CN104928292A - Design method of sgRNA and lentivirus carrier formed by sgRNA and plasmids - Google Patents

Abstract

The invention relates to a design method of an sgRNA and a lentivirus carrier formed by the sgRNA and plasmids. In the method, the design length of the sgRNA is 17bp or 18bp, and the tail end of the sgRNA is provided with a G or A; the target sequence is (N16)GNGG, (N16)ANGG, (N16)CNCC or (N16)TNCC; when a first basic group is A, C or T, g is additionally arranged in front of the first basic group. Whether a similar sequence exists in a gene group is searched in a TagScan database; when the sgRNA with the length of 17bp is additionally provided with a completely-matched sequence, the sgRNA is abandoned, and other appropriate sequences are tested; for the sgRNA which is 18bp long, when only one non-matched nucleotide is provided, the sgRNA is also abandoned, and other sequences with the designed sgRNA are continuously tested. The method for designing the sgRNA is optimized, the high knock-out efficiency and low target missing or no target missing can be realized.

Description

The method of design of a kind of sgRNA and the lentiviral vectors of structure, plasmid

Technical field

The invention belongs to gene editing and carrier design field, the method for design being specifically related to a kind of sgRNA and the target containing CRISPR/Cas9 system knock out optimization design and the application of plasmid and lentiviral vectors.

Background technology

CRISPR (Clustered regularly interspaced short palindromic repeats); be called as the short palindrome in rule cluster interval to repeat; in fact be exactly a kind of gene editing device; be bacterium in order to protect self to a phage-resistant system, be also a kind of genetic weapon tackling assailant.A series of reports are in the past few years pointed out, it can be used for deleting, add, activate or suppress the target gene of other biological body, and these target genes comprise the gene in people, mouse, zebra fish, bacterium, fruit bat, yeast, nematode and crop plant cells.

CRISPR bunch is a special repetitive dna sequence family being extensively present in bacterium and Archimycetes genome, and its sequence is by a leader (Leader), multiple short and the tumor-necrosis factor glycoproteins district (Repeat) of high conservative and multiple transcribed spacer (Spacer) form.Leader is generally positioned at CRISPR bunch of upstream, is to be rich in the region that AT length is 300 ~ 500bp, and being considered to may be the promoter sequence of CRISPR bunch.Tumor-necrosis factor glycoproteins section length is 21 ~ 48bp, containing palindromic sequence, can form hairpin structure.The transcribed spacer being 26 ~ 72bp by length between tumor-necrosis factor glycoproteins separates.Spacer region is made up of the foreign DNA of capturing, similar immunological memory, when foreign DNA invasion containing same sequence, can by bacterium identification, and carry out shearing and make it expression silencing, reach protection inherently safe object.By finding to there is a polymorphism family gene in its vicinity to the flanking sequence analysis of CRISPR bunch.The protein of this family coding is all containing the functional domain can had an effect with nucleic acid (having nuclease, helicase, intergrase and polysaccharase isoreactivity), and jointly play a role with CRISPR region, therefore be named as CRISPR associated gene (CRISPR associated), be abbreviated as Cas.The Cas of current discovery comprises the broad varietys such as Cas1 ~ Cas10.Cas gene and CRISPR common evolutionary, form the system of a high conservative.

The principle of work of CRISPR is, when resisting the foreign DNA invasions such as phage when bacterium, under the regulation and control of leader, CRISPR is transcribed into long RNA precursor (Pre RISPR RNA, pre-crRNA), then be processed into a series of short ripe crRNA containing conservative tumor-necrosis factor glycoproteins and transcribed spacer, finally identify and be attached on the exogenous DNA array with its complementation and play shearing action.The CRISPR/Cas system of current discovery has three kinds of dissimilar i.e. I type, II type and type III, and they are present in about 40% eubacterium of having checked order and 90% archeobacteria checked order.Wherein the composition of II type is comparatively simple, forms for core with Cas9 albumen and guide RNA (gRNA), is also the type that research is the most deep at present.

In II type system, the processing of pre-crRNA is participated in separately by the Cas9 in Cas family.Cas9 contains the avtive spot of HNH2 uniqueness in the middle part of aminoterminal RuvC and protein, plays a role in crRNA maturation and double-stranded DNA are sheared.In addition, while pre-crRNA transcribes, also transcribe out with the trans-activation crRNA (Trans-activating crRNA, tracrRNA) of its tumor-necrosis factor glycoproteins complementation, and excite Cas9 and double-stranded RNA specificity RNase III nuclease to process pre-crRNA.After processing maturation, crRNA, tracrRNA and Cas9 form complex body, identify and be incorporated into the sequence of crRNA complementation, then untie DNA double chain, form R-loop, make crRNA and complementary strand thereof, another chain keeps free single-chain state, then sheared the complementary dna chain of crRNA by the HNH avtive spot in Cas9, RuvC avtive spot shears incomplementarity chain, finally causes DNA double splitting of chain (DSB).The shearing site of CRISPR/Cas9 is arranged in the NGG site of the 5'-N20-NGG-3' character zone in contiguous PAM district (Protospacer Adjacent Motif), crRNA complementary sequence downstream, and the sequence of this feature just repeats once in the random dna sequence of every 8bp.

With carry out compared with other genetic engineering modified any method in past many decades, the advantage of CRISPR technology is that it uses single enzyme.This enzyme does not need each point changing target setting, and only need the different RNA copy of use one to update it, this is easy to Design and implementation.For promoting the widespread use of CRISPR-Cas9 gene editing technology, improve cutting efficiency further very necessary.In addition, also there is problem of missing the target in this technology at present, because have been found that for length be the sgRNA of 20bp, even if there be 3-4 non-matching base sequence, also may have cutting effect.Therefore an object of the present invention is exactly how to design efficient, the low sgRNA missed the target.

The George Church research group of Harvard Medical School generates a kind of Cas9 mutant, and it can not cause double-strand break, and each breach only affects a DNA chain.If use 2 sgRNA to identify the target sequence closed on, this strategy can cause double-strand break, but its insertion that non-homologous end joining (a kind of cellular repair mechanisms of double-strand break) usually can not be caused to cause or deletion.Therefore, this method can reduce effect of missing the target.But this method can need 2 sgRNA to act on, and makes system complexity increase, is awkward.In order to overcome this deficiency, solution of the present invention is, the length of sgRNA is reduced to 17bp from 20 oligonucleotide.We find, as long as there is a Nucleotide not mate, the almost completely dissolve of gene knockout effect, therefore greatly can reduce effect of missing the target.

Lentiviral vectors is one of the most promising gene transfer method in gene therapy.Slow virus (Lentivirus) carrier is the gene therapy vector grown up based on HIV-1 (human immune deficiency I C-type virus C).Lentiviral vectors has wider host range compared with retroviral vector, and slow virus effectively can infect the cell after the cell and mitotic division not entering the cell cycle.Lentiviral comprises the genetic information required for packaging, transfection, stable integration.After slow virus packaging plasmid transcription and translation, provide all accessory proteins required for the Pseudovirion vector of all packaging RNA and restructuring.Foreign gene can be incorporated on host chromosome by this carrier effectively, thus reaches persistence expression.For the cell of some more difficult transfections, as neuronal cell, liver cell, myocardial cell, tumour cell, endotheliocyte, stem cell, undifferentiated cell etc., can greatly improve goal gene transduction efficiency.And the probability that goal gene is incorporated into host cell gene group also increases greatly, thus reach good gene therapy or gene knockout effect.Carried out the clinical study of lentiviral gene treatment in the U.S., effect is ideal, therefore has broad application prospects.

Third generation slow virus packaging system is made up of a goal gene plasmid, two packaging plasmids, envelope plasmid.Wherein packaging plasmid is under the control of CMV promoter, expresses HIV and copies required whole trans-activators, but do not produce virus envelope protein and accessory protein vpu; The plasmid-encoded vesicular stomatitis virus G-protein (VSVG) of envelope protein, the false configuration lentiviral vectors of application VSVG coating expands the target cell tropism of carrier, and add the stability of carrier, allow to be concentrated carrier by high speed centrifugation, improve titre; Except containing the cis sequence needed for packaging, reverse transcription and integration in transferring plasmid, also retain gag and RRE of 350bp, and insert goal gene or marker gene (as green fluorescent protein GFP) wherein.For producing the virion of high titre, need utilization will carry lentiviral vectors and the packaging plasmid cotransfection 293T cell simultaneously of goal gene/sgRNA, the packaging of virus is carried out in cell, packaged pseudovirion is secreted in extracellular substratum, after centrifuging and taking obtains supernatant liquor, concentrate and can obtain infectious titer.After the infection of host cell, goal gene enters into host cell, through reverse transcription, is incorporated into genome, thus high-caliber expression effect molecule.

Summary of the invention

An object of the present invention is a kind of method providing sgRNA to design;

Two of object of the present invention is to provide the lentiviral vectors that can realize high efficiency gene and knock out;

Three of object of the present invention is to provide the transient transfection plasmid that can realize high efficiency gene and knock out.

The technical solution used in the present invention is:

A method of design of sgRNA, in the method, the length of sgRNA design is that the end of 17bp or 18bp, sgRNA is with G or A; Target sequence is (N16) GNGG, (N16) ANGG, (N16) CNCC or (N16) TNCC; When first base is A, C or T, add g above.

Further, the method also comprises: in TagScan ((Genome_wide Tag Scanner) http://ccg.vital-it.ch/tagger/tagscan.html) database, whether have similar sequence in muca gene group; For long (as the GN15G) NGG of 17bp) sgRNA, when separately there being the sequence of mating completely, abandon this sgRNA, then test other proper sequence; For long (as the gN16G) NGG of 18bp) sgRNA, when separately having and only having the sequence of 1 non-matching nucleotide acid, also abandon this sgRNA, other have the sgRNA sequence of design to continue test.

Preferably, in the design of this sgRNA, GC content is 40-80%.

More preferably, target sequence is positioned at middle-end or the front end of ORF encoding sequence.

Preferably, in the design of this sgRNA, the end of sgRNA is with G, and target sequence is (N16) GNGG or (N16) CNCC.

CRISPR editing system uses the Cas9 (SpyCas9) deriving from Streptococcus pyogenes bacterium.PAM (the protospacer adjacent motif) site of NGG is there is in this system requirements at 3 ' end of target sequence.Extensive examination finds, the potency due of the nucleotide pair sgRNA in NGG front end is very big: if G, then most effective; If A, efficiency is secondary high.Therefore, for strengthening sgRNA target practice efficiency, the end of the sgRNA designed by us is with G or A.Target sequence is (N16) GNGG, (N16) ANGG, (N16) CNCC or (N16) TNCC.On average every 16 base pairs just can design a sgRNA optimized.Because U6 promotor must be transcribed from G, if first base is A, C or T, add g above.

Method of design of the present invention, significantly reduces efficiency of missing the target, but still can keep very high target practice efficiency.(we find, the shortest length of sgRNA is 17bp, as long as when length is 16bp or when having 1 Nucleotide not mate, and target practice event resolves.Based on this, the sgRNA of our design is long is 17bp or 18bp (for the 17bp sequence that non-G is initial, needing to add that in front end G is to be conducive to U6 promoter transcription tiny RNA)).

For sgRNA and Cas9 is effectively proceeded to cell, the most efficient method utilizes lentiviral vectors, and this method can be widely used in fundamental research or library screening.Some are not wished to the application of vector integration, need to utilize plasmid transfection.

Present invention also offers a kind of Cas9-sgRNA lentiviral vectors, in cloning procedure, following element is inserted in lentiviral vectors skeleton successively: U6, sgRNA, EF1, Cas9,2A, Puro, WPRE.The expression of sgRNA is driven by human U_6 promoter.Humanization (coding is optimized) Cas9 and Puro (puromycin resistance gene) is by EF1 promoters driven.Cas9 and Puro links by from fracture polypeptide 2A, and such promotor can drive two or more genetic expression.Wpre is positioned at Cas9 and Puro downstream, can improve rna stability, thus increases expression level.

The building process of this Cas9-sgRNA lentiviral vectors: initial carrier is Lenti EF1-GFP-wpre, pcr amplification obtains the slow virus skeleton not having EF1-GFP original paper.U6 promotor, sgRNA skeleton, EF1 promotor, Cas9,2A, puro obtain respective segments after pcr amplification.When the design of PCR primer, add ~ homologous recombination the arm of 30bp, so that assembling.Finally use Gibson cloning Kit (NEB) fits together various element.Detailed process is carried out according to test kit operation instructions.Select 5-10 E.Coli clone to carry out enzyme and cut and check order.Result shows, and major part is correct clone.The sequence of each element sees below.

Present invention also offers a kind of Cas9-sgRNA transient transfection plasmid

(pU6-sgRNA-EF1-Cas9-2A-Puro-Wpre-PolyA), the building process of this Cas9-sgRNA transient transfection plasmid is: U6-sgRNA-EF1-Cas9-2A-Puro-Wpre original paper comes from Cas9-sgRNA lentiviral vectors through pcr amplification, when the design of PCR primer, add ~ homologous recombination the arm of 30bp, so that assembling, utilize Gibson cloning Kit (NEB) assembles several element.The common original paper of plasmid (comprising plasmid replication starting point and ampicillin resistance gene and β-Nei acyl ammonia enzyme gene) obtains from pUC plasmid.PolyA sequence increases from pCEP4 plasmid or directly synthesis obtains.Detailed process is carried out according to test kit operation instructions.Select 5-10 E.Coli clone to carry out enzyme and cut and check order.Result shows, and major part is correct clone.The sequence of each element sees below.

Wherein the sequence of each element is:

SgRNA (GN16) sequence is as shown in SEQ ID NO:1;

SgRNA (GN17) sequence is as shown in SEQ ID NO:2;

Cas9 sequence is as shown in SEQ ID NO:3;

2A sequence is as shown in SEQ ID NO:4;

Puro sequence is as shown in SEQ ID NO:5;

U6 promoter sequence is as shown in SEQ ID NO:6;

EF1 promoter sequence is as shown in SEQ ID NO:7;

WPRE sequence is as shown in SEQ ID NO:8;

PolyA sequence is as shown in SEQ ID NO:9.

The beneficial effect that the present invention has:

The invention discloses a kind of method of optimization design sgRNA, height can be caused to knock out efficiency but lowly to miss the target or without missing the target.The present invention have also been devised a kind of slow virus knockout carrier, cell transduction and screening after, knocking out efficiency is more than 80%, reaches as high as 98%.The present invention have also been devised nonconformity pUC pUC, and knocking out efficiency can reach 50%.These carriers may be used for site-directed point mutation, gene knockout and gene knock-in, for gene therapy is laid a good foundation.

Accompanying drawing explanation

Fig. 1 is the diagram of security from inactivation (self-inactivating (SIN)) lentiviral vectors.

Wherein Δ represents SIN design, namely deletes the partial sequence of 3 ' end long terminal repeat (LTR); CPPT, central polypurine tract; Wpre, post-transcriptional regulatory element (come from the post-transcriptional control sequence of woodchuck hepatitis virus, it can improve the stability of RNA, thus increases gene expression dose); RRE, rev-responsive element; ψ, packaging signal; EF1, Elongation factor-1alpha (EF-1 A promotor); E2A (2A), rupture peptide sequence certainly; The codon of Cas9 passes through to be optimized, to be increased in the expression in mammalian cell.

Fig. 2 is that Cas9 and sgGFP carries out expressing (pEF1-Cas9puro-wpre-polyA and pU6-sgGFP) with 2 plasmids respectively; And two-in-one system, namely a plasmid expresses the representative flow cytometric analysis results figure that Cas9 and sgGFP (pU6-sgGFP-EF1-Cas9puro) knocks out GFP in 293T cell simultaneously.Negative control is the cell that untransfected knocks out plasmid.

Fig. 3 is that Cas9 and sgGFP carries out expressing (pEF1-Cas9puro-wpre-polyA and pU6-sgGFP) with 2 plasmids respectively; And two-in-one system, namely a plasmid expresses the representative flow cytometry statistics figure that Cas9 and sgGFP (pU6-sgGFP-EF1-Cas9puro) knocks out GFP in 293T cell simultaneously.Negative control is the cell that untransfected knocks out plasmid.

Fig. 4 is that Cas9 and sgGFP carries out expressing (pEF1-Cas9puro-wpre-polyA and pU6-sgGFP) with 2 plasmids respectively; And two-in-one system, namely a plasmid expresses Cas9 and sgGFP (pU6-sgGFP-EF1-Cas9puro) simultaneously, 293T cell transfecting plasmid is after 3 days, and results comprise the total serum IgE of Microrna, then with the result figure detecting Cas9 expression level with quantitative RT-PCR.Negative control is the cell that untransfected knocks out plasmid.

Embodiment

Below in conjunction with specific examples, the invention will be further described, but do not limit protection scope of the present invention.

Hand-designed method for the sgRNA of target particular sequence: find NGG in known array or its reverse complementation (reverse complement) sequence, 17, NGG front end oligonucleotide is exactly the target practice sequence of sgRNA.If first Nucleotide is non-G, add g (overall length becomes 18bp) above.Preferred G or A of last Nucleotide.Then in TagScan (http://ccg.vital-it.ch/tagger/tagscan.html) database, search in specific gene group whether have similar sequence.Search sequence to be length be 17 or the sgRNA of 18bp add NGG sequence.For long (as the gN16) NGG of 17bp) sgRNA, when separately there being the sequence of mating completely, abandon this sgRNA, then test other proper sequence; For the sgRNA of 18bp long (as gN17NGG), when separately having and only having the sequence of 1 non-matching nucleotide acid, also abandon this sgRNA, continue sgRNA sequences of other designs of test.

The design software of sgRNA for knocking out specific gene: existing various software can design length be the sgRNA sequence of 20bp, and we are preferred Chopchop (https: //chopchop.rc.fas.harvard.edu/).The sgRNA of any gene comprising the species such as people, mouse, rat can be knocked out with the design of this network software.This software also can design any DNA sequence of manual input.The sgRNA length of design is 20bp, removes front 3 bases and can obtain the sgRNA that length is 17bp.If first Nucleotide is non-G, add g (overall length becomes 18bp) above.Preferred G or A of last Nucleotide.Then in TagScan (http://ccg.vital-it.ch/tagger/tagscan.html) database, search in specific gene group whether have similar sequence.Search sequence to be length be 17 or the sgRNA of 18bp add NGG sequence.For long (as the gN16) NGG of 17bp) sgRNA, when separately there being the sequence of mating completely, abandon this sgRNA, then test other proper sequence; For the sgRNA of 18bp long (as gN17NGG), when separately having and only having the sequence of 1 non-matching nucleotide acid, also abandon this sgRNA, continue sgRNA sequences of other designs of test.

The clone of sgRNA carrier: according to the sgRNA target practice sequence of design, both sides increase homologous recombination arm 25-30bp (left side is U6 sequence, and the right is sgRNA skeleton).The companies such as IDT can synthetic oligonucleotide, obtains length to be the ~ product of 70bp after pcr amplification.After sgRNA cloning vector BbsI enzyme is cut, run glue and reclaim the skeleton that DNA obtains clone.PCR primer and sgRNA carrier framework Gibson cloning Kit (NEB) assembles.For each carrier, select 2-4 clone, little carry after carry out DNA sequencing analysis.Result shows, the sgRNA carrier sequence of 80% is entirely true.

The preparation of lentiviral vectors:

First with enzyme cut, PCR or direct synthesis method obtain following fragment:

Slow virus skeleton: cut at 37 DEG C of enzymes that spend the night and remove EF1-GFP element (residual Wpre element) from lentiviral vectors: endonuclease NheI and PmeI each 2ul, 5ug Lenti EF1-GFP-wpre plasmid, 5ul 10x damping fluid, 36ul water.70V ran glue after 2 hours, cut correct band (6.1kb), extracted DNA with Qiagen DNA purification column.

U6-sgBBS: synthetic (IDT), sequence is as shown in SEQ ID NO:10; (U6 promotor-sgBbs1-sgRNA skeleton).

EF1:PCR primer sequence EF1-F:GGCTCCGGTGCCCGTCA; EF1-R:GGCGATCGCTCACGACAC.Template is 5ng Lenti EF1-GFP-wpre plasmid.PCR is carried out with KAPA HIFI polysaccharase.Condition is: 98 DEG C, 2min; 98 DEG C of 10sec, 60 DEG C of 30sec, 72 DEG C of 20sec, 30cycles.After reaction terminates, add 1ul restriction endonuclease DpnI and hatch 30min at 37 DEG C, to remove template plasmid.70V ran glue after 1 hour, cut correct band (1.2kb), extracted DNA with Qiagen DNA purification column.

Cas9: synthetic (IDT), as shown in SEQ ID NO:3.Then PCR is carried out with the plasmid of synthetic.Primer sequence Cas9-F:TCTTCCATTTCAGGTGTCGTGAGCGATCGCCATGGCCCCAAAGAAGAAG C, Cas9-R:AATTTCAAGAGAGCATAATTAGTACACTGACGCGTCTTTTTCTTTTTTG CCTGGCC.PCR is carried out with KAPA HIFI polysaccharase.Condition is: 98 DEG C, 2min; 98 DEG C of 10sec, 60 DEG C of 30sec, 72 DEG C of 70sec, 4cycles; 98 DEG C of 10sec, 68 DEG C of 30sec, 72 DEG C of 70sec, 25cycles.After reaction terminates, add 1ul restriction endonuclease DpnI and hatch 30min at 37 DEG C, to remove template plasmid.70V ran glue after 1 hour, cut correct band (4.2kb), extracted DNA with Qiagen DNA purification column.

E2A-Puro:PCR primer sequence F1:CAGTGTACTAATTATGCTCTCT, R:attttgtaatccaGAGGTTGATTG.Template is 5ng Lenti EF1-E2A-Puro-wpre.PCR is carried out with KAPA HIFI polysaccharase.Condition is: 98 DEG C, 2min; 98 DEG C of 10sec, 60 DEG C of 30sec, 72 DEG C of 15sec, 30cycles.After reaction terminates, add 1ul restriction endonuclease DpnI and hatch 30min at 37 DEG C, to remove template plasmid.70V ran glue after 1 hour, cut correct band (697bp), extracted DNA with Qiagen DNA purification column.

Finally use Gibson cloning Kit (NEB) fits together various element.In 20ul system, add 100ng slow virus skeleton, 15ng U6-sgBBS, 30ng EF1,100ngCas9 and 20ng E2A-Puro.30min is hatched at 50 DEG C.Get 1ul to transform.E.Coli is after 37 DEG C of incubated overnight, and random choose 10 carries out little carrying after being cloned in and cultivating in 1-2 milliliter LB substratum, and then enzyme cuts the correct clone of qualification, and carries out Sanger order-checking and examine.Finally choose correct clone to carry greatly.This plasmid Lenti-U6-sgBbsI-EF1-Cas9-E2A-Puro-wpre can be used as sgRNA slow virus skeleton and is cloned into any sgRNA sequence.

Clone other slow virus sgRNA carrier:

Spend the night digested plasmid Lenti-U6-sgBbsI-EF1-Cas9-E2A-Puro-wpre:5ug plasmid, 3ul restriction endonuclease BbsI, 5ul 10x damping fluid, 37ul water.70V ran glue after 2 hours, cut correct band (12.6kb), extracted DNA with Qiagen DNA purification column.

Synthetic template.SgRNA template is TATATATCTTGTGGAAAGGACGAAACACCG NNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAG CAAG TTAAAAT.PCR primer sequence sgRNA-F:TATATATCTTGTGGAAAGGACGAA, sgRNA-R:ATTTTAACTTGCTATTTCTAGCTCTAA.PCR is carried out with KAPA HIFI polysaccharase.Condition is: 98 DEG C, 2min; 98 DEG C of 5sec, 60 DEG C of 20sec, 20cycles.70V ran glue after 1 hour, cut correct band (~ 80bp), extracted DNA with Qiagen DNA purification column.

Finally use Gibson cloning Kit (NEB) fits together various element.In 20ul system, add 100ng slow virus sgRNA carrier framework, 10ng sgRNA.15min is hatched at 50 DEG C.Get 1ul to transform.E.Coli is after 37 DEG C of incubated overnight, and random choose 3 carries out little carrying after being cloned in and cultivating in 1-2 milliliter LB substratum, then carries out Sanger order-checking and examines.Sequencing primer is U6-F:GGGCAGGAAGAGGGCCTAT.Finally choose correct clone to carry greatly.

Transient transfection plasmid construction:

The clone of pU6-sgBbsI-EF1-Cas9-puro

Plasmid backbone (comprising resistant gene Amp and plasmid replication homing sequence ori): with plasmid Lenti-U6-sgBbsI-EF1-Cas9-E2A-Puro-wpre as pcr template.PCR primer sequence F:Caggtggcacttttcggg, R:TCCTGTGTGAAATTGTTATCCG.PCR is carried out with KAPA HIFI polysaccharase.Condition is: 98 DEG C, 2min; 98 DEG C of 10sec, 60 DEG C of 30sec, 72 DEG C of 40sec, 30cycles.After reaction terminates, add 1ul restriction endonuclease DpnI and hatch 30min at 37 DEG C, to remove template plasmid.70V ran glue after 1 hour, cut correct band (2.1kb), extracted DNA with Qiagen DNA purification column.

U6-sgBbsI-EF1-Cas9-Puro: with plasmid Lenti-U6-sgBbsI-EF1-Cas9-E2A-Puro-wpre as pcr template.PCR primer sequence F:GAGCGGATAACAATTTCACACAGGACCCCAGTGGAAAGACGCG, R:GCCCAAAGGGAGATCCGACTC.PCR is carried out with KAPA HIFI polysaccharase.Condition is: 98 DEG C, 2min; 98 DEG C of 10sec, 60 DEG C of 30sec, 72 DEG C of 2min, 4cycles; 98 DEG C of 10sec, 68 DEG C of 30sec, 72 DEG C of 2min, 25cycles.After reaction terminates, add 1ul restriction endonuclease DpnI and hatch 30min at 37 DEG C, to remove template plasmid.70V ran glue after 1 hour, cut correct band (6.4kb), extracted DNA with Qiagen DNA purification column.

PolyA sequence: synthetic (IDT), sequence is for such as shown in SEQ ID NO:11; Finally use Gibson cloning Kit (NEB) fits together various element.In 20ul system, add 50ng plasmid backbone, 100ng U6-sgBbsI-EF1-Cas9-Puro and 10ng PolyA.30min is hatched at 50 DEG C.Get 1ul to transform.E.Coli is after 37 DEG C of incubated overnight, and random choose 10 carries out little carrying after being cloned in and cultivating in 1-2 milliliter LB substratum, and then enzyme cuts the correct clone of qualification, and carries out Sanger order-checking and examine.Finally choose correct clone to carry greatly.This plasmid pU6-sgBbsI-EF1-Cas9-E2A-Puro-wpre can be used as sgRNA wink rotaring carrier skeleton and is cloned into any sgRNA sequence.

Clone other sgRNA wink rotaring carrier.

At 37 DEG C of digested plasmid pU6-sgBbsI-EF1-Cas9-E2A-Puro-wpre:5ug plasmids that spend the night, 3ul restriction endonuclease BbsI, 5ul 10x damping fluid, 37ul water.70V ran glue after 2 hours, cut correct band (9.5kb), extracted DNA with Qiagen DNA purification column.

Synthetic sgRNA template.SgRNA template is TATATATCTTGTGGAAAGGACGAAACACCGNNNNNNNNNNNNNNNN GTTTTAGAGCTAGAAATAG CAAG TTAAAAT.PCR primer sequence sgRNA-F:TATATATCTTGTGGAAAGGACGAA, sgRNA-R:ATTTTAACTTGCTATTTCTAGCTCTAA.PCR is carried out with KAPA HIFI polysaccharase.Condition is: 98 DEG C, 2min; 98 DEG C of 5sec, 60 DEG C of 20sec, 20cycles.70V ran glue after 1 hour, cut correct band (~ 80bp), extracted DNA with Qiagen DNA purification column.

Finally use Gibson cloning Kit (NEB) fits together various element.In 20ul system, add 100ng sgRNA wink rotaring carrier skeleton, 10ng sgRNA.15min is hatched at 50 DEG C.Get 1ul to transform.E.Coli is after 37C incubated overnight, and random choose 3 carries out little carrying after being cloned in and cultivating in 1-2 milliliter LB substratum, then carries out Sanger order-checking and examines.Sequencing primer is U6-F:GGGCAGGAAGAGGGCCTAT.Finally choose correct clone to carry greatly.

The preparation of 293T-GFP reporter cell.Knock out effect for what simply, accurately measure gene, we utilize and express the 293T clone of GFP.After cell proceeds to sgGFP and screens, if produce phase shift mutation, the afunction of GFP, cell no longer sends green fluorescence.Like this, by flow cytometry, efficiency can be knocked out by Accurate Determining.293T cell transduction slow virus Lenti-EF1-GFP-Zeo-WPRE, after 2 days, adds Zeomycin and carries out medicine sieve 3-5 days.It is that GFP is positive that medicine sieves rear ~ 97%.Use 10%DMSO Cell Cryopreservation in liquid nitrogen container.

The recovery of 293T cell or 293T-GFP cell and cultivation.Get the cell of liquid nitrogen cryopreservation, be put in rapidly in 37 DEG C of water-baths and thaw, period constantly rocks and solution in centrifuge tube is heated evenly as far as possible; Adding rapidly 7mL volume fraction after thawing is (DMEM nutrient solution needs to be preheated to 37 DEG C in advance) in the DMEM nutrient solution of 10% foetal calf serum, and rifle head is blown and beaten to the existence of acellular group gently, then centrifugal 5min under 1300rpm condition, supernatant discarded; In centrifuge tube, add 2mL be again preheated to the DMEM nutrient solution that 37 DEG C of volume fractions are 10% foetal calf serum in advance, piping and druming cell makes it suspend, and in 37 DEG C, containing the CO2 incubator of 5% in cultivate 24h, then change liquid, changed when liquid to cell density reaches 90% every 2 days later and go down to posterity.

Lentiviral vectors packaging and virus titer measure.Slow virus packaging uses calcium phosphate precipitation standard method.293T cell cultures is in 15cm ²in culture dish.When cell reaches 60-80% degree of converging, add the calcium phosphate precipitation of packaging plasmid and slow virus expression plasmid.After 40 hours and 64 hours, gather in the crops 2 culture supernatant respectively, after filtration, carry out high speed centrifugation.At centrifugal 2 hours of 20000g or 6000g after centrifugal 20 hours, abandon supernatant, virus is resuspended in the DMEM substratum of 1/100 volume.The biological titers of virus measures by HT1080 cell transduction method.5x10 is added in 12 orifice plates ⁴hT1080 cell, adds 0.2,0.5 or 1 μ l concentrating virus next day.Cell cultures, in DMEM/10%FBS, adds 8 μ g/ml protamine sulfate (Sigma-Aldrich).After 3 days, harvested cell, uses DNeasy test kit (Qiagen) to extract genomic dna (gDNA).Then use green PCR Master Mix (Applied Biosystems, Foster City, CA) reagent utilizes 7500Fast Real-Time PCR System (Applied Biosystems) to carry out quantitative PCR analysis.Design of primers is in the distinctive sequence of lentiviral vectors.General virus titer is 5-10x10 ⁷/ ml.

Lentiviral vectors is utilized to knock out GFP in 293T cell.293T-GFP cell cultures is in 12 or 6 orifice plates.When cell reaches 30-50% degree of converging, add packaged slow virus (MOI=1-5).After 36-48h, add the tetracycline of 1ug/ml.After 1-2 days, 4x diluting cells, continues to use tetracycline 2-3 days.Flow cytomery GFP per-cent is used after lentiviruses transduction 10-14 days.What can measure various sgGFP by the method knocks out effect.If the method for design after using us to optimize, it is 80-98% that GFP knocks out efficiency.It is below concrete outcome.

Example 1: when building sgRNA carrier, the minimum length of oligonucleotide is that 17bp could realize effectively knocking out.When the length of sgRNA is 16bp, knock out efficiency and compared with control cells does not have difference.

Example 2: the efficiency that knocks out being the sgRNA of 17bp according to the length of optimization method design is 80-98%.

Example 3: be the sgRNA of 17bp for length, if initiation nucleotide is non-G, adds g and can realize effectively knocking out.

Example 4: be the sgRNA of 17bp for length, if initiation nucleotide is non-G, replaces with g non-G, does not knock out effect (GFP negative cells ratio with contrast do not have notable difference).In conjunction with example 3, the result shows 17 oligonucleotide and target sequence must be had to mate completely just have and good knock out effect.

Example 5: utilize transient transfection system to realize gene knockout in 293T cell

We compare the efficiency that two kinds of pUC pUCs carry out gene knockout: double-mass model system, and namely Cas9 and sgGFP carries out expressing (pEF1-Cas9puro-wpre-polyA and pU6-sgGFP) with 2 plasmids respectively; And two-in-one system, namely a plasmid expresses Cas9 and sgGFP (pU6-sgGFP-EF1-Cas9puro) simultaneously.

Specific experiment method is as follows: 293T-GFP cell cultures is in 6 orifice plates, when cell confluency degree reaches about 90%, add 250ul0.25%Trypsin-EDTA (Gibco), put into 37 degree of incubator peptic cells, after 3-5 minute, add the substratum termination digestion that 1ml contains 10% foetal calf serum.Trypan Blue cell counting, will evenly reach in 12 orifice plates in 293T-GFP cell, every porocyte numerical control be built in 2-3 × 10 ⁵individual.Within second day, utilize liposome method to carry out transfection, Cas9 and sgGFP divides out expression vector to turn 0.5ug respectively, Cas9 and sgGFP coexpression two-in-one carrier transfection 1ug.After transfection 2-3 days, when cell confluency degree reaches 100%, carrying out in 1:6 ratio operation of going down to posterity, collect remaining cell and extract RNA, expressing for detecting Cas9.After transfection 8-10 days, utilize flow cytomery GFP cell percentages.

Flow cytometric analysis results shows, the two-in-one carrier target practice efficiency of Cas9 and sgGFP is significantly better than carrier system (Fig. 2 and Fig. 3) (n=3 dividing out expression in Cas9 and sgGFP, P<0.05), GFP knocks out efficiency and brings up to 35-45% from 16-20%.Knock out the reason of efficiency variance great disparity for disclosing 2 kinds of systems, we have detected the expression level of Cas9 with quantitative RT-PCR.Result shows, and Cas9 expression level in two-in-one system improves 5-10 doubly (Fig. 4) (n=3, P<0.01).This result meets former report, namely increases Cas9 level and can improve and knock out effect.

。

Claims (8)

1. a method of design of sgRNA, is characterized in that: in the method, and the length of sgRNA design is that the end of 17bp or 18bp, sgRNA is with G or A; Target sequence is (N16) GNGG, (N16) ANGG, (N16) CNCC or (N16) TNCC; When first base is A, C or T, add g above.

2. the method for design of a kind of sgRNA according to claim 1, is characterized in that: the method also comprises: in TagScan database, whether have similar sequence in muca gene group; For the sgRNA that 17bp is long, when separately there being the sequence of mating completely, abandon this sgRNA, then test other proper sequence; For the sgRNA that 18bp is long, when separately having and only having the sequence of 1 non-matching nucleotide acid, also abandon this sgRNA, other have the sgRNA sequence of design to continue test.

3. the method for design of a kind of sgRNA according to claim 2, it is characterized in that: in the design of this sgRNA, GC content is 40-80%.

4. the method for design of a kind of sgRNA according to any one of claim 1-3, it is characterized in that: in the design of this sgRNA, the end of sgRNA is with G, and target sequence is (N16) GNGG or (N16) CNCC.

5. a Cas9-sgRNA lentiviral vectors, it is characterized in that: in cloning procedure, following element is inserted in lentiviral vectors skeleton successively: U6, sgRNA, EF1, Cas9,2A, Puro, WPRE, the expression of sgRNA is driven by human U_6 promoter, Cas9 and Puro is by EF1 promoters driven, Cas9 and Puro links by from fracture polypeptide 2A, and Wpre is positioned at Cas9 and Puro downstream, and sgRNA adopts the method design of any one of claim 1-4 to obtain.

6. a kind of Cas9-sgRNA lentiviral vectors according to claim 5, is characterized in that: sgRNA sequence is for shown in SEQID NO:1 or SEQ ID NO:2; Cas9 sequence is for shown in SEQ ID NO:3; 2A sequence is for shown in SEQ ID NO:4; Puro sequence is for shown in SEQ ID NO:5; U6 promoter sequence is for shown in SEQ ID NO:6; EF1 promoter sequence is for shown in SEQ ID NO:7; WPRE sequence is for shown in SEQ ID NO:8.

7. a Cas9-sgRNA transient transfection plasmid, is characterized in that: consist of:

PU6-sgRNA-EF1-Cas9-2A-Puro-Wpre-PolyA, described sgRNA adopt the method design of any one of claim 1-4 to obtain.

8. a kind of Cas9-sgRNA transient transfection plasmid according to claim 7, is characterized in that: sgRNA sequence is for shown in SEQ ID NO:1 or SEQ ID NO:2; Cas9 sequence is for shown in SEQ ID NO:3; 2A sequence is for shown in SEQ ID NO:4; Puro sequence is for shown in SEQ ID NO:5; U6 promoter sequence is as shown in SEQ ID NO:6; EF1 promoter sequence is for shown in SEQ ID NO:7; WPRE sequence is for shown in SEQ ID NO:8, and PolyA sequence is for shown in SEQ ID NO:9.