CN105255819A - Cynomolgus monkey TRIM5alpha gene knockdown method - Google Patents

Cynomolgus monkey TRIM5alpha gene knockdown method Download PDF

Info

Publication number
CN105255819A
CN105255819A CN201510670510.4A CN201510670510A CN105255819A CN 105255819 A CN105255819 A CN 105255819A CN 201510670510 A CN201510670510 A CN 201510670510A CN 105255819 A CN105255819 A CN 105255819A
Authority
CN
China
Prior art keywords
cynomolgus monkey
trim5alpha
sequence
target spot
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201510670510.4A
Other languages
Chinese (zh)
Other versions
CN105255819B (en
Inventor
杨世华
马瑞瑞
黄群山
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou High Tech Zone Biological Research And Experimental Development Co ltd
Original Assignee
South China Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by South China Agricultural University filed Critical South China Agricultural University
Priority to CN201510670510.4A priority Critical patent/CN105255819B/en
Publication of CN105255819A publication Critical patent/CN105255819A/en
Application granted granted Critical
Publication of CN105255819B publication Critical patent/CN105255819B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Abstract

The invention discloses a cynomolgus monkey TRIM5alpha gene knockdown method, and belongs to the technical field of biology. The method for knocking down the TRIM5alpha gene of the cynomolgus monkey comprises the following steps: 1) establishing a target sequence aiming at mRNA of the cynomolgus monkey TRIM5alpha gene; 2) synthesizing a corresponding shRNA for each site; 3) packaging the corresponding lentivirus; 4) transfecting the cynomolgus monkey embryo fibroblasts to obtain the cynomolgus monkey TRIM5alpha gene knocked-down cells. According to the invention, the knocking effect is detected and identified, the knocking effect reaches over 90 percent, and a solid foundation is laid for establishing an animal model of AIDS.

Description

A kind of method of cynomolgus monkey TRIM5alpha Knockdown
Technical field
The invention belongs to biological technical field, be specifically related to a kind of method of cynomolgus monkey TRIM5alpha Knockdown.
Background technology
TRIM5alpha (tripartitemotifprotein5alpha) is one of TRIM family member, be a kind of important limiting factor in mammalian cell, they limit in a kind of mode of species-independent the multiple retrovirus comprising HIV-1 (Humanimmunodeficiencyvirustype1) and copy.The mechanism that TRIM5 limits HIV-1 provides important scientific basis to based on the biotherapy scheme of TRIM5 molecule, drug development and vaccine design, and to set up more preferably non-human primate model of AIDS also tool be of great significance.TRIM5 has four structural domains, comprises RING, B-BOX, Coiled-Coil and SPRY; If wherein RING is destroyed partly can eliminate the restriction of TRIM5 to HIV, if B-BOX is destroyed, the restriction of TRIM5 to HIV is eliminated completely.The Gag protein binding that B-BOX can produce with HIV, and promote that it is degraded, thus suppress the generation of HIV virion.Coiled-Coil and protein complex are formed relevant.SPRY may be relevant with the identification of signal.
In sum, non-human primate cell's model of preparation TRIM5alpha Knockdown, for setting up, acquired immune deficiency syndrome (AIDS) animal model is significant.So far do not find by report same or similar with the present invention.
Summary of the invention
For overcoming the shortcoming and defect of prior art, primary and foremost purpose of the present invention is a kind of method providing cynomolgus monkey TRIM5alpha Knockdown.The present invention specifically provides a kind of three effective target sequences and verification method of cynomolgus monkey TRIM5alpha gene knockout, for people's AIDS-like disease model provides thinking.
The scheme that the present invention solves the problems of the technologies described above is as follows: a kind of method of cynomolgus monkey TRIM5alpha Knockdown, establish 3 for cynomolgus monkey TRIM5alpha gene and strike low target sequence, corresponding shRNA is synthesized for each target spot, pack corresponding slow virus, transfection cynomolgus monkey embryo fibroblast, the effect of TRIM5alpha Knockdown can reach more than 90%; Concrete steps are as follows:
1) the mRNA sequence for cynomolgus monkey TRIM5alpha gene establishes target sequence; According to the mRNA sequence of cynomolgus monkey TRIM5alpha gene, establish 3 target sequences, be all positioned at the SPRY region of TRIM5alpha gene; The sequence of target spot 1 is agcctgtatttccatatttaaat, and the sequence of target spot 2 is ctgtctcattcttcaatatcaca, and the sequence of target spot 3 is atgaaaattatcaacctaaatat;
2) corresponding shRNA is synthesized for each target spot;
The upstream primer of target spot 1 is:
TGAGCCTGTATTTCCATATTTAAATCTTCCTGTCAATTTAAATATGGAAATACAGGCTTTTTTTC，
The downstream primer of target spot 1 is:
TCGAGAAAAAAAGCCTGTATTTCCATATTTAAATTGACAGGAAGATTTAAATATGGAAATACAGGCTCA；
The upstream primer of target spot 2 is:
TGCTGTCTCATTCTTCAATATCACACTTCCTGTCATGTGATATTGAAGAATGAGACAGTTTTTTC，
The downstream primer of target spot 2 is:
TCGAGAAAAAACTGTCTCATTCTTCAATATCACATGACAGGAAGTGTGATATTGAAGAATGAGACAGCA；
The upstream primer of target spot 3 is:
TGATGAAAATTATCAACCTAAATATCTTCCTGTCAATATTTAGGTTGATAATTTTCATTTTTTTC，
The downstream primer of target spot 3 is:
GAAAAAAATGAAAATTATCAACCTAAATATTGACAGGAAGATATTTAGGTTGATAA TTTTCATCA; Anneal is carried out to above-mentioned 3 pairs of primer pairs, makes the DNA of strand be annealed into shRNA;
3) corresponding slow virus is packed;
4) infect cynomolgus monkey embryo fibroblast, obtain the embryo fibroblast of cynomolgus monkey TRIM5alpha Knockdown.
Step 1) described in the mRNA sequence of cynomolgus monkey TRIM5alpha gene be gene I/D be NM_001283295.1, establish 3 and strike low target sequence.
Step 2) corresponding shRNA is synthesized for each target spot, the upstream and downstream primer of target sequence 1 ~ 3 is all according to the principle of following hair fastener sequent synthesis: if infructescence is not start with G, then corresponding upstream sequence is TG (XXXXXXXXXXXXXXXXXXX) 19cTTCCTGTCA (XXXXXXXXXXXXXXX xXX) 19 tTTTTTC respective downstream sequence is TCGAGAAAAAA (XXXXXXXXXXXXXXXXXX) 19tGACAGGAAG ( xXXXXXXXXXXXXXXXXX) 19 the principle of CA; Wherein: in above sequence (XXXXXXXXXXXXXXXXXX) 19sequence is siRNA sequence (U is wherein replaced to T), ( xXXXXXXXXXXXXXXXXX) 19 sequence is (XXXXXXXXXXXXXXXXXX) 19the complementary sequence of sequence.
Step 2) described in anneal is carried out to above-mentioned 3 pairs of primer pairs, concrete steps are: anneal to above-mentioned 3 pairs of primer pairs, make the DNA of strand be annealed into shRNA.
Step 3) described in the corresponding slow virus of packaging, concrete steps are: according to the Lenti-Pac of U.S. GeneCopoeia (reactivation gene) tMthe specification sheets packaging slow virus of lentiviral particle package kit; By the slow virus that obtains by ultracentrifugation, eccentricity is 50000rpm/min, time 90min, after discarding supernatant, by PBS virus dilution precipitation, obtains the virus of high titre.
Step 4) described in infection cynomolgus monkey embryo fibroblast, concrete steps are: with slow virus infection cynomolgus monkey embryo fibroblast CMEF, first day empirically needs cell to spread 6 orifice plates, cell count with the 2nd day density for 50%, 37 DEG C of overnight incubation; Before within second day, infecting, ice bath melted after taking out from-80 DEG C of refrigerators, with perfect medium dilution, join in Tissue Culture Dish.Attention: mix gently, does not use vibrator; Suck the original substratum of cell, the virus liquid diluted is added in cell; Add Polybrene, final concentration 10 μ g/ml, shakes up gently, 37 DEG C of overnight incubation; Infect after 48 hours, absorb the substratum containing slow virus, be changed to fresh substratum; Continue to cultivate after 24-48 hour, obtain the cynomolgus monkey embryo fibroblast of cynomolgus monkey TRIM5alpha Knockdown.
The invention has the beneficial effects as follows:
1 provides three for cynomolgus monkey TRIM5alpha gene strikes low target spot efficiently;
2 empirical tests strike low works very well;
3 provide Experience for other Precious, Rare, Endangered primate transgenic technology researchs.
Embodiment
Below in conjunction with embodiment, the present invention is described in further detail, but embodiments of the present invention are not limited thereto.
Embodiment 1
The invention provides a kind of method of cynomolgus monkey TRIM5alpha Knockdown, concrete steps are as follows:
1) for cynomolgus monkey TRIM5alpha gene mRNA establish target sequence;According to the cynomolgus monkey TRIM5alpha gene mRNA sequence(atggcttctggaatcctgcttaatgtaaaggaggaggtgacctgtcccatctgcctggaactcctgacagaacccctgagtctgcactgcggccacagcttctgccaagcgtgcatcactgcgaaccacaagaagtccatgctatacaaagaaggagagagaagctgccctgtgtgccggatcagttaccagcctgagaacatacagcctaatcggcatgtagccaacatagtggagaagctcagggaggtcaagttgagcccagaagaggggcagaaggttgatcactgtgcacgccatggagagaaactcctactcttctgtcaggaggacagcaaggtcatttgctggctttgtgagcggtctcaggagcaccgtggtcaccacactttcctcatggaggaggttgcccaggagtaccatgtgaagctccagacagctctggagatgctgaggcagaagcagcaggaagctgaaaagttggaagctgacatcagagaagagaaagcttcctggaagattcaaatagaccacgacaaaaccaacgtcttggcagattttgagcaactgagagagatcctggaccgggaggagagcaatgagctgcagaacctggagaaggagaaagaagacattctgaaaagtcttacaaagtctgaaacgaagatggtgcagcagacccagtacgtgagagagctcatctcagatctggagcatcggttgcaggggtcaatgatggagctgctgcagggtgtggatggcatcattaaaaggattgagaacatgaccttgaagaagccaaaaacttttcacaaaaatcaaaggagagtgtttcgagctcctgatctgaaaggaatgctagacatgtttagagagctaacagatgcccgacgctactgggttgatgtgacactggctccaaacaacatttcgcatgctgtcattgctgaagataagagacaagtgagctctcggaacccacagatagtgtatcagtcaccagggacattatttcagtcactcacgaatttcaattattgtactggcgtcctgggctcccaaagtatcacatcagggaagcattactgggaggtagatgtgtccaagaaaagtgcttggatcctgggggtatgtgctggcttccaatccgatgcaatgtgtaatattgaacaaaatgaaaattatcaacctaaatatggctactgggttataggattacaggaaggagttaaatatagtgttttccaggatggttccttacatactccttttgctcctttcattgtgcccctctctgtgattatttgtcctgatcgtgttggagttttcgtagactatgaggcttgcactgtctcattcttcaatatcacaaaccatggatttctcatctataagttttctcagtgttctttttctaagcctgtatttccatatttaaatcccagaaaatgtacagtccccatgactctgtgctcaccaagctcttga)，Design of three target sequence, which both are located in SPRY area;2 ctgtctcattcttcaatatcaca 1 agcctgtatttccatatttaaat targets, targets, target 3 atgaaaattatcaacctaaatat;
2) corresponding shRNA is synthesized for each site; Principle according to hair fastener sequent synthesis: if infructescence is not start with G, then first paragraph sequence is
TG(XXXXXXXXXXXXXXXXXXX) 19CTTCCTGTCA
(XXXXXXXXXXXXXXXXXX) 19 TTTTTTC；
Second segment sequence is TCGAGAAA
AAA(XXXXXXXXXXXXXXXXXX) 19TGACAGGAAG
( xXXXXXXXXXXXXXXXXX) 19 the principle of CA.Attention: in above sequence
(XXXXXXXXXXXXXXXXXX) 19sequence is siRNA sequence (U wherein being replaced to T just passable), ( xXXXXXXXXXXXXXXXXX) 19 sequence is
(XXXXXXXXXXXXXXXXXX) 19the complementary sequence of sequence;
Therefore the upstream primer of target spot 1 is:
TGAGCCTGTATTTCCATATTTAAATCTTCCTGTCAATTTAAATATGGAAATACAGGCTTTTTTTC，
The downstream primer of target spot 1 is:
TCGAGAAAAAAAGCCTGTATTTCCATATTTAAATTGACAGGAAGATTTAAATATGGAAATACAGGCTCA；
The upstream primer of target spot 2 is:
TGCTGTCTCATTCTTCAATATCACACTTCCTGTCATGTGATATTGAAGAATGAGACAGTTTTTTC，
The downstream primer of target spot 2 is:
TCGAGAAAAAACTGTCTCATTCTTCAATATCACATGACAGGAAGTGTGATATTGAAGAATGAGACAGCA；
The upstream primer of target spot 3 is:
TGATGAAAATTATCAACCTAAATATCTTCCTGTCAATATTTAGGTTGATAATTTTCATTTTTTTC，
The downstream primer of target spot 3 is:
GAAAAAAATGAAAATTATCAACCTAAATATTGACAGGAAGATATTTAGGTTGATAATTTTCATCA
3) above-mentioned DNAOligos is annealed, make the DNA of strand be annealed into shRNA and short hairpin RNA;
4) corresponding slow virus is packed; According to the Lenti-Pac of U.S. GeneCopoeia (reactivation gene) tMthe specification sheets packaging slow virus of lentiviral particle package kit.By the slow virus that obtains by ultracentrifugation, eccentricity is 50000rpm/min, time 90min, after discarding supernatant, precipitate by PBS virus dilution, obtain the virus (wherein: corresponding No. 1 slow virus of target spot 1shRNA, corresponding No. 2 slow viruss of target spot 2shRNA, corresponding No. 3 slow viruss of target spot 3shRNA) of high titre;
5) cynomolgus monkey embryo fibroblast is infected; With slow virus infection cynomolgus monkey embryo fibroblast CMEF, first day empirically needs cell to spread 6 orifice plates, cell count with the 2nd day density for 50%, 37 DEG C of overnight incubation; Before within second day, infecting, ice bath melted after taking out from-80 DEG C of refrigerators, with perfect medium dilution, join in Tissue Culture Dish.Attention: mix gently, does not use vibrator; Suck the original substratum of cell, the virus liquid diluted is added in cell; Add Polybrene, final concentration 10 μ g/ml, shakes up gently, 37 DEG C of overnight incubation; Infect after 48 hours, absorb the substratum containing slow virus, be changed to fresh substratum; Continue to cultivate after 24-48 hour, obtain the cynomolgus monkey embryo fibroblast of cynomolgus monkey TRIM5alpha Knockdown.
6) low effect is struck in detection; With GFP green fluorescent protein on lentiviral vectors, observe GFP green fluorescence with inverted fluorescence microscope at virus infection after 96 hours, to observe the infection conditions of virus to object cell; With the cell sorting that the bucketing of BDinfluxcellsorter cell sorter is low, what obtain 100%GFP strikes low cell.The low cell of bucketing does qPCR checking.
Result shows, and striking low efficiency to be respectively No. 1 slow virus be 90.2%, No. 2 slow viruss be 95.1%, No. 3 slow viruss is 92.7%.Result shows that the method for cynomolgus monkey TRIM5alpha Knockdown of the present invention has and higher strikes poor efficiency.
Above-described embodiment is the present invention's preferably embodiment; but embodiments of the present invention are not restricted to the described embodiments; change, the modification done under other any does not deviate from spirit of the present invention and principle, substitute, combine, simplify; all should be the substitute mode of equivalence, be included within protection scope of the present invention.

Claims (5)

1. the method for a cynomolgus monkey TRIM5alpha Knockdown, it is characterized in that: 3 for cynomolgus monkey TRIM5alpha gene are struck low target sequence, corresponding shRNA is synthesized for each target spot, pack corresponding slow virus, transfection cynomolgus monkey embryo fibroblast, the effect of TRIM5alpha Knockdown can reach more than 90%; Concrete steps are as follows:
1) the mRNA sequence for cynomolgus monkey TRIM5alpha gene establishes target sequence; According to the mRNA sequence of cynomolgus monkey TRIM5alpha gene, establish 3 target sequences, be all positioned at the SPRY region of TRIM5alpha gene; The sequence of target spot 1 is as shown in SEQIDNO:1, and the sequence of target spot 2 is as shown in SEQIDNO:2, and the sequence of target spot 3 is as shown in SEQIDNO:3;
2) corresponding shRNA is synthesized for each target spot;
The upstream primer sequence of target spot 1 is as shown in SEQIDNO:4;
The downstream primer sequence of target spot 1 is as shown in SEQIDNO:5;
The upstream primer sequence of target spot 2 is as shown in SEQIDNO:6;
The downstream primer sequence of target spot 2 is as shown in SEQIDNO:7;
The upstream primer sequence of target spot 3 is as shown in SEQIDNO:8;
The downstream primer sequence of target spot 3 is as shown in SEQIDNO:9;
Anneal is carried out to above-mentioned 3 pairs of primer pairs, makes the DNA of strand be annealed into shRNA;
3) corresponding slow virus is packed;
4) infect cynomolgus monkey embryo fibroblast, obtain the cynomolgus monkey embryo fibroblast of cynomolgus monkey TRIM5alpha Knockdown.
2. the method for cynomolgus monkey TRIM5alpha Knockdown according to claim 1, it is characterized in that: step 1) described in the gene of the mRNA sequence of cynomolgus monkey TRIM5alpha gene to be gene I/D be NM_001283295.1, establish three and strike low target sequence efficiently.
3. the method for cynomolgus monkey TRIM5alpha Knockdown according to claim 1, is characterized in that: step 2) described in anneal is carried out to above-mentioned 3 pairs of primer pairs, make the DNA of strand be annealed into shRNA.
4. the method for cynomolgus monkey TRIM5alpha Knockdown according to claim 1, is characterized in that: step 3) described in the corresponding slow virus of packaging, concrete steps are: according to the Lenti-Pac of U.S. GeneCopoeia tMthe specification sheets packaging slow virus of lentiviral particle package kit; By the slow virus that obtains by ultracentrifugation, eccentricity is 50000rpm/min, time 90min, after discarding supernatant, by PBS virus dilution precipitation, obtains the virus of high titre.
5. the method for cynomolgus monkey TRIM5alpha Knockdown according to claim 1, it is characterized in that: step 4) described in infection cynomolgus monkey embryo fibroblast, concrete steps are: with slow virus infection cynomolgus monkey embryo fibroblast CMEF, first day empirically needs cell to spread 6 orifice plates, cell count with the 2nd day density for 50%, 37 DEG C of overnight incubation; Before within second day, infecting, ice bath melted after taking out from-80 DEG C of refrigerators, with perfect medium dilution, join in Tissue Culture Dish; Attention: mix gently, does not use vibrator; Suck the original substratum of cell, the virus liquid diluted is added in cell; Add Polybrene, final concentration 10 μ g/ml, shakes up gently, 37 DEG C of overnight incubation; Infect after 48 hours, absorb the substratum containing slow virus, be changed to fresh substratum; Continue to cultivate after 24-48 hour, obtain the cynomolgus monkey embryo fibroblast of cynomolgus monkey TRIM5alpha Knockdown.
CN201510670510.4A 2015-10-13 2015-10-13 Cynomolgus monkey TRIM5alpha gene knockdown method Active CN105255819B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510670510.4A CN105255819B (en) 2015-10-13 2015-10-13 Cynomolgus monkey TRIM5alpha gene knockdown method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510670510.4A CN105255819B (en) 2015-10-13 2015-10-13 Cynomolgus monkey TRIM5alpha gene knockdown method

Publications (2)

Publication Number Publication Date
CN105255819A true CN105255819A (en) 2016-01-20
CN105255819B CN105255819B (en) 2019-11-08

Family

ID=55095750

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510670510.4A Active CN105255819B (en) 2015-10-13 2015-10-13 Cynomolgus monkey TRIM5alpha gene knockdown method

Country Status (1)

Country Link
CN (1) CN105255819B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108753775A (en) * 2018-05-04 2018-11-06 华南农业大学 The method for targeting the sgRNA and machin APOBEC3G gene knockouts of APOBEC3G genes

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101818204A (en) * 2010-04-30 2010-09-01 中国农业科学院哈尔滨兽医研究所 PCR method for detecting TRIMCyp genotypes of animals of macaca
WO2011060534A1 (en) * 2009-11-23 2011-05-26 3R Valo Societe En Commandite Trim5alpha mutants and uses thereof
WO2014026053A1 (en) * 2012-08-09 2014-02-13 The Regents Of The University Of California Cd25 pre-selective combination anti-hiv vectors, targeting vectors, and methods of use
CN104357444A (en) * 2014-10-13 2015-02-18 中国农业科学院兰州兽医研究所 SiRNA for bovine trim5alpha gene silencing and application of siRNA

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011060534A1 (en) * 2009-11-23 2011-05-26 3R Valo Societe En Commandite Trim5alpha mutants and uses thereof
CN101818204A (en) * 2010-04-30 2010-09-01 中国农业科学院哈尔滨兽医研究所 PCR method for detecting TRIMCyp genotypes of animals of macaca
WO2014026053A1 (en) * 2012-08-09 2014-02-13 The Regents Of The University Of California Cd25 pre-selective combination anti-hiv vectors, targeting vectors, and methods of use
CN104357444A (en) * 2014-10-13 2015-02-18 中国农业科学院兰州兽医研究所 SiRNA for bovine trim5alpha gene silencing and application of siRNA

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
田帅: "中国饲养食蟹猴TRIM5基因多态性研究", 《中国优秀硕士学位论文全文数据库.医药卫生科技辑》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108753775A (en) * 2018-05-04 2018-11-06 华南农业大学 The method for targeting the sgRNA and machin APOBEC3G gene knockouts of APOBEC3G genes
CN108753775B (en) * 2018-05-04 2021-08-24 华南农业大学 sgRNA of targeting APOBEC3G gene and method for knocking out APOBEC3G gene of cynomolgus monkey

Also Published As

Publication number Publication date
CN105255819B (en) 2019-11-08

Similar Documents

Publication Publication Date Title
Pessi et al. A general strategy to endow natural fusion-protein-derived peptides with potent antiviral activity
JP2022166288A (en) HIV pre-immunization and immunotherapy
JP2022101658A (en) HIV vaccination and immunotherapy
JP2021138721A (en) Hiv pre-immunization and immunotherapy
US11920147B2 (en) Genomic RNA packaging enhancer element
JP2019500030A5 (en)
RU2010117741A (en) VACCINE AGAINST CYTOMEGALOVIRUS AND METHOD FOR ITS OBTAINING
JP2019535302A (en) CAR-T gene recombination vector and its construction method and use for alleviating CRS blocked with IL6R
JP2011520424A5 (en)
CN103805635B (en) A kind of restructuring of the siRNA based on J subgroup avian leucosis virus env gene conserved sequence interference carrier and its preparation method and application
CN104694576B (en) A kind of method of IFNAR1 genes in 1 cell lines of silence DF
JP2016528878A (en) Avian cells for improved virus production
CN107596372A (en) Applications of the CBX4 as the latent infections of HIV 1 activation target spot
CN102206645B (en) Mediating method of RNAi (ribonucleic acid interference) utilizing lentiviral vector
CN105255819A (en) Cynomolgus monkey TRIM5alpha gene knockdown method
Wang et al. Endogenous retroviruses in development and health
CN104762322B (en) A kind of reverse transcription virus gene transfer system for prawn cell
CN103952410B (en) The shRNA of a kind of effective suppression rat FoxO3a genetic expression and application thereof
CN116254298A (en) Lentivirus packaging titer kit
CN103966259B (en) A kind of restructuring of the siRNA based on J subgroup avian leucosis virus gag gene conserved sequence interference carrier and its preparation method and application
CN103937833B (en) A kind of restructuring of the siRNA based on J subgroup avian leucosis virus LTR gene conserved sequence interference carrier and its preparation method and application
CN109735543A (en) A kind of GLI2-shRNA and application thereof
JP2021519069A (en) Method for producing genetically modified lymphocytes
CN113943734B (en) Antisense oligonucleotide against coronavirus and pharmaceutical use thereof
CN113736742B (en) Application of PRTN3 gene as target for activating cytotoxic immune cells in tumor immunotherapy

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right

Effective date of registration: 20211228

Address after: 510642 third floor, veterinary science and technology building, South China Agricultural University 483, five Shan Road, Tianhe District, Guangzhou, Guangdong.

Patentee after: Guangdong Nongda Assets Management Co.,Ltd.

Patentee after: Shi Hua Yang

Address before: 510642 No. five, 483 mountain road, Guangzhou, Guangdong, Tianhe District

Patentee before: SOUTH CHINA AGRICULTURAL University

TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20220517

Address after: 510525 Room 101, building 3 and building 4, No. 9, yayingshi Road, Huangpu District, Guangzhou, Guangdong

Patentee after: Guangzhou high tech Zone biological research and Experimental Development Co.,Ltd.

Address before: 510642 third floor, veterinary science and technology building, South China Agricultural University 483, five Shan Road, Tianhe District, Guangzhou, Guangdong.

Patentee before: Guangdong Nongda Assets Management Co.,Ltd.

Patentee before: Shi Hua Yang

TR01 Transfer of patent right