CN109628447B - sgRNA of specific target sheep friendly site H11, and coding DNA and application thereof - Google Patents

Abstract

The invention provides sgRNA specifically targeting sheep friendly locus H11, and coding DNA and application thereof. The sgRNA sequence of the invention is shown in SEQ ID NO.1 or 2, and the DNA sequence for transcribing the sgRNA sequence is shown in SEQ ID NO.3 or 4. The sgRNA can specifically recognize the sheep H11 locus, guides Cas9 endonuclease to efficiently cut the locus, has the targeting efficiency of over 70 percent, can effectively reduce the off-target phenomenon existing in a CRISPR/Cas9 system, and further reduces the influence caused by Indel of a genome non-target locus due to non-specific cutting. The Cas9/sgRNA expression system constructed on the basis of the sgRNA provided by the invention can realize targeted modification of a sheep H11 locus at a cell or individual level, and is used for researching related space-time specific expression genes and breeding new variety gene editing sheep.

Description

sgRNA of specific target sheep friendly site H11, and coding DNA and application thereof

Technical Field

The invention relates to the field of genetic engineering, in particular to sgRNA of a specific target sheep friendly locus H11, and coding DNA and application thereof.

Background

The Hipp11(H11) site, abbreviated H11 site was originally identified as a foreign gene friendly site isolated in 2010 on chromosome 11 in mice by Simo Hippenmeyer et al, Stanford university (Safe Harbor). Thereafter, the investigators further validated in stem cells of transgenic mice and humans. In mice, the H11 locus is located between Eif4enif1 and Drg l genes, is located near a centromere of chromosome 11, is an intergenic region, has high safety and has no gene silencing effect. Research shows that the exogenous gene is integrated at the site H11, and the physiological and biochemical indexes and the reproductive capacity of the mouse are not affected. The H11 site has a higher integration efficiency compared to the mouse Rosa26 integration site. In 2015, researchers have successfully inserted a gene fragment of about 9kb into the H11 site of swine by using CRISPR/Cas9 system.

Among foreign gene insertion sites in sheep, the most commonly used site is the Rosa26 site, which has the characteristic of systemic expression, and the transgenic animals targeted on the gene have no difference in growth and development from wild type, but the gene is a pseudogene, does not encode protein, but has the function of potentially participating in the transcriptional regulation of other genes. Although pseudogenes are "DNA waste" in the genetic evolution process and do not encode proteins, recent studies indicate that a large number of non-coding sequences in the genome, such as miRNA, LncRNA, etc., play a crucial role in the regulation of expression of related genes. In addition, the promoter of Rosa26 site is expressed in a systemic broad spectrum, tissue-specific expression is difficult to achieve, and the current research based on gene function usually needs to be specific to a certain tissue of a certain cell, even needs specific time to express a target gene, while the H11 site does not have the problem, is positioned in a spacer region of the gene, and does not have the promoter, so that unknown biosafety risk exists in targeting at a pseudogene region, and compared with the H11 site, the promoter has the advantage of site-specific integration of an exogenous gene. According to the scientific research needs, a specific promoter can be constructed to the target point so as to realize the space-time specific expression of the target gene and more particularly research the gene function. If the safe and effective gene modification site H11 is positioned in the genome of the sheep, the breeding of new sheep varieties with gene editing is facilitated.

Since the emergence of the earliest gene editing technologies, namely Zinc Finger Nucleases (ZFNs), new gene editing technologies are developed and become active, and a CRISPR/Cas nuclease system guided by Transcription Activator Like Effector Nucleases (TALENs) and RNA is developed. The former two techniques are to link the DNA binding protein assembly with the endonuclease catalytic domain to induce targeted DNA Double Strand Break (DSB) at a specific gene site, and the construction process is cumbersome. CRISPR-Cas9 is a microbial adaptive immune system that uses RNA-guided nucleases to cleave DNA. Compared with ZFN and TALEN, the CRISPR-Cas9 system is simpler in operation and higher in efficiency.

If a gRNA sequence of CRISPR-Cas of an H11 locus can be screened out efficiently and specifically targeted and edited, Cas9 nuclease is guided to carry out targeted editing on the locus, and powerful technical support can be provided for preparing a gene editing sheep with an H11 locus fixed-point integrated with an exogenous or endogenous target gene.

Disclosure of Invention

The invention aims to provide a sgRNA of a specific target sheep-friendly site H11 with high targeting efficiency and low off-target rate and application thereof.

In order to realize the purpose of the invention, the technical scheme of the invention is as follows:

the invention firstly provides sgRNA of a specific target sheep friendly locus H11, and the RNA sequence of the sgRNA is shown as SEQ ID NO.1 or SEQ ID NO. 2.

Specifically, the DNA sequence for transcribing the sgRNA is shown as SEQ ID NO.3 (transcribed SEQ ID NO.1) or SEQ ID NO.4 (transcribed SEQ ID NO. 2).

The sheep friendly locus H11 is located on sheep chromosome 17, and the nucleotide sequence of the sheep friendly locus H11 is shown in SEQ ID NO. 5.

The CRISPR/Cas9 targeting vector containing the sgRNA belongs to the protection scope of the invention.

Further, the invention provides a CRISPR/Cas9 targeting vector containing a drug screening marker puro. The screening marker can enrich more positive cells in a short time.

Preferably, a PX458 (114 bp larger than PX 459) vector with fluorescence similar to the size of the targeting vector is used as a control when the targeting vector is transfected, so that the transfection efficiency can be accurately monitored in real time.

A large number of experimental screenings show that the transfection efficiency of the method is superior to that of liposome transfection and a novel DNA polymerization transfection reagent by adopting a nuclear transfer mode when cells are transfected with a Cas9 targeting vector. Therefore, it is preferable to use a targeting vector having a large molecular weight by nuclear transfection.

In the embodiment of the invention, a direct TA clone sequencing method is adopted during the detection of targeting efficiency, so that the possibility of false positive results during enzyme digestion by T7E1 and Surveyor is avoided.

The invention provides application of the sgRNA or CRISPR/Cas9 targeting vector containing the sgRNA in specific recognition and targeted modification of sheep-friendly site H11.

Further, the targeted modification is gene knockout, gene transfer or site-directed overexpression of an endogenous gene.

The invention provides application of the sgRNA or CRISPR/Cas9 targeting vector containing the sgRNA in preparation of transgenic animals or improvement of animal germplasm resources.

The invention provides application of the sgRNA or CRISPR/Cas9 targeting vector containing the sgRNA in breeding new variety gene editing sheep.

The invention provides application of the sgRNA or CRISPR/Cas9 targeting vector containing the sgRNA in gene expression by using relevant space-time specificity.

In sheep gene editing, the research of gene knockout is far more than that of gene knockout, different from gene knockout, the gene knockout relates to an insertion position in a genome, and the inserted locus is required to be efficiently expressed and cannot interfere with the gene function on the original chromosome, so that the selection of the insertion position is particularly important, the sheep H11 site is not developed, the application screens a gRNA sequence of CRISPR-Cas of an efficient and specific target editing H11 site, guides Cas9 endonuclease to efficiently cut the site, the targeting efficiency is over 70 percent, the off-target phenomenon existing in a CRISPR/Cas9 system can be effectively reduced, the influence caused by Indel of a genome non-target site due to non-specific cutting is further reduced, and a new safe selection is provided for the insertion of an exogenous gene. In addition, random integration of the target gene is often caused when the traditional method is used for carrying out overexpression on the animal endogenous gene, the suspected positive phenotype of a progeny is probably not the function exerted by the target gene, and the random insertion of the progeny causes variation of other functional genes to a great extent, so the insertion site of the overexpression target gene is very critical, the sgRNA of the specific target sheep H11 friendly site, which is combined with the CRISPR-Cas9 technology, can be used for inserting the exogenous gene and also can be used for site-specific overexpression of the endogenous gene, and the foundation is laid for the research on the functions of the important economic character related genes of livestock.

Drawings

FIG. 1 is a schematic representation of chromosome location at the H11 locus of different species.

Figure 2 sheep H11 locus targeting scheme.

FIG. 3 shows the restriction electrophoresis of the targeting vector.

Fig. 4 sgRNA ligation targeting vector plasmid PCR electropherogram.

FIG. 5H 11-sgRNA1 sequencing alignment. The dark labeled portion is sgRNA sequence information, which is shown in greater depth in the corresponding sequencing peak plot portion.

Fig. 6H 11-sgRNA2 sequencing alignment results, with the dark labeled portions being sgRNA sequence information, which is shown in greater depth in the corresponding sequencing peak plot.

FIG. 7 Lipofectamine 2000 transfection effect, A, B, C represents the case of three transfections, A1, B1, C1 are fluorescence pictures, A2, B2, C2 are bright field pictures.

FIG. 8

HD transfection Effect. A. B, C represents the case of three transfections, and A1, B1 and C1 are fluorescence pictures, and A2, B2 and C2 are brightfield pictures.

FIG. 9

The transfection effect, A, B, C, represents the case of three transfections, and A1, B1, and C1 are fluorescence pictures, and A2, B2, and C2 are brightfield pictures.

FIG. 10 shows nuclear transfection effects, A, B, C, D represents the four transfection cases, A1, B1, C1 and D1 are fluorescence pictures, and A2, B2, C2 and D2 are bright field pictures.

FIG. 11 drug screening procedure, Day1 for Day1 post-dose screening, Day3 for Day3 post-dose screening, and so on for other identifiers.

FIG. 12 is a PCR amplification electrophoretogram of sequences near the target.

FIG. 13 is a diagram showing the results of sequencing of PCR products.

Fig. 14 TA clone sequencing of sgRNA1 target site. Fig. 14A, 14B, 14C, 14D, 14E represent five different Indel types of sgRNA1 target, respectively, and fig. 14F is an unmutated TA clone. Different colors in the sequence alignment result represent different base Indel conditions, and the deepened part in the sequencing peak image represents sequence information near a target point.

Fig. 15A, fig. 15B represent the sgRNA2 target two different Indel types, respectively, and fig. 15C is an unmutated TA clone. Different colors in the sequence alignment result represent different base Indel conditions, and the deepened part in the sequencing peak image represents sequence information near a target point.

FIG. 16 shows the PCR amplification of potential off-target sites.

FIGS. 17A-17E 5 are graphs of the sequencing alignment of PCR products at potential off-target sites. The boxed portion represents 100% alignment of the potential off-target site with the wild-type sequence.

Detailed Description

Preferred embodiments of the present invention will be described in detail with reference to the following examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention will become apparent to those skilled in the art without departing from the spirit and scope of this invention.

The experimental methods used in the examples are all conventional methods unless otherwise specified. The materials, reagents and the like used in the examples are commercially available unless otherwise specified.

EXAMPLE 1 analytical identification of sheep H11 site

Name: DRG1-Eif4enif1 (position H11); position: sheep Chr 17(69,623,238-69,627, 527); the chromosome location information of H11 locus of different species is shown in FIG. 1.

Example 2 construction of sgRNA expression vector

The sheep H11 site sequence is called out from NCBI, and the nucleotide sequence is shown as sequence SEQ ID NO. 5. And (3) screening out a PAM sequence and a corresponding sgRNA target according to the screening principle of the sgRNA, wherein the PAM motif is NGG. CCTCTCATAGTCGTCCTACAGCT, wherein the nucleotide sequence of the corresponding sgRNA sequence for identifying the target is shown as the sequence SEQ ID NO.1 in the sequence table; the DNA sequence for coding the sequence is shown as a sequence SEQ ID NO.3 in a sequence table.

TGGTTGCTCAACTACTTCGTAGG, wherein the corresponding sgRNA sequence recognizes the target nucleotide sequence as shown in sequence SEQ ID NO.2 in the sequence table; the DNA sequence for coding the sequence is shown as a sequence SEQ ID NO.4 in a sequence table.

Corresponding primer sequences are designed according to the two target sequences, synthesized by a biological company, and purified by HPLC, and the specific sequences are shown in Table 1.

TABLE 1 primers for targeting at H11 site

Nucleotide name	Sequence (5'to3')
		Safe Harbor H11-sgRNA1-F	caccgAGCTGTAGGACGACTATGAG
Safe Harbor H11-sgRNA1-R	aaacCTCATAGTCGTCCTACAGCTc
		Safe Harbor H11-sgRNA2-F	caccgTGGTTGCTCAACTACTTCGT
Safe Harbor H11-sgRNA2-R	aaacACGAAGTAGTTGAGCAACCAc

Olio formation: primer was diluted to 100 micromolar, phospho-annealed, system: sgRNA up (100. mu.M) 1. mu.L, sgRNA down (100. mu.M) 1. mu.L, T4 ligation buffer,10 ×, 1. mu.L, T4 PNK 1. mu.L, ddH₂O6. mu.L, total volume 10. mu.L. The procedure was as follows: 30min at 37 ℃; 5min at 95 ℃; the temperature in the PCR instrument is reduced by 5 to 25 ℃ per minute. After the dilution is finished, 250 times of dilution is carried out, and the vector is subjected to enzyme digestion. The cleavage products were run on a 0.8% agarose gel as shown in FIG. 3. Ligation was carried out overnight at 16 ℃. After the ligation reaction was completed, the linear DNA residue was removed using plasmid safe exouchase. 30min at 37 ℃ and 30min at 70 ℃. Then storing at-20 deg.C for at least one week.

The product after this step is used directly for transformation of E.coli, and Stbl3 is recommended. Adopting a heat shock method: 2ul of plasmid safe plasmid was added to 20ul of competence, ice for 10min, heat shock 42 ℃, 30s, immediately placed on ice for 2min, added 100ul of SOC, and directly plated. LB plates containing Amp100 were used. Overnight at 37 ℃. The next day, no clones should be observed for the control plate, while clones were grown in the plates containing the sgRNA inserts. Monoclonal shake bacteria were picked, plasmid extraction was performed with Omega kit, and plasmid PCR was performed. The ligation results are shown in FIG. 4.

The plasmid with correct initial identification is sent to Beijing Optimalaceae biology company for sequencing. The sequencing comparison result is shown in fig. 5 and fig. 6, the deepened part is sgRNA sequence information and a sequencing peak map result thereof, and the sequencing comparison result shows that the sgrnas are successfully connected into the vector. After the plasmid construction is verified to be correct, the plasmid is greatly extracted, and a subsequent transfection cell experiment is carried out.

Example 2 cell transfection

1. Fetal fibroblasts were prepared by conventional methods.

2. The effect of different cell transfection methods was compared.

(1) Lipofectamine 2000 Transfection Reagent (Invitrogen) was used, and the Transfection procedure was as described in the kit instructions. The transfection effect is shown in FIG. 7.

(2) Transfection reagents using novel DNA polymerization

HD Transfection Reagent (Promega), Transfection steps see kit instructions. The transfection effect is shown in FIG. 8.

(3) Transfection reagents using novel DNA polymerization

Transfection Reagent (Polyplus), Transfection procedure see kit instructions. The transfection effect is shown in FIG. 9.

(4) Using Nuclear transfection-Amaxa^TMBasic Nucleofector^TMKit for Primary Mammalian Fibroplasts (Lonza) with Nucleofector^TM2b, procedure V-024 for transfection, see kit instructions for the steps of transfection. The effect of transfection is shown in FIG. 10. The transfection efficiency of the control group can be accurately monitored in real time by using the transfection of the control group and PX458 vector with fluorescence with approximate size of PX459 as a control. By comparing the proportion of the luminous cells, the efficiency of the nuclear transfection targeting vector is better than that of liposome and novel polymeric transfection reagents, so that the transfection of the targeting vector with large molecular weight by the nuclear transfer mode is suggested.

(5) Drug selection cells were transfected for 48h, and then selected using puromycin to enrich for positive cells in the shortest time. The screening results are shown in FIG. 11.

Example 3 verification of targeting efficiency of two sgrnas (sgRNA1 and sgRNA2) of the present invention 1, target amplification primers were designed using Primer Premier 6.0. The primers were synthesized by Beijing Biotechnology Ltd, and the sequences of the primers are shown in Table 2:

TABLE 2 target amplification primers

Digesting the enriched positive cells and the untransfected wild type, extracting DNA by using a Tiangen kit, and performing PCR amplification by using the primers, wherein the amplification system is as follows: 3% DMSO, high fidelity DNA Polymerase PrimeSTAR MAX DNA Polymerase (R045A, Takara) 0.5. mu.l, dNTPmix (2.5mM each) 25. mu.l, GC Buffer II (RR02AG, Takara) 8. mu.l, Forward primer 1. mu.l, Reverse primer 1. mu.l, cDNA 2. mu.l, 11.5. mu. l H₂And O. The amplification conditions were: pre-denaturation at 98 ℃ for 2min, 10s at 98 ℃, 30s at 65 ℃, 45s at 72 ℃ for 35 cycles; after circulation is finished, the mixture is stored at the temperature of 72 ℃ for 10min and 4 ℃. The PCR products were electrophoretically detected using a 1.5% agarose gel. The electrophoretogram of PCR amplification of the target sequence is shown in FIG. 12.

And (3) PCR product purification: and (3) placing the gel under an ultraviolet lamp after electrophoresis, separating target bands, and recovering and purifying DNA by the following operations: (1) the gel fragment of interest was isolated under UV light and placed in a clean EP tube and its mass was measured. The conversion formula of the volume of the rubber block is 1 mu L-lmg. (2) Adding DR-1Buffer with volume 3 times of that of the EP tube, shaking and mixing, and placing in a water bath kettle at 45 ℃ to fully dissolve the rubber block for 8-10 min. (3) The balance Column Spin Column and the Collection Tube were removed and correctly positioned as required. Transferring the solution in the step (2) into a Spin Column tube, then centrifuging at 12000rpm for 1min, and repeating the centrifugation once. (4) Add 500. mu.L of Rinse A to Spin Column and centrifuge conditions as above. (5) Sucking the added liquidAdding 700 μ L of anhydrous ethanol Rinse B into Spin Column, centrifuging under the same conditions, discarding the filtrate, and centrifuging again. (6) And continuing to centrifuge for 2min under the same conditions. (7) Taking a new Collection Tube, placing Spin Cohmm, and adding RNase-free ddH into Spin Column₂025 μ L, standing at room temperature for 1-2 min. (8) Centrifugation at 12000rpm for 1min allowed the DNA to elute into the Collection Tube and stored at-20 ℃.

And (3) after purifying the product, sending the product to Beijing optimak company for sequencing, and connecting and transforming the product with the overlapping peaks according to a sequencing result: (1) a clean EP tube was taken and 1. mu.L of T-Vector, 8. mu.L of Insert DNA, 1. mu.L of 10 XEnhancer were added dropwise thereto using a pipette. After being mixed evenly, the mixture reacts for 3 minutes at normal temperature. (2) The ligation product of (1) was added to 100. mu.L of DH 5. alpha. competent cells, gently shaken and then placed in ice for about 30min, taken out, then placed in a 42 ℃ water bath for 1min and then placed in ice for about 2 min. (3) And (3) adding 750ml of LB liquid culture medium (without Amp) into the tube in the step (2), slightly blowing and uniformly mixing the mixture by using the tube wall of a gun head, and then placing the mixture in a constant humidity box at 37 ℃ for culturing for 60min at a speed of 150 r/min. (4) Taking out, directly centrifuging at 2000rpm for 2min, collecting supernatant to keep about 100 μ L in the tube, and blowing liquid in the tube with a pipette to mix well. (5) The bacterial liquid is smeared on a solid culture plate (containing Amp) and cultured for 12-16h at 37 ℃. (6) Single colonies on the culture medium are selected and inoculated into LB liquid culture containing Amp, and cultured for about 12h at 37 ℃. The results of PCR product sequencing are shown in FIG. 13.

Plasmid extraction: (1) the escherichia coli carrying the target plasmid is inoculated into a 50ml culture bottle containing 10-15 ul of basal medium/ampicillin culture medium. (2) Centrifuge at 5000 Xg for 10min at room temperature. (3) The supernatant was discarded, and 500. mu.l of Solution I/RNase A was added to the remaining precipitate, followed by thorough mixing. (4) Transferring the suspension into a new 2ml centrifuge tube, adding 500ul Solution II, gently and thoroughly mixing to obtain clear bacterial lysate, and incubating at room temperature for 2min (excessive force is applied during mixing to break out chromosome DNA, so that purity of target plasmid is reduced). (5) Adding 250ul precooled Buffer N3 into the 4 solution, mixing gently and thoroughly until white flocculent precipitate appears, centrifuging at 4 deg.C or more than 12000 Xg for 10min (room temperature, preferably 4 deg.C) (Buffer should be mixed thoroughly, if the mixture is viscous and brown or spherical, mixing more times to neutralize the solution, and thorough neutralization of the solution is necessary to obtain good yield). (6) Carefully aspirate and transfer the supernatant into a new 1.5ml centrifuge tube 1: a0.1 ratio was added to the supernatant to mix the ETR Solution and incubated on ice for 10min, with the incubation reversed several times to mix (after addition of the ETR Solution, the bacterial lysate will appear cloudy, but clear after incubation on ice) (the supernatant was not collected in a 2ml centrifuge tube, because when there was too much liquid in the 2ml centrifuge tube, the ETR Solution will be suspended in the Solution). (7) The liquid from 6 was incubated at 42 ℃ for 5min and the solution was again turbid. Centrifugation at 12000 Xg for 3min at room temperature will result in a blue layer at the bottom of the tube. (8) The upper aqueous phase was transferred to a new 2ml centrifuge tube, as described in 1: adding absolute ethyl alcohol (96-100% at room temperature) in a proportion of 0.5, gently mixing uniformly, and incubating for 1-2min at room temperature. (9) Taking 700ul of the solution in (8) to a column, assembling a collection tube, centrifuging at room temperature for 1min at 1000 Xg, discarding the liquid in the collection tube passing through the column, and recycling the column and the collection tube. (10) Repeat step 9 until all the collected bacterial lysate is used up. (11) 500ul Buffer HB was added to the column, centrifuged at 10000 Xg for 1min at room temperature, and the waste liquid from the collection tube was discarded (for the purpose of removing residual protein contaminants, necessary for obtaining high quality DNA). (12) 700ul of DNA Wash Buffer mixed with ethanol was added to the column, centrifuged at 10000 Xg for 1min at room temperature, and the liquid in the collection tube was discarded. (13) The steps in 12 are repeated. (14) The liquid in the collection tube was discarded and the empty tube was centrifuged at maximum speed (. gtoreq.13000 Xg) for 3min to dry the column (necessary to remove residual ethanol from the column). (15) The column was placed in a new 1.5ml centrifuge tube, and Endotoxin-Free Elution Buffer (80-100 ul (30 ul. times.2 each time depending on the final product concentration) was added directly to the white mesh in the column, left at room temperature for 2min, and centrifuged at 13000 Xg for 1min to elute the DNA (about 70-85% of the DNA collected in the column was extracted and can be repeated again to complete the extraction, but the final product concentration decreased by adding the eluent again). The plasmid was sent to Beijing Ongchow for re-sequencing. The TA clone sequencing results of the sgRNA1 target site are shown in fig. 14A-14F.

Taken together, for the target sgRNA1, the results of alignment of the sequencing results with the reference genomic sequence and wild type showed that, of 29 TA clones, 21 Indel mutations occurred at the target position, of which 5 mutation types were generated, and thus the targeting efficiency of H11-sgRNA1 was: 21/29 ═ 72.41%. The TA clone sequencing results of the sgRNA2 target site are shown in fig. 15A-15C.

Taken together, for the target sgRNA2, the results of alignment of the sequencing results with the reference genomic sequence and wild type showed that 7 of 10 TA clones had Indel mutations at the target position, of which 2 mutation types were generated, and thus the targeting efficiency of H11-sgRNA2 was: 7/10 is 70%. The above results show that: the two sgRNAs (RNA sequences are shown as SEQ ID NO.1 and SEQ ID NO.2) provided by the invention can both efficiently recognize the sheep H11 locus, and the locus is efficiently cut at a fixed point by means of Cas9 enzyme, wherein the sgRNA1 has higher cutting efficiency which reaches 72.41%.

2. Off-target effect analysis: 5 potential off-target sites of sgRNA1 (5 potential off-target sites are randomly selected by an online website (http:// crispr. dbcls. jp /) prediction) are selected for off-target effect analysis, and the 5 sites are respectively: (1) chr2: 2114124-2114134; (2) chr23: 6489774-; (3) chr25: 26417616-26417626; (4) chr3:42547394 and 42547404; (5) chr1: 289491-289501. Primers were designed as in table 3:

TABLE 3 primer for off-target Effect analysis

Primer name	Sequence (5'to3')
		chr2-F	AGTTAAACAAAACTAGGCATGAGG
chr2-R	CTGGAAATAAATACAGATTCTCCG
		chr1-F	TGAACTGAAATGGATGGGAA
chr1-R	CTGTGATGTTGAATGATCAGC
		Chr3-F	GTTCAAGGGCACAACTAGCAG
Chr3-R	GGACTAAATTGCCTAGTGTTAACCA
		Chr23-F	CTTATGTAGGGCATGGAGACTCA
Chr23-R	ACAGTATACAATCTGATGTTCTGGT
		Chr25-F	ATGTTTCTTTCTCAGTCTCCACAAAG
Chr25-R	ACTGGTACCAACCTTGTGCAT

The potential off-target site PCR amplification electrophoretogram is shown in FIG. 16, which shows that the amplification band is single and bright, non-specific amplification does not exist, and the sequencing result is true and credible.

The PCR products for each potential off-target site were sequenced and aligned with the wild-type, and the results are shown in FIGS. 17A-17E. The off-target effect analysis result shows that the targeting site H11-sgRNA1 not only has high efficiency, but also has low off-target rate, and is a good choice for site-specific integration of exogenous genes.

In conclusion, the sgRNAs of the 2 specific recognition sheep Safe Harbor H11 sites provided by the invention can effectively reduce the off-target phenomenon existing in the CRISPR/Cas9 system, and further reduce the influence caused by Indel of the genome non-target sites caused by non-specific cutting. In addition, the DNA fragment for coding the sgRNA provided by the invention can realize targeted modification (knockout or knock-in) of sheep H11 locus at a cell or individual level by constructing a Cas9/sgRNA expression system so as to research related space-time specific expression genes and further breed new variety gene editing sheep.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> university of agriculture in China

<120> sgRNA specifically targeting sheep friendly site H11, and coding DNA and application thereof

<130> KHP181117777.0

<160> 23

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cucauagucg uccuacagcu 20

<210> 2

<211> 20

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

acgaaguagu ugagcaacca 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

agctgtagga cgactatgag 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tggttgctca actacttcgt 20

<210> 5

<211> 4288

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gttcgtgtgt cattgtcaga atttgttatg aggtggattg aatgcggatg gctatgtata 60

gtgagggagc tgcagaagag gtgcttggga gcttggtctt gaatgtgaaa cgggtaaaaa 120

tatgaggtta gtcatgagaa atgcttcccg ctggatgtgg tcctttcaag tggtctttct 180

ctaatggtac tgcagaaagg aagggcctga cgtaaggtaa gtgattattc cctgcaagtc 240

tagcccactt gggagatggt gggtcagtaa aatactccga ccagacacat cgggctttga 300

gtggcaagcc cacctttaat tagctgtcga actctgcata aattacttga tctctgtgtc 360

agtttcctca tgtaacatgg agatagtaat aacaccttct agaatggaga ttcttagtat 420

taagagatgg tgcttgtaaa atgcttatta gcacagtgtc tgatatgtac gtggtgaatg 480

ttggctgttg tttcactggt tcctctcctt tagttagagc acagctgggt atcagtgttg 540

ggctgagtgt tgagctgaac tgtgctgcca gctgcgtgcc actgtctcct ttgccataac 600

ccagcccttc ttgaactccc atggcagtcc tggccccaac cacataacct ggatgaaagc 660

atggaggtag cccagtgcaa gtgaggccac cagtctgatc agagcaggtt tgtggggaca 720

cctgtgtgtt tatatggagg tgggaaggag ggtaggttat aagaagtaat ggggtcagga 780

ttgctagaga gggtactaag gacatcatta aaggttaata agggaattta aagggttttt 840

catgatagtg gaaaattgac tggcgaaaat ctgtgtgttg gagtggatta gtgagcatat 900

gggagacaga gggtgtgggc gtacaggaga gacctaaacc tggcaactgg cctgctgttt 960

gcagagagaa gtcaaagatt atataattat ggattgcatg gatgatagag aagggtggtc 1020

catgagaaag tcaccaaggg aaacagattt acaggaagac agagtttgat tttagatgag 1080

gtgaactaga acttctagca tgctgtgagc agtgaggatg tgggattatc cacatactca 1140

gccttttcca ggagctgtta ctcttgttat cttagtgaca gttttttccc tctcatagtc 1200

gtcctacagc ttgggcttaa cactgtcccc agacccagga gataagcctc tcaggcctgg 1260

tatcctactc actttggagg gtgtagatcg tgatataact ggtacattca tgatagaggc 1320

cataatttag agtttactgt ggcttttcag agagacactg gctttctgag atatgggatt 1380

tccagcaagg tttattttcc aggcagagct tatattgggt tttgaggaat cctcaaattc 1440

actttcattg ggcaatgaaa tgccagaata ttgagaaaga tgttgaaatc tgggttcatt 1500

ccaaggcttc aggatttgct ttgaatgggc tttacttcca tccttccaca ccttcccctt 1560

cccccatcag tggccccctg gtgtttgaga agagcattac cctacctcct ttctgggctc 1620

agacttggga gttctgggag aggtacagtt ttgtgtttgg attgctgcct ggggtagggc 1680

caccaaggag ggcaaagctt tctcttcctg aactccacga ctagggttgt ttgactgtca 1740

cgacgtggct taaatttcca tttttctttt cgaatgcttt tagctgtgtt tcaggtcagt 1800

tcagctcagt tgtgtctgac gccctgcgac cccatggact gtagcacgcc aggcttccct 1860

gtccatcacc agctcctgga gcctactcaa attcatgtcc attgtgttgg tgatgccatt 1920

caaccatctc atcctctgtc acccccttct cccactttca atcttcccca gtatcagggt 1980

cttttccagt gagtcggttc ttggcatcag gtcgccaaaa gtattaagct gtgtttaata 2040

gcagacagtc acttaactgg ctgaaatgga agaaaacttg gtctctcaca taagttgtct 2100

ggagctcaga tgggctagct ggtagactga cgatccaaat tctttccatg acgccatcct 2160

gttcactgct ctgctgggca gatggctccc ttcacagttg aagaatatct ttatagcctt 2220

gggctttata ccaatatcta gaggatgcta aagagggctg agtcttaact tttggtgaag 2280

ccatttccca gaagctgcac agccaattcc tctgtgtctc atacccattc ttgaaccagc 2340

tgttagtaaa gggcgtagaa tattgaagag tctgtttaac tccagtatgt tatcttcatt 2400

cttggagttt atccctttca tttgtaggcc agtggacctg actttctacc ttaagaggct 2460

atcttacaag atatctccta caagaagacc tggctgtact tctccataaa aaaaatttag 2520

ctttattttt tttcattgtg cctcacagca cacaggatct tagttgcctg acaaggaatt 2580

gaacccaggg ccccttcact gggagtacag agttttaacc actggactag cacagaagtt 2640

cctgtacttt cccatttccc cccctacttc tcattattac tgtttcaaag tactggttgc 2700

tcaactactt cgtaggggca gaggcaatgt tctttcctac ctgacccctc aacttccaca 2760

agattctctc tagccctctg ctgttctact ttgaggaggc tttgcacatt cttccagctt 2820

tgattgcttc taagcttctc atgcctgcta gactccccag agttgctccc tgtaagatgg 2880

cttattagct gagacatcat gtcatgttct ccttttactc catagctggc tcttagtttc 2940

tgaagactgt attcacttcc ttttttgcct ctactcccgt tcaccaaaat agctttaaga 3000

tctatgcatt tagcttctgc tgtgctattc ttagcaacat tcctttattt tcttctgact 3060

ccatctcacc agctactggc tttgcccttt gcctggtgcc tacatttgtt catgtctatc 3120

gtattagctt ctagcctaaa aaggaattcc tcactagcag cttcaaacca accctcccca 3180

ctttacaccc tggactgttg gttcaatagg aaaggaaagg aggtgaaagg acacacagga 3240

tggagttgga tccatgtttc tgttctgccc ctgttgcttg agactatttt ccagattctt 3300

tgtttatgaa acaaggcatt tgtgagaatt ctaaacaggg cttatttctg aagttgattc 3360

actcagatcc cacgtattca cttccgggct gaagttgaag tactcaagtt gaagtactgt 3420

gaagagacag acctcatgct caatccacaa agccaggttt tgttgaaaag cgacctgcta 3480

tttgttcttg gaagcacagg gcagagtggg cagctccagg ttaataggct gcaccccgaa 3540

cccttaggct gtttttttaa cattttagtc aaaatccagt cacttcactt gtgaatcaga 3600

atggtctcat tgtttgaacc tctactatga agtcaaacta gagttgaggg ccctaaatgg 3660

gaagagctga gagactcgct gagctcagtt gaggagattg aggtctgcca ccttggattg 3720

ggaggaatga agccttcagt caggaaaggg ggctccaggc cgtagttaca cttgcgtaga 3780

atcctcttcc ccagtgtatg cagctacagt ccacagaata tcggagcgga ggagtaagaa 3840

cacagaagaa gttaacagag gcaccagagt cttgagggaa gttctatacg gaaacaattc 3900

tggaatgaat cggaattcta aggctccatt tttccctatt ggggactctg acttggagaa 3960

caggaagcca accgttgact tttgccccag taaatgtgac aaatgaccat atacctgatg 4020

acccaataaa ttattttctt tagttgggtt tcattttaga aattacacat tatcatctga 4080

tattagccac aagactacct atagggtcag ctcagtctaa acttacccac tggggtcatt 4140

aaggctcaag aaagagggcc atggcttcct cctcccaagc agagttcagg tccatgagtc 4200

ttacagaaaa aactcaaggt aatttccctc aagaacctac tgaagaggaa gggattcagg 4260

aagaaataaa cacaacagtg ccattcgc 4288

<210> 6

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tttcatgata gtggaaaatt gactggc 27

<210> 7

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

acatctttct caatattctg gcatt 25

<210> 8

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ttatcccttt catttgtagg ccagt 25

<210> 9

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ttcagaaact aagagccagc tatggag 27

<210> 10

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

agttaaacaa aactaggcat gagg 24

<210> 11

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ctggaaataa atacagattc tccg 24

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tgaactgaaa tggatgggaa 20

<210> 13

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ctgtgatgtt gaatgatcag c 21

<210> 14

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gttcaagggc acaactagca g 21

<210> 15

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ggactaaatt gcctagtgtt aacca 25

<210> 16

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

cttatgtagg gcatggagac tca 23

<210> 17

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

acagtataca atctgatgtt ctggt 25

<210> 18

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

atgtttcttt ctcagtctcc acaaag 26

<210> 19

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

actggtacca accttgtgca t 21

<210> 20

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

caccgagctg taggacgact atgag 25

<210> 21

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

aaacctcata gtcgtcctac agctc 25

<210> 22

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

caccgtggtt gctcaactac ttcgt 25

<210> 23

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

aaacacgaag tagttgagca accac 25

Claims (4)

1. The application of sgRNA shown in SEQ ID NO.1 or SEQ ID NO.2 in specific recognition and targeted modification of sheep friendly site H11; the sheep friendly locus H11 is located on sheep chromosome 17, and the nucleotide sequence is shown in SEQ ID NO. 5.
2. 2. The use of claim 1, wherein the DNA sequence of the sgRNA transcribed as set forth in SEQ ID No.1 is set forth in SEQ ID No. 3;

   the DNA sequence for transcribing the sgRNA shown in SEQ ID NO.2 is shown in SEQ ID NO. 4.
3. 3. Use according to claim 2, wherein the targeted modification is gene knock-out, gene transfer or site-directed overexpression of an endogenous gene.
4. 4. The use according to any one of claims 1 to3, wherein the CRISPR/Cas9 targeting vector comprises the DNA sequence shown in SEQ ID No.3 or SEQ ID No.4 and further comprises a drug selection marker puro.

Images