is the gene therapy vector to be grown up based on HIV-1, to dividing cell and nondividing
Cell all has infection ability, is widely used at present in the research for expressing RNAi.With plasmid vector and other viral vectors
It compares, the RNA interference of lentivirus mediated has the characteristics that efficient, stable, high specificity.
Invention content
The object of the present invention is to provide a kind of siRNA of targeted inhibition mouse neural stem cells UCP2 gene expressions.
It is a further object of the present invention to provide a kind of RNA of targeted inhibition mouse neural stem cells UCP2 gene expressions interference
Recombined lentivirus vector, effectively to inhibit the expression of UCP2 genes in mouse primary neural stem cell.
The siRNA of targeted inhibition mouse neural stem cells UCP2 gene expressions of the present invention has Seq ID No.1 institutes
The nucleotide sequence shown, is denoted as LVT818.
The present invention is according to the siRNA sequence of above-mentioned design, and the DNA profiling for having synthesized two coding shRNA is single-stranded, the volume
The single-stranded DNA profiling of code shRNA is respectively with the positive-sense strand of nucleotide sequence shown in Seq ID No.2 and with Seq ID
The antisense strand of nucleotide sequence shown in No.3, by 5 ' glutinous end+19nt target sequences+loop-stem structure+target sequence complementary series+transcriptions
Termination site+3 ' stick end structure composition.
LVT818-1 (positive-sense strand)：
5’-CcggCCTAATGGCTGCCTACCAAcTCAAGAGATTGGTAGGCAGCCATTAGGTTTTTTg-3’。
LVT818-2 (antisense strand)：
5’-aattcaaaaaaCCTAATGGCTGCCTACCAATCTCTTGAgTTGGTAGGCAGCCATTAGG-3’。
It is the second of itself inactivation the present invention also provides the RNA interference recombinant lentivirus vectors comprising the shRNA
The carrier pNL-EGFP/CMV/ built after the shRNA is connected for the multiple cloning sites of slow virus carrier pMagic 4.1
WPREdU3-sh mUCP2。
Specific construction method is that the single-stranded annealing of DNA of the coding shRNA is formed double chain DNA fragment, is connected to
In the multiple cloning sites of pMagic4.1 slow virus carriers (Shanghai sbo-bio companies), recombined lentivirus vector pNL- is built
EGFP/CMV/WPREdU3-sh mUCP2, then with recombined lentivirus vector joint second generation slow virus packaging plasmid pCD/
NL-BH*DDD and memebrane protein expression plasmid pLTR-G (being purchased from Addgene) cotransfection 293T cells, obtain the weight of the packaging
Group slow virus carrier.
Wherein, in the construction method, be the DNA fragmentation end introduce withAge IWithEcoR IDigestion carrier
The glutinous end that site is connected, and withAge IWithEcoRIDigestion pMagic4.1 carriers, recycling large fragment and the double-stranded DNA
Segment is ligated and transformed into competence bacteria, picking recombinant clone.
RNA interference recombinant lentivirus vectors constructed by the present invention can be applied to inhibit mouse neural stem cells UCP2 bases
Because in expression, effectively to inhibit UCP2 gene expressions in neural stem cell.
The present invention provides a kind of siRNA sequences for capableing of specific silence mouse UCP2 genes, pass through in-vitro transfection reality
Verification is real, which can effectively inhibit the UCP2 gene expressions in mouse primary neural stem cell.The present invention is further built
It can stablize the recombined lentivirus vector for expressing above-mentioned siRNA sequence, and be produced with high infection rate in 293T cells
The recombinant slow virus.It is tested by In vivo infection, the recombinant slow virus energy of high efficiency stable expression UCP2 gene shRNA sequences
Enough UCP2 gene expressions for obviously inhibiting primary neural stem cell.The studies above result is further to study UCP2 genes in nerve
Effect in pipe deformity generating process provides cell model.
4.1 carriers of pMagic that the present invention uses contain U6 promoters, can have interference by continuous expression in host cell
The tiny RNA of effect.Meanwhile the plasmid can express the fluorescin EGFP driven by CMV promoter, turn when virus being facilitated to pack
The detection of efficiency of infection when contaminating efficiency, and infecting host cell.The second generation slow virus packaging plasmid pCD/ that the present invention uses
NL-BH*DDD and memebrane protein expression plasmid pLTR-G provides the enzyme and albumen needed for virus packaging.By the above carrier cotransfection
293T cells can efficiently assemble the slow virus carrier of itself inactivation.It is not necessarily to infective gland using helper plasmid packaging virus
Virus, and only use the output that two plasmids just improve transfection efficiency and carrier.
Compared with chemically synthesized siRNA and the shRNA built based on transient expression vector, slow virus structure is utilized
ShRNA carriers have the following advantages：On the one hand it can expand and substitute transient expression vector use, can be inserted after being transferred to target cell
In host cell gene group and stablize expression, will not cause to be inserted into inactivation；On the other hand, which can be used for infecting tradition
Transfection reagent is difficult to for example primary neural stem cell of the non-dividing cell system transfected, and can be integrated into after infection infected thin
The genome of born of the same parents carries out prolonged stablize and expresses, and the transfection experiment of other traditional forms early period is all unable to reach expected mesh
Mark.The present invention by target gene be integrated into target cell gene group leader's time-histories expression, immune response it is small, be a kind of more satisfactory use
In importing neural stem cell, it to be used for the interference carrier of UCP2 genes silence in neural stem cell.
The present invention carries the DNA profiling of UCP2 RNA interference fragments using inactivation slow virus carrier, is transcribed into vivo
ShRNA perfectly solves the problems, such as targeting, safety and the expression duration of RNA interference.
Description of the drawings
Fig. 1 is the structural schematic diagram of 4.1 slow virus carriers of pMagic.
Fig. 2 is the fluorescence microscopy result of virus infection neural stem cell.
Fig. 3 is that virus infects the design sketch interfered mouse UCP2 gene mRNA expressions after neural stem cell 72h.
Fig. 4 is the albumen Western-blot testing results to mouse UCP2 genes after virus infection neural stem cell 72h.
Fig. 5 is the albumen Western-blot testing results to mouse UCP2 genes after virus infection neural stem cell 72h
Gray value scans.
Specific implementation mode
Below in conjunction with drawings and examples, the present invention is described in further detail.
Embodiment 1：Design the siRNA sequence of targeted inhibition mouse UCP2 gene expressions.
According to the mRNA sequence of mouse neural stem cells UCP2 genes（NM_011671）, one group of design is for mUCP2 genes
The siRNA sequence and control siRNA sequence of expression, and a best siRNA sequence of interference effect is therefrom filtered out, it is named as
LVT818。
Specific siRNA sequence is as follows, and wherein LVT818 is effective interference fragment group, and LVT4 is negative control group.
LVT818：5’-CCTAATGGCTGCCTACCAA-3’；GC52.6%.
LVT4：5’-TTCTCCGAACGTGTCACGT-3’；GC52.6%.
Embodiment 2：The design and synthesis of oligonucleotides.
With the positive-sense strand and antisense strand of the siRNA sequence design synthesis shRNA that above-described embodiment 1 designs.In the shRNA
Loop structures selected " cTCAAGAGA " and " TCTCTTGAg ", and added respectively at 5 ' endsAge IWithEcoR IDigestion position
The glutinous end of point, by Invitrogen companies composition sequence, specific shRNA sequences are as follows.
LVT818-1（Positive-sense strand）：
5’-CcggCCTAATGGCTGCCTACCAAcTCAAGAGATTGGTAGGCAGCCATTAGGTTTTTTg-3’。
LVT818-2（Antisense strand）：
5’-aattcaaaaaaCCTAATGGCTGCCTACCAATCTCTTGAgTTGGTAGGCAGCCATTAGG-3’。
LVT4-1（Positive-sense strand）：
5’-CcggTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTg-3’。
LVT4-2（Antisense strand）：
5’-aattcaaaaaTTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAA-3’。
After above-mentioned synthetic shRNA sequences are dissolved into 20 μM with oligo annealing buffer, complementary single strand
Respectively take 30 μ l mixing, 95 DEG C of heating water baths 5 minutes are cooled to room temperature, form double-strand oligo segments naturally.Take production of annealing described in 1 μ l
Object is reacted for subsequent connection, remaining -20 DEG C preservations.
Embodiment 3：The structure of the interference slow virus carrier of targeted inhibition mouse UCP2 gene expressions.
The structural schematic diagram of slow virus carrier pMagic 4.1 such as Fig. 1.The carrier contains U6 promoters, can be thin in host
Persistently starting downstream gene expression and continuous expression in born of the same parents has the tiny RNA of interference effect.The carrier also contains CMV promoter, energy
Enough expression of driving fluorescin EGFP, facilitate the detection of transfection efficiency and efficiency of infection.
WithAge IWithEcoR IDouble digestion slow virus carrier pMagic 4.1 makes its linearisation use T4 after glue purification recycling
Ligase is connect overnight with 16 DEG C of the annealed product of embodiment 2, transformed competence colibacillus bacterium, picking recombinant clone, inverted sieve
After choosing, Invitrogen companies is sent to carry out sequencing identification.
（Positive colony sequencing result）
ATAGAAAATATTTGACTGTAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGT
TTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCT
TTATATATCTTGTGGAAAGGACGAAACACCGGCCTAATGGCTGCCTACCAACTCAAGAGATTGGTAGGCAGCCATTA GGTTTTTTGAATTCGGATCCATTAGGCGGCCGCGTGGATAACCGTATTACCGCCATGCATTAGTTATTAATAGTAAT
CAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGC
TGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCA
TTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGC
CCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACT
TGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATA
GCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAAC
GGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTAT
ATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGCGCTACCGGACGCCACCATGGTGAGCAAAGGGCGAGGA
GCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAACGGCCACAAGTTCAGCGTGTCCGGCGA
GGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACACGGGCAAGCTGCCCGTGCCCTGACC
ACCCTCGTGACCACCCTGACTACGGCGGTGCAGTGCTTCAGCCGCTACCCGACACATGAGCAGCACGACTTCTCAGT
CGCATGCCCGAAGCTACGTCCAGGGAGCGCACCATCTTCTTCAGGACGACGGCCAACATACAGAACCGCGCTCAAGG
TGAAGCTCCAAGGTCCCAACACCTGGGTGAACCGCCACTCTAGACGCTGAAGGGGGCACTCG。
（Compare cloning and sequencing result）
TCGGGCCGGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGA
AAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTG
AAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGTTCTCCGAACGTGTCACGTTTCA AGAGAACGTGACACGTTCGGAGAATTTTTGAATTCGGATCCATTAGGCGGCCGCGTGGATAACCGTATTACCGCCAT
GCATTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTT
ACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGT
AACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAG
TGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATG
ACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCA
GTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTT
TGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGG
CGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTACTGAACTGTCAGATCCCGCTAGCGCTACAGACGACACC
ATGATGAGCCATGGCGAGGAGCTGATCACCGGGGTGTGCCCATCCTGTCTGACTGACTGCTACTAAACTGTCGACCA
CGTTCAGCGTGTCGGTCAGGCACAGGCGATGCCCTCCTACCGCTATGCTGACCCTGAG。
Sequencing result show with design sequence it is identical, acquisition it is correct clone as build successful targeted inhibition
The interference slow virus carrier of mouse UCP2 gene expressions, is named as pNL-EGFP/CMV/WPREdU3-sh mUCP2.
Embodiment 4：The packaging and titer determination of recombination interference slow virus carrier.
High-purity recombined lentivirus vector pNL-EGFP/CMV/WPREdU3-sh mUCP2 prepared by Example 3, joint
Second generation slow virus packaging plasmid pCD/NL-BH*DDD and memebrane protein expression plasmid pLTR-G (being purchased from Addgene) cotransfection
293T cells, concrete operation step are carried out according to 2000 operation instructions of Invitrogen companies Lipofectamine.
Prepare the 293T cells of 2 T10cm culture dishes in advance, culture medium DMEM+10%FBS, 1%Glutamax, 1% are green
Mycin-streptomysin.Cell is assigned in 10 10cm culture dishes, every bottle of cell density about 107It is a.It is checked under second clear water surface thin
Born of the same parents, cell fusion degree substantially 80~90%, are evenly distributed.
Cell plates are taken out in first 1 hour of transfection, remove original cell culture medium, and 9ml Opti-MEM culture mediums are added, will be thin
Born of the same parents send incubator back to.
Two sterile 15ml centrifuge tubes are taken, 100 μ g pNL-EGFP/CMV/WPREdU3-sh mUCP2 are added in one
Recombined lentivirus vector, 65 μ g pCD/NL-BH*DDD slow virus packaging plasmids and 35 μ g pLTR-G memebrane protein expression plasmids are used
Opti-MEM culture mediums polishing is to 5ml；500 μ l Trans-EZ solution and 4.5ml Opti-MEM culture mediums are added in another,
With electric pipettor gently mixing.
Trans-EZ dilutions are added drop-wise in plasmid pipe, side edged gently shake it is even, be incubated at room temperature 20 minutes, make DNA and
Trans-EZ is fully combined and is formed transfecting complexes.
1 5ml pipette is taken, obtained DNA-Trans-EZ complexs are dropped evenly in tissue culture plate, per plate
1ml.Culture plate is shaken back and forth, and 5% carbon dioxide incubator is put back into after mixing, cell conditioned medium is removed after 6 hours, is changed to
The DMEM complete mediums of 10ml.Cell is observed in transfection one day after, it can be seen that the cell more than 95% all carries fluorescence.It will be thin
Born of the same parents send incubator back to and continue culture 2 days, collect all supernatants, 4 DEG C, 4000g centrifuge 10 minutes, after removing cell fragment, with
0.45 μM of filter filtering supernatant, obtains the recombined lentivirus vector of packaging.
After the recombined lentivirus vector of the packaging is concentrated and purified, the slow virus carrier concentrate of high titre is obtained, point
- 80 °C of long-term preservations after dress, and take wherein one progress viral biology titer determination.
Embodiment 5：Target cell infects experiment and gene expression inhibition effect analysis.
1, mouse neural stem cells are infected with recombination interference slow virus carrier.
1）Mouse neural stem cells in good condition are chosen, the soft piping and druming of suction pipe makes cell disperse, is collected by centrifugation, uses cell
Cell count after culture solution is resuspended, it is 3 × 10 to adjust cell concentration4~5 × 104A/ml is added to 24 orifice plates by 90 holes μ l/
In, it places and is cultivated 24 hours in incubator.
2）Preparing the recombination that MOI values are 40 interferes slow virus carrier to dilute virus liquid, sucks the culture solution in 96 orifice plates, often
Hole is added 100 μ l and dilutes virus liquid, while setting up invalid interference fragment viral vectors dilution and empty viral vectors dilution, point
It Zuo Wei not negative control and blank control.
3）Removal contains virulent culture solution after 24 hours, and new culture solution is added and continues to cultivate, is being inverted after 72 hours
Judge transfection efficiency by observing GFP expression under fluorescence microscope.Fig. 2 is under the microscope of virus infection neural stem cell fluorescence
Observed result, due to containing green fluorescence protein gene on 4.1 carriers of pMAGic, it can be seen that 90% or more neural stem cell
For cell by viral vector infection, efficiency of infection is higher.Cell sample is collected, gained cell is (real-time for Real-time PCR
Quantitative PCR) and Western blot (western blot) detections.
2, the RT-QPCR detections of rear neural stem cell are infected.
Virus infection neural stem cell collects after 72 hours and is infected cell, and conventional Trizol methods extract cell RNA, inverse
Transcription obtains cDNA, and wherein M-MLV reverse transcriptases and dNTP is purchased from PROMEGA companies, and Oligo dT give birth to work purchased from Shanghai, specifically
Step is carried out according to the M-MLV operational manuals of Promega companies.
1）1.0 μ l Oligo dT (0.5 μ g/ μ l) and 2.0 μ g total serum IgEs are added in PCR tubules, DEPC-H is supplemented2O
It to 9 μ l, is centrifuged after mixing, 70 DEG C of warm bath 10min.It is immediately inserted into later into 0 DEG C of ice-water bath, Oligo dT and template is made to move back
Fire.
2）According to the form below ratio figures out required amount of reagent according to reaction tube.By the mixing on ice such as M-MLV enzymes, RT is obtained
Reaction solution.
3）11 μ l RT reaction solutions are added in each reaction tube, are centrifuged after mixing.
4）RT reactions are completed after being carried out 1 hour at 42 DEG C, and 70 DEG C of processing 10min, make RT enzymes inactivate later.
5）Obtained RT reaction products cDNA is used for PCR.
6）Real-time PCR detections.
Using β-actin genes as internal reference, detected using real-time fluorescence quantitative PCR：
（1）Primer sequence is as follows：
（2）By following proportional arrangement reaction system：
（3）Setting program is quantitative for two-step method Real-time, 95 DEG C of pre-degeneration 15S, later 95 DEG C of denaturation 5S of each step,
60 DEG C of annealing extend 30S, totally 45 cycles.Extending stage reading light absorption value every time.
The result shows that designed specific interference fragment can effectively inhibit UCP2 gene expressions, it is infected mouse Nerve
Stem cell UCP2 expression quantity is only 21% compareed, i.e. jamming rate is 79%, and concrete outcome is as shown in table 1 and Fig. 3, wherein pLVT4
To have transfected the groups of cells (negative control) of empty virus control, pLVT818 is transfected pLVT818 target spot viral supernatants thin
Born of the same parents' group.
Fig. 3 is after interfering slow virus carrier infecting mouse neural stem cell 72h with recombination, to mouse UCP2 gene mRNA tables
Up to the design sketch of interference.In figure, empty virus group is to have transfected the control group (blank control) of empty virus, and pLVT4 is transfection
The groups of cells (negative control) of pLVT4 virus controls, pLVT818 are the groups of cells for having transfected pLVT818 target spot viral supernatants
(positive group).It can be seen that infected mouse neural stem cells UCP2 gene mRNA expression amounts are only the 21% of blank control, that is, interfere
Rate is 79%.
3, Western-blot is detected.
Antibody information in this experiment.
72 hours after virus transfection, each experimental group total protein of cell, Western blot detections, UCP2 and β-are extracted
The gray level ratio of actin shows that inhibiting rate 75% illustrates that the plasmid inhibits the efficiency of UCP2 higher, as shown in Figure 4,5.
Fig. 4 is after virus infection neural stem cell 72h to UCP2 gene protein Western-blot testing results, 1 in figure
It is pLVT4 Viral interference negative control groups for empty virus control group, 2,3,4 be pLVT818 Viral interference groups, it is seen that the 4th group of egg
White band of expression significantly reduces.
Fig. 5 is after virus infection neural stem cell 72h to mouse UCP2 gene protein Western-blot testing results
Gray value scans.1 is empty virus control group in figure, and 2,3 be invalid interference group, and 4 be pLVT818 Viral interference groups.Gray scale scanning
It has been shown that, the 4th group of expression are interfered up to 75%.
Above-mentioned Fig. 3,4,5 can illustrate that pLVT818 Viral interferences group can be substantially reduced UCP2 in neural stem cell
Expression, pLVT818 are effective interference fragment.
SEQUENCE LISTING
<110>Mountain Western Medicine S University
<120>The siRNA of targeted inhibition mouse UCP2 gene expressions and its structure of expression vector
<160> 3
<170> Patentin version 3.2
<210> 1
<211> 21
<212> RNA
<213>Artificial sequence
<223>The siRNA of targeted inhibition mouse neural stem cells UCP2 gene expressions
<400> 1
CCTAATGGCT GCCTACCAA 19
<210> 2
<211> 58
<212> RNA
<213>Artificial sequence
<223>The positive-sense strand of the shRNA sequences of targeted inhibition mouse neural stem cells UCP2 gene expressions
<400> 2
CCGGCCTAAT GGCTGCCTAC CAACTCAAGA GATTGGTAGG CAGCCATTAG GTTTTTTG 58
<210> 3
<211> 58
<212> RNA
<213>Artificial sequence
<223>The antisense strand of the shRNA sequences of targeted inhibition mouse neural stem cells UCP2 gene expressions
<400> 3
AATTCAAAAA ACCTAATGGC TGCCTACCAA TCTCTTGAGT TGGTAGGCAG CCATTAGG 58
Claims (7)
1. a kind of siRNA of targeted inhibition mouse neural stem cells UCP2 gene expressions, the nucleotide sequence of the siRNA is such as
Shown in Seq ID No.1.
2. a kind of DNA of coding shRNA, the shRNA is positive-sense strand or antisense strand containing siRNA described in claim 1
shRNA。
3. a kind of RNA interference recombinant lentivirus vectors of targeted inhibition mouse neural stem cells UCP2 gene expressions, are at itself
After the DNA of shRNA described in the multiple cloning sites connection coding claim 2 of the second generation slow virus carrier pMagic 4.1 of inactivation
The carrier pNL-EGFP/CMV/WPREdU3-sh mUCP2 of structure.
4. the construction method of RNA interference recombinant lentivirus vectors described in claim 3 is that the DNA of the coding shRNA is single-stranded
Annealing forms double chain DNA fragment, is connected in the multiple cloning sites of pMagic4.1 carriers, structure recombined lentivirus vector pNL-
EGFP/CMV/WPREdU3-sh mUCP2, then with recombined lentivirus vector joint second generation slow virus packaging plasmid pCD/
NL-BH*DDD and memebrane protein expression plasmid pLTR-G cotransfection 293T cells, obtain the recombined lentivirus vector of the packaging.
5. the construction method of RNA interference recombinant lentivirus vectors according to claim 4 is at the end of the DNA fragmentation
End introduce withAge IWithEcoR IThe glutinous end that restriction enzyme site is connected.
6. the construction method of RNA interference recombinant lentivirus vectors according to claim 4, be withAge IWithEcoRIDigestion
PMagic4.1 carriers, recycling large fragment are ligated and transformed into competence bacteria, picking recombinant clone with the double chain DNA fragment.
7. RNA interference recombinant lentivirus vectors described in claim 3 are on inhibiting mouse neural stem cells UCP2 gene expressions
Using.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510684316.1A CN105200059B (en) | 2015-10-22 | 2015-10-22 | The siRNA of targeted inhibition mouse UCP2 gene expressions and its structure of expression vector |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510684316.1A CN105200059B (en) | 2015-10-22 | 2015-10-22 | The siRNA of targeted inhibition mouse UCP2 gene expressions and its structure of expression vector |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105200059A CN105200059A (en) | 2015-12-30 |
| CN105200059B true CN105200059B (en) | 2018-07-17 |
Family
ID=54948021
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510684316.1A Expired - Fee Related CN105200059B (en) | 2015-10-22 | 2015-10-22 | The siRNA of targeted inhibition mouse UCP2 gene expressions and its structure of expression vector |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105200059B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109055389B (en) * | 2018-08-08 | 2021-07-09 | 北京诺思兰德生物技术股份有限公司 | Recombinant plasmid carrying human glucagon-like peptide 1(7-36) gene |
| CN110951733A (en) * | 2019-11-27 | 2020-04-03 | 山西医科大学 | siRNA for targeted inhibition of esophageal cancer EGFL6 gene expression, constructed expression vector and application |
| CN113652428B (en) * | 2021-08-24 | 2023-09-22 | 南通大学 | Application of nuclear membrane protein knockout in stem cell transplantation |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7250289B2 (en) * | 2002-11-20 | 2007-07-31 | Affymetrix, Inc. | Methods of genetic analysis of mouse |
-
2015
- 2015-10-22 CN CN201510684316.1A patent/CN105200059B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN105200059A (en) | 2015-12-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106636090B (en) | SiRNA, recombinant expression CAR-T carrier and its construction method of human leukocyte interleukin 6 and application | |
| CN101307085B (en) | SiRNA and recombination lentivirus from preventing hepcidin from regulating protein and uses thereof | |
| CN107405357A (en) | Multiple shRNAs and its application | |
| CN105200059B (en) | The siRNA of targeted inhibition mouse UCP2 gene expressions and its structure of expression vector | |
| CN116284351A (en) | Preparation method of artificial antibody | |
| CN107523569A (en) | The purposes and its related drugs of PDCD1 genes | |
| CN104928292A (en) | Design method of sgRNA and lentivirus carrier formed by sgRNA and plasmids | |
| CN102206645B (en) | Mediating method of RNAi (ribonucleic acid interference) utilizing lentiviral vector | |
| CN103352052B (en) | Construction and application of multi-cistron double-label expression lentivirus vector | |
| CN105039342A (en) | siRNA capable of inhibiting MAT2A genetic expression and application of siRNA | |
| WO2020125576A1 (en) | Method for delivering gene in cells | |
| CN111235150B (en) | shRNA for inhibiting replication of African swine fever virus and application thereof | |
| CN106191118B (en) | A kind of slow virus interference carrier and its construction method and application | |
| CN108441496B (en) | shRNA sequence for inhibiting chicken SOX5 gene expression and application thereof | |
| CN109266684B (en) | Method for constructing animal model with pathogen infection sensitivity | |
| CN110951733A (en) | siRNA for targeted inhibition of esophageal cancer EGFL6 gene expression, constructed expression vector and application | |
| CN112618708A (en) | hACE2 knock-out RNA interference stem cell vector new corona vaccine | |
| CN102643860A (en) | Recombinant lentiviral vector aiming at hUHRF1 gene RNA (Ribonucleic Acid) interference and preparation thereof | |
| CN112646780A (en) | hACE2 knockout novel coronavirus gene silencing stem cell | |
| CN104745635B (en) | A kind of method of OASL genes in silence DF-1 cell lines | |
| Liu et al. | Design of lentivirally expressed siRNAs | |
| CN104357444A (en) | SiRNA for bovine trim5alpha gene silencing and application of siRNA | |
| CN116622652A (en) | Lentivirus for neuroblastoma gene therapy and preparation method and application thereof | |
| CN102643859A (en) | Recombinant lentiviral vector aiming at hNINL gene RNA (Ribonucleic Acid) interference and preparation thereof | |
| CN114181936B (en) | shRNA for inhibiting chicken CA13 gene expression and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20151230 Assignee: Shanxi Medical University Asset Management Co., Ltd Assignor: Shanxi Medial University Contract record no.: X2019980000611 Denomination of invention: SiRNA for targeted inhibition of mouse UCP2 gene expression and construction of expression vector thereof Granted publication date: 20180717 License type: Common License Record date: 20191115 |
|
| EC01 | Cancellation of recordation of patent licensing contract | ||
| EC01 | Cancellation of recordation of patent licensing contract |
Assignee: Shanxi Medical University Asset Management Co.,Ltd. Assignor: SHANXI MEDICAL University Contract record no.: X2019980000611 Date of cancellation: 20210422 |
|
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180717 Termination date: 20201022 |