CN104357444A - SiRNA for bovine trim5alpha gene silencing and application of siRNA - Google Patents
SiRNA for bovine trim5alpha gene silencing and application of siRNA Download PDFInfo
- Publication number
- CN104357444A CN104357444A CN201410539364.7A CN201410539364A CN104357444A CN 104357444 A CN104357444 A CN 104357444A CN 201410539364 A CN201410539364 A CN 201410539364A CN 104357444 A CN104357444 A CN 104357444A
- Authority
- CN
- China
- Prior art keywords
- sirna
- trim5
- cell
- gene
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention provides an interference method for bovine trim5alpha gene silencing, a siRNA sequence, a siRNA human lentivirus expression vector, a replication-defective human lentivirus and a human lentivirus infected MDBK (madin-darby bovine kidney) cell. RNAi and the siRNA human lentivirus expression vector effectively interfere with the expression of a bovine trim5alpha gene, and the gene expression of the human lentivirus vector in the MDBK cell is significantly improved. The siRNA provides the new technical support for research on bovine virus disease related gene functions and transgenic cattle breeding.
Description
Technical field
The invention belongs to cell biology, specifically, the present invention relates to a kind of ox trim5 α and lower the siRNA and application thereof that express.
Background of invention
Before RNA perturbation technique occurs, gene knockout (gene knockout) is main reverse genetics (reverse genetics) research means, but its technical difficulty is high, and complicated operation, the cycle is long.Due to RNA interference can utilize siRNA or SiRNA expression vector fast, economical, easy while there is again the sequence specificity of height, specific gene can be made specifically reticent, obtain afunction or lower mutant nucleotide sequence specific fashion and reject destination gene expression, become now the important research means exploring gene function.In functional genome research, need specific gene afunction or lower sudden change, to determine its function, therefore RNA interference can as the strong research tool of one, for the research of functional genome.
Large quantity research shows, different siRNA sequences for same target gene have different silence efficiencies, will filter out efficient siRNA sequence from the siRNA sequence with different silence efficiency, use RNAi technology more effectively silencing of target genes, the design of siRNA sequence is key link.Desirable siRNA sequence is generally searched in the position of siRNA sequence in target gene from the Nucleotide of 50 ~ 100, target gene initiator codon AUG downstream, the closer to 3 ' end of target gene, its Gene silencing efficacy may the better (.RNA such as McManus MT, 2002,8 (6): 842-850).Research in the past shows: the template not using sequence near 5 ' non-translational region (5 ' UTR) and 3 ' non-translational region (3 ' UTR) and initiator codon as design siRNA, Function protein binding site (as translation initiation complex) is contained in these regions, silencing complex (RISC) the competition binding siRNA sequence that Function protein can be induced with RNA, reduce RNAi effect .2002 such as (, 26 (2): 199-213) Elbashir SM; Also juncture area and single nucleotide polymorphism (SNP) region of exon and exon will be avoided.But also studies have found that, in 5 ' UTR, introduce stem-ring structure that is suppressed translation, mRNA transformation period .RNA such as (, 2001,7 (7): 1024-1033) Anthonisen IL can be changed like this.When there is base pairing in the sequence of 5 ' UTR, just can form hair fastener type or stem ring-type secondary structure.This class formation can stop the migration of small subunit ribosome, has cis resistance inhibitor action to translation initiation.Therefore use RNAi technology to act on 5 ' UTR or 3 ' UTR sequence, target gene silence (the .Genes Dev such as Doench JG, 2003,17 (4): 438-442 can be caused equally; The .Dev Cell such as Eckmann CR, 20023 (5): 697-710), these discoveries make the screening scope of siRNA sequence relate to non-coding region and the coding region of gene complete sequence.
The research strategy of three kinds of conventional at present RNAi is as follows: the first is that directly synthesis, for the siRNA of target gene, makes it to enter in cell by the method for transfection, participates in RNAi approach, plays the effect making target gene silence.Two is the plasmid expression vector transfectional cells building shRNA, generates shRNA, utilizes intracellular Dicer enzyme to generate corresponding siRNA, play RNAi effect at Intracellular transcription.Three is the virus expression carriers building shRNA, conventional virus vector has adenovirus carrier, gland relevant viral vector, lentiviral vectors etc., mechanism is similar to plasmid vector, make use of the feature that virus infected cell efficiency comparison is high, solves by the inefficient defect of plamid vector transfection.Utilize virus vector shRNA transfered cell, the U6 promotor in carrier guarantees that shRNA always expresses; This shRNA of being loaded with carrier can be passed in daughter cell and goes, thus makes the silence of gene can be hereditary.
To mammalian cell carry out transgenosis be gene function and gene therapy research in important step.Virus vector is widely used with advantages such as its high transfection efficiencies.Recombinant slow virus is the novel gene transfer vector in recent years progressively grown up, compare the advantage that other conventional virus vector is as unique in retrovirus, poxvirus etc. have, such as effectively can infect and presumptuously split phase cell, tool stable integration ability, (the .J Virol such as Joseph A such as cytotoxicity is low, immune response is little, 2008,82 (6): 3078-3089).Lentiviral vectors is developed to the third generation at present, in system stability and security etc., obtain large increase, demonstrate huge application potential (Niemann H, Kues WA.Reprod Fertil Dev, 2007,19 (6): 762-770.).Current slow virus is also widely used in the research of expressed rna i.Due to some cell type liposome transfection weak effect, transfer to the intracellular siRNA transformation period short, external synthesis siRNA is normally of short duration to the restraining effect of genetic expression, thus makes it apply and is subject to larger restriction.Adopt the carrier building in vitro in advance and can express siRNA, then the strategy of Intracellular transcription siRNA is transferred to, the cell category of the effective transfection of liposome is not only made to increase, and to gene expression inhibition effect also no less than external synthesis siRNA, in the cell of expression vector steady in a long-term, even can play the effect that long-term blocking gene is expressed.In constructed SiRNA expression vector, carry out guide RNA synthesize by RNA polymerase III promotor, this is because RNA polymerase III has clear and definite initial sum terminator sequence, and the RNA of synthesis can not be with poly A tail.When RNA polymerase III run into continuous 4 or 5 T time, its instruct transcribe and will stop, transcription product 3' hold formed 1-4 U.U6 and H1 RNA promotor is the promotor that two kinds of RNA polymerase III rely on, and is characterized in that promotor self element is all positioned at the upstream of transcriptional domain, is suitable for expressing 21ntRNA and 50ntRNA loop-stem structure (stem loop).In SiRNA expression vector, form justice and the antisense strand of siRNA, can be transcribed respectively by respective promotor, then two chain complementations combine and form siRNA; Also little hair fastener shape RNA (small hairpin RNA can directly be expressed by carrier, shRNA), carrier comprises the loop-stem structure sequence between RNA polymerase III promotor and 4-5 T translational termination site, namely can be folded into the loop-stem structure of the 3' overhang with 1-4 U after transcribing, in cell, be processed into siRNA further.Lentiviral vectors can produce the slow virus of the high titre expressing shRNA, periodically and aperiodicity cell, stem cell, zygote and differentiation progeny cell in express shRNA, realize the functional silence of genetic expression special and stable in polytype cell and transgenic mice, for studying gene function fast and efficiently in primary humans and animals cell tissue, and the animal producing specific gene expression reduction provides possibility.
Ox kidney passage cell (MDBK) is a kind of conventional cell studying virus infection propagation.The infection rate of MDBK cell to mouse N-type retrovirus and people 1 type HIV (Human immunodeficiency virus type) virus is extremely low, when infestation index MOI is 1, infect percentage less than 1% (Si, Z. .Proc.Natl.Acad.Sci.U.S.A.2006 is waited, 103 (19), 7454-7459), the direct liposome transfection efficiency of plasmid vector is also very low, cause the transfection efficiency of MDBK cell to the mouse N-type retrovirus of foreign gene-carrying and people 1 type HIV virus recombinant vectors low, foreign gene expression levels is low, the transgenosis MDBK cell Effective selection of foreign gene high level stably express is made to become the work of wasting time and energy.
Summary of the invention
TRIM (Tripartite motif) family protein has 3 conservative structural domains.These three structural domains are RING structural domain (RING domain), 1 or 2 B-box structural domains, a coiled-coil domain (Coiled-coil domain) from the order that N holds C to hold successively, in addition this family also has a variable C-end, and therefore TRIM family is also referred to as RBCC family.After TRIM (RBCC) protein family in 1991 first member XNF7 clone identification, current human genome has found and has identified nearly 70 TRIM protein member.Researchist is when foundation can be infected by HIV-1 and produce the animal model of pathogenic effects, Late Cambrian trim5 α (Stremlau M in the non-human primate monkey of old century in 2004, Deng .Nature, 2004,427:848-853.), in multiple primates strain as have also discovered the existence of TRIM5 gene in people, man like ape and new millennium monkey.As ox and rabbit also exist TRIM5 gene in other mammal line.TRIM5 gene has multiple alternative splice forms (TRIM5 α, β, γ, δ, ε etc.), trim5 α is one the longest in various spliceosome, is that wherein unique C end has the spliceosome of B30.2 (PRYSPRY) structural domain, the gene of ox trim5 α is positioned on No. 15 karyomit(e)s, total length 2630bp.At present about the main research of trim5 α has: trim5 α gene order (Ylinen, L.M. .2006 is waited, J.Virol.80 (15), 7332-7338), molecular evolution (Si, Z. .Proc.Natl.Acad.Sci.U.S.A.2006 is waited, 103 (19), 7454-7459), viral infection resisting function (.Virology such as Li X, 2007; 366 (2): 234-244; The .Science such as Brass A L, 2008,3,19 (5865): 234-244; The .J Virol such as Diaz-Griffero F, 2009; 83 (20): 10737-10751).Research shows that part TRIM albumen has antiviral functions, especially has restriction to retrovirus, and take part in a series of bioprocess relevant to the natural immunity.
Applicant finds to disturb ox trim5 α genetic expression effectively can improve the genetic expression of people's lentiviral vectors in ox kidney passage cell by RNA.Obtain ox trim5 α and lower the siRNA sequence of expressing, siRNA people's Lentiviral, siRNA replication deficient human slow virus, siRNA replication deficient human slow virus infection MDBK cell.
The invention provides a kind of RNA interference method making ox trim5 α gene silencing, its interference ox trim5 α gene, lowers the trim5 alpha expression of ox thus improves the expression level of foreign gene in MDBK cell.
RNA interference method of the present invention use be selected from ox trim5 α gene special siRNA sequence 5 '-CTGGCAGAAGTCAAGACAA-3 ', 5 '-CTGTCAAGCCTGTATCACT-3 ', 5 '-CTCCAATCATGTCTGCAGA-3 ' or 5 '-AGAATGATCTGGTCCAAGA-3 ', as SEQ IDNo.1-No.4.Wherein, 5 '-CTGGCAGAAGTCAAGACAA-3 ' disturbs 5 '-UTR non-coding region of trim5 α gene, 5 '-CTGTCAAGCCTGTATCACT-3 ', 5 '-CTCCAATCATGTCTGCAGA-3 ' and 5 '-AGAATGATCTGGTCCAAGA-3 ' disturb the coding region of trim5 α gene.
Preferably, RNA interference method of the present invention uses 5 '-CTGGCAGAAGTCAAGACAA-3 ' as siRNA sequence.
The invention provides a kind of ox trim5 α and lower the siRNA sequence of expressing, it can be lowered the trim5 alpha expression of ox thus improve the expression level of foreign gene in MDBK cell.
The invention provides a kind of ox trim5 α that makes and lower the siRNA expressed, described siRNA is preferably selected from special the siRNA sequence 5 '-CTGGCAGAAGTCAAGACAA-3 ' of ox trim5 α gene (LOC505265), 5 '-CTGTCAAGCCTGTATCACT-3 ', 5 '-CTCCAATCATGTCTGCAGA-3 ' or 5 '-AGAATGATCTGGTCCAAGA-3 '.Described siRNA is particularly preferably selected from 5 '-CTGGCAGAAGTCAAGACAA-3 '.
The present invention also provides described siRNA sequence for the preparation of a kind of purposes of mammalian cell of trim5 α gene silencing.Described mammalian cell is preferably ox cell.More preferably, described mammalian cell is MDBK cell.
The present invention also provides a kind of siRNA virus expression carrier, can lower the trim5 alpha expression of ox thus improve the expression level of foreign gene in MDBK cell.
Described siRNA virus expression carrier comprises ox trim5 α and lowers the siRNA sequence of expressing, and can lower the trim5 alpha expression of ox thus improve the expression level of foreign gene in MDBK cell.Described siRNA is preferably selected from special the siRNA sequence 5 '-CTGGCAGAAGTCAAGACAA-3 ' of ox trim5 α gene, 5 '-CTGTCAAGCCTGTATCACT-3 ', 5 '-CTCCAATCATGTCTGCAGA-3 ' or 5 '-AGAATGATCTGGTCCAAGA-3 '.Particularly preferably be selected from 5 '-CTGGCAGAAGTCAAGACAA-3 '.
Further, the above-mentioned siRNA virus expression carrier of the present invention is Lentiviral pLV-shRNA-puro, pLVX-shRNA1, pLVX-shRNA2.Be preferably pLV-shRNA-puro.
Further, the above-mentioned siRNA virus expression carrier of the present invention is pLV-shRNA-trim5 α-337, pLV-shRNA-trim5 α-480, pLV-shRNA-trim5 α-808, pLV-shRNA-trim5 α-1037.Preferably pLV-shRNA-trim5 α-337.
The present invention also provides a kind of method building above-mentioned siRNA virus expression carrier, comprises the following steps:
(1) according to ox trim5 α gene (LOC505265) mRNA complete sequence screening RNA disturbance target point, design siRNA sequence and contrast stochastic sequence,
(2) enzyme cuts virus vector,
(3) synthetic linker primer, is connected to virus vector after annealing,
(4) product transfection Escherichia coli competence dH5 α is connected, overnight incubation,
(5) picked clones carries out PCR qualification, obtains the clone that order-checking is correct, and large upgrading grain is quantitatively rear for subsequent use.
Further, in aforesaid method, siRNA sequence is preferably selected from special the siRNA sequence 5 '-CTGGCAGAAGTCAAGACAA-3 ' of ox trim5 α gene (LOC505265), 5 '-CTGTCAAGCCTGTATCACT-3 ', 5 '-CTCCAATCATGTCTGCAGA-3 ' or 5 '-AGAATGATCTGGTCCAAGA-3 '.Particularly preferably be selected from 5 '-CTGGCAGAAGTCAAGACAA-3 '.
In above-mentioned construction process, virus expression carrier is Lentiviral, is preferably people's Lentiviral.Be preferably pLV-shRNA-puro, pLVX-shRNA1, pLVX-shRNA2.Be particularly preferably pLV-shRNA-puro.
The present invention also provides the purposes of above-mentioned virus expression carrier in the mammalian cell of preparation trim5 α gene silencing.Described mammalian cell is preferably ox cell.More preferably, described mammalian cell is MDBK cell.
The present invention also provides a kind of mammalian cell of trim5 α gene silencing.
Preferably, the cell of described trim5 α gene silencing is ox cell, more preferably MDBK.
Further, the cell of trim5 α gene silencing of the present invention is preferably N1, N2, N3 and N14.Be more preferably N14, this cell strain called after ox trim5 α gene silencing cell strain BTL2013, is preserved in China typical culture collection center, address on July 8th, 2014: Wuhan, China Wuhan University, postcode 430072, deposit number is CCTCC No.C2014116.
Further, the mammalian cell of trim5 α gene silencing of the present invention disturbs with siRNA, siRNA is preferably from special the siRNA sequence 5 '-CTGGCAGAAGTCAAGACAA-3 ' of ox trim5 α gene (LOC505265), 5 '-CTGTCAAGCCTGTATCACT-3 ', 5 '-CTCCAATCATGTCTGCAGA-3 ' or 5 '-AGAATGATCTGGTCCAAGA-3 ', particularly preferably 5 '-CTGGCAGAAGTCAAGACAA-3 '.
The mammalian cell of trim5 α gene silencing of the present invention obtains with replication defective slow virus infection prepared by siRNA people's lentiviral vectors of the present invention.Described siRNA people's Lentiviral is pLV-shRNA-trim5 α-337, pLV-shRNA-trim5 α-480, pLV-shRNA-trim5 α-808, pLV-shRNAtrim5 α-1037.Preferably, the mammalian cell of described trim5 α gene silencing obtains with replication defective people slow virus infection prepared by pLV-shRNA-trim5 α-337.
The present invention also provides a kind of method obtaining the mammalian cell of trim5 α gene silencing, and it comprises with carrier transfection mammalian cell of the present invention, and preferably ox cell, is more preferably MDBK cell.
The method that the present invention obtains the mammalian cell of trim5 α gene silencing comprises the following steps:
(1) siRNA people's Lentiviral of the present invention, pH1 carrier and pH2 carrier three plasmid and Polyfect-V transfection reagent (buying in Inovogen Tech Co., Ltd.) lipofection cotransfection HEKC HEK293T, obtain siRNA replication deficient human slow virus.
(2) MDBK cell is inoculated into 24 orifice plates, cultivates MDBK to cell confluency degree 60% with the nutrient solution of DMEM in high glucose and weight percent 10% foetal calf serum (buying in Hyclone company of the U.S.).(concentration is about 1 ~ 5 × 10 to get siRNA replication deficient human slow virus
7tU/ml) 100 μ l, at room temperature melt, and add nutrient solution 400 μ l,, add polybrene (polybrene is bought in Sigma Co., USA) to final concentration 6 μ g/ml, SiRNA people's slow virus infection liquid is made in mixing, replaces MDBK cell culture fluid with infection liquid.Abandon infection liquid after 24 hours, the DMEM containing final concentration 7.5 μ g/ml tetracycline renewed carries out cultured continuously.
(3) described tetracycline concentration 2 weeks are maintained until 1-2 cell clone appears in every hole.
(4) tetracycline concentration is reduced to 3.75 μ g/ml, continue cultivation and after 2 weeks, cell clone is selected to 24 orifice plates continuation cultivations.
(5) frozen after cell amplification and detect trim5 α genetic expression.
The object of the present invention is to provide a kind of method improving the expression level of foreign gene in MDBK cell, it is included in MDBK cell and imports people's lentiviral vectors of the present invention.
The present invention also provides the purposes of mammalian cell as exogenous gene expression host of trim5 α gene silencing, imports people slow virus virus vector of the present invention in described MDBK cell.Described mammalian cell is preferably ox cell.More preferably, described mammalian cell is MDBK cell.More preferably, described mammalian cell is MDBK cell N1, N2, N3 and N14, is particularly preferably N14 (CCTCC No.C2014116).
The invention has the advantages that by siRNA reticent ox trim5 α genetic expression, effectively improve the genetic expression of Human virus's carrier in ox kidney passage cell MDBK.Import trim5 α gene inhibition successful in the cell clone of siRNA sequence of the present invention, mRNA relative expression levels significantly declines, and in N14 cell, the mrna expression of trim5 α has been lowered 60%.Improve 4 times (P<0.05) with the efficiency of infection of N14 cell infection GFP people lentiviral vectors of the present invention, expression efficiency improves 80 times ((P<0.01).The research that the present invention cultivates for cattle disease viral disease genes involved function and transgenic cattle provides new technical support.
The ox trim5 α gene silencing cell strain BTL2013 that the present invention relates to is preserved in China typical culture collection center, address on July 8th, 2014: Wuhan, China Wuhan University, postcode 430072, deposit number is CCTCC No.C2014116.
Accompanying drawing explanation
Fig. 1 is the schematic diagram that trim5 α gene silencing of the present invention expresses lentiviral vectors.SiRNA ds oligo is inserted in carrier between BamH1 and EcoR1, produces shRNA, produce ripe siRNA, produce interference effect after shearing by the sub-U6 promoter transcription of III class rna polymerase promoter.Tetracycline (Puromycin) resistant gene may be used for screening trim5 α gene silencing stable cell line.
Fig. 2 real time quantitative PCR method detects trim5 α mRNA relative expression levels in the cell clone of different siRNA sequence.
Fig. 3 real time quantitative PCR method detects the expression level of trim5 α in the N14 cell in the 45th generation.
GFP luciferase expression level after the CMV-GFP-L.V slow virus infection N14 cell of Fig. 4 fluorescent microscope detection MOI 100.
GFP gene transfering efficiency after the CMV-GFP-L.V slow virus infection N14 cell of Fig. 5 fluorescent microscope detection MOI 100.
After the CMV-GFP-L.V slow virus infection N14 cell of Fig. 6-1 flow cytomery MOI 100, GFP expresses the cell percentages be positive;
GFP gene transfering efficiency after the CMV-GFP-L.V slow virus infection N14 cell of Fig. 6-2 flow cytomery gene M OI 100 and expression intensity.
Embodiment
Embodiment 1. builds people's lentiviral vectors of the DNA of the siRNA with encode specialized reticent trim5 α gene
1, the DNA sequence dna of the siRNA of screening coding trim5 α gene
Utilize information biology to retrieve NCBI GeneBank and obtain the target sequence that ox trim5 α gene (LOC505265) mRNA complete sequence designs as siRNA.Design on website (http://rnaidesigner.lifetechnologies.com/rnaiexpress/) at corresponding siRNA and carry out primary design and screening, find out the DNA sequence dna of the encode siRNA corresponding to it of the possible target sequence with siRNA function.Then known infraspecific gene order in selected sense strand sequence and antisense strand sequence and GeneBank (http://www.ncbi.nlm.nih.gov/blast/) is compared, optimize the possible target sequence with siRNA function, called after SiRNA-1 to SiRNA-4. comprises respectively:
(1)trim5α-siRNA-1：
5’-CTGGCAGAAGTCAAGACAA-3’
3’-TTGTCTTGACTTCTGCCAG-5’
(2)：trim5α-siRNA-2
5’-CTGTCAAGCCTGTATCACT-3’
3’-AGTGATACAGGCTTGACAG-5’
(3)trim5α-siRNA-3：
5’-CTCCAATCATGTCTGCAGA-3’
3’-TCTGCAGACATGATTGGAG-5’
(4)trim5α-siRNA-4：
5’-AGAATGATCTGGTCCAAGA-3’
3’-TCTTGGACCAGATCATTCT-5’
According to DNA sequence dna and the random controls sequence of target sequence design coding siRNA, these sequences are
(1) the corresponding target sequence siRNA-1 of trim5 α-337:() 5 '-3 '
SEQ ID NO.5:S
gatcGCTGGCAGAAGTCAAGACAATTCAAGAGATTGTCTTGACTTCTGCCAGTTTTTTg
SEQ ID NO.6:R
aattcAAAAAACTGGCAGAAGTCAAGACAATCTCTTGAATTGTCTTGACTTCTGCCAGC
(2) the corresponding target sequence SiRNA-2 of trim5 α-480:() 5 '-3 '
SEQ ID NO.7:S
gatcGCTGTCAAGCCTGTATCACTTTCAAGAGAAGTGATACAGGCTTGACAGTTTTTTg
SEQ ID NO.8:R
aattcAAAAAACTGTCAAGCCTGTATCACTTCTCTTGAAAGTGATACAGGCTTGACAGC
(3) the corresponding target sequence siRNA-3 of trim5 α-808:() 5 '-3 '
SEQ ID NO.9:S
gatcGCTCCAATCATGTCTGCAGATTCAAGAGATCTGCAGACATGATTGGAGTTTTTTg
SEQ ID NO.10:R
aattcAAAAAACTCCAATCATGTCTGCAGATCTCTTGAATCTGCAGACATGATTGGAGC
(4) the corresponding target sequence siRNA-4 of trim5 α-1037:() 5 '-3 '
SEQ ID NO.11:S
gatccAGAATGATCTGGTCCAAGATTCAAGAGATCTTGGACCAGATCATTCTTTTTTTg
SEQ ID NO.12:R
aattcAAAAAAAGAATGATCTGGTCCAAGATCTCTTGAATCTTGGACCAGATCATTCTg
(5) random controls sequence C ontrol:5 '-3 '
SEQ ID NO.13:S
gatccATCGACTAGCCACTTAGACTTCAAGAGAGTCTAAGTGGCTAGTCGATTTTTTTg
SEQ ID NO.14:R
aattcAAAAAAATCGACTAGCCACTTAGACTCTCTTGAAGTCTAAGTGGCTAGTCGATg
2, send Invitrogen company to synthesize the DNA sequence dna of above-mentioned siRNA and random controls sequence, and annealing generate double chain oligonucleotide ds oligo.
Following 10 μ l reaction systems are set up in the pcr amplification pipe of 0.2ml:
The positive-sense strand of 1 μ g/ μ l: 0.4 μ l
The antisense strand of 1 μ g/ μ l: 0.4 μ l
Annealing buffer: 9.2 μ l
Hatch above-mentioned reaction system 4min for 95 DEG C, then place annealing at room temperature 5-10min.Of short duration centrifugal after, shifting out 1 μ l reaction solution, to be diluted to proper concn for subsequent use.Remaining 50 μMs of ds oligo are stored in-20 DEG C.
3, EcoR1, BamH1 double digestion linearizing people lentiviral vectors pLV-shRNA-puro (restriction endonuclease is bought in NEB company, and pLV-shRNA-puro carrier is purchased from Inovogen Tech Co., Ltd.).Ds oligo fragment is connected with linearizing pLV-shRNA-puro carrier, builds restructuring pLV-shRNA-puro.At room temperature, add following reagent successively in the pcr amplification pipe of 0.2ml and set up 10 μ l ligation systems:
The above-mentioned 2 ds oligo:1 μ l diluted
The carrier after purifying is cut: 1 μ l through enzyme
10 × connect damping fluid: 1 μ l
T4 DNA ligase (Promega): 1 μ l
Distilled water: 6 μ l
16 DEG C of connections of spending the night ,-20 DEG C of preservations after reaction terminating.
4, product transfection Escherichia coli competence dH5 α is connected.37 DEG C of overnight incubation, picked clones primer U6F, U6R carry out PCR qualification.Primer sequence is as follows:
U6F：GACTATCATATGCTTACCGTAACT
U6R：GGTGGATGTGGAATGTGTG
5, PCR identifies that correct clone primer U6F checks order (primer synthesis and order-checking are completed by calm and peaceful Bioisystech Co., Ltd of Beijing Sino-U.S.), by plasmid correct for order-checking called after pLV-shRNA-trim5 α-337, pLV-shRNA-trim5 α-480, pLV-shRNA-trim5 α-808, pLV-shRNA trim5 α-1037 and pLV-shRNA-control respectively.PLV-shRNA-trim5 α-337 sequencing result is shown in SEQ ID No.17.The correct clone Qiagen Plasmid Plus Maxi Kit plasmid extraction kit that checks order extracts plasmid, saves backup quantitatively.
Embodiment 2.MDBK cell trim5 α gene silencing stable cell line screens
1, MDBK cell tetracycline working concentration test
(1) MDBK cell is with 5 × 10
4/ hole is inoculated into 24 orifice plates.Tetracycline (buying in sigma company of the U.S.) is added to following concentration after 24 hours:
(2)0.1μg/ml；2.5μg/ml；5μg/ml；7.5μg/ml；10μg/ml。
(3) within every 2 days, change liquid once, and again add tetracycline.
(4) select the concentration of whole necrocytosis in 3-4 days for screening Drug level.
2, the acquisition of replication deficient human slow virus
In 5 recombinant human lentiviral vectorss of preparation in Example 1 any one, pH1 carrier and pH2 carrier three plasmid and Polyfect-V transfection reagent (buying in Inovogen Tech Co., Ltd.) lipofection cotransfection HEKC HEK293T (buying in Inovogen Tech Co., Ltd.), 48h gather in the crops people slow virus supernatant liquor without replication.Under 4 DEG C of conditions, the centrifugal 5min of 500g is to remove cell debris, and the supernatant-70 DEG C collected containing slow virus saves backup.PEG6000 precipitator method purified virus.Adopt the method for tetracycline minimum lethal dose screening virus infected cell, carry out slow virus titer determination.Prepare the replication deficient human slow virus that 4 contain siRNA sequence and 1 random controls sequence as stated above.
3, replication deficient human slow-virus transfection MDBK cell and tetracycline screening
(1) MDBK cell is inoculated into 24 orifice plates, cultivates MDBK to cell confluency degree 60% with the nutrient solution of DMEM in high glucose and weight percent 10% foetal calf serum (buying in Hyclone company of the U.S.) by 500 μ l/ holes.(concentration is about 1 ~ 5 × 10 to appoint the replication deficient human slow virus of getting 1 above-mentioned preparation
7tU/ml) 100 μ l, at room temperature melt, and add nutrient solution 400 μ l, add polybrene (polybrene is bought in Sigma Co., USA) to final concentration 6 μ g/ml, and siRNA people's slow virus infection liquid 500 μ l is made in mixing.4 infection liquid containing the replication deficient human slow virus of siRNA sequence and 1 random controls sequence are all by this kind of method preparation.Often kind is infected liquid replacement MDBK cell culture fluid to infect.Abandon infection liquid after 24 hours, what renew carries out cultured continuously containing final concentration 7.5 μ g/ml tetracycline DMEM.Often kind is infected liquid and does 2 24 orifice plates.
(2) described tetracycline concentration 2 weeks are maintained until cell clone appears in every hole.
(3) tetracycline concentration is reduced to 3.75 μ g/ml, continue cultivation and after 2 weeks, cell clone is selected to 24 orifice plates continuation cultivations.
(4) frozen after cell amplification and detect trim5 α genetic expression, by MDBK trim5 α gene silencing cell clone called after N14 (corresponding trim5 α-337), N1 (corresponding trim5 α-480), N2 (trim5 α-808) and the N3 (trim5 α-1037) respectively obtained.The cell clone called after NC of random controls sequence.Cell clone N14 called after ox trim5 α gene silencing cell strain BTL2013, be preserved in China typical culture collection center on July 8th, 2014, preserving number is CCTCC No.C2014116.
4, the cell clone of different siRNA sequence detects
Trim5 α mRNA relative expression levels in the cell clone of different siRNA sequence is detected with real-time quantitative PCR.
4.1, cell total rna is extracted
(1) above-mentioned different cell clone is accessed in 6 orifice plates, treat Growth of Cells to 90% density, remove substratum, add 1ml Trizol/ hole.Pressure-vaccum makes cell detachment repeatedly.Cell lysate is transferred in 1.5ml centrifuge tube.
(2) incubated at room 5 minutes, adds 0.2ml chloroform, concussion mixing, incubated at room 3 minutes.
(3) 4 DEG C, centrifugal 15 minutes of 12000rpm.
(4) colourless for upper strata aqueous phase is transferred to new centrifuge tube, add 0.5ml Virahol.Abundant mixing.Incubated at room 10 minutes.
Centrifugal 10 minutes of (5) 4 DEG C of 12000rpm.
(6) supernatant is removed.
(7) add 1ml 75% ethanol, rinsing RNA precipitates, centrifugal 5 minutes of 4 DEG C of 7000rpm.
(8) remove supernatant, room temperature is volatilized clean residual liquid, adds 20 μ l and precipitates without the water dissolution RNA of RNA enzyme.Quantitatively rear for subsequent use with ultraviolet spectrophotometer.
4.2 reverse transcription
(1) reactant is formulated as follows on ice:
Total serum IgE 1 μ g
oligodT primer 1μl
Add water and supply 12 μ l
(2) the reactant mixing will prepared, of short duration centrifugal, hatch 5 minutes for 65 DEG C, ice bath at once.
(3) following reagent is added:
(4) of short duration centrifugal after mixing, 42 DEG C of water-baths 60 minutes.
(5) 70 DEG C of heating 5 minutes termination reactions.
4.3 Real time-PCR
Internal reference primer:
GAPDH-F(BT):TGCTGGTGCTGAGTATGTGGTG
GAPDH-R(BT):TGCTGACAATCTTGAGGGTGTTG
Trim5 α gene primer:
TM-RT-F:GAAGGTCATTTGTTGGCTTTGTG
TM-RT-R:CTGTCCAGGATTTGTCTTAGTTGTGT
Real time-PCR reaction system:
Upstream and downstream primer (10 μMs) each 0.8 μ l, cDNA 1 μ l, 2 × SYBG reaction solution 10 μ l, adds water and supplies 20 μ l
Reaction conditions: denaturation 94 DEG C of 3min, circulation: 94 DEG C of 10s, 61 DEG C of 1min, 35 circulations.
Often fluorescence intensity at the end of wheel extension.
Data processing method: compare threshold method
The expression of the amount=experimental group goal gene of goal gene is relative to the change multiple=change multiple (FC)=2 of control group
-Δ Δ CT;
Δ Δ CT=(CT target gene-CT internal reference) RNAi group-(CT target gene-CT internal reference) control group.
The implication of Ct (Cycle threshold) value is: the cycle number experienced when the fluorescent signal in each reaction tubes arrives the thresholding of setting.In this formula, Ct is the intensity level that real-time PCR detects fluorescent signal in reaction system.
Experimental result as shown in Figure 2, N1 cell clone and NC negative control cell clone in the mrna expression amount of trim5 α gene close, illustrate that the inhibition of this siRNA sequence of trim5 α-480 to trim5 α gene is not obvious, and the siRNA sequence in N14, N2 and N3 cell clone is to trim5 α gene inhibition successful in MDBK cell, mRNA relative expression levels significantly declines, and is about 40% of compared with control cells.
5, N14 stablizes passage cell strain trim5 α genetic expression detection
To recover frozen N14 cell clone, within every 3 days, carry out Secondary Culture, add 3.75 μ g/ml tetracyclines to maintain screening pressure, when Cell viability reaches or surpasses 90%, complete screening, freeze-stored cell.Recovery N14 cell and negative control NC cell are normally cultivated, respectively get 45 generation cells and carry out trim5 α genetic expression detection, do 3 biology altogether to repeat, result is as Fig. 4, detected result shows that the mrna expression of trim5 α in the N14 cell in the 45th generation has been lowered 60%, illustrate that the siRNA in N14 can express by genetic stability, have reticent effect to trim5 α gene expression dose.
The transfer efficiency of trim5 α-337 siRNA on foreign gene and the impact of expression level after embodiment 3. people slow virus infection N14 stable cell line
N14 cell is inoculated in 24 porocyte culture plates by 30% degree of converging, and every porocyte number is about 5 × 10
4individual, cultivate 18h for 37 DEG C.Adding Polybrene to final concentration is 5 μ g/ml, add the CMV-GFP-L.V slow virus (buy in first biotechnology (Shanghai) Co., Ltd.) of MOI100, after infecting 18h, discard substratum, every hole adds the fresh DMEM in high glucose substratum of 500 μ l.Infect fluorescent microscope after 72 hours to take pictures.Fluorescence microscopy is adopted to detect gene transfering efficiency and the expression efficiency of the people CMV-GFP-L.V slow virus of N14 cell and NC.Concrete steps comprise: 2 kinds of cells are placed in fluorescence inverted microscope (ECLIPSE Ti-S, NIKON) Stage microscope, and excitation wavelength 488nm detects.Under fluorescence inverted microscope, observe luciferase expression situation, relatively detect luciferase expression efficiency and efficiency of infection in N14 cell and MDBK compared with control cells according to the details in a play not acted out on stage, but told through dialogues fluorescence visual field and the light field visual field.Use the cell of fluorescence microscope counting expressing green fluorescent protein, observe the total cell count in counting the same visual field at light field, counting GFP positive cell.Often kind of cell establishes 2 multiple holes, and 3 visual field statistics are selected in every hole, and the result in every hole gets the mean value in 3 visuals field.With statistics software, statistical analysis is carried out to result.Result as shown in Figure 4 and Figure 5, statistic analysis result shows that the N14 groups of cells visible GFP positive cell rate of people CMV-GFP-L.V slow virus infection is 44%, the fluorescence of GFP positive cell is better than contrast, and the visible GFP positive cell rate of compared with control cells group is 9%, there is significant difference (p<0.01) in the data of 2 groups of cells, result has statistical significance, and gene transfering efficiency and the expression efficiency of the people slow virus that improve band GFP gene in trim5 α-347 siRNA silence N14 cell after trim5 alpha expression are described.
Cell after taking pictures is through trysinization and dispel as single cell suspension, the centrifugal 5min of 1500rpm/min, with the PBS Eddy diffusion containing weight percent 5% foetal calf serum.Cell suspending liquid uses flow cytometer (BD FACS after 200 object nylon net filters, Calibur) cell fluorescence intensity is surveyed, during detection, forward side is lin to voltage amplification pattern, and adopt FL1-H fluorescence intensity, FL-1H channel voltage amplification mode is log.Excitation wavelength is 488nm.Each cell sample collection about 5.2 × 10
4individual cell, not add the cell of virus treated as negative control, setting GFP positive cell district (FL-1H+ district), makes the cell count of negative control sample in FL-1H+ district be no more than 1%.Gene transfering efficiency is that the cell quantity percentage of sample in FL-1H+ district deducts the quantity percentage of negative control sample in FL-1H+ district; Positive cell average fluorescent strength is the mean value of sample cell fluorescence intensity in FL-1H+ district.Result is the mean value of 3 experiments.Flow cytomery result, as shown in Fig. 6-1 and Fig. 6-2, can find out that the fluorescence intensity of the N14 experimental group of transfection trim5 α-347 siRNA strengthens, higher than contrast 80 times (p<0.01); The efficiency of infection of N14 experimental group also exceeds contrast 4 times (p<0.05), this effective detection method directly perceived confirms that people's slow virus infection of GFP gene GFP gene transfering efficiency and gene expression efficiency in N14 cell and negative control cell exist significant difference, and in N14 cell, trim5 α-337 siRNA effectively enhances transgenosis and the expression efficiency of band GFP gene by the expression of lowering trim5 α gene.
2 independent experiment results of fluorescent microscope and flow cytometer all describe N14 cell and have higher efficiency of infection and gene expression efficiency to the infection of people slow virus than MDBK cell; application of the present invention can provide experimental model for cow genome group and transgenic research, can improve the screening efficiency of the transgenosis MDBK cell that people's lentiviral vectors infects.
Claims (10)
1. make a RNA interference method for ox trim5 α gene silencing, it is characterized in that, by interference ox trim5 α gene, lowering ox trim5 alpha expression thus improving the expression level of foreign gene in MDBK cell.
2. method according to claim 1, it is characterized in that realizing interference by siRNA sequence, described siRNA sequence is selected from 5 '-CTGGCAGAAGTCAAGACAA-3 ', 5 '-CTCCAATCATGTCTGCAGA-3 ' or 5 '-AGAATGATCTGGTCCAAGA-3 '.
3. make a siRNA for ox trim5 α gene silencing, it is characterized in that described siRNA disturbs ox trim5 α gene, lower the trim5 alpha expression of ox thus improve the expression level of foreign gene in MDBK cell.
4. siRNA according to claim 3, is characterized in that described siRNA is selected from 5 '-CTGGCAGAAGTCAAGACAA-3 ', 5 '-CTCCAATCATGTCTGCAGA-3 ' or 5 '-AGAATGATCTGGTCCAAGA-3 '.
5. comprise a virus expression carrier of the siRNA described in claim 3 or 4, described virus expression carrier is pLV-shRNA-trim5 α-337, pLV-shRNA-trim5 α-808, pLV-shRNA-trim5 α-1037.
6. build the method for siRNA virus expression carrier according to claim 5, comprise the following steps:
(1) according to ox trim5 α gene mRNA complete sequence screening RNA disturbance target point, design siRNA sequence and contrast stochastic sequence,
(2) enzyme cuts virus vector,
(3) synthetic linker primer, is connected to virus vector after annealing,
(4) product transfection Escherichia coli competence dH5 α is connected, overnight incubation,
(5) picked clones carries out PCR qualification, obtains the clone that order-checking is correct, and upgrading grain is quantitatively rear for subsequent use.
7. a mammalian cell for trim5 α gene silencing, is characterized in that described mammalian cell imports siRNA virus expression carrier according to claim 5.
8. cell according to claim 7, it is characterized in that described cell is bovine kidney cells MDBK, described cell is N14, called after ox trim5 α gene silencing cell strain BTL2013, be preserved in China typical culture collection center on July 8th, 2014, deposit number is CCTCC No.C2014116.
9. improve a method for the expression level of foreign gene in MDBK cell, it is characterized in that described method is included in MDBK cell and import siRNA virus expression carrier according to claim 5.
10. the siRNA described in claim 3 or 4 or siRNA virus expression carrier according to claim 5 are in the purposes of the mammalian cell of preparation trim5 α gene silencing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410539364.7A CN104357444A (en) | 2014-10-13 | 2014-10-13 | SiRNA for bovine trim5alpha gene silencing and application of siRNA |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410539364.7A CN104357444A (en) | 2014-10-13 | 2014-10-13 | SiRNA for bovine trim5alpha gene silencing and application of siRNA |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104357444A true CN104357444A (en) | 2015-02-18 |
Family
ID=52524755
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410539364.7A Pending CN104357444A (en) | 2014-10-13 | 2014-10-13 | SiRNA for bovine trim5alpha gene silencing and application of siRNA |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104357444A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105255819A (en) * | 2015-10-13 | 2016-01-20 | 华南农业大学 | Cynomolgus monkey TRIM5alpha gene knockdown method |
| CN107746857A (en) * | 2017-08-07 | 2018-03-02 | 中国农业大学 | A kind of RNA interference methods of inhibition of gene expression |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011060534A1 (en) * | 2009-11-23 | 2011-05-26 | 3R Valo Societe En Commandite | Trim5alpha mutants and uses thereof |
-
2014
- 2014-10-13 CN CN201410539364.7A patent/CN104357444A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011060534A1 (en) * | 2009-11-23 | 2011-05-26 | 3R Valo Societe En Commandite | Trim5alpha mutants and uses thereof |
Non-Patent Citations (3)
| Title |
|---|
| LAURA M. J. YLINEN ET AL.: "Isolation of an active Lv1 gene from cattle indicates that tripartite motif protein-mediated innate immunity to retroviral infection is widespread among mammals", 《JOURNAL OF VIROLOGY》 * |
| ZHIHAI SI ET AL.: "Evolution of a cytoplasmic tripartite motif (TRIM) protein in cows that restricts retroviral infection", 《PNAS》 * |
| 魏衍全 等: "RNAi实现方法及在免疫相关基因功能鉴定中的应用", 《中国人兽共患病学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105255819A (en) * | 2015-10-13 | 2016-01-20 | 华南农业大学 | Cynomolgus monkey TRIM5alpha gene knockdown method |
| CN105255819B (en) * | 2015-10-13 | 2019-11-08 | 华南农业大学 | Cynomolgus monkey TRIM5alpha gene knockdown method |
| CN107746857A (en) * | 2017-08-07 | 2018-03-02 | 中国农业大学 | A kind of RNA interference methods of inhibition of gene expression |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106459976A (en) | Mirnas enhancing cell productivity | |
| CN101120093B (en) | Vectors comprising novel regulatory elements | |
| CN103923925A (en) | siRNA (small interfering ribonucleic acid) for inhibiting ER81 gene expression and application of siRNA in breast cancer cells | |
| JP2016528878A (en) | Avian cells for improved virus production | |
| Min et al. | Generation of antiviral transgenic chicken using spermatogonial stem cell transfected in vivo | |
| Lambeth et al. | Targeting Marek's disease virus by RNA interference delivered from a herpesvirus vaccine | |
| CN104928292A (en) | Design method of sgRNA and lentivirus carrier formed by sgRNA and plasmids | |
| CN104357444A (en) | SiRNA for bovine trim5alpha gene silencing and application of siRNA | |
| CN101575615B (en) | Construction of recombined lentivirus vector aiming at PKC gamma gene RNA interference and application thereof | |
| CN102492711A (en) | Transgenic interference vector containing enhancer Hr3 and promotor IE1, as well as preparation method and application of transgenic transposition vector | |
| CN105200059B (en) | The siRNA of targeted inhibition mouse UCP2 gene expressions and its structure of expression vector | |
| CN110272919A (en) | A method of finding the target gene of embryonic stem cell Wnt signal path into archaeocyte atomization | |
| CN103642807B (en) | Enhanced bombyx mori nuclear polyhedrosis virus inducible promoter En39k and application thereof | |
| Cullen | Does RNA interference have a future as a treatment for HIV-1 induced disease | |
| CN110331143A (en) | For the miRNA and coding nucleic acid molecule of the leaf regulation of sweet potato and application | |
| CN111808858B (en) | siRNA sequence and application of target thereof in improving PEDV (porcine reproductive and respiratory syndrome Virus) toxicity | |
| CN108441496B (en) | shRNA sequence for inhibiting chicken SOX5 gene expression and application thereof | |
| CN106337049A (en) | Breeding method of anti-influenza transgenic animals expressing double genes | |
| CN102703506A (en) | Alpha 1,2-fucosyltransferase gene silenced somatic cloning pig, as well production method and application thereof | |
| CN103255142A (en) | Method for regulating endogenous prion protein expression by using RNAi, and application thereof | |
| CN103695427B (en) | Small interfering RNA (Ribonucleic Acid) and recombinant vector for knocking down VPS11 (Vacuolar Protein Sorting-Associated Protein 11), and application of small interfering RNA and recombinant vector | |
| CN102352360B (en) | Construction and function test of double-long-hairpin RNA (Ribonucleic Acid) expression element for inhibiting HIV-1 (Human Immunodeficiency Virus-1) | |
| CN104630272A (en) | Demethylation-based vector for promoting self-renewal and proliferation of germline stem cells and application thereof | |
| CN106957845A (en) | Suppress siRNA and its application of mouse gonadotropin inhibiting hormone (GN-IH) gene expression | |
| Keyer et al. | Towards development of plasmacytoma cells-based expression systems utilizing alphavirus vectors: An NS0-VEE model |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150218 |
|
| RJ01 | Rejection of invention patent application after publication |