CN104152414A - Gene modifying method for reserved locus of cell genome - Google Patents
Gene modifying method for reserved locus of cell genome Download PDFInfo
- Publication number
- CN104152414A CN104152414A CN201410346231.8A CN201410346231A CN104152414A CN 104152414 A CN104152414 A CN 104152414A CN 201410346231 A CN201410346231 A CN 201410346231A CN 104152414 A CN104152414 A CN 104152414A
- Authority
- CN
- China
- Prior art keywords
- che
- nucleic acid
- acid molecule
- gene
- cas9
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a recombinant cell, a gene modifying reagent for a cell and a gene modifying method for a reserved locus of a cell genome. The recombinant cell is used for over-expressing a first nucleic acid molecule; the first nucleic acid molecule is used for encoding a Cas9 protein or a derivative of the Cas9 protein; and compared with the Cas9 protein, the derivative of the Cas9 protein has no DNA cleavage activity, but remains target recognition activity. By using the recombinant cell, Che-chiRNA or Che-gRNA and tracrRNA can be transferred into the recombinant cell, so that genome editing or gene expression control can be easily carried out, and furthermore the gene modification on the reserved locus of the cell genome can be effectively realized.
Description
Technical field
The present invention relates to biological technical field, more specifically, the present invention relates to reconstitution cell, method for cell is carried out the reagent of genetic modification and the predetermined site of cellular genome carried out to genetic modification.
Background technology
CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 be within nearly 2 years, extensively approved instruct Cas nuclease target gene to be carried out to the technology of specific DNA modification by RNA.In this technology, crRNA (CRISPR-derived RNA) forms double-stranded RNA by base pairing and tracrRNA (trans-activating RNA) combination, obtains tracrRNA/crRNA binary complex body.The tracrRNA/crRNA binary complex body obtaining can instruct Cas9 albumen to shear double-stranded DNA at the target locating point mating with crRNA homing sequence, thereby reaches the object that genomic dna is modified.CRISPR/Cas9 system can accurately be edited the genome specific gene site of multiple species, the model preparation that has been successfully applied to the gene knockouts such as large and small mouse, human archeocyte at present and has knocked in.
Cas9 system is carried out three kinds of elements of effective need of work, i.e. crRNA (CRISPR-derived RNA, target identification 20 or 30 bases), tracrRNA (trans-activating RNA) and Cas9 albumen.
Because crRNA and tracrRNA can serial operations, so three element system also can be simplified to two component system, i.e. chiRNA (being formed 20 bases of target identification by crRNA and tracrRNA series connection degeneracy), Cas9 albumen.So the main flow strategy that utilizes at present Cas9 system to carry out genome editor and gene expression regulation has two kinds: three element system, two element system.
But the method for utilizing at present Cas9 system to carry out genome editor and gene expression regulation still haves much room for improvement.
Summary of the invention
It should be noted that, the following discovery of the present invention based on contriver completes:
Present stage, utilize Cas9 system to carry out genome editor and gene expression regulation, mainly contain two kinds of strategies: the one, exogenous plasmid system strategy; The 2nd, in-vitro transcription is synthesized chiRNA strategy.
Wherein, the first strategy (being exogenous plasmid system strategy), that element relevant Cas9 system is assembled in heterogenous expression pUC pUC, be the element in three element system or two component system is all incorporated on a heterogenous expression carrier, for target spots different in genome, each only need carry out the restructuring of plasmid to corresponding crRNA or chiRNA part, other parts need not operate, and then plasmid are proceeded to and in corresponding experimental model, just can make its work.This strategy has following shortcoming:
1. the limitation that target spot is selected: conventional target recognition site length is 20 bases at present, because latter linked first base of U6 promotor is necessary for G (guanine), therefore first base that defines these 20 bases is necessary for G, this has just caused very strong restriction, causes the selection of target spot to lose great selection space;
2. single pUC pUC: the exogenous plasmid building is excessive, can produce and be difficult for transfection (especially original with regard to very low cell more so for transfection efficiency) or the too low problem of transfection copy number, and this is the main cause of the common inefficiency of Cas9 system;
3. multi plasmid system: as need make the onset of Cas9 system, will require whole element corotation to enter same cell, and corotation efficiency is the bottleneck of this technical tactic;
4. virus carrier system: Cas9 albumen is excessive, is more than 4,000 bp, is difficult for packaging, cause virus to be packaged into power too low, be difficult to efficient functionating;
5. for different loci: need to repeatedly build the vector expression part of crRNA or chiRNA, operation inconvenience;
6. disposable for multidigit point operation: need the common transfection of multiple plasmids, corotation efficiency is low, causes the inefficient operation for many target spots;
7.Cas9 expressing quantity is unstable: the Cas9 gene of heterogenous expression proceeds to the copy number difference of each cell, causes the expression amount of Cas9 albumen in cell unstable, homogeneous, has limited the working efficiency of Cas9 system;
8. for high, middle flux operation, the cycle is long, and time cost, human cost are too high.
The second strategy (being the synthetic chiRNA strategy of in-vitro transcription), is that existing Cas9 two element system is separated, and is divided into: in-vitro transcription chiRNA and cas9 albumen.To be mode by plasmid construction be inserted into target sequence on the such carrier of pT7-gRNA for example in-vitro transcription chiRNA, then under the external environment in laboratory, be prepared into chiRNA with the transcriptase such as T7 or SP6; The expression of Cas9 albumen has various ways in this scheme: the heterogenous expression of realizing by transfection, embryo's injection of Cas9mRNA (being also in-vitro transcription), be incorporated in genome by virus vector, Cas9 gene order fixed point is knocked in genome.This strategy has following shortcoming:
1. the limitation that in-vitro transcription chiRNA target spot is selected: conventional target recognition site length is 20 bases at present, because T7 or SP6 promotor latter linked first or the first two base are necessary for G (guanine), therefore first or the first two base that define these 20 bases are necessary for G, this has just caused very strong restriction, causes the selection of target spot to lose great selection space;
In-vitro transcription chiRNA operating environment require high, technical requirements is high, transcribes the RNA for preparing extremely unstable in environment in vitro, extremely handled is to avoid RNA enzyme ubiquitous in environment; Full-range operative technique requires also far above other molecular biology experiments;
3. in-vitro transcription chiRNA cost is high, and pilot process is multiplex to the relevant test kit of RNA, and RNA test kit is often expensive, causes whole process cost not low;
4. in-vitro transcription chiRNA preparation process is many, and the cycle is long, flow process complexity: need to order target spot Oligo, annealing link, transform, order-checking qualification, plasmid preparation, PCR, PCR product purification, transcribe, all multi-steps such as transcription product purifying, quality evalution;
5.Cas9 albumen is as needed cotransfection, and cotransfection efficiency is also problem.
6. for high, middle flux operation, the cycle is long, and time cost, human cost are too high.
The present invention is intended at least solve one of technical problem existing in prior art.For this reason, one object of the present invention be to propose a kind of easier with respect to prior art operation, more safety and stability, more efficient fast, flux is higher, be applicable to various flux, utilize the improved Cas9 system predetermined site of cellular genome to be carried out to the method for genetic modification.
Thereby, according to an aspect of the present invention, the invention provides a kind of reconstitution cell.According to embodiments of the invention, described cell is crossed expression: the first nucleic acid molecule, and described the first nucleic acid molecule encoding Cas9 albumen or derivatives thereof, the derivative of described Cas9 albumen is compared with described Cas9 albumen, disappearance DNA nicking activity, but it is active to retain target spot identification.Contriver is surprised to find, utilize this reconstitution cell, can effectively pass through Che-chiRNA, or Che-gRNA and tracrRNA proceed in reconstitution cell of the present invention, can easily carry out genome editor or gene expression regulation, thereby effectively realize, the predetermined site of cellular genome be carried out to genetic modification.
In addition, reconstitution cell according to the above embodiment of the present invention can also have following additional technical characterictic:
According to embodiments of the invention, described the first nucleic acid molecule is positioned in the H3F3A gene in described cellular genome.This is because H3F3A is positioned at euchromosome, the first nucleic acid molecule is positioned to H3F3A genetic manipulation convenient; H3F3A all has expression in any tissue, can ensure the effective expression of foreign gene; And amalgamation and expression can be avoided the non-homogeneous restructuring of foreign DNA as much as possible.
According to embodiments of the invention, described cell is crossed expression: the second nucleic acid molecule, described the second nucleic acid molecule encoding tracrRNA.
According to the invention of the implementation of the cases, described the first nucleic acid molecule with a nucleotide sequence as shown below:follows:AtgccaaagaagaagcggaaggtcggtatccacggagtcccagcagccgacaagaagtacagcatcggcctggacatcggcaccaactctgtgggctgggccgtgatcaccgacgagtacaaggtgcccagcaagaaattcaaggtgctgggcaacaccgaccggcacagcatcaagaagaacctgatcggagccctgctgttcgacagcggcgaaacagccgaggccacccggctgaagagaaccgccagaagaagatacaccagacggaagaaccggatctgctatctgcaagagatcttcagcaacgagatggccaaggtggacgacagcttcttccacagactggaagagtccttcctggtggaagaggataagaagcacgagcggcaccccatcttcggcaacatcgtggacgaggtggcctaccacgagaagtaccccaccatctaccacctgagaaagaaactggtggacagcaccgacaaggccgacctgcggctgatctatctggccctggcccacatgatcaagttccggggccacttcctgatcgagggcgacctgaaccccgacaacagcgacgtggacaagctgttcatccagctggtgcagacctacaaccagctgttcgaggaaaaccccatcaacgccagcggcgtggacgccaaggccatcctgtctgccagactgagcaagagcagacggctggaaaatctgatcgcccagctgcccggcgagaagaagaatggcctgttcggaaacctgattgccctgagcctgggcctgacccccaacttcaagagcaacttcgacctggccgaggatgccaaactgcagctgagcaaggacacctacgacgacgacctggacaacctgctggcccagatcggcgaccagtacgccgacctgtttctggccgccaagaacctgtccgacgccatcctgctgagcgacatcctgagagtgaacaccgagatcaccaaggcccccctgagcgCctctatgatcaagagatacgacgagcaccaccaggacctgaccctgctgaaagctctcgtgcggcagcagctgcctgagaagtacaaagagattttcttcgaccagagcaagaacggctacgccggctacattgacggcggagccagccaggaagagttctacaagttcatcaagcccatcctggaaaagatggacggcaccgaggaactgctcgtgaagctgaacagagaggacctgctgcggaagcagcggaccttcgacaacggcagcatcccccaccagatccacctgggagagctgcacgccattctgcggcggcaggaagatttttacccattcctgaaggacaaccgggaaaagatcgagaagatcctgaccttccgcatcccctactacgtgggccctctggccaggggaaacagcagattcgcctggatgaccagaaagagcgaggaaaccatcaccccctggaacttcgaggaagtggtggacaagggcgcttccgcccagagcttcatcgagcggatgaccaacttcgataagaacctgcccaacgagaaggtgctgcccaagcacagcctgctgtacgagtacttcaccgtgtataacgagctgaccaaagtgaaatacgtgaccgagggaatgagaaagcccgccttcctgagcggcgagcagaaaaaggccatcgtggacctgctgttcaagaccaaccggaaagtgaccgtgaagcagctgaaagaggactacttcaagaaaatcgagtgcttcgactccgtggaaatctccggcgtggaagatcggttcaacgcctccctgggcacataccacgatctgctgaaaattatcaaggacaaggacttcctggacaatgaggaaaacgaggacattctggaagatatcgtgctgaccctgacactgtttgaggacagagagatgatcgaggaacggctgaaaacctatgcccacctgttcgacgacaaagtgatgaagcagctgaaGcggcggagatacaccggctggggcaggctgagccggaagctgatcaacggcatccgggacaagcagtccggcaagacaatcctggatttcctgaagtccgacggcttcgccaacagaaacttcatgcagctgatccacgacgacagcctgacctttaaagaggacatccagaaagcccaggtgtccggccagggcgatagcctgcacgagcacattgccaatctggccggcagccccgccattaagaagggcatcctgcagacagtgaaggtggtggacgagctcgtgaaagtgatgggccggcacaagcccgagaacatcgtgatcgaaatggccagagagaaccagaccacccagaagggacagaagaacagccgcgagagaatgaagcggatcgaagagggcatcaaagagctgggcagccagatcctgaaagaacaccccgtggaaaacacccagctgcagaacgagaagctgtacctgtactacctgcagaatgggcgggatatgtacgtggaccaggaactggacatcaaccggctgtccgactacgatgtggaccatatcgtgcctcagagctttctgaaggacgactccatcgacaacaaggtgctgaccagaagcgacaagaaccggggcaagagcgacaacgtgccctccgaagaggtcgtgaagaagatgaagaactactggcggcagctgctgaacgccaagctgattacccagagaaagttcgacaatctgaccaaggccgagagaggcggcctgagcgaactggataaggccggcttcatcaagagacagctggtggaaacccggcagatcacaaagcacgtggcacagatcctggactcccggatgaacactaagtacgacgagaatgacaagctgatccgggaagtgaaagtgatcaccctgaagtccaagctggtgtccgatttccggaaggatttccagttttacaaagtgcgcgagatcaacaactaccaccacgcccacGacgcctacctgaacgccgtcgtgggaaccgccctgatcaaaaagtaccctaagctggaaagcgagttcgtgtacggcgactacaaggtgtacgacgtgcggaagatgatcgccaagagcgagcaggaaatcggcaaggctaccgccaagtacttcttctacagcaacatcatgaactttttcaagaccgagattaccctggccaacggcgagatccggaagcggcctctgatcgagacaaacggcgaaaccggggagatcgtgtgggataagggccgggattttgccaccgtgcggaaagtgctgagcatgccccaagtgaatatcgtgaaaaagaccgaggtgcagacaggcggcttcagcaaagagtctatcctgcccaagaggaacagcgataagctgatcgccagaaagaaggactgggaccctaagaagtacggcggcttcgacagccccaccgtggcctattctgtgctggtggtggccaaagtggaaaagggcaagtccaagaaactgaagagtgtgaaagagctgctggggatcaccatcatggaaagaagcagcttcgagaagaatcccatcgactttctggaagccaagggctacaaagaagtgaaaaaggacctgatcatcaagctgcctaagtactccctgttcgagctggaaaacggccggaagagaatgctggcctctgccggcgaactgcagaagggaaacgaactggccctgccctccaaatatgtgaacttcctgtacctggccagccactatgagaagctgaagggctcccccgaggataatgagcagaaacagctgtttgtggaacagcacaagcactacctggacgagatcatcgagcagatcagcgagttctccaagagagtgatcctggccgacgctaatctggacaaagtgctgtccgcctacaacaagcaccgggataagcccatcagagagcaggccgagaatatcatccacctgtttaccctgaccaatctggGagcccctgccgccttcaagtactttgacaccaccatcgaccggaagaggtacacc agcaccaaagaggtgctggacgccaccctgatccaccagagcatcaccggcctgta cgagacacggatcgacctgtctcagctgggaggcgacaaaaggccggcggccacga aaaaggccggccaggcaaaaaagaaaaagtaa (SEQ ID NO:1), the shown nucleotide sequence coded wild type Cas9 albumen of SEQ ID NO:1;
Described the second nucleic acid divides and has nucleotide sequence as follows: GGTAGTATTAAGTATTGTTTTATGGCTGATAAATTTCTTTGAATTTCTCCTTGATT ATTTGTTATAAAAGTTATAAAATAATCTTGTTGGAACCATTCAAAACAGCATAGCA AGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT TTTTTT (SEQ ID NO:2), the nucleotide sequence coded tracrRNA shown in SEQ ID NO:2.
According to embodiments of the invention, described the second nucleic acid molecule is positioned in the H3F3A gene in described cellular genome.Thus, the second nucleic acid molecule is positioned to the easy to operate of H3F3A gene, can ensures the effective expression of the second nucleic acid molecule, and amalgamation and expression can be avoided the non-homogeneous restructuring of the second nucleic acid molecule as much as possible.
According to embodiments of the invention, the direction along 5 ' end to 3 ' end, described the first nucleic acid molecule is positioned at the upstream of described the second nucleic acid molecule.
According to embodiments of the invention, the derivative of described Cas9 albumen has following sudden change one of at least compared with described Cas9 albumen: D10A and H840A.Wherein, " D10A " represents that, compared with described Cas9 albumen, the 10th amino acid D of the derivative of described Cas9 albumen sports A, and " H840A " represents that, compared with described Cas9 albumen, the 840th amino acid of the derivative of described Cas9 albumen sports A by H.Thus, in reconstitution cell, to cross expression efficiency high for the derivative of Cas9 albumen, and Cas9 albumen and Che-chiRNA, or Che-gRNA and tracrRNA matched, be conducive to the genetic modification for carrying out follow-up genome predetermined site.It should be noted that, phraseology of the present invention " Cas9 albumen " is wild-type Cas9 albumen, and " derivative of Cas9 albumen " is Cas9 protein mutant.
According to embodiments of the invention, described genome is crossed expressing gene expression regulation element.It should be noted that, utilize the Cas9 albumen of nuclease free nicking activity and special transcription regulatory element (VP16, VP48, VP64, KRAB, SID4X etc.) amalgamation and expression, can carry out human intervention, regulation and control to the expression of genome native gene.And then according to a concrete example of the present invention, described gene expression regulation element is SID4X or VP64.Wherein, SID4X is in series by four mSin3interacting domain, can be combined with the PAH2 of transcriptional modulatory gene Sin3A, Sin3B structural domain, thereby reach the effect of inhibition of gene expression.VP64 is in series by four VP16 structural domains, can be combined with the transcription factor such as Oct1, HCF and then the expression of promotor gene.
According to embodiments of the invention, the direction along 5 ' end to 3 ' end, described the first nucleic acid molecule is positioned at the downstream of described SID4X.Thus, can reduce as much as possible the competition combination of other transcription factors, make the effect of SID4X more stable.
According to embodiments of the invention, the direction along 5 ' end to 3 ' end, described the first nucleic acid molecule is positioned at the upstream of described VP64.Thus, be conducive to VP64 and recruit transcription factor and carry out genetic expression, reduce Cas9 albumen to VP64 or be recruited the interference of albumen.
According to another aspect of the invention, the present invention also provides a kind of for cell being carried out to the reagent of genetic modification.According to embodiments of the invention, this pack contains: Che-chiRNA; Or Che-gRNA and optionally Che-tracrRNA.Thus, the reagent for target gene of the present invention is proceeded in aforesaid reconstitution cell, can easily carry out genome editor or gene expression regulation, thereby effectively realize, the predetermined site of cellular genome is carried out to genetic modification.
According to embodiments of the invention, Che-chiRNA comprises sequence: 5 '-(N)
20gUUUUAGAGCUAGAAAUAGCAAGUUAAAAU-3 ' (SEQ ID NO:3), N=A, U, G or C.Thus, thus, with respect to prior art, the length of Che-chiRNA of the present invention is that first or the first two base of the target recognition site of 20 bases do not need to be necessary for G (guanine), thereby the selection of Che-chiRNA transfection target spot limitation is little.And then while utilizing reagent of the present invention to carry out genetic modification to the predetermined site of cellular genome, efficiency is high, effective.
According to embodiments of the invention, Che-gRNA comprises sequence: 5 '-(N)
20gUUUUAGAGCUA-3 ' (SEQ ID NO:4), N=A, U, G or C.Thus, with respect to prior art, the length of Che-gRNA of the present invention is that first or the first two base of the target recognition site of 20 bases do not need to be necessary for G (guanine), little thereby Che-gRNA proceeds to the selection limitation of target spot.And then while utilizing reagent of the present invention to carry out genetic modification to the predetermined site of cellular genome, efficiency is high, effective.
According to embodiments of the invention, Che-chiRNA, Che-gRNA and Che-tracrRNA's is one of at least chemosynthesis.Thus, when when the predetermined site of cellular genome is carried out to genetic modification, RNA target identified region is not subject to the restriction of the factors such as promotor, target spot is selected more extensive, RNA quality safety is stable, quantitatively accurate, easy and simple to handle, efficient, and after integrating, onset is quick, flux is high.
According to a further aspect in the invention, the present invention also provides a kind of method of the predetermined site of cellular genome being carried out to genetic modification.According to embodiments of the invention, the method comprises: foregoing reconstitution cell is provided; And foregoing reagent is incorporated in described reconstitution cell, wherein, the motif of described Che-chiRNA or Che-gRNA (N)
20it is sequences Design based on described predetermined site.Thus, can easily carry out genome editor or gene expression regulation, thereby effectively realize, the predetermined site of cellular genome is carried out to genetic modification, and easier with respect to prior art operation, more safety and stability, more efficient fast, flux is higher, is applicable to various flux.
According to embodiments of the invention, described genetic modification comprises carries out gene knockout or expression regulation to predetermined site.
It should be noted that, the term " genetic modification " that used in this article should be interpreted broadly, it refers to any any operation that can affect genetic transcription, translation, expression, sequence, for example, can raise or lower the expression of genes involved, start transcribing and translating of genes involved, cut off the sequence of genes involved, in the sequence of genes involved, cause sudden change, such as insertion, disappearance and displacement etc.Certainly, those skilled in the art can understand, and can in identical gene, carry out the operation of multiple genetic modifications simultaneously.
In addition, according to embodiments of the invention, carry out the method for genome editor and gene expression regulation with respect to the existing Cas9 of utilization system, the method that the predetermined site of cellular genome is carried out to genetic modification of the present invention at least has the following advantages:
1. according to embodiments of the invention, chemosynthesis RNA target identified region is not subject to the restriction of the factors such as promotor, and target spot is selected more extensive;
2. according to embodiments of the invention, chemosynthesis RNA quality safety is stable, quantitatively accurate: because being is prepared from by chemical synthesis process, whole process obtains standard Quality Control supervision, by RNA being carried out to the modifications such as 5 ' end, 3 ' end, strand or two strands, can reach RNA is stable effectively again effect; And in building-up process, molecular weight is known, resultant quantity is known, can accomplish accurate quantification, facilitate follow-up operation;
3. according to embodiments of the invention, chemosynthesis RNA is efficient, easy and simple to handle: due to the molecular weight of RNA, in the situation that transfection efficiency is identical, in the time utilizing the transfection thing of the strategy use equal in quality that Cas9 system carries out genome editor and gene expression regulation with two kinds of aforementioned present stage, the copy number of RNA is higher, can recruit more Cas9 albumen and carry out work, so more efficient; Because being is prepared from by chemical synthesis process, the transfection of RNA can be as siRNA transfection light completing, and transfection reagent is identical with siRNA transfection reagent, facilitates the use in laboratory;
4. according to embodiments of the invention, chemosynthesis RNA onset is quick, flux is high: because Cas9 albumen has been incorporated in genome, in cell, express, start to recruit Cas9 albumen and carry out work so RNA enters into cell interior; Multiple synthetic RNA can be mixed and carry out the operation of many target spots, also can, with multiple synthetic RNA experiment that walks abreast, improve working flux and efficiency with this;
5. according to embodiments of the invention, Cas9 albumen is accurately incorporated into the specific site in genome, expresses and stablizes, and can accomplish that the accurate tune on expression time and expression amount is logical; Can not cause the destruction of genome being caused to the aspects such as safety and stability.
Additional aspect of the present invention and advantage in the following description part provide, and part will become obviously from the following description, or recognize by practice of the present invention.
Brief description of the drawings
Above-mentioned and/or additional aspect of the present invention and advantage accompanying drawing below combination is understood becoming the description of embodiment obviously and easily, wherein:
Fig. 1 has shown according to one embodiment of the invention, the result of Flow cytometry gene recombination efficiency;
Fig. 2 has shown according to one embodiment of the invention, for the identification of the PCR schematic diagram in Cas9 gene insertion H3F3A gene and the electrophoresis result of PCR product;
Fig. 3 has shown according to one embodiment of the invention, the electrophoresis result of T7 restriction endonuclease detection cellular targets point destruction situation;
Fig. 4 has shown according to one embodiment of the invention, the result of the expression amount of CXCR4 and MyoD1 gene in qPCR detection cell.
Embodiment
Describe embodiments of the invention below in detail, it should be noted that, the following example is only used to explain the present invention, and scope of the present invention is not caused to any restriction.
Embodiment 1: carry out gene knockout in HELA cell
1, prepare the cell of foreign gene-carrying
By inner H3F3A gene target spot destroy plasmid pDSB-H3.3 with the homologous recombination instrument plasmid Donor-KI-1/Donor-KI-2 cotransfection with inserting gene fragment in Hela cell.
Wherein, pDSB-H3.3 comprises following sequence successively: U6 promotor, H3F3A gRNA-1, U6 promotor, H3F3A gRNA-2, CBh promotor, the encoding gene of Flag label protein, the encoding gene of Cas9 (D10A) albumen.Wherein Cas9 (D10A) albumen is the derivative of wild-type Cas9 albumen, it has D10A sudden change with respect to wild-type Cas9 albumen (nucleotide sequence coded albumen shown in SEQ ID NO:1), the encoding gene of Cas9 (D10A) albumen, sports C with respect to the 74th bit base of nucleotide sequence shown in SEQ ID NO:1 by A.
Donor-KI-1 comprises following sequence successively: H3F3A homologous recombination arm left arm, SA shears sequence, CDS sequence (not containing terminator codon) on last exon of H3F3A, 2A is from fracture sequence, puromycin resistant gene, polyA tail, CBh promotor, the encoding gene of Flag label protein, Cas9 gene (sequence is as shown in SEQ ID NO:1), bGH polyA tail, H3F3A homologous recombination arm right arm.
Donor-KI-2 comprises following sequence successively: H3F3A homologous recombination arm left arm, and SA shears sequence, the CDS sequence (not containing terminator codon) on last exon of H3F3A, 2A is from fracture sequence, puromycin resistant gene, polyA tail, CBh promotor, Flag label protein, Cas9 gene (sequence is as shown in SEQ ID NO:1), bGH polyA tail, H1 promotor, short tracrRNA sequence, H3F3A homologous recombination arm right arm.
It should be noted that, above-mentioned each carrier is all to obtain above-mentioned corresponding each assembly fragment by PCR method, then adds to successively on T carrier and builds and obtain.
First 24 hours of cotransfection, is inoculated into cell in a hole of 24 orifice plates with 40% density.
Above-mentioned transfection is to adopt transfection reagent: X-tremeGENE HP DNA Transfection Reagent, by specification operates.Particularly, DNA total amount 1 μ g is diluted in 100uL OPTI-MEM substratum, then adds 3 μ L X-tremeGENE HP DNA Transfection Reagent to mix standing 15 minutes, get 50 μ L and add in the hole that has cell cultures, concussion mixes, and after 24 hours, changes substratum.
Then,, by Flow cytometry gene recombination efficiency, Fig. 1 has shown the result of flow cytometry.Wherein, as shown in Figure 1, by specific antibody anti-Flag, by green fluorescence on Cas9 protein labeling, WT is wild-type contrast.And then, based on the result of flow cytometry, the cell sorting of the green fluorescence positive is gone out, after cultivating, PCR qualification external source fragment (being Cas9 gene) is accurately inserted in the gene of H3F3A.Fig. 2 has shown the electrophoresis result of PCR schematic diagram and PCR product.As shown in Figure 2, use respectively two primer P1, the P2 in homologous recombination arm outside, and two primer P3, P4 of Insert Fragment inside, three kinds of array modes are carried out PCR to gfp positive cell sample, and PCR product is carried out to 1% agarose gel electrophoresis; Wherein, in PCR schematic diagram, KI fragment represents to insert the Cas9 gene in H3F3A gene, in electrophorogram, KI-1 swimming lane is the PCR product adopting after pDSB-H3.3 and Donor-KI-1 cotransfection, and KI-2 swimming lane is the PCR product adopting after pDSB-H3.3 and Donor-KI-2 cotransfection.
Thus, prepare the Hela cell (reconstitution cell that adopts Donor-KI-1 cotransfection to obtain) that only carries Cas9, the Hela cell (reconstitution cell that adopts Donor-KI-2 cotransfection to obtain) that simultaneously carries Cas9+tracrRNA.
2, for the shot design of gene EMX1, PVALB in human genome, synthetic che-chiRNA and che-gRNA.
Wherein, the principle of design of che-chiRNA and che-gRNA is:
A. sequence must meet (N)
20the sequence of NGG, (N)
20target identified region, NGG is Cas9 cleavage site;
B. the target sequence that used occurs that at full genome the probability of mispairing approaches 0 as much as possible.
In the total length of EMX1 and PVALB gene, search for respectively the target spot that meets mentioned above principle, then generate corresponding RNA sequence according to the principle of che-chiRNA and che-gRNA design.The RNA of the present embodiment is produced by American I DT company.
Result is as follows:
For EMX1 gene:
Che-gRNA sequence is: GGGGCCACUAGGGACAGGAUGUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO:5);
Che-chiRNA sequence is: GGGGCCACUAGGGACAGGAUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCU AGUCCG (SEQ ID NO:6).
For PVALB gene:
Che-gRNA sequence is: AUUGGGUGUUCAGGGCAGAGGUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO:7);
Che-chiRNA sequence is: AUUGGGUGUUCAGGGCAGAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCU AGUCCG (SEQ ID NO:8).
3, transfection
Utilize above for the synthetic che-chiRNA Hela cell that only carries Cas9 that transfection obtains above respectively of the target spot of EMX1, PVALB (reconstitution cell that adopts Donor-KI-1 cotransfection to obtain); Utilize above for the synthetic che-gRNA of the target spot of EMX1, PVALB respectively transfection carry the Hela cell (reconstitution cell that adopts Donor-KI-2 cotransfection to obtain) of Cas9+tracrRNA simultaneously.Wherein, the che-chiRNA of each gene of each cell or the transfection of che-gRNA are all to carry out separately, be all to test independently, thus, each independent experiment is that a kind of cell knocks out a gene, thereby the Hela cell that only carries Cas9 can detect respectively two genes, the cell that carries Cas9+tracrRNA also can detect respectively two genes.
Carrying out above-mentioned transfection first 24 hours, cell is being inoculated in a hole of 24 orifice plates with 40% density.
Above-mentioned transfection be adopt transfection reagent "
rNAiMAX Transfection Reagent " (Life technologies), by specification operation is carried out.Particularly, 10pmol RNA is diluted in 50 μ L OPTI-MEM substratum to 3 μ L
rNAiMAX Transfection Reagent is diluted in 50 μ L OPTI-MEM substratum, and both mixed room temperatures are left standstill to 5 minutes, gets 50 μ L and adds in the hole that has cell cultures, and concussion mixes, and after 24 hours, changes substratum.
4, use T7 restriction endonuclease to detect target spot and destroy situation.
By 48 hours collecting cells after cell transfecting, use respectively reagent QuickExtract
tMdNA Extraction Solution (Epicentre) prepares genomic dna.
Then, use for the primer of target spot near zone design and carry out PCR.
Wherein, the primer that PCR adopts is:
EMX1-test-F:AAAACCACCCTTCTCTCTGGC(SEQ?ID?NO：9)，
EMX1-test-R:GGAGATTGGAGACACGGAGAG(SEQ?ID?NO：10)，
PVALB-test-F:CTGGAAAGCCAATGCCTGAC(SEQ?ID?NO：11)，
PVALB-test-R:GGCAGCAAACTCCTTGTCCT(SEQ?ID?NO：12)。
PCR reagent: Q5Hot Start High-Fidelity2X Master Mix (NEB), reaction system (cumulative volume 40 μ L): 2X Master Mix20 μ L, genome DNA sample 5 μ L, primer mixed solution (10 μ M) 3 μ L, ddH
2o12 μ L.Response procedures: 1.98 DEG C of 30s; 2.98 DEG C 5s; 3.60 DEG C 10s; 4.72 DEG C 30s; 5.72 DEG C of 1m, wherein the 2nd to the 4th step is carried out 35 circulations.
Then, by the sex change annealing again of PCR reaction product: add 2 μ L NEB buffer2, ddH in 10uL PCR product
2o complements to 20 μ L, and cycle of annealing is: 1.95 DEG C 10 minutes, 2. per secondly successively decrease 2 DEG C to 85 DEG C, 3. per secondly successively decrease 0.2 DEG C to 25 DEG C, 4.25 DEG C 1 minute.
After annealing, in annealing product, add 1 μ L T7 restriction endonuclease (NEB), 37 DEG C of reactions 30 minutes (T7 restriction endonuclease can cut target spot destroyed and the double-stranded DNA that does not destroy the annealing generation of chain), again reaction product is carried out to electrophoresis, destroy situation to utilize T7 restriction endonuclease to detect target spot.Fig. 3 has shown that T7 restriction endonuclease detects the electrophoresis result of target spot destruction situation.From the electrophoresis result of Fig. 3, can find out, utilize technology of the present invention, effectively in the cell that carries Cas9, knock out respectively EMX1 gene and PVALB gene, and also effectively in the cell that carries Cas9 and tracrRNA, knocked out respectively EMX1 gene and PVALB gene.
Embodiment 2 carries out gene expression regulation in Hela cell
According to method similar to Example 1, build the Hela cell that simultaneously carries Cas9 mutant (D10A, H840A) and transcriptional regulatory element (SID4X or VP64).Wherein, SID4X or VP64 are connected on carrier with Cas9 mutant (D10A, H840A), and its carrier construction method is also to use conventional PCR and the method for molecular cloning; The method of cell restructuring is identical with embodiment 1 with strategy, be only before Cas9 (D10A, the H840A) DNA sequence dna in Donor many SID4X or below how VP64; Other comprise that transfection conditions etc. is identical with embodiment 1.Wherein Cas9 (D10A, H840A) albumen is the derivative of wild-type Cas9 albumen, and it has D10A and H840A sudden change with respect to wild-type Cas9 albumen (nucleotide sequence coded albumen shown in SEQ ID NO:1) simultaneously.
Then, knock in genome as example taking SID4X-Cas9 (D10A, H840A), Cas9 (D10A, H840A)-VP64, in Hela cell, carry out gene expression regulation, specific as follows:
Target spot is chosen in transcription factor calmodulin binding domain CaM or 5 ' the UTR region of goal gene (hMyoD1, hCXCR4).Each Che-chiRNA sequence is as follows:
hMYOD1-1：GCCUGGGCUCCGGGGCGUUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG(SEQ?ID?NO：13)；
hMYOD1-2：GGGCCCCUGCGGCCACCCCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG(SEQ?ID?NO：14)
hMYOD1-3：CCUCCCUCCCUGCCCGGUAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG(SEQ?ID?NO：15)；
hMYOD1-4：GAGGUUUGGAAAGGGCGUGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG(SEQ?ID?NO：16)；
hCXCR4-1：ACUUACACUGAUCCCCUCCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG(SEQ?ID?NO：17)；
hCXCR4-2：AGGUAGCAAAGUGACGCCGAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG(SEQ?ID?NO：18)；
hCXCR4-3：GAACCAGCGGUUACCAUGGAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG(SEQ?ID?NO：19)；
hCXCR4-4：CAAACUGAAGUUUCUGGCCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG(SEQ?ID?NO：20)。
The che-chiRNA of hMyoD1, hCXCR4 is proceeded to respectively to Hela-Cas9a, Hela-Cas9i clone, wherein Hela-Cas9a cell is to carry Cas9 (D10A, H840A) the Hela cell of-VP64, Hela-Cas9i cell is the Hela clone of carrying SID4X-Cas9 (D10A, H840A).Transfection conditions is identical with embodiment 1,48 hours collecting cells after transfection, and adopt reagent iScript
tMrT-qPCR Sample Preparation Reagent (Bio-Rad) prepares total RNA, then adopts reagent iScript
tMone-Step RT-PCR Kit with
green (Bio-Rad) carries out single stage method qPCR reaction.The results are shown in Figure 4.Fig. 4 has shown that qPCR detects the result of the relative expression quantity of the interior CXCR4 of cell and MyoD1 gene.As shown in Figure 4, ordinate zou represents relative expression quantity, and unit is multiple.As shown in Figure 4, the expression of native gene CXCR4 is obviously suppressed, and native gene MyoD1 is activated, great expression.Wherein, it should be noted that, native gene MyoD1 great expression be mainly because, Cas9 mutant (the D10A that the present embodiment adopts, H840A) do not possess genomic destructiveness, just identify target spot, and the shot design of the present embodiment is in the transcriptional control region of gene, and the VP64 connecting with Cas9 recruited transcription factor by the gene activation being identified, start and express.
In the description of this specification sheets, the description of reference term " embodiment ", " some embodiment ", " example ", " concrete example " or " some examples " etc. means to be contained at least one embodiment of the present invention or example in conjunction with specific features, structure, material or the feature of this embodiment or example description.In this manual, the schematic statement of above-mentioned term is not necessarily referred to identical embodiment or example.And specific features, structure, material or the feature of description can be with suitable mode combination in any one or more embodiment or example.
Although illustrated and described embodiments of the invention, those having ordinary skill in the art will appreciate that: in the situation that not departing from principle of the present invention and aim, can carry out multiple variation, amendment, replacement and modification to these embodiment, scope of the present invention is limited by claim and equivalent thereof.
Claims (17)
1. a reconstitution cell, is characterized in that, described cell is crossed expression:
The first nucleic acid molecule, described the first nucleic acid molecule encoding Cas9 albumen or derivatives thereof, the derivative of described Cas9 albumen is compared with described Cas9 albumen, and disappearance DNA nicking activity, identifies active but retain target spot.
2. reconstitution cell according to claim 1, is characterized in that, described the first nucleic acid molecule is positioned in the H3F3A gene in described cellular genome.
3. reconstitution cell according to claim 1, is characterized in that, described cell is crossed expression:
The second nucleic acid molecule, described the second nucleic acid molecule encoding tracrRNA.
4. reconstitution cell according to claim 3, is characterized in that, described the first nucleic acid molecule has the nucleotide sequence shown in SEQ ID NO:1, and described the second nucleic acid molecule has the nucleotide sequence shown in SEQ ID NO:2.
5. reconstitution cell according to claim 3, is characterized in that, described the second nucleic acid molecule is positioned in the H3F3A gene in described cellular genome.
6. reconstitution cell according to claim 5, is characterized in that, the direction along 5 ' end to 3 ' end, and described the first nucleic acid molecule is positioned at the upstream of described the second nucleic acid molecule.
7. reconstitution cell according to claim 1, is characterized in that, the derivative of described Cas9 albumen has following sudden change one of at least compared with described Cas9 albumen: D10A and H840A.
8. reconstitution cell according to claim 5, is characterized in that, described genome is crossed expressing gene expression regulation element.
9. reconstitution cell according to claim 8, is characterized in that, described gene expression regulation element is SID4X or VP64.
10. reconstitution cell according to claim 9, is characterized in that, the direction along 5 ' end to 3 ' end, and described the first nucleic acid molecule is positioned at the downstream of described SID4X.
11. reconstitution cells according to claim 9, is characterized in that, the direction along 5 ' end to 3 ' end, and described the first nucleic acid molecule is positioned at the upstream of described VP64.
12. 1 kinds for carrying out the reagent of genetic modification to cell, it comprises:
Che-chiRNA; Or
Che-gRNA and optionally Che-tracrRNA.
13. reagent according to claim 12, is characterized in that, Che-chiRNA comprises sequence:
5 '-(N)
20gUUUUAGAGCUAGAAAUAGCAAGUUAAAAU-3 ', N=A, U, G or C.
14. reagent according to claim 12, is characterized in that, Che-gRNA comprises sequence:
5 '-(N)
20gUUUUAGAGCUA-3 ', N=A, U, G or C.
15. reagent according to claim 12, is characterized in that, Che-chiRNA, Che-gRNA and Che-tracrRNA's is one of at least chemosynthesis.
16. 1 kinds are carried out the method for genetic modification to the predetermined site of cellular genome, it is characterized in that, comprising:
Reconstitution cell described in claim 1～11 any one is provided; And
Reagent described in claim 12～15 any one is incorporated in described reconstitution cell,
Wherein, the motif of described Che-chiRNA or Che-gRNA (N)
20it is sequences Design based on described predetermined site.
17. methods according to claim 16, is characterized in that, described genetic modification comprises carries out gene knockout or expression regulation to predetermined site.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410346231.8A CN104152414B (en) | 2014-07-18 | 2014-07-18 | The method that genetic modification is carried out to the predetermined site of cellular genome |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410346231.8A CN104152414B (en) | 2014-07-18 | 2014-07-18 | The method that genetic modification is carried out to the predetermined site of cellular genome |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104152414A true CN104152414A (en) | 2014-11-19 |
| CN104152414B CN104152414B (en) | 2018-03-13 |
Family
ID=51878042
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410346231.8A Expired - Fee Related CN104152414B (en) | 2014-07-18 | 2014-07-18 | The method that genetic modification is carried out to the predetermined site of cellular genome |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104152414B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104450785A (en) * | 2014-12-08 | 2015-03-25 | 复旦大学 | Genome editing method using attachment carrier for encoding targeted endonuclease and kit |
| CN106119269A (en) * | 2016-06-23 | 2016-11-16 | 百奥迈科生物技术有限公司 | A kind of method preparing linear ssdna in escherichia coli |
| CN108220339A (en) * | 2016-12-14 | 2018-06-29 | 深圳华大生命科学研究院 | The method of cell transformation |
| CN108342416A (en) * | 2018-02-08 | 2018-07-31 | 广州医科大学 | A kind of conditionity induction knocks out the construction method for the liver cancer cell lines for being overexpressed Chd1l genes |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140186958A1 (en) * | 2012-12-12 | 2014-07-03 | Feng Zhang | Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains |
| WO2014093635A9 (en) * | 2012-12-12 | 2014-07-24 | The Broad Institute, Inc. | Engineering and optimization of improved systems, methods and enzyme compositions for sequence manipulation |
-
2014
- 2014-07-18 CN CN201410346231.8A patent/CN104152414B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140186958A1 (en) * | 2012-12-12 | 2014-07-03 | Feng Zhang | Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains |
| WO2014093635A9 (en) * | 2012-12-12 | 2014-07-24 | The Broad Institute, Inc. | Engineering and optimization of improved systems, methods and enzyme compositions for sequence manipulation |
Non-Patent Citations (4)
| Title |
|---|
| LE CONG，ET AL: "Multiplex Genome Engineering Using CRISPR/Cas Systems", 《SCIENCE》 * |
| YANNI LIN，ET AL: "CRISPR/Cas9 systems have off-target activity with insertions or deletions between target DNA and guide RNA sequences", 《NUCLEIC ACIDS RESEARCH》 * |
| 方锐等: "CRISPR/Cas9 介导的基因组定点编辑技术", 《生物化学与生物物理进展》 * |
| 王梦瑶等: "基于CRISPR-CAS系统的基因组定点修饰新技术", 《中国生物化学与分子生物学报》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104450785A (en) * | 2014-12-08 | 2015-03-25 | 复旦大学 | Genome editing method using attachment carrier for encoding targeted endonuclease and kit |
| CN106119269A (en) * | 2016-06-23 | 2016-11-16 | 百奥迈科生物技术有限公司 | A kind of method preparing linear ssdna in escherichia coli |
| CN108220339A (en) * | 2016-12-14 | 2018-06-29 | 深圳华大生命科学研究院 | The method of cell transformation |
| CN108342416A (en) * | 2018-02-08 | 2018-07-31 | 广州医科大学 | A kind of conditionity induction knocks out the construction method for the liver cancer cell lines for being overexpressed Chd1l genes |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104152414B (en) | 2018-03-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2020267249B2 (en) | Genome editing using campylobacter jejuni crispr/cas system-derived rgen | |
| US20220033858A1 (en) | Crispr oligoncleotides and gene editing | |
| CA3111432A1 (en) | Novel crispr enzymes and systems | |
| US20190038780A1 (en) | Vectors and system for modulating gene expression | |
| US11898270B2 (en) | Pig genome-wide specific sgRNA library, preparation method therefor and application thereof | |
| CN107151677B (en) | Method for knocking out low transfection efficiency cell line based on CRISPR/Cas9 multiple genes | |
| JP2020517299A (en) | Site-specific DNA modification using a donor DNA repair template with tandem repeats | |
| EP3464587A1 (en) | Compositions and methods for enhancing homologous recombination | |
| CN104152414A (en) | Gene modifying method for reserved locus of cell genome | |
| CN107245493B (en) | Vector for expressing aptamer ribozyme modified sgRNA regulated and controlled by theophylline and application | |
| CN110835635B (en) | Plasmid construction method for promoting expression of multiple tandem sgRNAs by different promoters | |
| CN105543223A (en) | Method for transcribing sgRNA (small guide Ribonucleic Acid) based on miRNA/shRNA (micro Ribonucleic Acid/short hairpin Ribonucleic Acid) transcription processing mechanism | |
| CN112384620A (en) | Method for screening and identifying functional lncRNA | |
| CN107488655B (en) | Method for removing 5 'and 3' adaptor connection by-products in sequencing library construction | |
| CN104928292A (en) | Design method of sgRNA and lentivirus carrier formed by sgRNA and plasmids | |
| CA3190758A1 (en) | Systems and methods for transposing cargo nucleotide sequences | |
| WO2022066335A1 (en) | Systems and methods for transposing cargo nucleotide sequences | |
| CN113728097A (en) | Enzymes with RUVC domains | |
| CN111088256B (en) | Construction method of carrier for efficiently expressing small RNA and expressing multiple small RNAs by cynomolgus monkey U6 promoter | |
| CN118139979A (en) | Enzymes with HEPN domains | |
| CN111218479A (en) | Method for realizing knock-out of transcribable element by knocking-in terminator by gene editing technology | |
| CN111662932B (en) | Method for improving homologous recombination repair efficiency in CRISPR-Cas9 gene editing | |
| CN110551763B (en) | CRISPR/SlutCas9 gene editing system and application thereof | |
| Liu et al. | Comparative analysis of genome editing systems, Cas9 and BE3, in silkworms | |
| CN111057717B (en) | Method for rapidly preparing gRNA expression vector capable of being directly used and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180313 Termination date: 20210718 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |