CN113151265A - Method for inhibiting expression of lncRNA in nucleus based on CRISPR-dCase9 system - Google Patents

Abstract

The invention discloses a method for inhibiting the expression of lncRNA in a cell nucleus based on a CRISPR-dCase9 system, which comprises the following steps: selecting a 100bp sequence range of upstream and downstream of a transcription initiation site of lncRNA for designing a guide sgRNA sequence; acquiring an Oligo for system use; cutting the lentiviral vector, and connecting the Oligo corresponding to the modified sgRNA sequence to the lentiviral vector by using ligase; aiming at a target cell line, packaging lentiviruses and a dcase9 vector by using a lentivirus packaging reagent box, respectively preparing red fluorescent lentiviruses and blue fluorescent lentiviruses, transfecting the target cell line, and sorting double positive cells; screening to obtain a monoclonal target cell line stably transfected with lentivirus and dcase9 vector. The invention aims to solve the technical problem that the conventional gene knockdown technology cannot stably knock down the intranuclear lncRNA.

Description

Method for inhibiting expression of lncRNA in nucleus based on CRISPR-dCase9 system

Technical Field

The invention relates to the technical field of molecular biology, in particular to a method for inhibiting the expression of lncRNA in a cell nucleus based on a CRISPR-dCase9 system.

Background

Long non-coding incrnas (long non-coding RNAs) are a class of RNA molecules over 200nt in length, located in the nucleus or cytoplasm; it transcribes only untranslated RNA molecules, which are involved in many life processes, such as cell differentiation, apoptosis, immune response, growth and development, glycolipid metabolism, inflammation, and tumors. Long non-coding RNAs can be classified into five types, according to their origin, as Antisense IncRNA (Antisense Long non-coding RNA), intron non-coding RNA (intron non-coding RNA), Long endogenous non-coding RNA (lincRNA), Promoter-associated IncRNA (Promoter-associated IncRNA), and UTR associated IncRNA (untranslated region IncRNA). IncRNA plays an important role at the pre-transcriptional, transcriptional and post-transcriptional levels. The proportion of lncRNA in the whole genome transcription product is far more than that of coding RNA, compared with human and animals, the research on plant lncRNA is still in the initial stage, the research on plant lncRNA may reveal unknown new mechanisms for controlling plant growth and differentiation, and lncRNA plays a role of a regulatory factor in various biological processes such as plant flowering, male sterility, nutrient metabolism, biotic stress, abiotic stress and the like. The nuclear lncRNA (HoxBlinc) has the function of regulating and controlling a HoxB series gene of a transcription factor which is important in the process of generating and developing leukemia.

The conventional operations of long-chain non-coding LncRNA are function acquisition (over-expression) and function deletion (interference or knock-out), RNAi (RNA interference) technology is a commonly used knocking-down means, and RNA interference (RNAi) technology refers to a phenomenon that is highly conserved in the evolution process, induced by double-stranded RNA (dsRNA), and efficiently and specifically degraded by homologous mRNA. However, the existing gene knockdown technology cannot stably knock down lncRNA mainly located in a nucleus, specifically, the main action site of shRNA (short hairpin RNA) is located in cytoplasm, instability exists in knocking down lncRNA mainly located in a nucleus, instability of repeated follow-up experiments is often caused, and design of shRNA is particularly important and has high uncertainty, so that waste of experiment resources is often caused, and instability and difficult repeatability of experiment results are caused. In addition, ASO (antisense oligonucleotide) is similar to siRNA (small interfering RNA) design principle, but the chemical composition difference, siRNA is antisense RNA, and ASO is antisense RNA, DNA hybrid, cytoplasm location of lncRNA by RNA-RNA formed binary complex in RISC form by Dicer enzyme degradation, and nuclear location of lncRNA by RNA-RNA complex formed by RNAse H decomposition (ribonuclease H, a kind of endoribonuclease, can be specifically hydrolysis of DNA-RNA hybrid chain RNA). ASO is a multipotent player, but the chemically synthesized ASO is only suitable for routine cytological experiments, and the characteristic of only transient transfection results in that stable transfected cell strains cannot be constructed for long-term research, and is not suitable for gene function research at an animal level.

Disclosure of Invention

The invention mainly aims to provide a method for inhibiting the expression of lncRNA in a cell nucleus based on a CRISPR-dCase9 system, and aims to solve the technical problem that the conventional gene knocking-down technology cannot stably knock down lncRNA mainly in the nucleus.

The CRISPR system realizes the transcription inhibition of genes at a DNA level, dCas9 (cas 9 with no cutting activity) is fused with a transcription inhibition domain KRAB, an expressed fusion protein is combined to a promoter region under the mediation of gRNA, and the KRAB protein inhibits the combination of eukaryotic promoters PolII and the promoters, thereby inhibiting the transcription of the genes. The CRISPR plays a role before transcription, so that the characteristics of lncRNA are not required to be considered, the CRISPR system can be stably expressed in a cell line, and the defects of RNAi and ASO technologies are overcome.

In order to solve the technical problems, based on the above principle, the present invention provides a method for inhibiting the expression of lncRNA in a cell nucleus based on a CRISPR-dCase9 system, the method comprising:

selecting a guide sgRNA sequence used for designing a CRISPR system within a sequence range of 100bp upstream and downstream of the incRNA transcription initiation site;

obtaining a sgRNA nucleotide strand Oligo for use in the CRISPR system;

cutting a lentivirus lenti-sgRNA vector, and connecting the Oligo corresponding to the modified sgRNA sequence to the lentivirus sgRNA vector by using T4-DNA ligase;

aiming at a target cell line, packaging the lentivirus sgRNA and dcase9 vectors by using a lentivirus packaging kit, and preparing red fluorescent lenti-dcase 9-mchery lentivirus and blue fluorescent lenti-sgRNA-BFP lentivirus respectively;

transfecting the lenti-dcase 9-mchery lentivirus and the lenti-sgRNA-BFP lentivirus to the target cell line, and sorting double positive cells of red fluorescent protein mchery and blue fluorescent protein BFP;

screening the transfected target cells to obtain a monoclonal target cell line stably transfected with the lentiviral sgRNA and dcase9 vectors.

Further, before the step of selecting the sequence range of 100bp upstream and downstream of the incrna transcription start site for designing the guide sgRNA sequence used by the CRISPRi system, the method further comprises:

and obtaining the long-chain non-coding lncRNA full-length DNA sequence in the target cell nucleus.

Further, before the step of cleaving the lentiviral sgRNA vector and ligating the Oligo corresponding to the modified sgRNA sequence to the lentiviral sgRNA vector using T4-DNA ligase, the method comprises:

modifying the sequences of the 5 'end and the 3' end of the sgRNA according to the used lentiviral sgRNA vector;

further, Oligo of the SgRNA is obtained by modifying the following core sequence fragments of the SgRNA and the connected vector:

the core sequence of sgRNA is 1: GAAACCGAAGGCCCGAGCGGAGG;

sgRNA core sequence 2: CCAGCCGGCCTGCGCACCGGCGG;

sgRNA core sequence 3: CTGGGGACTCGCCTCCGCTCGGG;

sgRNA core sequence 4: GCCGGTGCGCAGGCCGGCTGGGG;

sgRNA core sequence 5: GCTGGGGACTCGCCTCCGCTCGG;

sgRNA core sequence 6: GCCGGCCTGCGCACCGGCGGCGG.

Further, the step of designing a guide sgRNA sequence used by the CRISPRi system specifically includes:

and designing the sgRNA sequence with the length of about 20bp by using a network sgRNA prediction database platform.

Further, the lentivirus packaging kit is one of a lipo2000 transfection kit, a lipo3000 transfection kit and a calcium phosphate transfection kit.

Further, the lentivirus lenti-sgRNA vector is one of lentivirus sgRNA expression vectors Addgene 60955, Addgene 118650 and Addgene 65656.

Further, the monoclonal target cell line for screening transfected target cells to obtain stably transfected lentiviral sgRNA and dcase9 vectors is specifically:

the transfected target cells were screened using 96-well plates to obtain stably transfected monoclonal target cell lines of the lentiviral sgRNA and dcase9 vectors. Further, the step of sorting the red fluorescent protein mchery and the blue fluorescent protein BFP double-positive cells comprises the following steps:

and (3) sorting the red fluorescent protein mcerry and the blue fluorescent protein BFP double positive cells by using a flow cytometer.

Further, the step of sorting the red fluorescent protein mchery and the blue fluorescent protein BFP double-positive cells comprises the following steps:

and obtaining a corresponding screening medicament according to the antibiotic resistance target of the lentivirus lenti-sgRNA vector, and using the screening medicament to sort the red fluorescent protein mcherry and the blue fluorescent protein BFP double positive cells.

Specifically, the CRISPR system utilizes a lentivirus transfection system to construct a stable expression cell line, and overcomes the defects that ASO cannot be stably transfected and cannot utilize the stable transfection cell line to perform in-vivo experiments on animals. Meanwhile, the CRISPR system has the action principle that KRAB protein is accurately recruited at the nuclear transcription initiation site through combination of dcase9 and sgRNA, so that the transcription of target genes is influenced to achieve the purpose of expression inhibition.

The technical scheme of the invention has the beneficial effects that:

according to the method for inhibiting the expression of the lncRNA in the cell nucleus based on the CRISPR-dCase9 system, the CRISPR-dCase9 system can target up-regulate or down-regulate the transcription level of the gene or lncRNA under the condition of not cutting double-stranded DNA, and the expression of the nuclear lncRNA is inhibited from the transcription level of the lncRNA while a possible function regulation sequence of the nuclear lncRNA is reserved, so that a platform is provided for subsequent gene function research or clinical gene therapy.

Drawings

FIG. 1 is a flow chart of a method for inhibiting the expression of IncRNA in a cell nucleus based on a CRISPR-dCase9 system provided by an embodiment of the invention;

FIG. 2 is a schematic diagram of the SgRNA design principle according to an embodiment of the present invention;

FIG. 3 is a SgRNA structural model according to an embodiment of the present invention;

FIG. 4 is a perspective view of transfection of the red fluorescent protein mcherry according to an embodiment of the present invention;

FIG. 5 is a perspective view of BFP transfection of the blue fluorescent protein according to the present invention;

FIG. 6 is an overview of transfection of positive cells in accordance with an embodiment of the present invention;

FIG. 7 is a graph comparing the expression levels of HoxBlinc in accordance with the present invention;

FIG. 8 is a graph comparing the expression levels of genes of HoxBlinc regulating HoxB focus according to the present invention;

FIG. 9 is a graph of the effect of altered gene expression on the growth of stably transcribed cell lines in accordance with an embodiment of the present invention.

The implementation, functional features and advantages of the objects of the present invention will be further explained with reference to the accompanying drawings.

Detailed Description

It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

In the following description, suffixes such as "module", "component", or "unit" used to represent components are used only for facilitating the explanation of the present invention, and have no specific meaning in itself. Thus, "module", "component" or "unit" may be used mixedly.

CRISPR(

Cluster regulated intersectant Short Palindromic Repeats) are a repetitive sequence in a prokaryotic genome, and are immune weapons generated by bacteria and viruses in a struggle in the history of life evolution, namely, the viruses can integrate own genes into the bacteria, cell tools of the bacteria are utilized to replicate the own genes, and the bacteria can eliminate foreign invader genes of the viruses to eliminate the foreign invader genes of the virusesThe CRISPR-Cas9 system was evolved, with which bacteria could soundlessly excise viral genes from their own genome, a unique immune system of bacteria.

CRISPR finds, excises and replaces specific parts of DNA by a specially programmed enzyme called Cas9, a technique that is very accurate, inexpensive, easy to use, and very powerful. CRISPR is derived from the immune system of a microorganism, an engineered editing system that uses an enzyme that cuts a small RNA into DNA as a guide, where it can be cut or otherwise altered. Through these interventions, CRISPRs can make changes or mutations in genomes more efficient than TALENs (transcription activator-like receptor nucleases) and other gene editing technologies. The simplicity and high efficiency of the CRISPR-Cas9 system make it an important gene research tool rapidly. Besides gene editing, it also serves as a functional genome screening tool, helping people develop loss-of-function studies on a genome-wide scale. Recently, the CRISPR-Cas9 toolbox has been greatly expanded, with new additions of both CRISPRi and CRISPRa.

The CRISPRi technique is capable of suppressing transcription of a given target, whether a coding or non-coding DNA fragment. CRISPR uses a catalytically inactive Cas9(dCas9), dCas9 is able to reach the site designated by the guide RNA, but is unable to cleave the DNA (Cell,152:1173-83, 2013). When dCas9 binds to the genome, it blocks the binding of the transcription machinery, preventing this process from proceeding.

In addition, CRISPRi has a domain from the transcriptional silencer (KRAB) linked to dCas 9. This addition of approximately 50aa hinders the DNA from stretching, making it difficult to obtain a transcript. Although it acts on a larger site, the inhibitory effect is also stronger and more easily observed by us. The dCas9 protein is a mutant of Cas9 protein, namely, the active regions of both RuvC1 and HNH nuclease of Cas9 endonuclease are mutated simultaneously. Thus, the endonuclease activity of dCas9 protein was completely abolished, and only the ability to be directed by grnas into the genome was retained. The dCas9 protein can form fusion proteins with effectors (e.g., repressor and activator domains) such that dCas9 can bring these effectors into the promoter, regulatory, or coding region for precise site-directed regulation of any gene without DNA damage; can be used for researching the influence of transcription factors or auxiliary transcription factors on specific genes.

Example 1

As shown in fig. 1, the embodiment of the present invention provides a method for inhibiting the expression of lncRNA in a cell nucleus based on a CRISPR-dCase9 system, the method comprising:

s101, selecting a 100bp sequence range of the upstream and downstream of the incRNA transcription initiation site for designing a guide sgRNA sequence used by a CRISPR system;

specifically, before the step of selecting the sequence range of 100bp upstream and downstream of the incRNA transcription initiation site for designing a guide sgRNA sequence used by the CRISPR system, the long-chain non-coding incRNA full-length DNA sequence in the target cell nucleus is obtained.

Specifically, sgRNA (small guide RNA for short) is an important component in a CRISPR gene knockout knock-in system, and guide RNA discovered earlier consists of two parts, namely tracrrna and crRNA, and after the two parts are fused and expressed, the sgRNA can also well perform the function of guide, and is combined with cas9 protein to guide cas9 enzyme to target genomic DNA for shearing.

As shown in fig. 2, the general principle of SgRNA design is as follows:

(1) the length of sgRNA should generally be around 20 nt;

(2) for the base composition of the sgRNA sequence, the sgRNA with GG at the 3' end can be selected, meanwhile, the sgRNA seed sequence is prevented from ending by more than 4T as far as possible, and the optimal GC% content is 40-60%;

(3) the number of matches of the seed sequence of the sgRNA to the off-target site is as low as possible;

(4) if an expression vector of a U6 or T7 promoter for driving the sgRNA is constructed, the 5' base of the sgRNA is G or GG, so that the transcription efficiency of the sgRNA is improved;

(5) for the combination position of the sgRNA targeting gene, if gene frame shift mutation needs to be caused, the combination position needs to be as close to the ATG downstream of the gene coding region as possible, and is preferably positioned in a first exon or a second exon;

(6) checking whether SNPs exist in the sgRNA targeting binding site genome sequence;

(7) if a Cas9 single-nickase is adopted, the space between pairs of sgRNAs is required to be considered for designing the paired-gRNAs;

(8) the analysis of the whole gene off-target effect needs to consider the maximum allowable number of several mismatched bases of an off-target site, and a minimum number of 5 bases is recommended. The number of mismatches between the base of the seed sequence and the non-seed sequence, whether the off-target site is located in the coding region of the gene, and the like are mainly examined, and whether the off-target site with base insertion or deletion exists can also be examined.

In addition, the activity of sgRNA is directly related to the mutation efficiency of a CRISPR system, a good sgRNA target point can bring higher mutation efficiency, more positive clones can be screened and identified in the later stage with half the effort, and therefore, the design and finding of the active target point are very important before gene editing is started. Usually, after designing a specific target, in vitro cell activity screening is required to screen out an effective target for subsequent experiments.

How to design sgrnas with good specificity:

if you have the species genome sequence you want in the software, you can design in the following website.

1、http://crispr.mit.edu/

2、http://www.broadinstitute.org/mpg/crispr_design/

3、http://spot.colorado.edu/～slin/cas9.html

4、http://www.e-crisp.org/E-CRISP/

5、http://flycrispr.molbio.wisc.edu/

6、http://www.flyRNAi.org/crispr/,Drosophila

7、http://cas9.cbi.pku.edu.cn/index.jsp

8、http://eendb.zfgenetics.org/casot/index.php

9、http://zifit.partners.org/ZiFiT/ChoiceMenu.aspx

10、http://cas9.wicp.net/

11、http://crispr-era.stanford.edu/

12. http:// cbi.hzau.edu.cn/cgi-bin/CRISPR plants

SgRNA design target sequence selection for knockdown:

the search is performed in NCBI or ENSEMBLE based on the species, gene name or gene ID provided. Find the promoter region of the gene and obtain the upstream and downstream 100bp sequence of the gene transcription initiation site through network database, such as UCSC Genome Browser (https:// Genome. UCSC. edu /). In the case of microRNA, the site to be knocked out can be designed in the exon coding for mature microRNA or in the 5 'and 3' flanking sequences of the exon coding for mature microRNA.

The upstream and downstream sequences of a 100bp transcription initiation site are selected and Input into a software Input box (http:// crispr. mit. edu /) of the sgRNA designed on line, then design operation is carried out, and the software can automatically output the sgRNA sequence.

As shown in fig. 3, one of the sgrnas was modeled. NNNNNNNNNNNNNNNNNNNNNGG synthesizes a pair of DNA Oligos with complementary sequences according to the designed sgRNA target sequence.

According to the digestion mode, a suitable joint is selected, for example, plasmid sgRNA target Oligo such as PX458 is as follows (BbsI digestion):

5‘-CACCGNNNNNNNNNNNNNNNNNNNN-3’

3‘-CNNNNNNNNNNNNNNNNNNNN-CAAA-5’

sequencing primer: U6-CRISP/Cas 9-promoter: gggcctatttcccatgattc

According to the requirement, the designed target point can be used for vector construction, or sgRNA is transcribed in vitro, and cell transfection or fertilized egg injection is carried out.

In the examples of the present application, sgrnas of about 20bp in length were designed based on the human Grch38 reference genome using a web sgRNA prediction website. Wherein hg38 refers to the human reference genome, and similarly hg19 genome, etc.

The operation mode adopted by the specific embodiment is as follows:

the predicted website is as follows:

https://portals.broadinstitute.org/gpp/public/analysis-tools/sgRNA-design

a100 bp sequence on the upstream and downstream of a transcription start site of a target lncRNA promoter is input by a website to predict a sgRNA sequence, and then, an overhang modification sequence at the 5 'end and the 3' end of a core sequence is added according to a specific sgRNA vector, so that the sgRNA sequence is easier to connect with the vector.

S102, obtaining a sgRNA nucleotide chain Oligo used for the CRISPR system; specifically, the Oligo is a poly-thymine, T-repeat oligonucleotide, that is, a nucleotide chain consisting of only thymine. In the embodiment of the invention, the nucleotide chain Oligo is designed according to the following sgRNA core sequence fragments:

the core sequence of sgRNA is 1: GAAACCGAAGGCCCGAGCGGAGG;

sgRNA core sequence 2: CCAGCCGGCCTGCGCACCGGCGG;

sgRNA core sequence 3: CTGGGGACTCGCCTCCGCTCGGG;

sgRNA core sequence 4: GCCGGTGCGCAGGCCGGCTGGGG;

sgRNA core sequence 5: GCTGGGGACTCGCCTCCGCTCGG;

sgRNA core sequence 6: GCCGGCCTGCGCACCGGCGGCGG.

Alternatively, the sgRNA nucleotide strand Oligo is not limited to the core fragment sequence described above, and is obtained for the sgRNAs of the present application using the Blast tool (https:// ccttop. cos. uni-heidelberg. de:8043 /):

PAM:NGG

Target site length:20

Target site 5'limitation:NN

Target site 3'limitation:NN

Core length:12

Core MM:2

Total MM:3

blast, called Basic Local Alignment Search Tool, is a "Search Tool based on Local Alignment algorithm". Blast can compare homology between two nucleic acid or protein sequences, and can quickly find out a homologous sequence between the two sequences and compare and score regions to determine the homology.

Wherein oligo (dT) has the following functions: because oligo (dT) can specifically bind to the Poly (A) tail of mRNA, so that mRNA can be specifically separated from total RNA, and the method belongs to the affinity chromatography technology.

Reverse transcription (RT-PCR): since most eukaryotic mRNAs have a Poly (A) tail at the 3' end, and oligo (dT) pairs with it, only the mRNA can be reverse transcribed. Since Poly (A) RNA accounts for only 1-4% of total RNA, the cDNA synthesized by the primer is smaller in quantity and complexity than the cDNA obtained by using random hexamers as primers. However, random hexamer primers and specific primers can also be used when reverse transcribing to obtain cDNA from mRNA.

Random hexamer primer when it is difficult to copy a full-length sequence of a specific mRNA because it contains a sequence for terminating reverse transcriptase, a non-specific primer, a random hexamer primer, may be used to copy the full-length mRNA. In this way, all RNA molecules in the system act as first strand cDNA templates, and PCR primers confer the desired specificity during amplification. Usually, 96% of the cDNA synthesized using this primer is derived from rRNA.

Specific primers the most specific priming method is to use oligonucleotides containing the complementary sequence of the target RNA as primers, and if two specific primers are used for the PCR reaction, the synthesis of the first strand can be initiated by the paired primer closest to the 3' end of the mRNA. The use of such primers only produces the desired cDNA, resulting in a more specific PCR amplification.

Among them, the Hox gene (Hox genes) is a holonomic gene (English: homeotic genes) or a homeotic gene. Are genes in organisms that specifically regulate the body of the organism and, once mutated, deform a part of the body. The mechanism of action is mainly to regulate and control other genes related to cell division, spindle direction, and development of hard hair, appendages and the like. Hox genes belong to one member of the family of homeobox (homeobox) genes, and in most Hox genes, contain a stretch of about 180 nucleotides of homeobox, which can be transcribed to form a sequence of about 60 amino acids, called a homeobox (homeobox). The Hox gene of human can be divided into 4 gene clusters, which are located on different chromosomes, i.e., 7, 17, 12 and 2. The Hox genes of humans are expressed in full capitals when written, e.g., HOXA, HOXB, HOXC and HOXD. In addition, these genes can be divided into 13 parallel homologous families (paralogous family) indicated by numbers, such as HOXA4, HOXB4, HOXC4 and HOXD 4. The DNA sequences of these family members are similar to the transcribed protein sequences.

LincRNA is Long endogenous non-coding RNA. Only a few transcriptionally produced RNAs in human cells serve as templates for protein synthesis. The remaining RNAs are called non-coding RNAs (ncRNAs) they are located between genes encoding proteins, with ncRNAs of length greater than 200bp called lincRNAs. Despite the large number of lincRNAs present in cells, they have long been recognized as "dark materials" in transcribed RNAs, and little is known about their function and mechanism. There are two ways to obtain the LincRNA sequence, namely, reference can be made to the obtaining of the LncRNA (Long non-coding RNA) sequence, and only after the LncRNA sequence is obtained, the LncRNA is required to be confirmed to be the LincRNA; ② the sequences are obtained by searching research papers of LincRNA, and many LincRNA sequences will be contained in the attachment or the article provides the link address.

S103, cutting a lenti-sgRNA vector by utilizing vector specific restriction enzymes according to the sgRNA vector, and connecting the Oligo corresponding to the modified sgRNA sequence to the lenti-virus sgRNA vector by utilizing T4-DNA ligase.

T4DNA Ligase, T4DNA Ligase, catalyzes the bonding between the 5'-P end and the 3' -OH end of double-stranded DNA or RNA at the sticky end or the blunt end by a phosphodiester bond, and ATP is required as a cofactor in the catalytic reaction. Meanwhile, T4DNA ligase can repair single-strand nicks (single-strand nicks) on double-stranded DNA, double-stranded RNA or DNA/RNA hybrids. T4DNA ligase has wide application in molecular biology. The T4DNA ligase is high-purity T4DNA ligase obtained by prokaryotic expression and column chromatography purification, and SDS-PAGE shows that the T4DNA ligase is a 62kD protein band. The product is attached with 10 XLigaptionBuffer containing ATP; is suitable for various reactions such as DNA fragment grafting, cloning and the like.

S104, packaging the lentivirus sgRNA vector by using a lentivirus packaging kit aiming at a target cell line, and preparing red fluorescent lenti-dcase 9-mchery lentivirus and blue fluorescent lenti-sgRNA-BFP lentivirus respectively;

s105, transfecting the lenti-dcase 9-mchery lentivirus and the lenti-sgRNA-BFP lentivirus to the target cell line, and sorting double positive cells of red fluorescent protein mchery and blue fluorescent protein BFP.

Specifically, as shown in fig. 4, 5, and 6, the red fluorescent protein mcherry and the blue fluorescent protein BFP double-positive cells are sorted by a flow cytometer.

Or obtaining a corresponding screening drug according to the antibiotic resistance target of the lentivirus lenti-sgRNA vector, and using the screening drug to sort the red fluorescent protein mcherry and the blue fluorescent protein BFP double positive cells.

Wherein, mCherry is a red fluorescent dye widely used in biotechnology as tracer, including molecular marking and cell component positioning. Unlike other GFP proteins and other green fluorescent protein variants isolated from medusa, mCherry and most other red fluorescent proteins are proteins isolated from coral (Discosoma). mCherry is superior to other fluorescent protein tags due to its color and light stability of the monomer molecules, with maximum excitation and emission light of 587nm and 610nm, respectively.

And S106, screening the transfected target cells to obtain a monoclonal target cell line of the stably transfected lentivirus sgRNA and dcase9 vector.

Specifically, a 96-well plate is used for screening transfected target cells to obtain a monoclonal target cell line of the stably transfected lentivirus sgRNA and dcase9 vector.

Specifically, before the step of cleaving the lentiviral sgRNA vector and ligating the Oligo corresponding to the modified sgRNA sequence to the lentiviral sgRNA vector by using T4-DNA ligase, the method comprises: the 5 'and 3' end sequences of the sgrnas are modified according to the lentiviral sgRNA vector used. The aim is to increase the degree of linkage matching of sgRNA sequences and vectors.

Optionally, the lentivirus packaging kit is one of lipo2000 transfection kit, lipo3000 transfection kit and calcium phosphate transfection kit.

3000 is a new transfection reagent, can improve the delivery efficiency and realize the application of new technology, is suitable for systems with higher relevance and can obtain more reliable results more quickly. The fields of genome editing, stem cell manipulation and immunotherapy are rapidly developing and they require the maximization of the potential for application with more advanced technologies. Compared with the current commercial lipid-mediated transfection reagent,

3000 for various cell lines.

Optionally, the lentiviral lenti-sgRNA vector is one of lentiviral sgRNA expression vectors Addgene 60955, Addgene 118650 and Addgene65656, or other lentiviral vectors used for cloning target sgRNA molecules and subsequently constructing stable transfection.

Therefore, the CRISPR system utilizes a lentivirus transfection system to construct a stable expression cell line, and overcomes the defects that ASO cannot be stably transfected and cannot utilize the stable transfection cell line to perform in-vivo experiments on animals. Meanwhile, the CRISPR system has the action principle that KRAB protein is accurately recruited at the nuclear transcription initiation site through combination of dcase9 and sgRNA, so that the transcription of target genes is influenced to achieve the purpose of expression inhibition.

One embodiment is now provided, in which, as shown in fig. 7, 8 and 9, sgScramble (i.e., sgRNA as a control) and sgHoxblinc (sgRNA for lncrna-hoxblinc, which is the subject of this example) cell lines (two monoclonal repeats) are taken to extract RNA and cDNA is reverse transcribed. The amount of expression of HoxBlinc in three cell lines was measured by realtome-qPCR to determine the knockdown efficiency of the CRISPRi system. The knockdown efficiency is generally determined by detecting the expression of a target gene according to a monoclonal cell strain after transfection, and the percent of reduction calculated by comparing the result of a qPCR experiment with that of a control group is used as the knockdown efficiency of the CRISPR system.

Among them, RealTime PCR (qPCR), a real-time fluorescent quantitative nucleic acid amplification detection system, is a method and technology for detecting the total amount of products after each PCR cycle using a fluorescent dye, and is a derivative reaction of conventional PCR. The method mainly comprises the steps of monitoring the change of the quantity of each cycle of amplified products in the PCR amplification reaction in real time through the change of a fluorescent signal, and carrying out quantitative analysis on an initial template through the relation between a ct value and a standard curve. Because of the advantages of sensitivity, specificity, accuracy, simple and convenient use and the like, the probe has been developed into an important tool in molecular biology research.

The test result shows that: the CRISPR system stably knockdown nuclear lncRNA to make up for the defects of RNAi technology. The CRISPR system can construct a stable transfected cell line, and is convenient for the development of subsequent cell line research and the development of in-vivo experimental verification. The CRISPRi system regulates gene expression without cleaving dna, providing a safer alternative to clinical gene therapy.

According to the method for inhibiting the expression of the lncRNA in the cell nucleus based on the CRISPR-dCase9 system, the CRISPR-dCase9 system can target up-regulate or down-regulate the transcription level of the gene or lncRNA under the condition of not cutting double-stranded DNA, and the expression of the nuclear lncRNA is inhibited from the transcription level of the lncRNA while a possible function regulation sequence of the nuclear lncRNA is reserved, so that a platform is provided for subsequent gene function research or clinical gene therapy.

It should be noted that, in this document, the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus. Without further limitation, an element defined by the phrase "comprising an … …" does not exclude the presence of other like elements in a process, method, article, or apparatus that comprises the element.

The above-mentioned serial numbers of the embodiments of the present invention are merely for description and do not represent the merits of the embodiments.

Through the above description of the embodiments, those skilled in the art will clearly understand that the method of the above embodiments can be implemented by software plus a necessary general hardware platform, and certainly can also be implemented by hardware, but in many cases, the former is a better implementation manner. Based on such understanding, the technical solutions of the present invention may be embodied in the form of a software product, which is stored in a storage medium (such as ROM/RAM, magnetic disk, optical disk) and includes instructions for enabling a terminal device (such as a mobile phone, a computer, a server, an air conditioner, or a network device) to execute the method according to the embodiments of the present invention.

The above description is only a preferred embodiment of the present invention, and not intended to limit the scope of the present invention, and all modifications of equivalent structures and equivalent processes, which are made by using the contents of the present specification and the accompanying drawings, or directly or indirectly applied to other related technical fields, are included in the scope of the present invention.

Claims (10)

1. A method for inhibiting the expression of lncRNA in a cell nucleus based on a CRISPR-dCase9 system, comprising:

selecting a guide sgRNA sequence used for designing a CRISPR system within a sequence range of 100bp upstream and downstream of the incRNA transcription initiation site;

obtaining a sgRNA nucleotide strand Oligo for use in the CRISPR system;

cutting a lentivirus lenti-sgRNA vector, and connecting the Oligo corresponding to the modified sgRNA sequence to the lentivirus sgRNA vector by using T4-DNA ligase;

aiming at a target cell line, packaging the lentivirus sgRNA vector and the crspr-dcase9 vector by using a lentivirus packaging kit, and preparing red fluorescent lenti-dcase9-mcherry lentivirus and blue fluorescent lenti-sgRNA-BFP lentivirus respectively;

transfecting the lenti-dcase 9-mchery lentivirus and the lenti-sgRNA-BFP lentivirus to the target cell line, and sorting double positive cells of red fluorescent protein mchery and blue fluorescent protein BFP;

the transfected target cells were screened to obtain a monoclonal target cell line stably transfected with lentiviral sgRNA and dcase9 vector.

2. The method for inhibiting the expression of lncRNA in a cell nucleus based on the CRISPR-dCase9 system, according to claim 1, wherein the method further comprises the following steps before the step of selecting the sequence range of 100bp upstream and downstream of the incrna transcription start site for designing a guide sgRNA sequence used by the CRISPRi system:

and obtaining the long-chain non-coding lncRNA full-length DNA sequence in the target cell nucleus.

3. The method for inhibiting the expression of lncRNA in a cell nucleus based on the CRISPR-dCase9 system according to claim 1, wherein the step of cleaving the lentiviral sgRNA vector and ligating the Ol igo corresponding to the modified sgRNA sequence to the lentiviral sgRNA vector using T4-DNA ligase is preceded by the method comprising:

the 5 'and 3' end sequences of the sgrnas are modified according to the lentiviral sgRNA vector used.

4. The method for inhibiting the expression of lncRNA in a cell nucleus based on the CRISPR-dCase9 system according to claim 1, wherein the Ol igo of the SgRNA is obtained by modifying the following SgRNA core sequence fragment and the linked vector:

the core sequence of sgRNA is 1: GAAACCGAAGGCCCGAGCGGAGG;

sgRNA core sequence 2: CCAGCCGGCCTGCGCACCGGCGG;

sgRNA core sequence 3: CTGGGGACTCGCCTCCGCTCGGG;

sgRNA core sequence 4: GCCGGTGCGCAGGCCGGCTGGGG;

sgRNA core sequence 5: GCTGGGGACTCGCCTCCGCTCGG;

sgRNA core sequence 6: GCCGGCCTGCGCACCGGCGGCGG.

5. The method for inhibiting the expression of lncRNA in a cell nucleus based on the CRISPR-dCase9 system according to claim 1, wherein the step of designing the guide sgRNA sequence used by the CRISPRi system specifically comprises:

designing the sgRNA sequence with the length of 20bp by using a network sgRNA prediction database platform.

6. The method for inhibiting the expression of incrna in a cell nucleus based on the CRISPR-dCase9 system according to claim 1, wherein the lentiviral packaging kit is one of lipo2000 transfection kit, lipo3000 transfection kit and calcium phosphate transfection kit.

7. The method for inhibiting the expression of lncRNA in a cell nucleus based on the CRISPR-dCase9 system of claim 1, wherein the lentiviral lenti-sgRNA vector is a lentiviral sgRNA expression vector which is one of addge 60955, addge 118650 and addge 65656.

8. The method for inhibiting the expression of lncRNA in a cell nucleus based on the CRISPR-dCase9 system according to claim 1, wherein the target cell lines stably transfected with CRISPR-dCase9 and sgRNA obtained by screening transfected monoclonal cells are specifically:

screening the transfected monoclonal cells by using a 96-well plate to obtain the target cell line stably transfected with CRISPR-dcase9 and sgRNA.

9. The method for inhibiting the expression of lncRNA in a cell nucleus based on the CRISPR-dCase9 system according to claim 1, wherein the step of sorting the red fluorescent protein mcherry and blue fluorescent protein BFP double positive cells comprises:

and (3) sorting the red fluorescent protein mcerry and the blue fluorescent protein BFP double positive cells by using a flow cytometer.

10. The method for inhibiting the expression of lncRNA in a cell nucleus based on the CRISPR-dCase9 system according to claim 1, wherein the step of sorting the red fluorescent protein mcherry and blue fluorescent protein BFP double positive cells comprises:

and obtaining a corresponding screening medicament according to the antibiotic resistance target of the lentivirus lenti-sgRNA vector, and using the screening medicament to sort the red fluorescent protein mcherry and the blue fluorescent protein BFP double positive cells.

Images