CN105255819B - Cynomolgus monkey TRIM5alpha gene knockdown method - Google Patents
Cynomolgus monkey TRIM5alpha gene knockdown method Download PDFInfo
- Publication number
- CN105255819B CN105255819B CN201510670510.4A CN201510670510A CN105255819B CN 105255819 B CN105255819 B CN 105255819B CN 201510670510 A CN201510670510 A CN 201510670510A CN 105255819 B CN105255819 B CN 105255819B
- Authority
- CN
- China
- Prior art keywords
- machin
- trim5alpha
- gene
- sequence
- knockdown
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a cynomolgus monkey TRIM5alpha gene knockdown method, and belongs to the technical field of biology. The method for knocking down the TRIM5alpha gene of the cynomolgus monkey comprises the following steps: 1) establishing a target sequence aiming at mRNA of the cynomolgus monkey TRIM5alpha gene; 2) synthesizing a corresponding shRNA for each site; 3) packaging the corresponding lentivirus; 4) transfecting the cynomolgus monkey embryo fibroblasts to obtain the cynomolgus monkey TRIM5alpha gene knocked-down cells. According to the invention, the knocking effect is detected and identified, the knocking effect reaches over 90 percent, and a solid foundation is laid for establishing an animal model of AIDS.
Description
Technical field
The invention belongs to field of biotechnology, and in particular to a kind of method of machin TRIM5alpha Knockdown.
Background technique
TRIM5alpha (5 alpha of tripartite motif protein) is one of TRIM family member, is lactation
A kind of important restriction factor in zooblast, they are limited in a manner of a kind of species-independent including HIV-1 (Human
Immunodeficiency virus type 1) including a variety of retrovirus duplication.The mechanism pair of TRIM5 limitation HIV-1
Biological therapy scheme, drug development and vaccine design based on TRIM5 molecule provide important scientific basis, and more to foundation
It is also had a very important significance for ideal non-human primate model of AIDS.There are four structural domains for TRIM5 tool, including
RING, B-BOX, Coiled-Coil and SPRY；If wherein RING is destroyed the limitation work that can partially remove TRIM5 to HIV
With if B-BOX is destroyed, TRIM5 completely eliminates the restriction effect of HIV.The Gag protein binding that B-BOX can be generated with HIV,
And promote its degradation, to inhibit the generation of inhibition of HIV particle.Coiled-Coil forms related to protein complex.SPRY
It may be related with the identification of signal.
In conclusion non-human primate cell's model of TRIM5alpha Knockdown is prepared, for establishing AIDS
Sick animal model is of great significance.So far do not find by with the same or similar report of the present invention.
Summary of the invention
It is in order to overcome the shortcomings of the prior art and insufficient, the primary purpose of the present invention is that providing a kind of machin
The method of TRIM5alpha Knockdown.The present invention specifically provides three of a kind of machin TRIM5alpha gene knockout effectively
Target sequence and verification method provide thinking for people's AIDS-like disease model.
The scheme that the present invention solves above-mentioned technical problem is as follows: a kind of method of machin TRIM5alpha Knockdown,
3 are established for machin TRIM5alpha gene and strikes low target sequence, and corresponding shRNA, packaging are synthesized for each target spot
Corresponding slow virus transfects machin embryo fibroblast, and the effect of TRIM5alpha Knockdown is up to 90% or more；Tool
Steps are as follows for body:
1) target sequence is established for the mRNA sequence of machin TRIM5alpha gene；According to machin TRIM5alpha base
The mRNA sequence of cause establishes 3 target sequences, is respectively positioned on the region SPRY of TRIM5alpha gene；The sequence of target spot 1 is
The sequence of agcctgtatttccatatttaaat, target spot 2 are ctgtctcattcttcaatatcaca, and the sequence of target spot 3 is
atgaaaattatcaacctaaatat；
2) corresponding shRNA is synthesized for each target spot；
The upstream primer of target spot 1 are as follows:
TGAGCCTGTATTTCCATATTTAAATCTTCCTGTCAATTTAAATATGGAAATACAGG CTTTTTTTC,
The downstream primer of target spot 1 are as follows:
TCGAGAAAAAAAGCCTGTATTTCCATATTTAAATTGACAGGAAGATTTAAATATGGAAATACAGGCT
CA；
The upstream primer of target spot 2 are as follows:
TGCTGTCTCATTCTTCAATATCACACTTCCTGTCATGTGATATTGAAGAATGAGAC AGTTTTTTC,
The downstream primer of target spot 2 are as follows:
TCGAGAAAAAACTGTCTCATTCTTCAATATCACATGACAGGAAGTGTGATATTGAAGAATGAGACAG
CA；
The upstream primer of target spot 3 are as follows:
TGATGAAAATTATCAACCTAAATATCTTCCTGTCAATATTTAGGTTGATAATTTTC ATTTTTTTC,
The downstream primer of target spot 3 are as follows:
GAAAAAAATGAAAATTATCAACCTAAATATTGACAGGAAGATATTTAGGTTGATAATTTTCATCA；It is right
Above-mentioned 3 pairs of primer pairs make annealing treatment, and single-stranded DNA is made to be annealed into shRNA；
3) corresponding slow virus is packed；
4) machin embryo fibroblast is infected, the embryo fibroblast for obtaining machin TRIM5alpha Knockdown is thin
Born of the same parents.
It is NM_001283295.1 that the mRNA sequence of machin TRIM5alpha gene described in step 1), which is gene I/D,
It establishes 3 and strikes low target sequence.
Step 2) synthesizes corresponding shRNA for each target spot, and the upstream and downstream primer of target sequence 1~3 is all in accordance with to issue
The principle of card sequent synthesis: if sequence is started with G, corresponding upstream sequence is TG
(XXXXXXXXXXXXXXXXXXX)19CTTCCTGTCA(XXXXXXXXXXXXXXX XXX) 19 TTTTTT C respective downstream sequence is
TCGAGAAAAAA(XXXXXXXXXXXXXXXXXX)19TGACAGGAAG(XXXXXXXXXXXXXXXXXX) 19 The principle of CA；Its
In: in the above sequence (XXXXXXXXXXXXXXXXXX)19Sequence is siRNA sequence (U therein is substituted for T),
(XXXXXXXXXXXXXXXXXX) 1 9Sequence is (XXXXXXXXXXXXXXXXXX)19The complementary series of sequence.
Above-mentioned 3 pairs of primer pairs are made annealing treatment described in step 2), specific steps are as follows: to above-mentioned 3 pairs of primer pairs
It anneals, single-stranded DNA is made to be annealed into shRNA.
The corresponding slow virus of packaging described in step 3), specific steps are as follows: according to U.S. GeneCopoeia (reactivation base
Cause) Lenti-PacTMThe specification of lentiviral particle package kit packs slow virus；By obtained slow virus by hypervelocity from
Heart method, eccentricity 50000rpm/min, time 90min after discarding supernatant, dilute viral pellet with PBS, obtain high titre
Virus.
Infection machin embryo fibroblast, specific steps described in step 4) are as follows: use slow-virus infection machin
Embryo fibroblast CMEF needs to spread in cell 6 orifice plates by experiment in first day, cell number with the 2nd day density for 50%, 37 DEG C
Overnight incubation；Before infection in second day, from -80 DEG C of refrigerators take out after ice bath melted, diluted with complete medium, be added to cell
In culture dish.Note: mixing gently, not use oscillator；The original culture medium of cell is sucked, the virus liquid diluted is added
In cell；Polybrene is added, 10 μ g/ml of final concentration gently shakes up, 37 DEG C of overnight incubations；After infection 48 hours, absorption contains
The culture medium of slow virus is changed to fresh culture medium；After continuing culture 24-48 hours, machin TRIM5alpha gene is obtained
Strike low machin embryo fibroblast.
The beneficial effects of the present invention are:
1, which provides three for machin TRIM5alpha gene, efficiently strikes low target spot；
2 verified to strike inefficient fruit fabulous；
3 provide Experience for other Precious, Rare, Endangered primate transgenic technology researchs.
Specific embodiment
Below with reference to embodiment, the present invention is described in further detail, and embodiments of the present invention are not limited thereto.
Embodiment 1
The present invention provides a kind of methods of machin TRIM5alpha Knockdown, the specific steps are as follows:
1) target sequence is established for the mRNA of machin TRIM5alpha gene；According to machin TRIM5alpha gene
MRNA sequence (atggcttctggaatcctgcttaatgtaaaggaggaggtgacctgtcccatctgcct ggaactcctga
cagaacccctgagtctgcactgcggccacagcttctgccaagcgtgcatcactgcgaaccacaagaagtccatgct
atacaaagaaggagagagaagctgccctgtgtgccggatcagttaccagcctgagaacatacagcctaatcggcat
gtagccaacatagtggagaagctcagggaggtcaagttgagcccagaagaggggcagaaggttgatcactgtgcac
gccatggagagaaactcctactcttctgtcaggaggacagcaaggtcatttgctggctttgtgagcggtctcagga
gcaccgtggtcaccacactttcctcatggaggaggttgcccaggagtaccatgtgaagctccagacagctctggag
atgctgaggcagaagcagcaggaagctgaaaagttggaagctgacatcagagaagagaaagcttcctggaagattc
aaatagaccacgacaaaaccaacgtcttggcagattttgagcaactgagagagatcctggaccgggaggagagcaa
tgagctgcagaacctggagaaggagaaagaagacattctgaaaagtcttacaaagtctgaaacgaagatggtgcag
cagacccagtacgtgagagagctcatctcagatctggagcatcggttgcaggggtcaatgatggagctgctgcagg
gtgtggatggcatcattaaaaggattgagaacatgaccttgaagaagccaaaaacttttcacaaaaatcaaaggag
agtgtttcgagctcctgatctgaaaggaatgctagacatgtttagagagctaacagatgcccgacgctactgggtt
gatgtgacactggctccaaacaacatttcgcatgctgtcattgctgaagataagagacaagtgagctctcggaacc
cacagatagtgtatcagtcaccagggacattatttcagtcactcacgaatttcaattattgtactggcgtcctggg
ctcccaaagtatcacatcagggaagcattactgggaggtagatgtgtccaagaaaagtgcttggatcctgggggta
tgtgctggcttccaatccgatgcaatgtgtaatattgaacaaaatgaaaattatcaacctaaatatggctactggg
ttataggattacaggaaggagttaaatatagtgttttccaggatggttccttacatactccttttgctcctttcat
tgtgcccctctctgtgattatttgtcctgatcgtgttggagttttcgtagactatgaggcttgcactgtctcattc
ttcaatatcacaaaccatggatttctcatctataagttttctcagtgttctttttctaagcctgtatttccatatt
Taaatcccagaaaatgtacagtccccatgactctgtgctcaccaagctcttga), 3 target sequences are designed, are respectively positioned on
The region SPRY；Target spot 1agcctgtatttccatatttaaat, target spot 2ctgtctcattcttcaatatcaca, target spot
3atgaaaattatcaacctaaatat；
2) corresponding shRNA is synthesized for each site；According to the principle of hair fastener sequent synthesis: if sequence is not with G
Start, then first segment sequence is
TG(XXXXXXXXXXXXXXXXXXX)19CTTCCTGTCA
(XXXXXXXXXXXXXXXXXX)19 TTTTTT C；
Second segment sequence is TCGAG AAA
AAA(XXXXXXXXXXXXXXXXXX)19TGACAGGAAG
(XXXXXXXXXXXXXXXXXX) 19 The principle of CA.Note: in the above sequence
(XXXXXXXXXXXXXXXXXX)19Sequence be siRNA sequence (by U therein be substituted for T can),
(XXXXXXXXXXXXXXXXXX) 1 9Sequence is
(XXXXXXXXXXXXXXXXXX)19The complementary series of sequence；
Therefore the upstream primer of target spot 1 are as follows:
TGAGCCTGTATTTCCATATTTAAATCTTCCTGTCAATTTAAATATGGAAATACAGG CTTTTTTTC,
The downstream primer of target spot 1 are as follows:
TCGAGAAAAAAAGCCTGTATTTCCATATTTAAATTGACAGGAAGATTTAAATATGGAAATACAGGCT
CA；
The upstream primer of target spot 2 are as follows:
TGCTGTCTCATTCTTCAATATCACACTTCCTGTCATGTGATATTGAAGAATGAGAC AGTTTTTTC,
The downstream primer of target spot 2 are as follows:
TCGAGAAAAAACTGTCTCATTCTTCAATATCACATGACAGGAAGTGTGATATTGAAGAATGAGACAG
CA；
The upstream primer of target spot 3 are as follows:
TGATGAAAATTATCAACCTAAATATCTTCCTGTCAATATTTAGGTTGATAATTTTC ATTTTTTTC,
The downstream primer of target spot 3 are as follows:
GAAAAAAATGAAAATTATCAACCTAAATATTGACAGGAAGATATTTAGGTTGATAATTTTCATCA
3) it anneals to above-mentioned DNA Oligos, single-stranded DNA is made to be annealed into shRNA i.e. short hairpin RNA；
4) corresponding slow virus is packed；According to the Lenti-Pac of U.S. GeneCopoeia (reactivation gene)TMSlow virus
The specification of grain package kit packs slow virus.By obtained slow virus by supercentrifugation, eccentricity 50000rpm/
Min, time 90min after discarding supernatant, dilute viral pellet with PBS, obtain the virus of high titre (wherein: 1shRNA pairs of target spot
Answer No. 1 slow virus, corresponding No. 2 slow virus of target spot 2shRNA, corresponding No. 3 slow virus of target spot 3shRNA)；
5) machin embryo fibroblast is infected；With slow-virus infection machin embryo fibroblast CMEF, first
It needs to spread in cell 6 orifice plates by experiment, cell number with the 2nd day density for 50%, 37 DEG C of overnight incubations；Before infection in second day,
From -80 DEG C of refrigerators take out after ice bath melted, diluted, be added in Tissue Culture Dish with complete medium.Note: gently mixing
It is even, it not use oscillator；The original culture medium of cell is sucked, the virus liquid diluted is added in cell；It is added
Polybrene, 10 μ g/ml of final concentration, gently shakes up, 37 DEG C of overnight incubations；After infection 48 hours, the culture containing slow virus is absorbed
Base is changed to fresh culture medium；After continuing culture 24-48 hours, the machin of machin TRIM5alpha Knockdown is obtained
Embryo fibroblast.
6) inefficient fruit is struck in detection；GFP green fluorescent protein is had on slow virus carrier, with after virus infection 96 hours
Fluorescence microscope GFP green fluorescence is set, to observe virus to the infection conditions of aim cell；With BD influx cell
The low cell sorting of sorter cell sorter bucketing, obtain 100%GFP strikes low cell.The low cell of bucketing is qPCR
Verifying.
The results show that it is 90.2% that strike low efficiency, which be respectively No. 1 slow virus, No. 2 slow virus are 95.1%, No. 3 slow diseases
Poison is 92.7%.The result shows that the method for machin TRIM5alpha Knockdown of the invention is with higher to strike poor efficiency.
The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment
Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention,
It should be equivalent substitute mode, be included within the scope of the present invention.
Claims (5)
1. a kind of method of machin TRIM5alpha Knockdown, it is characterised in that: be directed to machin TRIM5alpha gene
Strike low target sequence, corresponding shRNA is synthesized for target spot, packs corresponding slow virus, transfection machin embryo fibroblast is thin
Born of the same parents, the effect of TRIM5alpha Knockdown is up to 90% or more；Specific step is as follows:
1) target sequence is established for the mRNA sequence of machin TRIM5alpha gene；According to machin TRIM5alpha gene
MRNA sequence, established target sequence, positioned at the region SPRY of TRIM5alpha gene；The sequence of target spot such as SEQ ID NO:2 institute
Show；
2) corresponding shRNA is synthesized for target spot；
The upstream primer sequence of target spot is as shown in SEQ ID NO:6；
The downstream primer sequence of target spot is as shown in SEQ ID NO:7；
Above-mentioned primer pair is made annealing treatment, single-stranded DNA is made to be annealed into shRNA；
3) corresponding slow virus is packed；
4) machin embryo fibroblast is infected, the machin embryo fibroblast of machin TRIM5alpha Knockdown is obtained
Cell.
2. the method for machin TRIM5alpha Knockdown according to claim 1, it is characterised in that: institute in step 1)
The mRNA sequence for the machin TRIM5alpha gene stated is the gene that gene I/D is NM_001283295.1, is established efficient
Strike low target sequence.
3. the method for machin TRIM5alpha Knockdown according to claim 1, it is characterised in that: institute in step 2)
That states makes annealing treatment above-mentioned primer pair, and single-stranded DNA is made to be annealed into shRNA.
4. the method for machin TRIM5alpha Knockdown according to claim 1, it is characterised in that: institute in step 3)
The corresponding slow virus of the packaging stated, specific steps are as follows: according to the Lenti-Pac of U.S. GeneCopoeiaTMLentiviral particle packaging
The specification of kit packs slow virus；By obtained slow virus by supercentrifugation, eccentricity 50000rpm, time
90min after discarding supernatant, dilutes viral pellet with PBS, obtains the virus of high titre.
5. the method for machin TRIM5alpha Knockdown according to claim 1, it is characterised in that: institute in step 4)
The infection machin embryo fibroblast stated, specific steps are as follows: slow-virus infection machin embryo fibroblast CMEF is used,
Need to spread in cell 6 orifice plates by experiment within first day, cell number with the 2nd day density for 50%, 37 DEG C of overnight incubations；It infects within second day
Before, from -80 DEG C of refrigerators take out after ice bath melted, diluted, be added in Tissue Culture Dish with complete medium；Note: gently
It mixes, not use oscillator；The original culture medium of cell is sucked, the virus liquid diluted is added in cell；It is added
Polybrene, 10 μ g/ml of final concentration, gently shakes up, 37 DEG C of overnight incubations；After infection 48 hours, the culture containing slow virus is absorbed
Base is changed to fresh culture medium；After continuing culture 24-48 hours, the machin of machin TRIM5alpha Knockdown is obtained
Embryo fibroblast.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510670510.4A CN105255819B (en) | 2015-10-13 | 2015-10-13 | Cynomolgus monkey TRIM5alpha gene knockdown method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510670510.4A CN105255819B (en) | 2015-10-13 | 2015-10-13 | Cynomolgus monkey TRIM5alpha gene knockdown method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105255819A CN105255819A (en) | 2016-01-20 |
| CN105255819B true CN105255819B (en) | 2019-11-08 |
Family
ID=55095750
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510670510.4A Active CN105255819B (en) | 2015-10-13 | 2015-10-13 | Cynomolgus monkey TRIM5alpha gene knockdown method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105255819B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108753775B (en) * | 2018-05-04 | 2021-08-24 | 华南农业大学 | sgRNA of targeting APOBEC3G gene and method for knocking out APOBEC3G gene of cynomolgus monkey |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101818204A (en) * | 2010-04-30 | 2010-09-01 | 中国农业科学院哈尔滨兽医研究所 | PCR method for detecting TRIMCyp genotypes of animals of macaca |
| WO2011060534A1 (en) * | 2009-11-23 | 2011-05-26 | 3R Valo Societe En Commandite | Trim5alpha mutants and uses thereof |
| WO2014026053A1 (en) * | 2012-08-09 | 2014-02-13 | The Regents Of The University Of California | Cd25 pre-selective combination anti-hiv vectors, targeting vectors, and methods of use |
| CN104357444A (en) * | 2014-10-13 | 2015-02-18 | 中国农业科学院兰州兽医研究所 | SiRNA for bovine trim5alpha gene silencing and application of siRNA |
-
2015
- 2015-10-13 CN CN201510670510.4A patent/CN105255819B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011060534A1 (en) * | 2009-11-23 | 2011-05-26 | 3R Valo Societe En Commandite | Trim5alpha mutants and uses thereof |
| CN101818204A (en) * | 2010-04-30 | 2010-09-01 | 中国农业科学院哈尔滨兽医研究所 | PCR method for detecting TRIMCyp genotypes of animals of macaca |
| WO2014026053A1 (en) * | 2012-08-09 | 2014-02-13 | The Regents Of The University Of California | Cd25 pre-selective combination anti-hiv vectors, targeting vectors, and methods of use |
| CN104357444A (en) * | 2014-10-13 | 2015-02-18 | 中国农业科学院兰州兽医研究所 | SiRNA for bovine trim5alpha gene silencing and application of siRNA |
Non-Patent Citations (1)
| Title |
|---|
| 中国饲养食蟹猴TRIM5基因多态性研究;田帅;《中国优秀硕士学位论文全文数据库.医药卫生科技辑》;20150115(第1期);第9页倒数第1段-第11页第1段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105255819A (en) | 2016-01-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bobbin et al. | RNA interference approaches for treatment of HIV-1 infection | |
| US11911458B2 (en) | HIV pre-immunization and immunotherapy | |
| Ghosh et al. | A molecular clone of HIV-1 tropic and cytopathic for human and chimpanzee lymphocytes | |
| JP2021138721A (en) | Hiv pre-immunization and immunotherapy | |
| JP2019509029A (en) | HIV vaccination and immunotherapy | |
| RU2010117741A (en) | VACCINE AGAINST CYTOMEGALOVIRUS AND METHOD FOR ITS OBTAINING | |
| CN103805635B (en) | A kind of restructuring of the siRNA based on J subgroup avian leucosis virus env gene conserved sequence interference carrier and its preparation method and application | |
| Johnson et al. | Molecular clones of SIVsm and SIVagm: experimental infection of macaques and African green monkeys | |
| CN105255819B (en) | Cynomolgus monkey TRIM5alpha gene knockdown method | |
| CN107596372A (en) | Applications of the CBX4 as the latent infections of HIV 1 activation target spot | |
| CN104928292A (en) | Design method of sgRNA and lentivirus carrier formed by sgRNA and plasmids | |
| CN102206645B (en) | Mediating method of RNAi (ribonucleic acid interference) utilizing lentiviral vector | |
| US20240115604A1 (en) | Methods of manufacturing genetically-modified lymphocytes | |
| CN116254298B (en) | Lentivirus packaging kit | |
| CN103937833B (en) | A kind of restructuring of the siRNA based on J subgroup avian leucosis virus LTR gene conserved sequence interference carrier and its preparation method and application | |
| CN115141273B (en) | Monoclonal antibody of feline calicivirus and application thereof | |
| CN100334107C (en) | Ligands | |
| CN103966259B (en) | A kind of restructuring of the siRNA based on J subgroup avian leucosis virus gag gene conserved sequence interference carrier and its preparation method and application | |
| CN103952410B (en) | The shRNA of a kind of effective suppression rat FoxO3a genetic expression and application thereof | |
| CN109266684B (en) | Method for constructing animal model with pathogen infection sensitivity | |
| CN104630221B (en) | Suppress shRNA and its recombinant vector and the application of growth of tumour cell | |
| CN108517335B (en) | A kind of Lentiviral and its construction method of liver cell miR-199b low expression | |
| CN105018524A (en) | Preparation method and kit of human stem cell with prolonged service life and enhanced angiogenesis | |
| RU98101849A (en) | HUMAN ENDOGLINE GENE PROMOTOR AND ITS APPLICATION | |
| CN104745635B (en) | A kind of method of OASL genes in silence DF-1 cell lines |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20211228 Address after: 510642 third floor, veterinary science and technology building, South China Agricultural University 483, five Shan Road, Tianhe District, Guangzhou, Guangdong. Patentee after: Guangdong Nongda Assets Management Co.,Ltd. Patentee after: Shi Hua Yang Address before: 510642 No. five, 483 mountain road, Guangzhou, Guangdong, Tianhe District Patentee before: SOUTH CHINA AGRICULTURAL University |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220517 Address after: 510525 Room 101, building 3 and building 4, No. 9, yayingshi Road, Huangpu District, Guangzhou, Guangdong Patentee after: Guangzhou high tech Zone biological research and Experimental Development Co.,Ltd. Address before: 510642 third floor, veterinary science and technology building, South China Agricultural University 483, five Shan Road, Tianhe District, Guangzhou, Guangdong. Patentee before: Guangdong Nongda Assets Management Co.,Ltd. Patentee before: Shi Hua Yang |