CN104152414B - The method that genetic modification is carried out to the predetermined site of cellular genome - Google Patents
The method that genetic modification is carried out to the predetermined site of cellular genome Download PDFInfo
- Publication number
- CN104152414B CN104152414B CN201410346231.8A CN201410346231A CN104152414B CN 104152414 B CN104152414 B CN 104152414B CN 201410346231 A CN201410346231 A CN 201410346231A CN 104152414 B CN104152414 B CN 104152414B
- Authority
- CN
- China
- Prior art keywords
- che
- nucleic acid
- acid molecules
- cas9
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Reagent the invention discloses recombinant cell, for carrying out genetic modification to cell and the method for the predetermined site progress genetic modification to cellular genome, the wherein recombinant cell are overexpressed：First nucleic acid molecules, the first nucleic acid molecule encoding Cas9 albumen or derivatives thereof, the derivative of the Cas9 albumen lack DNA cleavage activities compared with the Cas9 albumen, but retain target spot identification activity.Utilize the recombinant cell, can be effectively by by Che chiRNA, or Che gRNA and tracrRNA are transferred in the recombinant cell of the present invention, you can genome editor or gene expression regulation are easily performed, so as to which the predetermined site effectively realized to cellular genome carries out genetic modification.
Description
Technical field
The present invention relates to biological technical field, more specifically, the present invention relates to recombinant cell, for carrying out gene to cell
The reagent of transformation and the method that genetic modification is carried out to the predetermined site of cellular genome.
Background technology
CRISPR(Clustered Regularly Interspaced Short Palindromic Repeats)/
Cas9 is the technology for instructing Cas nucleases to carry out specific DNA modification to target gene by RNA being widely recognized as nearly 2 years.
In the technology, crRNA (CRISPR-derived RNA) passes through base pairing and tracrRNA (trans-activating
RNA double-stranded RNA) is combined to form, obtains tracrRNA/crRNA binary complex.Resulting tracrRNA/crRNA binary is answered
Zoarium can instruct Cas9 albumen to target site shearing double-stranded DNA what is matched with crRNA homing sequences, so as to reach to gene
The purpose that group DNA is modified.CRISPR/Cas9 systems can carry out accurate to the genome specific gene site of a variety of species
Editor, has been successfully applied to the gene knockouts such as large and small mouse, human archeocyte at present and prepared by the model knocked in.
Cas9 systems carry out effective three kinds of elements of need of work, i.e. crRNA (CRISPR-derived RNA, target identification
20 or 30 bases), tracrRNA (trans-activating RNA) and Cas9 albumen.
Due to crRNA and tracrRNA can with serial operation, so three element systems can also be simplified to two component system,
That is chiRNA (being formed by crRNA and tracrRNA series connection degeneracys, target identifies 20 bases), Cas9 albumen.So profit at present
The main flow strategy that genome editor and gene expression regulation are carried out with Cas9 systems shares two kinds：Three element systems, two element system
System.
However, the method for carrying out genome editor and gene expression regulation currently with Cas9 systems still has much room for improvement.
The content of the invention
It should be noted that the present invention is the following discovery based on inventor and completed：
At this stage, genome editor and gene expression regulation are carried out using Cas9 systems, mainly there are two kinds of strategies：It is first, outer
Source pUC pUC strategy；Second, in-vitro transcription synthesis chiRNA strategies.
Wherein, the first tactful (i.e. exogenous plasmid system strategy), it is that the related element group of Cas9 systems is mounted in external source
In expression plasmid system, the element in three element systems or two component system is all as incorporated into a heterogenous expression carrier
On, for target spot different in genome, the restructuring that need to only carry out plasmid to corresponding crRNA or chiRNA parts every time is
Can, other parts do not have to operation, and then plasmid, which is transferred in corresponding experimental model, can just make its work.The strategy have with
Lower shortcoming：
1. the limitation of target spot selection：Currently used targets identification site length is 20 bases, after U6 promoters
First base of connection is necessary for G (guanine), and first base for thus defining 20 bases is necessary for G, and this is just
Very strong limitation is caused, causes the selection of target spot to lose greatly selection space；
2. single pUC pUC：The exogenous plasmid built is excessive, can produce be not easy to transfect it is (original particularly with transfection efficiency
Just very low cell is more so) or transfection copy number it is too low the problem of, and this is the low main cause of the common efficiency of Cas9 systems；
3. multi plasmid system：As that Cas9 systems need to be made to work it is necessary to require that whole element corotation enter same cell, and corotation
Efficiency is the bottleneck of this technical tactic；
4. virus carrier system：Cas9 albumen is excessive, is more than 4,000 individual bp, not easy to package, causes the packaging success rate of virus
It is too low, it is difficult to efficiently to function；
5. it is directed to different loci：Need repeatedly structure crRNA or chiRNA vector expression part, operation inconvenience；
6. disposably operated for more sites：Multiple plasmids are needed to transfect jointly, corotation efficiency is low, causes to be directed to Mutiple Targets
Inefficient operation；
7.Cas9 expressing quantities are unstable：The copy number that the Cas9 genes of heterogenous expression are transferred to each cell is different, makes
The expression quantity of Cas9 albumen is unstable, homogeneous into cell, limits the operating efficiency of Cas9 systems；
8. being directed to high, middle throughput, cycle length, time cost, human cost are too high.
Second of strategy (i.e. in-vitro transcription synthesis chiRNA strategies), is to separate existing Cas9 two elements system, i.e.,
It is divided into：In-vitro transcription chiRNA and cas9 albumen.In-vitro transcription chiRNA is to be inserted target sequence by way of plasmid construction
Enter to as example pT7-gRNA on carrier, then be prepared into transcriptases such as T7 or SP6 under the vitro of laboratory
chiRNA；The expression of Cas9 albumen has diversified forms in this scheme：By transfecting the heterogenous expression realized, Cas9mRNA
Embryo's injection of (being also in-vitro transcription), by viral vector integration into genome, Cas9 gene orders fixed point is knocked in
In genome.The strategy has the disadvantages that：
1. the limitation of in-vitro transcription chiRNA target spots selection：Currently used targets identification site length is 20 bases,
Because T7 or SP6 promoters latter linked first or the first two base are necessary for G (guanine), 20 bases are thus defined
First or the first two base be necessary for G, this has resulted in very strong limitation, causes the selection of target spot to lose great selection
Space；
2. in-vitro transcription chiRNA operating environments require high, technical requirements height, the RNA prepared is transcribed in an in vitro environment
It is extremely unstable, extremely handled to avoid RNase ubiquitous in environment；Full-range operating technology requires also remote
Higher than other molecular biology experiments；
3. in-vitro transcription chiRNA costs are high, pilot process uses the related kits of RNA more, and RNA kits are often
It is expensive, cause whole process cost not low；
4. in-vitro transcription chiRNA preparation processes are more, cycle length, flow is complicated：Need to order the Oligo of target spot, chain of annealing
Connect, convert, sequencing identification, plasmid preparation, PCR, PCR primer purifying, transcription, transcription product purifying, all multisteps such as Quality Identification
Suddenly；
5.Cas9 albumen such as needs cotransfection, and cotransfection efficiency is also problem.
6. being directed to high, middle throughput, cycle length, time cost, human cost are too high.
It is contemplated that at least solves one of technical problem present in prior art.Therefore, one object of the present invention
Be to propose it is a kind of relative to prior art operation it is easier, more safety and stability, more efficiently quick, flux is higher, be applicable
In various flux, the method for carrying out genetic modification to the predetermined site of cellular genome using improved Cas9 systems.
Thus, according to an aspect of the present invention, the invention provides a kind of recombinant cell.According to the implementation of the present invention
Example, the cell are overexpressed：First nucleic acid molecules, the first nucleic acid molecule encoding Cas9 albumen or derivatives thereof, it is described
The derivative of Cas9 albumen lacks DNA cleavage activities compared with the Cas9 albumen, but retains target spot identification activity.Inventor
It has surprisingly been found that using the recombinant cell, can be effectively by the way that Che-chiRNA, or Che-gRNA and tracrRNA be turned
In the recombinant cell for entering the present invention, you can genome editor or gene expression regulation are easily performed, so as to effectively realize pair
The predetermined site of cellular genome carries out genetic modification.
In addition, recombinant cell according to the above embodiment of the present invention can also have technical characteristic additional as follows：
According to an embodiment of the invention, the H3F3A genes that first nucleic acid molecules are positioned in the cellular genome
In.Because H3F3A is located at autosome, it is convenient that the first nucleic acid molecules are positioned at into H3F3A genetic manipulations；H3F3A is in office
What has expression in organizing, it is ensured that the effective expression of foreign gene；And amalgamation and expression can avoid exogenous DNA as far as possible
Non-homogeneous restructuring.
According to an embodiment of the invention, the cell is overexpressed：Second nucleic acid molecules, second nucleic acid molecule encoding
tracrRNA。
According to an embodiment of the invention, first nucleic acid molecules have nucleotide sequence as follows：
atgccaaagaagaagcggaaggtcggtatccacggagtcccagcagccgacaagaagtacagcatcggcctggacat
cggcaccaactctgtgggctgggccgtgatcaccgacgagtacaaggtgcccagcaagaaattcaaggtgctgggca
acaccgaccggcacagcatcaagaagaacctgatcggagccctgctgttcgacagcggcgaaacagccgaggccacc
cggctgaagagaaccgccagaagaagatacaccagacggaagaaccggatctgctatctgcaagagatcttcagcaa
cgagatggccaaggtggacgacagcttcttccacagactggaagagtccttcctggtggaagaggataagaagcacg
agcggcaccccatcttcggcaacatcgtggacgaggtggcctaccacgagaagtaccccaccatctaccacctgaga
aagaaactggtggacagcaccgacaaggccgacctgcggctgatctatctggccctggcccacatgatcaagttccg
gggccacttcctgatcgagggcgacctgaaccccgacaacagcgacgtggacaagctgttcatccagctggtgcaga
cctacaaccagctgttcgaggaaaaccccatcaacgccagcggcgtggacgccaaggccatcctgtctgccagactg
agcaagagcagacggctggaaaatctgatcgcccagctgcccggcgagaagaagaatggcctgttcggaaacctgat
tgccctgagcctgggcctgacccccaacttcaagagcaacttcgacctggccgaggatgccaaactgcagctgagca
aggacacctacgacgacgacctggacaacctgctggcccagatcggcgaccagtacgccgacctgtttctggccgcc
aagaacctgtccgacgccatcctgctgagcgacatcctgagagtgaacaccgagatcaccaaggcccccctgagcgc
ctctatgatcaagagatacgacgagcaccaccaggacctgaccctgctgaaagctctcgtgcggcagcagctgcctg
agaagtacaaagagattttcttcgaccagagcaagaacggctacgccggctacattgacggcggagccagccaggaa
gagttctacaagttcatcaagcccatcctggaaaagatggacggcaccgaggaactgctcgtgaagctgaacagaga
ggacctgctgcggaagcagcggaccttcgacaacggcagcatcccccaccagatccacctgggagagctgcacgcca
ttctgcggcggcaggaagatttttacccattcctgaaggacaaccgggaaaagatcgagaagatcctgaccttccgc
atcccctactacgtgggccctctggccaggggaaacagcagattcgcctggatgaccagaaagagcgaggaaaccat
caccccctggaacttcgaggaagtggtggacaagggcgcttccgcccagagcttcatcgagcggatgaccaacttcg
ataagaacctgcccaacgagaaggtgctgcccaagcacagcctgctgtacgagtacttcaccgtgtataacgagctg
accaaagtgaaatacgtgaccgagggaatgagaaagcccgccttcctgagcggcgagcagaaaaaggccatcgtgga
cctgctgttcaagaccaaccggaaagtgaccgtgaagcagctgaaagaggactacttcaagaaaatcgagtgcttcg
actccgtggaaatctccggcgtggaagatcggttcaacgcctccctgggcacataccacgatctgctgaaaattatc
aaggacaaggacttcctggacaatgaggaaaacgaggacattctggaagatatcgtgctgaccctgacactgtttga
ggacagagagatgatcgaggaacggctgaaaacctatgcccacctgttcgacgacaaagtgatgaagcagctgaagc
ggcggagatacaccggctggggcaggctgagccggaagctgatcaacggcatccgggacaagcagtccggcaagaca
atcctggatttcctgaagtccgacggcttcgccaacagaaacttcatgcagctgatccacgacgacagcctgacctt
taaagaggacatccagaaagcccaggtgtccggccagggcgatagcctgcacgagcacattgccaatctggccggca
gccccgccattaagaagggcatcctgcagacagtgaaggtggtggacgagctcgtgaaagtgatgggccggcacaag
cccgagaacatcgtgatcgaaatggccagagagaaccagaccacccagaagggacagaagaacagccgcgagagaat
gaagcggatcgaagagggcatcaaagagctgggcagccagatcctgaaagaacaccccgtggaaaacacccagctgc
agaacgagaagctgtacctgtactacctgcagaatgggcgggatatgtacgtggaccaggaactggacatcaaccgg
ctgtccgactacgatgtggaccatatcgtgcctcagagctttctgaaggacgactccatcgacaacaaggtgctgac
cagaagcgacaagaaccggggcaagagcgacaacgtgccctccgaagaggtcgtgaagaagatgaagaactactggc
ggcagctgctgaacgccaagctgattacccagagaaagttcgacaatctgaccaaggccgagagaggcggcctgagc
gaactggataaggccggcttcatcaagagacagctggtggaaacccggcagatcacaaagcacgtggcacagatcct
ggactcccggatgaacactaagtacgacgagaatgacaagctgatccgggaagtgaaagtgatcaccctgaagtcca
agctggtgtccgatttccggaaggatttccagttttacaaagtgcgcgagatcaacaactaccaccacgcccacgac
gcctacctgaacgccgtcgtgggaaccgccctgatcaaaaagtaccctaagctggaaagcgagttcgtgtacggcga
ctacaaggtgtacgacgtgcggaagatgatcgccaagagcgagcaggaaatcggcaaggctaccgccaagtacttct
tctacagcaacatcatgaactttttcaagaccgagattaccctggccaacggcgagatccggaagcggcctctgatc
gagacaaacggcgaaaccggggagatcgtgtgggataagggccgggattttgccaccgtgcggaaagtgctgagcat
gccccaagtgaatatcgtgaaaaagaccgaggtgcagacaggcggcttcagcaaagagtctatcctgcccaagagga
acagcgataagctgatcgccagaaagaaggactgggaccctaagaagtacggcggcttcgacagccccaccgtggcc
tattctgtgctggtggtggccaaagtggaaaagggcaagtccaagaaactgaagagtgtgaaagagctgctggggat
caccatcatggaaagaagcagcttcgagaagaatcccatcgactttctggaagccaagggctacaaagaagtgaaaa
aggacctgatcatcaagctgcctaagtactccctgttcgagctggaaaacggccggaagagaatgctggcctctgcc
ggcgaactgcagaagggaaacgaactggccctgccctccaaatatgtgaacttcctgtacctggccagccactatga
gaagctgaagggctcccccgaggataatgagcagaaacagctgtttgtggaacagcacaagcactacctggacgaga
tcatcgagcagatcagcgagttctccaagagagtgatcctggccgacgctaatctggacaaagtgctgtccgcctac
aacaagcaccgggataagcccatcagagagcaggccgagaatatcatccacctgtttaccctgaccaatctgggagc
ccctgccgccttcaagtactttgacaccaccatcgaccggaagaggtacaccagcaccaaagaggtgctggacgcca
ccctgatccaccagagcatcaccggcctgtacgagacacggatcgacctgtctcagctgggaggcgacaaaaggccg
gcggccacgaaaaaggccggccaggcaaaaaagaaaaagtaa(SEQ ID NO：1), SEQ ID NO：Nucleotides shown in 1
Sequential coding wild type Cas9 albumen；
Second nucleic acid point has nucleotide sequence as follows：
GGTAGTATTAAGTATTGTTTTATGGCTGATAAATTTCTTTGAATTTCTCCTTGATTATTTGTTATAAAAGTTATAAA
ATAATCTTGTTGGAACCATTCAAAACAGCATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGC
ACCGAGTCGGTGCTTTTTTT(SEQ ID NO：2), SEQ ID NO：Nucleotide sequence coded tracrRNA shown in 2.
According to an embodiment of the invention, the H3F3A genes that second nucleic acid molecules are positioned in the cellular genome
In.Thus, the second nucleic acid molecules are positioned at the easy to operate of H3F3A genes, effective table of the second nucleic acid molecules can be ensured
Reach, and amalgamation and expression can avoid the non-homogeneous restructuring of the second nucleic acid molecules as far as possible.
According to an embodiment of the invention, the direction along 5 ' ends to 3 ' ends, first nucleic acid molecules are located at described second
The upstream of nucleic acid molecules.
According to an embodiment of the invention, the derivative of the Cas9 albumen has following mutation compared with the Cas9 albumen
At least one：D10A and H840A.Wherein, " D10A " is represented compared with the Cas9 albumen, the derivative of the Cas9 albumen
10th amino acid D sports A, and " H840A " is represented compared with the Cas9 albumen, and the of the derivative of the Cas9 albumen
840 amino acid sport A by H.Thus, in recombinant cell Cas9 albumen derivative be overexpressed efficiency high, Cas9 albumen with
Che-chiRNA, or Che-gRNA and tracrRNA matcheds, it is advantageously used for carrying out follow-up genome predetermined site
Genetic modification.It should be noted that expression way " Cas9 albumen " of the present invention is wild type Cas9 albumen,
" derivative of Cas9 albumen " is Cas9 protein mutants.
According to an embodiment of the invention, the genome is overexpressed gene expression regulation element.It should be noted that utilize
The Cas9 albumen of nuclease free cleavage activity melts with special transcription regulatory element (VP16, VP48, VP64, KRAB, SID4X etc.)
Expression is closed, expression that can be to genome endogenous gene carries out human intervention, regulation and control.And then one according to the present invention is specific
Example, the gene expression regulation element are SID4X or VP64.Wherein, SID4X is by four mSin3interacting
Domain is in series, and can be combined with transcriptional modulatory gene Sin3A, Sin3B PAH2 domains, so as to reach suppressor
The effect of expression.VP64 is in series by four VP16 domains, can be combined and then started with transcription factors such as Oct1, HCF
The expression of gene.
According to an embodiment of the invention, the direction along 5 ' ends to 3 ' ends, first nucleic acid molecules are located at the SID4X
Downstream.Thereby, it is possible to reduce the competition binding of other transcription factors as far as possible, make SID4X effect more stable.
According to an embodiment of the invention, the direction along 5 ' ends to 3 ' ends, first nucleic acid molecules are located at the VP64
Upstream.Thus, be advantageous to VP64 and recruit transcription factor progress gene expression, reduce Cas9 albumen and to VP64 or be recruited albumen
Interference.
According to another aspect of the invention, present invention also offers a kind of reagent for being used to carry out cell genetic modification.
According to an embodiment of the invention, the reagent includes：Che-chiRNA；Or Che-gRNA and optionally Che-tracrRNA.
Thus, the reagent for target gene of the present invention is transferred in foregoing recombinant cell, you can be easily performed genome editor
Or gene expression regulation, so as to which the predetermined site effectively realized to cellular genome carries out genetic modification.
According to an embodiment of the invention, Che-chiRNA includes sequence：5’-(N)20GUUUUAGAGCUAGAAAUAGCAAGUUAAAAU-3’(SEQ ID NO：3), N=A, U, G or C.Thus, thus, relative to
Prior art, Che-chiRNA of the invention length for the targets identification site of 20 bases first or the first two base not
Need to be necessary for G (guanine), so as to which the selection limitation of Che-chiRNA transfection target spots is small.And then utilize the reagent of the present invention
When carrying out genetic modification to the predetermined site of cellular genome, efficiency high, effect is good.
According to an embodiment of the invention, Che-gRNA includes sequence：5’-(N)20GUUUUAGAGCUA-3’(SEQ ID NO：
4), N=A, U, G or C.Thus, relative to prior art, Che-gRNA of the invention length is the targets identification of 20 bases
First or the first two base in site not have to be G (guanine), and the selection limitation that target spot is transferred to so as to Che-gRNA is small.
And then when carrying out genetic modification using the predetermined site of the agents on cellular genome of the present invention, efficiency high, effect is good.
According to an embodiment of the invention, being of at least one of Che-chiRNA, Che-gRNA and Che-tracrRNA
Learn synthesis.Thus, when for carrying out genetic modification to the predetermined site of cellular genome, RNA target to identification region not by
The limitation of the factors such as promoter, target spot selection is more extensive, and RNA quality safeties are stable, quantitative accurate, easy to operate, efficient, integrate
Working afterwards, quick, flux is high.
According to another aspect of the present invention, present invention also offers a kind of predetermined site to cellular genome to carry out gene
The method of transformation.According to an embodiment of the invention, this method includes：Foregoing recombinant cell is provided；And will above institute
The reagent stated is incorporated into the recombinant cell, wherein, the motif (N) of the Che-chiRNA or Che-gRNA20It is to be based on institute
State the sequences Design of predetermined site.Thereby, it is possible to be easily performed genome editor or gene expression regulation, so as to effectively
Realize and genetic modification is carried out to the predetermined site of cellular genome, and it is easier, more safe steady relative to prior art operation
It is fixed, more efficiently quick, flux is higher, suitable for various flux.
According to an embodiment of the invention, the genetic modification includes carrying out gene knockout or expression regulation to predetermined site.
It should be noted that herein used in term " genetic modification " should be interpreted broadly, its refer to it is any can
Genetic transcription, translation, expression, any operation of sequence are influenceed, for example, the expression of related gene can be raised or lowered, is opened
The transcription and translation of dynamic related gene, cuts off the sequence of related gene, causes to be mutated in the sequence of related gene, such as inserts
Enter, lack and replace.Certainly, it will be appreciated to those of skill in the art that can be carried out in identical gene simultaneously
The operation of multiple genetic modifications.
In addition, according to an embodiment of the invention, genome editor and gene are carried out using Cas9 systems relative to existing
The method of expression regulation, the predetermined site of the invention to cellular genome carry out the method for genetic modification at least with following excellent
Point：
1. according to an embodiment of the invention, chemical synthesis RNA target is not limited to identification region by factors such as promoters, target
Point selection is more extensive；
2. according to an embodiment of the invention, chemical synthesis RNA quality safeties are stable, quantitative accurate：By then passing through chemistry
Synthetic method is prepared, and whole process obtains standard Quality Control supervision, is repaiied by carrying out 5 ' ends, 3 ' ends, single-stranded or double-stranded etc. to RNA
Decorations, the i.e. effective and stable effects of RNA can be reached；And building-up process middle-molecular-weihydroxyethyl is known, synthetic quantity is, it is known that can accomplish essence
It is determined that amount, facilitates follow-up operation；
3. according to an embodiment of the invention, chemical synthesis RNA is efficient, easy to operate：Because RNA molecular weight is smaller,
In the case of transfection efficiency identical, when utilizing Cas9 systems to carry out genome editor and gene expression with foregoing at this stage two kinds
During the transfection thing of the strategy use phase homogenous quantities of regulation and control, RNA copy number is higher, can recruit more Cas9 albumen and carry out work
Make, so more efficient；It is prepared by then passing through chemical synthesis process, RNA transfection can be light as being transfected siRNA
Complete, and transfection reagent is identical with siRNA transfection reagents, facilitates the use in laboratory；
4. according to an embodiment of the invention, chemical synthesis RNA works, quick, flux is high：Because Cas9 albumen has been integrated into
In genome, expressed in the cell, thus RNA enter cell interior start recruit Cas9 albumen be operated；Can
Multiple synthesis RNA are mixed and carry out Mutiple Targets operation, also can parallel be tested with multiple synthesis RNA, be improved with this
Working flux and efficiency；
5. according to an embodiment of the invention, Cas9 albumen is accurately incorporated into the specific site in genome, expression is stable, can
Accomplish that the accurate tune on expression time and expression quantity leads to；It will not cause to cause safety and stability etc. to genome
Destroy.
The additional aspect and advantage of the present invention will be set forth in part in the description, and will partly become from the following description
Obtain substantially, or recognized by the practice of the present invention.
Brief description of the drawings
The above-mentioned and/or additional aspect and advantage of the present invention will become in the description from combination accompanying drawings below to embodiment
Substantially and it is readily appreciated that, wherein：
Fig. 1 is shown according to one embodiment of the invention, the result of Flow cytometry genetic recombination efficiency；
Fig. 2 is shown according to one embodiment of the invention, for identifying that the PCR in Cas9 genes insertion H3F3A genes shows
The electrophoresis result of intention and PCR primer；
Fig. 3 is shown destroys the electrophoresis result of situation according to one embodiment of the invention, T7 restriction endonucleases detection cellular targets point；
Fig. 4 is shown detects the expression quantity of intracellular CXCR4 and MyoD1 genes according to one embodiment of the invention, qPCR
Result.
Embodiment
Embodiments of the invention are described below in detail, it is necessary to which explanation, the following example is just for the sake of this hair of explanation
It is bright, without causing any restrictions to the scope of the present invention.
Embodiment 1：Gene knockout is carried out in HELA cells
1st, the cell of foreign gene-carrying is prepared
H3F3A gene internals target spot is destroyed into plasmid pDSB-H3.3 and the homologous recombination instrument with insertion genetic fragment
Plasmid Donor-KI-1/Donor-KI-2 cotransfections are into Hela cells.
Wherein, pDSB-H3.3 includes one sequence successively：U6 promoters, H3F3A gRNA-1, U6 promoters, H3F3A
GRNA-2, CBh promoter, the encoding gene of Flag label proteins, the encoding gene of Cas9 (D10A) albumen.Wherein Cas9
(D10A) albumen is the derivative of wild type Cas9 albumen, and it is relative to wild type Cas9 albumen (SEQ ID NO：Nucleosides shown in 1
The albumen of sequences code) there is D10A mutation, the encoding gene of Cas9 (D10A) albumen, relative to SEQ ID NO：Shown in 1
The bit base of nucleotide sequence the 74th sports C by A.
Donor-KI-1 includes one sequence successively：H3F3A homologous recombination arm left arms, SA shearing sequence, H3F3A last
CDS sequences (being free of terminator codon) on individual extron, 2A is from Cleavage sequences, puromycin resistant genes, polyA tails,
CBh promoters, the encoding gene of Flag label proteins, Cas9 genes (sequence such as SEQ ID NO：Shown in 1), bGH polyA tails,
H3F3A homologous recombination arm right arms.
Donor-KI-2 includes one sequence successively：H3F3A homologous recombination arm left arms, SA shearing sequence, H3F3A last
CDS sequences (being free of terminator codon) on individual extron, 2A is from Cleavage sequences, puromycin resistant genes, polyA tails,
CBh promoters, Flag label proteins, Cas9 genes (sequence such as SEQ ID NO：Shown in 1), bGH polyA tails, H1 promoters,
Short tracrRNA sequences, H3F3A homologous recombination arm right arms.
It should be noted that above-mentioned each carrier is that above-mentioned corresponding each component fragment, Ran Houyi are obtained by PCR method
Secondary be added in carrier T and build what is obtained.
24 hours before cotransfection, cell is inoculated into a hole of 24 orifice plates with 40% density.
Above-mentioned transfection is to use transfection reagent：X-tremeGENE HP DNA Transfection Reagent, illustratively
What book was operated.Specifically, the μ g of DNA total amounts 1 are diluted in 100uL OPTI-MEM culture mediums, add 3 μ L X-
TremeGENE HP DNA Transfection Reagent, which are mixed, stands 15 minutes, takes 50 μ L to add the hole for having cell culture
In, concussion is mixed, and culture medium is changed after 24 hours.
Then, the result of flow cytometry is shown by Flow cytometry genetic recombination efficiency, Fig. 1.Wherein, such as
By green fluorescence on Cas9 protein labelings, WT it is wild type control by specific antibody anti-Flag shown in Fig. 1.And then
Result based on flow cytometry, the positive cell sorting of green fluorescence is gone out, after being cultivated, PCR identification exogenous sequences
(i.e. Cas9 genes) is properly inserted in H3F3A gene.Fig. 2 shows the electrophoresis result of PCR schematic diagrames and PCR primer.
As shown in Fig. 2 two primers P1, P2 on the outside of homologous recombination arm are used respectively, and two primers P3, P4 inside Insert Fragment,
Three kinds of combinations enter performing PCR to gfp positive cell sample, and PCR primer is carried out into 1% agarose gel electrophoresis；Its
In, KI fragment represent the Cas9 genes in insertion H3F3A genes in PCR schematic diagrames, and KI-1 swimming lanes is use in electrophoretogram
PDSB-H3.3 and the PCR primer after Donor-KI-1 cotransfections, KI-2 swimming lanes are to be total to using pDSB-H3.3 and Donor-KI-2
PCR primer after transfection.
Thus, prepare only carry Cas9 Hela cells (i.e. using Donor-KI-1 cotransfections obtain restructuring it is thin
Born of the same parents) at the same carry Cas9+tracrRNA Hela cells (i.e. using Donor-KI-2 cotransfections obtain recombinant cell).
2nd, for gene EMX1, PVALB shot design, synthesis che-chiRNA and che-gRNA in human genome.
Wherein, che-chiRNA and che-gRNA design principle is：
A. sequence has to comply with (N)20NGG sequence, (N)20Targets identification region, NGG are Cas9 cleavage sites；
B. there is the probability of mispairing as close as 0 in full-length genome in used target sequence.
Search meets the target spot of mentioned above principle in the total length of EMX1 and PVALB genes respectively, then according to che-
The principle of chiRNA and che-gRNA designs generates corresponding RNA sequence.The RNA of the present embodiment is produced by Integrated Device Technology, Inc. of the U.S..
As a result it is as follows：
For EMX1 genes：
Che-gRNA sequences are：GGGGCCACUAGGGACAGGAUGUUUUAGAGCUAUGCUGUUUUG(SEQ ID NO：
5)；
Che-chiRNA sequences are：GGGGCCACUAGGGACAGGAUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAA
GGCUAGUCCG(SEQ ID NO：6).
For PVALB genes：
Che-gRNA sequences are：AUUGGGUGUUCAGGGCAGAGGUUUUAGAGCUAUGCUGUUUUG(SEQ ID NO：
7)；
Che-chiRNA sequences are：AUUGGGUGUUCAGGGCAGAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAA
GGCUAGUCCG(SEQ ID NO：8).
3rd, transfect
Previously obtained only carrying is transfected respectively using the che-chiRNA of the target spot synthesis above for EMX1, PVALB
Cas9 Hela cells (recombinant cell obtained using Donor-KI-1 cotransfections)；Using above for EMX1, PVALB
The che-gRNA of target spot synthesis is transfected while is carried Cas9+tracrRNA Hela cells and (is total to using Donor-KI-2 respectively
Transfect the recombinant cell obtained).Wherein, the che-chiRNA or che-gRNA of each gene of each cell transfection are equal
It is individually to carry out, i.e., is independently to test, thus, each independent experiment is that a kind of cell knocks out a gene, so as to only
Two genes can be detected respectively by carrying Cas9 Hela cells, and carrying Cas9+tracrRNA cell can also detect respectively
Two genes.
24 hours before above-mentioned transfection is carried out, cell is inoculated into a hole of 24 orifice plates with 40% density.
Above-mentioned transfection be using transfection reagent " RNAiMAX Transfection Reagent”
(Life technologies), by specification operation are carried out.Specifically, 10pmol RNA are diluted in 50 μ L OPTI-MEM
In culture medium, 3 μ LRNAiMAX Transfection Reagent are diluted in 50 μ L OPTI-MEM trainings
Support in base, both mixed room temperatures are stood 5 minutes, taking 50 μ L to add has in the hole of cell culture, and concussion mixes, after 24 hours more
Change culture medium.
4th, situation is destroyed using T7 restriction endonucleases detection target spot.
Cell was collected by 48 hours after cell transfecting, respectively using reagent QuickExtractTM DNA Extraction
Solution (Epicentre) prepares genomic DNA.
Then, performing PCR is entered using the primer designed for target spot near zone.
Wherein, the primer that PCR is used for：
EMX1-test-F:AAAACCACCCTTCTCTCTGGC(SEQ ID NO：9),
EMX1-test-R:GGAGATTGGAGACACGGAGAG(SEQ ID NO：10),
PVALB-test-F:CTGGAAAGCCAATGCCTGAC(SEQ ID NO：11),
PVALB-test-R:GGCAGCAAACTCCTTGTCCT(SEQ ID NO：12).
PCR reagent：Q5Hot Start High-Fidelity2X Master Mix (NEB), reaction system (cumulative volume 40
μL)：2X Master Mix20 μ L, the μ L of genome DNA sample 5, primer mixed liquor (10 μM) 3 μ L, ddH2O12μL.Reaction interval
Sequence：1.98℃30s；2.98℃5s；3.60℃10s；4.72℃30s；5.72 DEG C of 1m, followed wherein the 2nd to the 4th step carries out 35
Ring.
Then, the denaturation of PCR reaction products again is annealed：2 μ L NEB buffer2 are added into 10uL PCR primers,
ddH2O complements to 20 μ L, and cycle of annealing is：1.95 DEG C 10 minutes, 2. it is per second successively decrease 2 DEG C to 85 DEG C, 3. per second successively decrease 0.2 DEG C extremely
25 DEG C, 4.25 DEG C 1 minute.
After annealing, 1 μ L T7 restriction endonucleases (NEB) are added into annealed product, 37 DEG C are reacted 30 minutes (T7 restriction endonucleases can be with
Double-stranded DNA caused by not destroying to target spot destroyed and the annealing of chain is cut), then reaction product is subjected to electrophoresis, so as to
Situation is destroyed using T7 restriction endonucleases detection target spot.Fig. 3 shows that T7 restriction endonucleases detection target spot destroys the electrophoresis result of situation.From figure
As can be seen that using technology of the invention in 3 electrophoresis result, EMX1 has effectively been knocked out respectively in the cell for carrying Cas9
Gene and PVALB genes, and also effectively carry Cas9 and tracrRNA cell in knocked out respectively EMX1 genes and
PVALB genes.
Embodiment 2 carries out gene expression regulation in Hela cells
According to method similar to Example 1, structure carries Cas9 mutant (D10A, H840A) and transcriptional control simultaneously
The Hela cells of element (SID4X or VP64).Wherein, SID4X or VP64 is connected on Cas9 mutant (D10A, H840A)
On carrier, its carrier construction method is also the method using conventional PCR and molecular cloning；The method and strategy of cell restructuring
It is same as Example 1, only it is more SID4X or more below before Cas9 (D10A, H840A) DNA sequence dna in Donor
VP64；Other are identical with embodiment 1 including transfection conditions etc..Wherein Cas9 (D10A, H840A) albumen is wild type Cas9
The derivative of albumen, it is relative to wild type Cas9 albumen (SEQ ID NO：Nucleotide sequence coded albumen shown in 1) simultaneously
It is mutated with D10A and H840A.
Then, exemplified by knocking in genome with SID4X-Cas9 (D10A, H840A), Cas9 (D10A, H840A)-VP64,
Gene expression regulation is carried out in Hela cells, it is specific as follows：
Target spot is selected in the transcription factor binding region domain of target gene (hMyoD1, hCXCR4) or 5 ' UTR regions.Each Che-
ChiRNA sequences are as follows：
hMYOD1-1：GCCUGGGCUCCGGGGCGUUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUC
CG(SEQ ID NO：13)；
hMYOD1-2：GGGCCCCUGCGGCCACCCCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUC
CG(SEQ ID NO：14)
hMYOD1-3：CCUCCCUCCCUGCCCGGUAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUC
CG(SEQ ID NO：15)；
hMYOD1-4：GAGGUUUGGAAAGGGCGUGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUC
CG(SEQ ID NO：16)；
hCXCR4-1：ACUUACACUGAUCCCCUCCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUC
CG(SEQ ID NO：17)；
hCXCR4-2：AGGUAGCAAAGUGACGCCGAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUC
CG(SEQ ID NO：18)；
hCXCR4-3：GAACCAGCGGUUACCAUGGAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUC
CG(SEQ ID NO：19)；
hCXCR4-4：CAAACUGAAGUUUCUGGCCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUC
CG(SEQ ID NO：20).
HMyoD1, hCXCR4 che-chiRNA are transferred to Hela-Cas9a, Hela-Cas9i cell line respectively, wherein
For Hela-Cas9a cell lines to carry Cas9 (D10A, H840A)-VP64 Hela cells, Hela-Cas9i cell lines are carrying
SID4X-Cas9 (D10A, H840A) Hela cell lines.Transfection conditions are same as Example 1, collect within 48 hours after transfection thin
Born of the same parents, and using reagent iScriptTMRT-qPCR Sample Preparation Reagent (Bio-Rad) prepare total serum IgE, so
Reagent iScript is used afterwardsTM One-Step RT-PCR Kit with Green (Bio-Rad) carries out one-step method
QPCR reacts.As a result Fig. 4 is seen.Fig. 4 shows that qPCR detects the result of the relative expression quantity of intracellular CXCR4 and MyoD1 genes.
As shown in figure 4, ordinate represents relative expression quantity, unit is multiple.As shown in Figure 4, endogenous gene CXCR4 expression is obvious
Suppress, endogenous gene MyoD1 is activated, great expression., wherein it is desired to explanation, endogenous gene MyoD1 great expressions are main
It is because the Cas9 mutant (D10A, H840A) that the present embodiment uses does not possess the damage capability of genome, simply identifies target
Point, and the shot design of the present embodiment is in the transcription regulating region of gene, and the VP64 to be connected with Cas9 has recruited transcription factor
By identified gene activation, start expression.
In the description of this specification, reference term " one embodiment ", " some embodiments ", " example ", " specifically show
The description of example " or " some examples " etc. means specific features, structure, material or the spy for combining the embodiment or example description
Point is contained at least one embodiment or example of the present invention.In this manual, to the schematic representation of above-mentioned term not
Necessarily refer to identical embodiment or example.Moreover, specific features, structure, material or the feature of description can be any
One or more embodiments or example in combine in an appropriate manner.
Although an embodiment of the present invention has been shown and described, it will be understood by those skilled in the art that：Not
In the case of departing from the principle and objective of the present invention a variety of change, modification, replacement and modification can be carried out to these embodiments, this
The scope of invention is limited by claim and its equivalent.
Claims (4)
1. a kind of recombinant cell, it is characterised in that the cell is overexpressed：
First nucleic acid molecules, the first nucleic acid molecule encoding Cas9 albumen or derivatives thereof, the derivative of the Cas9 albumen
Compared with the Cas9 albumen, DNA cleavage activities are lacked, but retain target spot identification activity,
Wherein, the derivative of the Cas9 albumen has at least one following mutation compared with the Cas9 albumen：D10A and
H840A,
The cell is further overexpressed：Second nucleic acid molecules, the second nucleic acid molecule encoding tracrRNA,
And first nucleic acid molecules have SEQ ID NO：Nucleotide sequence shown in 1, second nucleic acid molecules have
SEQ ID NO：Nucleotide sequence shown in 2,
First nucleic acid molecules are positioned in the H3F3A genes in the cellular genome,
Second nucleic acid molecules are positioned in the H3F3A genes in the cellular genome,
Direction along 5 ' ends to 3 ' ends, first nucleic acid molecules are located at the upstream of second nucleic acid molecules,
The genome is overexpressed gene expression regulation element,
The gene expression regulation element is SID4X or VP64,
Direction along 5 ' ends to 3 ' ends, first nucleic acid molecules are located at the downstream of the SID4X,
Direction along 5 ' ends to 3 ' ends, first nucleic acid molecules are located at the upstream of the VP64.
2. a kind of method that predetermined site to cellular genome carries out genetic modification, it is characterised in that including：
Recombinant cell described in claim 1 is provided；And
It will be incorporated into for the reagent that genetic modification is carried out to cell in the recombinant cell,
The reagent includes：
Che-chiRNA；Or
Che-gRNA and optionally Che-tracrRNA,
Wherein, Che-chiRNA includes sequence：
5’-(N)20GUUUUAGAGCUAGAAAUAGCAAGUUAAAAU-3 ', N=A, U, G or C, Che-gRNA include sequence：
5’-(N)20GUUUUAGAGCUA-3 ', N=A, U, G or C,
Wherein, the motif (N) of the Che-chiRNA or Che-gRNA20It is the sequences Design based on the predetermined site.
3. according to the method for claim 2, it is characterised in that the genetic modification includes carrying out clpp gene to predetermined site
Remove or expression regulation.
4. according to the method for claim 2, it is characterised in that Che-chiRNA, Che-gRNA and Che-tracrRNA
At least one of be chemical synthesis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410346231.8A CN104152414B (en) | 2014-07-18 | 2014-07-18 | The method that genetic modification is carried out to the predetermined site of cellular genome |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410346231.8A CN104152414B (en) | 2014-07-18 | 2014-07-18 | The method that genetic modification is carried out to the predetermined site of cellular genome |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104152414A CN104152414A (en) | 2014-11-19 |
| CN104152414B true CN104152414B (en) | 2018-03-13 |
Family
ID=51878042
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410346231.8A Expired - Fee Related CN104152414B (en) | 2014-07-18 | 2014-07-18 | The method that genetic modification is carried out to the predetermined site of cellular genome |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104152414B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104450785A (en) * | 2014-12-08 | 2015-03-25 | 复旦大学 | Genome editing method using attachment carrier for encoding targeted endonuclease and kit |
| CN106119269B (en) * | 2016-06-23 | 2019-12-06 | 百奥迈科生物技术有限公司 | Method for preparing linear single-stranded DNA in escherichia coli |
| CN108220339A (en) * | 2016-12-14 | 2018-06-29 | 深圳华大生命科学研究院 | The method of cell transformation |
| CN108342416A (en) * | 2018-02-08 | 2018-07-31 | 广州医科大学 | A kind of conditionity induction knocks out the construction method for the liver cancer cell lines for being overexpressed Chd1l genes |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DK3064585T3 (en) * | 2012-12-12 | 2020-04-27 | Broad Inst Inc | DESIGN AND OPTIMIZATION OF IMPROVED SYSTEMS, PROCEDURES AND ENZYME COMPOSITIONS FOR SEQUENCE MANIPULATION |
| WO2014093655A2 (en) * | 2012-12-12 | 2014-06-19 | The Broad Institute, Inc. | Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains |
-
2014
- 2014-07-18 CN CN201410346231.8A patent/CN104152414B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN104152414A (en) | 2014-11-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11760998B2 (en) | High-throughput precision genome editing | |
| US20220033858A1 (en) | Crispr oligoncleotides and gene editing | |
| US20230091847A1 (en) | Compositions and methods for improving homogeneity of dna generated using a crispr/cas9 cleavage system | |
| CN106119269B (en) | Method for preparing linear single-stranded DNA in escherichia coli | |
| CN108546716A (en) | A kind of genome edit methods | |
| WO2017147056A1 (en) | Methods for modulating dna repair outcomes | |
| CN109136248B (en) | Multi-target editing vector and construction method and application thereof | |
| CN102703424B (en) | A kind of method of genome of E.coli point mutation of recombined engineering mediation | |
| CN110343724B (en) | Method for screening and identifying functional lncRNA | |
| CN112384620B (en) | Methods for screening and identifying functional lncRNA | |
| JP2020517299A (en) | Site-specific DNA modification using a donor DNA repair template with tandem repeats | |
| CN104152414B (en) | The method that genetic modification is carried out to the predetermined site of cellular genome | |
| WO2018089437A1 (en) | Compositions and methods for scarless genome editing | |
| Kouprina et al. | Highly selective, CRISPR/Cas9‐mediated isolation of genes and genomic loci from complex genomes by TAR cloning in yeast | |
| KR20240099418A (en) | serine recombinase | |
| CN111662932B (en) | Method for improving homologous recombination repair efficiency in CRISPR-Cas9 gene editing | |
| US20220333129A1 (en) | A nucleic acid delivery vector comprising a circular single stranded polynucleotide | |
| CN111088256B (en) | Construction method of carrier for efficiently expressing small RNA and expressing multiple small RNAs by cynomolgus monkey U6 promoter | |
| CN113151265A (en) | Method for inhibiting expression of lncRNA in nucleus based on CRISPR-dCase9 system | |
| CN109628447B (en) | sgRNA of specific target sheep friendly site H11, and coding DNA and application thereof | |
| CN111334531A (en) | High signal-to-noise ratio negative genetic screening method | |
| Liu et al. | Rapid control of genome editing in human cells by chemical-inducible CRISPR-Cas systems | |
| CN116254258A (en) | Method for constructing carrier library containing tag sequence through short oligonucleotides and application | |
| WO2023183627A1 (en) | Production of reverse transcribed dna (rt-dna) using a retron reverse transcriptase from exogenous rna | |
| CN115747209A (en) | Specific nucleotide sequence and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180313 Termination date: 20210718 |