CN106318947A - Genome editing system and application thereof - Google Patents

Abstract

The invention provides a genome editing system and application thereof. The genome editing system comprises a) and b): a) an embedded sequence, and b) a Cas9 protein. A target spot, sgRNA and the Cas9 protein are integrated in an expression box, and expression is driven by a type-II starter, so that the starter range which is available for sgRNA is expanded, and gene editing of specific tissues can be realized favorably; meanwhile, limitation to a basic group at the first site of the target spot is eliminated, and the target spot selection range is expanded; furthermore, the number of expression boxes in a carrier construction process can be reduced, and carriers can be simplified; the problem of loss of part of elements due to recombination caused by the fact that a plurality of expression boxes use the same starter is avoided.

Description

Genome editing system and application thereof

Technical field

The present invention relates to a kind of genome editing system and application thereof, particularly to a kind of by II type promoters driven CRISPR/Cas9 system and application thereof.

Background technology

CRISPR is a kind of viral DNA from bacterial degradation invasion or the immunologic mechanism of other foreign DNAs.Antibacterial and In archeobacteria, CRISPR system is divided into into 3 classes, and wherein I class and III class need multiple CRISPR associated protein (Cas albumen) common Playing a role, and II class system has only to a kind of Cas albumen, this can extensively apply, for it, the condition of providing convenience.

The II type CRISPR/Cas system relating to Cas9 albumen and sgRNA is representational, under the guiding of sgRNA, First Cas9 albumen be combined into complex with sgRNA, then combines and invade DNA by PAM sequence, forms RNA-DNA and is combined Structure, and then cut target DNA double-strand, makes DNA double chain interruption, utilize the nonhomologous end of cell self to engage and Homologous recombination repair mechanism realizes errors repair or introduces change, causes DNA sequence to change, thus the orientation realizing gene is repaiied Decorations operation.

In plant, normally used CRISPR/Cas system comprises two independent expression cassettes of sgRNA and Cas9, and divides Not by type III promoter (such as Oryza sativa L. U3 or U6 promoter etc.) and II type promoter (such as cauliflower mosaic virus 35 S promoter or Ubiquitin protein 1 promoter etc.) drive and express.This system is primarily present following defect:

(1) sgRNA is typically expressed by Oryza sativa L. U3 or U6 promoters driven, but first base that the two requirement is transcribed is respectively Being A and G, therefore it has certain restriction to the selection of target spot.

(2) Oryza sativa L. U3 and U6 promoter are constitutive promoter, it is impossible to realize in specific tissue different genes Edit.

(3) if the promoter phase of the promoter of Cas9 expression cassette and selected marker (such as Hpt or PMI etc.) expression cassette With, the phenomenon that the Cas9 element being just susceptible to cause because of restructuring in the Agrobacterium of some kind is lost, cause Agrobacterium The transfer-gen plant obtained after conversion there is no mutant, and then affects CRISPR/Cas9 systematic difference effect.

Summary of the invention

It is an object of the invention to provide a kind of genome editing system and application thereof, effectively overcome III in prior art The base of transcriptional start site is limited, can not edit different genes in specific tissue, due to weight by type promoter Group and cause element lose cause obtaining the technological deficiencies such as mutant.

For achieving the above object, the present invention provides a kind of chimeric sequences, comprises sgRNA sequence and can shear sequence, described SgRNA sequence inserts the inside of intervening sequence.

Further, the both sides, position that described sgRNA sequence is inserted within described intervening sequence the most at least retain a length of The described intervening sequence of 12bp.

On the basis of technique scheme, described chimeric sequences also includes target sequence.

Specifically, described intervening sequence is intron sequences.

For achieving the above object, the present invention also provides for a kind of genome editing system, including a) and b):

A) described chimeric sequences；

B) Cas9 albumen.

Further, described chimeric sequences is effectively connected with the nucleotide sequence encoding described Cas9 albumen.

Described chimeric sequences is operably coupled to regulating and controlling sequence.

On the basis of technique scheme, described regulating and controlling sequence includes II type promoter and/or localization domain.

Preferably, described II type promoter includes constitutive promoter, tissue-specific promoter and inducible promoter.

Specifically, described constitutive promoter includes cauliflower mosaic virus 35 S promoter or ubiquitin promoter.

Described tissue-specific promoter includes that pollen specific expresses promoter, root-specific expresses promoter, green Tissue specificity expression promoter or endosperm specificity expression promoter.

Described inducible promoter include chemical inducible promoter type promoter sub, cold-induced, Heat-inducible promoter or Virus induction type promoter.

For achieving the above object, the present invention also provides for a kind of genome editing system by II type promoters driven, including A), b) and c):

A) II type promoter；

B) described chimeric sequences；

C) Cas9 albumen.

Further, described chimeric sequences is effectively connected with the nucleotide sequence encoding described Cas9 albumen.

Described chimeric sequences is operably coupled to described II type promoter.

Preferably, described II type promoter includes constitutive promoter, tissue-specific promoter and inducible promoter.

Specifically, described constitutive promoter includes cauliflower mosaic virus 35 S promoter or ubiquitin promoter.

Described tissue-specific promoter includes that pollen specific expresses promoter, root-specific expresses promoter, green Tissue specificity expression promoter or endosperm specificity expression promoter.

Described inducible promoter include chemical inducible promoter type promoter sub, cold-induced, Heat-inducible promoter or Virus induction type promoter.

For achieving the above object, the present invention also provides for a kind of expression cassette, comprises the core encoding described genome editing system Acid sequence or coding are described by the nucleotide sequence of the genome editing system of II type promoters driven.

For achieving the above object, the present invention also provides for a kind of recombinant expression carrier, comprises the described genome editor of coding and is The nucleotide sequence of system or or the described nucleotide sequence by the genome editing system of II type promoters driven of coding or described expression Box.

For achieving the above object, the present invention also provides for a kind of method realizing genome editor, is included in table in organism Reach described genome editing system or described by the genome editing system of II type promoters driven.

For achieving the above object, the present invention also provides for a kind of method editing target site sequence, including by described genome Editing system imports in the organism comprising target site sequence.

For achieving the above object, the present invention also provides for a kind of method of plant producing genome editor, including to plant Genome introduces and encodes the nucleotide sequence of described genome editing system or encode described by the gene of II type promoters driven The nucleotide sequence of group editing system.

For achieving the above object, the present invention also provides for a kind of method producing genome editor's plant seed, including by institute State the plant selfing of the genome editor that method produces, thus obtain and there is genome editor's plant seed.

For achieving the above object, the present invention also provides for a kind of method cultivating genome editor plant, including:

Plant described genome editor's plant seed that at least one described method produces；

Described seed is made to grow up to plant.

For achieving the above object, the present invention also provides for a kind of described genome editing system or described is driven by II type promoter Dynamic genome editing system purposes in obtaining genome mutation biology.

For achieving the above object, the present invention also provides for a kind of test kit, including described genome editing system or described by The genome editing system of II type promoters driven, is used for realizing genome editor.

Heretofore described CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), refer to the short palindrome repetitive sequence of the regular intervals of cluster, short repeat in the same direction containing multiple Locus, it is found to be present in the genome of about 40% order-checking antibacterial and in the genome of 90% order-checking archeobacteria. CRISPR is as the immune system function of protokaryon, and it gives the opposing to external genetic elements such as plasmid and phage Property.CRISPR system provides a kind of acquired immunity form.The short-movie section (referred to as spacer) of foreign DNA is incorporated into CRISPR In genome between repetitive sequence, then CRISPR spacer being similar in eukaryote in the way of RNAi for identifying and Reticent external genetic elements.In antibacterial and archeobacteria, CRISPR system is divided into into 3 classes, and wherein I class and III class need multiple CRISPR associated protein (Cas albumen) plays a role jointly, and II class system has only to a kind of Cas albumen, and this is its energy The most extensively apply condition of providing convenience.

The limiting examples of Cas albumen of the present invention includes: Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also referred to as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2、Csa5、Csn2、Csm2、Csm3、Csm4、Csm5、Csm6、Cmr1、Cmr3、Cmr4、Cmr5、Cmr6、Csb1、Csb2、 Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, its homology Thing or its modified forms.These enzymes are known；Such as, the aminoacid sequence of streptococcus pyogenes Cas9 albumen is found in Under SwissProt database login Q99ZW2.In certain embodiments, the CRISPR enzyme such as Cas9 of unmodified has DNA and cuts Cut activity.In certain embodiments, this CRISPR enzyme is Cas9, and can be from streptococcus pyogenes or streptococcus pneumoniae Cas9。

Heretofore described Cas9, a kind of important protein component in II type CRISPR/Cas system, can be from life Object such as Streptococcus species (Streptococcus sp.), preferably streptococcus pyogenes (Streptococcus pyogenes) Middle isolated.When two RNA of Cas9 and referred to as CRISPR RNA (crRNA) and trans-activation crRNA (TracrRNA) are multiple During conjunction, form activity Cobra venom endonuclease, thus cut off the foreign genetic element in invasion phage or plasmid, to protect host thin Born of the same parents.CrRNA CRISPR element from host genome is transcribed, and wherein captures from external source invader before this CRISPR element. It is multiple that research shows that the single-chain chimeric RNA that the necessary part by merging crRNA and tracrRNA produces can replace Cas9/RNA Two RNA in zoarium are to form functional nucleic acid restriction endonuclease.The variant of Cas9 protein can be the mutant forms of Cas9, Wherein catalytic aspartate residues changes into other aminoacid any.Preferably, other aminoacid described can be alanine.

Heretofore described guide RNA or guiding RNA (guide RNA, gRNA), the least guide RNA (small Guide RNA, sgRNA), act on kinetoplast (kinetoplastid) internal one and be referred to as rna editing (RNA editing) After transcribe in modification, be also a kind of small-sized non-coding RNA.Can match with pre-mRNA, and insert some urine wherein Pyrimidine (U), produces and has effective mRNA.The RNA molecule of guide rna editing, length is about 60-80 nucleotide, be by Single genetic transcription, the 5 ' ends at gRNA have one section of anchorage zone, with special G-U matching method and unedited pre- MRNA complementary, anchor series promotes that the editing area in gRNA Yu pre-mRNA is complementary, specific bond；In gRNA molecule Between position have an editing area to be responsible for inserting the position of U in the pre-mRNA molecule edited, its with by editor mRNA accurate Complementary；At 3 ' ends of gRNA molecule, add after having one section to transcribe by about 15 noncoding PolyU sequences, function is GRNA is linked to the 5 ' upstreams of editing area of pre-mRNA rich on the nucleotide sequence of purine bases.When editor, formed One editosome (editosome), carries out the correction of transcript, produces editor's simultaneously using the sequence within gRNA as template mRNA。

There is three types CRISPR/Cas system, be directed to II type of Cas9 protein and crRNA, tracrRNA CRISPR/Cas system is representational.Cas9 protein can be practiced shooting DNA by the guide effect of manually modified guide RNA The 5 '-N20-NGG-3 ' (N represents any Deoxydization nucleotide base) of sequence, N20 are 20 alkali identical with the 5 ' sequences of gRNA Base, NGG is PAM district (prototype introns is adjacent to motif, Protospacer-adjacent motif).The site that Cas9 shears is just It it is the region near PAM.Relative to zinc refer to activating transcription factor sample effector DBP provide advantage-because Nucleotide combines the locus specificity in CRISPR-Cas albumen and is regulated and controled by RNA molecule rather than DBP regulation and control.

Heretofore described restructuring, when for such as cell, nucleic acid, protein or carrier time, represent this cell, nucleic acid, Protein or carrier are modified by introducing heterologous nucleic acids or protein or change natural acid or protein, or this is thin Born of the same parents are derived from this cell modified.

In the present invention, guide RNA can transfer to cell or organism to encode the form of RNA or DNA of this guide RNA In.Guide RNA can be to be the RNA of separation, be incorporated to the form of the RNA of viral vector or encode in the carrier.Preferably, carry Body can be viral vector, plasmid vector or agrobacterium vector.

The DNA of coding guide RNA can be the carrier comprising coding guide RNA sequence.For example, it is possible to by using separation Guide RNA or comprise the coding sequence of guide RNA and the plasmid DNA transfection cell of promoter or organism, by guide RNA transfection To cell or organism.

Heretofore described cutting or shearing refer to the fracture of nucleic acid molecule covalency skeleton.Guide RNA can be prepared as It is specific to any target to be cut, cuts any target DNA by the target specific moiety of guide RNA.

The genome of heretofore described plant, plant tissue or plant cell, refers to plant, plant tissue or plant Intracellular any hereditary material, and include nucleus and plastid and mitochondrial genome.

Heretofore described polynucleotide and/or nucleotide form completely " gene ", encode in required host cell Protein or polypeptide.Those skilled in the art are it is readily appreciated that can be placed in the polynucleotide of the present invention and/or nucleotide Under regulating and controlling sequence in purpose host controls.

Such as the application, including use in claim, unless clearly indicated otherwise in context, otherwise odd number and list The term of number form formula, such as " one ", " one " and " being somebody's turn to do ", including plural thing.It is thus possible, for instance " plant ", " this plant " or " plant " also indicates that multiple plant.And based on context, use term " plant " to may further indicate that this plant is in heredity Similar or identical offspring.Similarly, term " nucleic acid " can refer to many copies of nucleic acid molecules.Similarly, term " probe " May refer to same or analogous probe molecule.

Digital scope includes the numeral limiting this scope, and includes each integer in limited range and non-clearly Integer fraction.Unless otherwise noted, whole technology the most used herein and scientific terminology have and ordinary skill people The identical implication that member is commonly understood by.

In the present invention, term " nucleic acid ", " nucleotide ", " nucleotide sequence ", " oligonucleotide " and " polynucleotide " can be mutual Changing use, they refer to the polymerized form with the nucleotide of any length, based on context implication, may refer to DNA or RNA, Or its analog.Wherein DNA includes but not limited to cDNA, genomic DNA, synthetic DNA (such as synthetic) and contains nucleic acid DNA (or RNA) like thing.Polynucleotide can have any three dimensional structure, and can perform known or unknown any function. Nucleic acid can be double-strand or strand (both sense strand or antisense strand).The non-limiting example of polynucleotide includes gene, gene sheet Section, exon, intron, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozyme, cDNA, recombination of polynucleotide, branch Polynucleotide, plasmid, carrier, the separation DNA of any sequence, separation RNA, nucleic probe and the primer of any sequence, Yi Jihe Acid-like substance.

In the present invention, term " intervening sequence " refers between gene or intragenic non-coding sequence.Most of eucaryon structures Intervening sequence in gene or not coded sequence can be transcribed, but after genetic transcription, these intervening sequences the part transcribed Processed accurately removed from primary transcribe, just had the RNA of function.

In the present invention, term " intron (Intron) " is the intervening sequence in eukaryotic cells DNA, is blocking gene The linear sequence expressed.These sequences are transcribed in precursor RNA, but the intron on RNA can leave nucleus at RNA carries out Wiped out before Zhuan Yi, be finally not present in mature rna molecule.Outside the Gene Partial being retained when at ripe mRNA is referred to as Aobvious son.Intron is the most also interior aobvious son, relative with exon.Alternately arranged the constituting of intron and exon isolates base Cause.Intron in precursor RNA is often referred to as " intervening sequence ".In processing after transcribing, it has more than exon Sudden change." intron " also refers to the region encoding in the DNA of corresponding RNA intron.The number of intron contained by eukaryotic gene, position It is not quite similar with length.Intron is one section of special DNA sequence, and it can realize self cleavage.The intron that the present invention uses Derive from Semen Ricini (Ricinus communis).In plant, intron can stabilize and increase the expression of gene.Derive from The gus gene of antibacterial does not has intron, therefore in the ordinary course of things, when expressing GUS in plant, meeting is at this gus gene Interior sequences adds the intron (such as the carrier of pCambia series) deriving from Semen Ricini, with the table in plant that stabilizes and increases Reach.

There is intron function the separation sequence hybridized with intron sequences of the present invention or its fragment under strict conditions It is included in the invention.These sequences and sequence of the present invention at least about 40%-50% homology, about 60%, 65% or 70% Homology, the most about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology.The i.e. scope of sequence iden is distributed at least about 40%-50%, about 60%, 65% or 70% Homology, the most about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, The sequence iden of 99% or bigger.

In the present invention, " chimeric sequences " refers to utilize gene recombination technology by DNA/RNA sequence restructuring different for source The artificial sequence become.

In the present invention " wild type " represent biology, bacterial strain, the canonic form of gene or work as it there is time zone at nature Not in mutant or the feature of variant form.

In the present invention, " mutant " or " variant " refers to the individuality undergone mutation, and it has the sequence different from wild type, May result in the sequence that at least part of function of wherein sequence has been lost, such as, sequence in promoter or enhancer region Change will affect the expression of coded sequence in organism at least in part.Term " suddenly change " refer to can by such as lacking, add, Replace or reset any change of sequence in the nucleotide sequence caused.Sudden change also can affect one or more steps that this sequence participates in Suddenly.Such as, the change in DNA sequence may result in activated, to have amount of activated or inactive change mRNA and/or egg White synthesis.

In the present invention, " non-naturally-occurring " shows artificial participation.When referring to nucleic acid molecules or polypeptide, represent this nucleic acid At least another kind in connection that molecule or polypeptide at least substantially or are such as found in nature in nature from them Component is free out.

The present invention " expresses " and refers to that sequence interested transcribes the corresponding mRNA of generation and this mRNA translation produces correspondence and produces Thing, i.e. peptide, polypeptide or albumen.Regulating element controls or adjusts sequence interested to express, and described regulating element includes that 5 ' regulate Element such as promoter.

In the present invention, " polypeptide ", " peptide " and " protein " is interchangeably used, and refers to that the aminoacid with any length gathers Compound.This polymer can be straight or branched, and it can comprise the aminoacid of modification, and it can be by non-amino acid Disconnected.These terms are also contemplated by the most adorned amino acid polymer；These modify such as disulfide formation, glycosylation, esterified, Acetylation, phosphorylation or any other operation, such as the combination with marker components.Term " aminoacid " includes natural and/or non- Natural or the aminoacid of synthesis, including glycine and D and L optical isomer and amino acid analogue and peptide simulation Thing.

In the present invention, term " carrier " refers to the DNA molecular replicated in host cell.Plasmid and cosmid are examples Property carrier.Additionally, term " carrier " and " medium " are used interchangeably to refer to be transferred to another kind of thin from a kind of cell by DNA fragmentation The nucleic acid molecules of born of the same parents, therefore cell is unnecessary belongs to identical biology and (such as from agrobatcerium cell, DNA fragmentation is transferred to plant Cell).

In the present invention, term " expression vector " refers to express containing required coded sequence with in specific host biology The recombinant DNA molecules of the appropriate nucleic acid sequences required for the coded sequence effectively connected.

In the present invention, term " recombinant expression carrier " refers to from any source, can be integrated into genome or autonomous replicate Any factor such as plasmid, cosmid, virus, BAC (bacterial artificial chromosome), autonomous replication form sequence, phage or linear or Cyclic single strand or double-stranded DNA or RNA nucleotide sequence, use well-known restructuring including one or more of which DNA sequence The DNA molecular that DNA technique connects in functional operable mode.

Heretofore described regulating and controlling sequence includes but not limited to promoter, transit peptides, terminator, enhancer, targeting sequencing And other is operably connected to the regulation sequence of described chimeric sequences.

In the present invention, " localization domain " is optionally added to the part of protein part, and localization domain can be by egg The complex of white part or the protein part of programming or assembling positions to specific cells in living cells or Subcellular Localization.Location knot By being fused to mix by the aminoacid sequence of protein part, structure territory can include that the aminoacid of following domain builds: nuclear location Signal (NLS)；Mitochondrion targeting sequencing (MLS)；Chloroplast targeting sequencing；And/or be designed with by albumen transport or guide or Any sequence of any subdivided portions positioned to organelle, cellular compartment or cell containing nucleic acid.In some embodiments In, organism is eukaryote, and localization domain includes allowing albumen to enter the nuclear location knot in nucleus and genomic DNA Structure territory (NLS).The sequence of described NLS can include any function NLS of positively charged sequence.In other embodiments, fixed Nuclear localization sequence can include the targeting sequencing making the nucleoprotein of protein part or programming enter organelle, makes organelle DNA be modified It is possibly realized.

In the present invention, eukaryote has 3 class RNA polymerases, is responsible for transcribing the promoter that 3 classes are different.By rna plymerase i Being responsible for the rRNA gene transcribed, promoter (I type) is the most single, by two parts Sequence composition of near transcriptional start sites: the A part is core promoter (core promoter), is made up of-45+20 nucleotide, just be enough to initiate during individualism Transcribe；Another part is made up of-170-107 bit sequences, referred to as upstream regulatory elements, can effectively strengthen transcriptional efficiency.

Be responsible for transcribing by RNA polymerase III is microRNA (snRNA) in 5S rRNA, tRNA and some core, and it opens Mover (III type) composition is more complicated, can be divided into again two subclass: a class belongs to structural gene Natural promoter, and a class belongs to structure Extragenic promoter.The effectively start of Natural promoter depends on two discontinuous DNA fragmentations that gene internal comprises, the two DNA fragmentation includes some different continuous DNA sequence A, B or C districts, and Liang Ge is spaced between district.According to Liang Ge district different groups Close, I class and II class two kinds: I class can be divided into include A and C district, have now been found that it exists only in the gene of 5S rRNA；II class Including A and B district, it is present in the RNA of the gene of tRNA, the gene of 7SLRNA, adenovirus VAI Yu VAII.Inside A, B or A, C DNA sequence is transcription factor TF III A and TF III C transcripting starting binding site.As a rule, 5 ' ends also have other regulation Or key element, these elements are required to the efficient transcription of RNA.Affect between the presence or absence of these sequences and transcribe effect Rate.These sequences present the multiformity of complexity, but most of promoter 5 ' end-30 to-20 places also exist TATA box sample sequence, Similar to outer promoter.Outer promoter lacks corresponding internal sequence, only has cis acting element, at the end of gene at 5 ' ends By one group of termination signal being made up of 4 or more thymus pyrimidine, such as vertebrates U6 small nuclear RNA and 7SK RNA promoter, this A little promoteres are the most similar or identical, its position and base sequence high conservative, and its structure is with pol II promoter also There is certain similarity.Their 5 ' end cis acting element include that several control element, the most about-30 places exist one TATA sample sequence, there are a snRNA PSE (snRNA approximating sequence) and one or more modification sequence being referred to as OCT in nearly-60 places Row 5 '-ATGCAAAT-3 '.TATA sample sequence is that snRNA gene is transcribed special by pol III.TATA sample element and PSE Element has together decided on selection and the transcriptional efficiency of transcriptional start site.Distance between TATA sample element and PSE element determines The specificity of rna polymerase transcribe, but it is more important, because at U6RNA and the 7SK RNA of PSE disappearance to seem TATA sample element In genetic transcription, the only decline of transcriptional efficiency.And, PSE element may be correlated with B box (boxB), and B box is to a certain extent PSE element can be substituted.Transcribing of these sequence pair downstream genes has conclusive effect, and they and initiation site phase Away from farther out, often beyond 150bp, and for pol III Natural promoter, typically within 80bp；Promoter outer with pol III Comparing, pol II promoter 5 ' holds the effect of each cis acting element just on the contrary, if TATA sample element disappearance, PSE then may be used To fulfil TATA sample element function, determine the initial position transcribed.In PSE upstream, outer promoter also has a far-end to control sequence Row, its structure is similar to pol II enhancer OCT skeleton, but relatively it is complicated.And a CACC sequence and OCT is also had at-223 places Skeleton is connected.The existence of these far-ends control sequence is greatly improved the expression efficiency of U6RNA and 7SK RNA.

The II type gene being responsible for transcribing by rna plymerase ii includes all proteins encoding gene and part snRNA gene, The promoter structure of the latter is similar to the 3rd subclass in type III gene promoter, the II type gene promoter of coded protein Structurally there is common conserved sequence.Transcriptional start site sequence homology the most widely, but first base is that gland is fast Purine, and both sides are pyrimidine bases.This region is referred to as initial son (initiator, Inr), and sequence is represented by Py2CAPy5. Inr element is positioned at-3+5.The promoter being only made up of Inr element is that have can the most simply opening by rna plymerase ii identification Mover form.Most II type promoteres have a consensus sequence being referred to as TATA box, are generally in-30th district, relative to transcribing The location comparison of initiation site is fixed.TATA box is present in all eukaryotes, and TATA box is seven conservative base pairs, Also having some II type promoteres not contain TATA box, such promoter is referred to as without TATA box promoter.

In the present invention, term " promoter " refers to DNA regulatory region." constitutive promoter " of the present invention refers at such Under the control of promoter, the expression somewhat constant of purpose heterologous nucleotide sequence is on certain level, at the different tissues of plant And/or difference growth and development stage expression does not has notable difference.Described be organized as origin source in plant identical and perform The structural units of one or more cell type set of same function, such as protective tissue, conducting tissue, nutrition group Knit, mechanical tissue, separate living tissue, several organic cooperations of different tissues, be closely connected, form different organs (organ), no Work in coordination between same organ, be efficiently completed organic whole vital movement process.Described growth and development stage can Difference according to phytomorph, function is divided into embryo stage, plantlet stage, maturation period and ageing phase.Art in the present invention Language " expression of composing type " refers to that purpose heterologous nucleotide sequence is at the different tissues of plant and/or different growth and development stage all Express with substantially uniform level.Instruct the example of the promoter of constitutive expression in plant to include but not limited to, come Come from the 35S promoter of cauliflower mosaic virus, ubi promoter of maize, the promoter etc. of Oryza sativa L. GOS2 gene.

The scope of obtainable plant compatibility promoter includes tissue-specific promoter and inducible promoter.Induction Type controlling element is to respond to derivant directly or indirectly to activate the element transcribed of one or more DNA sequence or gene. When there is not derivant, DNA sequence or gene can not be transcribed.Typically, with inducible regulatory element specific bond to swash The rho factor transcribed of living exists with inactive form, and it is directly or indirectly converted into activity form by derivant again.Lure Leading agent can be chemical reagent, such as protein, metabolite, growth regulatory factor, herbicide or phenolic compound or direct The life applied by hot, cold, salt or toxic element or indirectly applied by pathogen actin or disease agent (such as virus) Reason is coerced.Plant cell containing inducible regulatory element can be exposed to derivant, by spraying, water, heat or similar side Derivant is applied on cell or plant by method.

Any inducible promoter is used equally to the present invention.Exemplary inducible promoter includes ecdysone receptor promoter Son；The promoter responding to copper from ACE1 system；From In2-1 and the In2-2 gene of Semen Maydis, it responds to benzsulfamide Herbicide-safener；Maize GST promoter, it is activated by the hydrophobic electrophilic compounds of herbicide urgent before being used as；And Nicotiana tabacum L. PR-1a promoter, it is activated by salicylic acid.Other is included sterol response type promoter and Fourth Ring by the promoter of chemical regulation Element induction type and tetracycline containment type promoter.

" tissue-specific promoter " of the present invention is also called organ specific promoters, can be used for targeting and specifically plants Strengthen in fabric texture transcribes and/or expresses.Promoter can be expressed in targeted tissue and also express in other plant tissue, can Strong expression and the expression more much lower than other tissue degree in targeted tissue, or can highly preferred in targeted tissue Express.The difference of the gene expression tissue according to promoter regulation, can be divided into root-specific promoter, flower specific promoter, Embryo-specific promoter etc..Koehorst-van Putten etc. analyze GBSSI promoter, find that this promoter can drive base Because of the expression in Maninot esculenta crantz. tuberous root, but can not express in remaining tissue, show that this promoter has tissue specific expression Characteristic.Lv Shanhua etc. utilize GUS to stablize expression system and analyze pyk10 promoter expression in transgene tobacco, Find that the gene of this promoters driven is specific expressed in root.Fang Xiaoliang etc. have studied rice Os ESP1 promoter, and finding should The gus gene of promoters driven is only expressed in embryo, illustrates that this promoter is embryo-specific promoter.Also as in chlorenchyma Instruct expression its hetero-organization higher than plant of coded sequence, such as PEP carboxylase promoter.

Heretofore described " effectively connecting " or " being operably connected " represent the connection of nucleotide sequence, and described connection makes Article one, sequence can provide the function needed for linked sequence.Described " effectively connecting " in the present invention can be by promoter It is connected with sequence interested so that transcribing of this sequence interested is controlled by this promoter and regulation and control.When interested Sequential coding albumen and when going for the expression of this albumen " effectively connecting " represent: promoter is connected with described sequence, phase Mode even makes the transcript efficient translation obtained.If promoter is that transcript merges and thinks with the connection of coded sequence When realizing the expression of albumen of coding, manufacture such connection so that the first translation initiation codon in the transcript obtained It it is the start codon of coded sequence.Alternatively, merge if the connection of promoter and coded sequence is translation and wants reality During the expression of the albumen now encoded, manufacture such connection so that the first translation initiation password contained in 5 ' non-translated sequences Son is connected with promoter, and connected mode makes the translation product obtained and the translation encoding the albumen wanted opens reading code The relation of frame meets reading frame.The nucleotide sequence that can " effectively connect " includes but not limited to: provide gene expression function Sequence (i.e. gene expression element, such as promoter, 5 ' untranslated regions, intron, protein encoding regions, 3 ' untranslated regions Territory, poly-putative adenylylation site and/or transcription terminator), provide DNA transfer and/or sequence (the i.e. T-DNA border sequence of integration function Row, site-specific recombinase recognition site, intergrase recognition site), provide selectivity function sequence (i.e. antibiotic resistance Label, biosynthesis gene), provide and can score the sequence of label function, the sequence of external or internal assistance series of operations (i.e. polylinker sequence, locus specificity recombination sequence) and sequence (the i.e. origin of replication, independently multiple of antibacterial of copy function is provided Sequence processed, centromeric sequence).

In the present invention, described regulating and controlling sequence includes but not limited to promoter, transit peptides, terminator, enhancer, leading sequence Row, intron and other be operably connected to one or more elements of CRISPR system, thus drive this CRISPR system The expression of the one or more element of system.It is said that in general, CRISPR (repetition of the regular intervals cluster short palindrome), also referred to as SPIDR (repetition in the same direction that Spacer is spaced apart), is constituted generally for DNA locus specific for specific bacteria species Family.This CRISPR seat be included in escherichia coli identified spaced apart short tandem repeats (SSR) an inhomogeneity, And related gene.Similar spaced apart SSR is the most identified to be belonged to and knot in Hfx. mediterranei, streptococcus pyogenes, Herba Houttuyniae In core mycobacteria.These CRISPR seats typically differ from the repetitive structure of other SSR, and these repeat to be referred to as rule The short weight at interval is multiple (SRSR).It is said that in general, these repeat to be that it is had substantial constant length with bunch short element existed Unique intervening sequence the most spaced apart.Although repetitive sequence is high conservative between bacterial strain, many spaced apart weights Multiple and these spacers sequence is typically different between bacterial strain from bacterial strain, identifies in the prokaryote more than 40 kinds CRISPR seat.

In the present invention, it is any desired that " target spot ", " target site " or " target sequence ", " target site sequence " refer to be applied Predetermined nucleotide sequence, include but not limited to coding or non-coding sequence, gene, exon or intron, regulation sequence, base Sequence, composition sequence and cytozoon sequence between Yin.In some embodiments, target sequence is present in target cell, group Knit, in organ or organism.Target sequence includes target site, and including the one or more nucleotide in target sequence, it can lead to Cross present disclosure to be modified to any degree.Such as, target sequence can comprise a nucleotide.Such as, target spot sequence Row can comprise 1-300 nucleotide.Such as, target sequence can include about 1-100 nucleotide.Such as, target sequence can comprise 1-50 nucleotide.Such as, target sequence can include about 1-35 nucleotide.In some embodiments, target sequence can wrap Including more than one target site, it can be same or different.

The length of primer is usually 11 polynucleotide or more, preferably 18 polynucleotide or more, more preferably Be 24 polynucleotide or more, most preferably 30 polynucleotide or more.This primer is at high stringency hybridization bar Specifically hybridize with target sequence under part.Although being different from target dna sequence and target dna sequence being kept hybridization ability Primer can be by conventional design out, however, it is preferred to, the continuous kernel of primer in the present invention and target sequence Acid has DNA sequence homogeneity completely.

The primer of the present invention hybridizes with target dna sequence under strict conditions.Nucleic acid molecules or its fragment are in a stable condition Under can carry out specific hybrid with other nucleic acid molecules.As the present invention uses, if two nucleic acid molecules can be formed anti-flat The double-strandednucleic acid structure of row, it is possible to say that the two nucleic acid molecules can carry out specific hybrid to each other.If two nucleic acid Molecule demonstrates complementary completely, then claiming one of them nucleic acid molecules is another nucleic acid molecules " complement ".Such as this Bright use, when the corresponding nucleotide complementary of each nucleotide and another nucleic acid molecules of a nucleic acid molecules, then The two nucleic acid molecules is claimed to demonstrate " complete complementary ".If two nucleic acid molecules can be with enough stability phase mutual crosses So that they are annealed and be bonded to each other under the conditions of at least conventional " low strict ", then the two nucleic acid molecules is called " Low degree is complementary ".Similarly, if two nucleic acid molecules can be with enough stability phase mutual crosses so that they be in routine " the strictest " under the conditions of anneal and be bonded to each other, then claim the two nucleic acid molecules there is " complementary ".From complete complementary Middle deviation can allow, as long as this deviation not exclusively stops two molecules to form duplex structure.In order to make a nucleic acid Molecule can be as primer or probe, it is only necessary to ensure that it has sufficient complementarity in sequence, so that the spy used Determine be formed under solvent and salinity stable duplex structure.

As the present invention uses, the sequence of basic homology is one section of nucleic acid molecules, and this nucleic acid molecules is at high stringency Down can be with the complementary strand generation specific hybrid of another section of nucleic acid molecules matched.Promote DNA hybridization be suitable for strict Condition, such as, about processes by 6.0 × sodium chloride/sodium citrate (SSC) under the conditions of 45 DEG C, then uses under the conditions of 50 DEG C 2.0 × SSC washs, and these conditions are known to those skilled in the art.Such as, the salinity in washing step can be selected From the about 2.0 × SSC of Low stringency conditions, the about 0.2 × SSC of 50 DEG C to high stringency, 50 DEG C.Additionally, washing step In temperature conditions can be increased to about 65 DEG C of high stringency from the room temperature of Low stringency conditions about 22 DEG C.Temperature strip Part and salinity can all change, it is also possible to one of them keeps constant and another variable changes.Preferably, originally Invention a nucleic acid molecules can under moderate stringency, such as at about 2.0 × SSC and about 65 DEG C with SEQ ID NO: One or more nucleic acid molecules or its complementary series in 1 and SEQ ID NO:2, or arbitrary fragment generation of above-mentioned sequence is special Property hybridization.It is highly preferred that the present invention nucleic acid molecules under high stringency with SEQ ID NO:1 and SEQ ID NO: One or more nucleic acid molecules or its complementary series in 2, or arbitrary fragment generation specific hybrid of above-mentioned sequence.The present invention In, preferred label nucleic acid molecules has SEQ ID NO:1 or SEQ ID NO:2 or its complementary series, or above-mentioned sequence Arbitrary fragment.Another preferred label nucleic acid molecules of the present invention and SEQ ID NO:1 or SEQ ID NO:2 or its complementary sequence Arrange, or arbitrary fragment of above-mentioned sequence has the sequence iden of 80% to 100% or 90% to 100%.SEQ ID NO:1 Or SEQ ID NO:2 can serve as the label in plant breeding method to identify the offspring of genetic cross.Probe and target dna The hybridization of molecule can be detected by the method that is well known to those skilled in the art of any one, these methods include but It is not limited to, fluorescent labeling, radioactive label, antibody class labelling and chemiluminescent labeling.

About the amplification (such as, pass through PCR) using specific amplimer that target nucleic acid sequence is carried out, " strict bar Part " refer to only allow primer that target nucleic acid sequence is occurred the condition of hybridization in the hot amplified reaction of DNA, have and target core The primer of the corresponding wild-type sequence of acid sequence (or its complementary series), it is possible to be combined with described target nucleic acid sequence, and excellent Choosing produces unique amplified production, amplified production i.e. amplicon.

Term " specific binding (target sequence) " refer under stringent hybridization condition primer only with comprise target sequence Target sequence in sample hybridizes.

Expression cassette can additionally contain selectable marker gene.Usually, expression cassette will comprise for selecting conversion cell Selected marker.Described selected marker is for selecting the cell or tissue converted.Described selected marker base Because including but not limited to, the gene (such as encoding neomycin phosphotransferase II (NPT)) of coding antibiotic resistance and hygromycin phosphorus The gene of acid transferring enzyme (HPT), the gene of coding phosphomannose isomerase (PMI), and the gene of conferring herbicide resistance Such as cremart, Brominal, imidazolone type and 2,4-dichlorphenoxyacetic acid ester (2,4-D).

In the present invention, " test kit " can include genomic modification system that the present invention describes and following any one or complete Portion: measure reagent, buffer, probe and/or primer and Sterile Saline or another kind of pharmaceutically acceptable Emulsion and suspension base The end.Additionally, test kit can include saying containing directions for use (such as, the operation scheme) for putting into practice the method that the present invention describes Bright property material.

Conversion scheme and nucleotide sequence is imported plant or the plant cell type that the scheme of plant converts according to orientation And different, i.e. monocotyledon or dicotyledon.Nucleotide sequence is imported plant cell and is subsequently inserted in Plant Genome Appropriate methodology include but not limited to, Agrobacterium-medialed transformation, trace are launched bombardment, directly DNA are taken in protoplast, electricity The DNA of perforation or silicon whisker mediation imports.

The most inverted cell can grow into plant in a conventional manner.These plants are cultivated, with identical conversion Strain or the pollination of different transformants, the certified Phenotype feature needed for the crossbred obtained expression.Can cultivate secondary or many In generation, then results can ensure to obtain required Phenotype feature to ensure stably to keep and the expression of Phenotype feature needed for heredity The seed expressed.

The invention provides a kind of genome editing system and application thereof, have the advantage that

1, transcriptional start site is unrestricted: uses II type promoters driven sgRNA to express, eliminates for transcription initiation position The base of point limits.

2, cutting specific tissue is instructed: the promoter of most of specifically expressings belongs to II type promoter, if using the type The expression of promoters driven sgRNA, is advantageously implemented the gene editing of specific tissue.

3, widening sgRNA available promoter scope: use II type promoter transcription sgRNA, having widened sgRNA can profit Promoter scope, eliminate the restriction for target spot the first bit base simultaneously, expand the target spot range of choice.

4, simplify carrier: by being incorporated into by sgRNA and Cas9 in an expression cassette, be possible not only to reduce vector construction mistake The quantity of expression cassette, simplification carrier in journey, moreover it is possible to avoid in some kind Agrobacterium owing to multiple expression cassettes use identical Promoter and the problem of the loss causing subelement of recombinating.

5, editorial efficiency is higher: the editor obtained by the gene editing system of the II type promoters driven effect that the present invention provides Rate is suitable with conventional system, and may be directly applied in actual production.

Accompanying drawing explanation

Fig. 1 is that the recombinant cloning vector DBN02-T of genome editing system of the present invention and application thereof builds flow chart；

Fig. 2 is that the recombinant expression carrier DBN100677 of genome editing system of the present invention and application thereof builds flow chart；

Fig. 3 is that the Semen Maydis of the sgRNA chimeric mode different from intron of genome editing system of the present invention and application thereof hangs The GUS Color figure of floating cell mass；

Fig. 4 is that the recombinant clone shears carrier DBN04-T of genome editing system of the present invention and application thereof builds flow chart；

Fig. 5 is that the recombinant expression carrier DBN100777 of genome editing system of the present invention and application thereof builds flow chart；

Fig. 6 is that the recombinant expression carrier DBN100775 of genome editing system of the present invention and application thereof builds flow chart；

Fig. 7 is that the Semen Maydis of II type promoters driven Cas9/sgRNA of genome editing system of the present invention and application thereof suspends The GUS Color figure of cell mass；

Fig. 8 is the recombinant expression carrier DBN100000 carrier structure figure of genome editing system of the present invention and application thereof；

Fig. 9 is the target spot 1 carrier DBN-A carrier structure figure of genome editing system of the present invention and application thereof；

Figure 10 is the target spot 2 carrier DBN-B carrier structure figure of genome editing system of the present invention and application thereof；

Figure 11 is that the recombinant expression carrier DBN100778 of genome editing system of the present invention and application thereof builds flow chart；

Figure 12 is the target spot 3 carrier DBN-C carrier structure figure of genome editing system of the present invention and application thereof；

Figure 13 is the target spot 4 carrier DBN-D carrier structure figure of genome editing system of the present invention and application thereof.

Detailed description of the invention

The technical scheme of genome editing system of the present invention and application thereof is further illustrated below by specific embodiment.

The screening of first embodiment, sgRNA mode chimeric with intron

One, the acquisition of the chimeric sequences that sgRNA forms under different chimeric modes from intron and synthesis

1, the chimeric sequences that sgRNA forms under different connected modes is obtained from intron

The aminoacid sequence of gus protein is as shown in SEQ ID NO:1 in sequence table, and coding is corresponding to described gus protein The GUS-01 nucleotide sequence of aminoacid sequence is as shown in SEQ ID NO:2 in sequence table, and wherein intron iGUS-01 sequence is such as In sequence table shown in SEQ ID NO:3；Include as described in sgRNA sequence (shown in SEQ ID NO:4 in sequence table) is inserted into Chimeric sequences iGUS-02 (containing restriction enzyme site BsaI) that sub-iGUS-01 is internally formed, as shown in SEQ ID NO:5 in sequence table, Comprise the GUS-02 nucleotide sequence of described chimeric sequences iGUS-02 as shown in SEQ ID NO:6 in sequence table；Include described Sub-iGUS-01 Sequence replaces with chimeric sequences iGUS-that sgRNA (as shown in SEQ ID NO:4 in sequence table) is formed afterwards 03 (containing restriction enzyme site BsaI), as shown in SEQ ID NO:7 in sequence table, comprises the GUS-03 of described chimeric sequences iGUS-03 Nucleotide sequence is as shown in SEQ ID NO:8 in sequence table.

2, above-mentioned nucleotide sequence is synthesized

Described GUS-01 nucleotide sequence (shown in SEQ ID NO:2 in sequence table), as described in GUS-02 nucleotide sequence (shown in SEQ ID NO:6 in sequence table) and as described in GUS-03 nucleotide sequence (as shown in SEQ ID NO:8 in sequence table) Synthesized by Nanjing Genscript Biotechnology Co., Ltd.；5 ' ends of the described GUS-01 nucleotide sequence of synthesis are also associated with KpnI Restriction enzyme site, 3 ' ends of described GUS-01 nucleotide sequence are also associated with SpeI restriction enzyme site；The described GUS-02 nucleoside of synthesis 5 ' ends of acid sequence are also associated with KpnI restriction enzyme site, and 3 ' ends of described GUS-02 nucleotide sequence are also associated with SpeI enzyme action position Point；5 ' ends of the described GUS-03 nucleotide sequence of synthesis are also associated with KpnI restriction enzyme site, described GUS-03 nucleotide sequence 3 ' end be also associated with SpeI restriction enzyme site.

Two, structure and the recombinant expression carrier of recombinant expression carrier converts Agrobacterium

1, recombinant cloning vector is built

The GUS-02 nucleotide sequence of synthesis is connected into cloning vehicle pGEM-T (Promega, Madison, USA, CAT: A3600), on, operating procedure is carried out by Promega Products pGEM-T carrier description, obtains recombinant cloning vector DBN02- T, it builds flow process, and (wherein, Amp represents ampicillin resistance gene as shown in Figure 1；F1 represents that the duplication of phage f1 rises Point；LacZ is LacZ start codon；SP6 is SP6RNA polymerase promoter；T7 is t7 rna polymerase promoter；GUS-02 For GUS-02 nucleotide sequence (SEQ ID NO:6)；MCS is multiple clone site).

Then by recombinant cloning vector DBN02-T with heat shock method convert escherichia coli T1 competent cell (Transgen, Beijing, China, CAT:CD501), its hot shock condition is: 50 μ l escherichia coli T1 competent cells, 10 μ l plasmid DNA (weight Group cloning vehicle DBN02-T), 42 DEG C of water-baths 30 seconds；37 DEG C of shaken cultivation 1 hour (shaking table shake under 100rpm rotating speed), at table Topcoating has the ammonia of IPTG (isopropylthio-β-D-galactoside) and X-gal (the bromo-4-of 5-chloro-3-indole-β-D-galactoside) The LB flat board of benzylpcnicillin (100mg/L) (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, PH to 7.5 is adjusted with NaOH) upper growth is overnight.Picking white colony, at LB fluid medium, (tryptone 10g/L, yeast extract Thing 5g/L, NaCl 10g/L, ampicillin 100mg/L, with NaOH adjust pH to 7.5) in cultivated under the conditions of temperature 37 DEG C Night.Its plasmid of alkalinity extraction: by bacterium solution centrifugal 1min under 12000rpm rotating speed, removing supernatant, precipitation thalline is pre-with 100 μ l ice Cold solution I (25mM Tris-HCl, 10mM EDTA (ethylenediaminetetraacetic acid), 50mM glucose, pH8.0) suspends；Add 200 The solution II (0.2M NaOH, 1%SDS (sodium lauryl sulphate)) that μ l newly prepares, overturns pipe 4 times, mixing, puts on ice 3-5min；Add 150 solution III (3M potassium acetate, 5M acetic acid) ice-cold for μ l, the most fully mix, place 5-10min on ice； Centrifugal 5min under the conditions of temperature 4 DEG C, rotating speed 12000rpm, adds 2 times of volume dehydrated alcohol, room temperature after mixing in supernatant Place 5min；Under the conditions of temperature 4 DEG C, rotating speed 12000rpm, centrifugal 5min, abandons supernatant, and precipitation concentration (V/V) is 70% Washing with alcohol after dry；Add the 30 μ l TE (10mM Tris-HCl, 1mM EDTA, pH8.0) containing RNase (20 μ g/ml) molten Solve precipitation；Water-bath 30min at temperature 37 DEG C, digests RNA；Save backup in temperature-20 DEG C.

The plasmid extracted, after KpnI and SpeI enzyme action is identified, carries out sequence verification to positive colony, and result shows restructuring The described GUS-02 nucleotides sequence inserted in cloning vehicle DBN02-T is classified as the nucleotide shown in SEQ ID NO:6 in sequence table Sequence, i.e. GUS-02 nucleotide sequence is correctly inserted into.

According to the method for above-mentioned structure recombinant cloning vector DBN02-T, by the described GUS-01 nucleotide sequence of synthesis even Entering on cloning vehicle pGEM-T, obtain recombinant cloning vector DBN01-T, wherein, GUS-01 is GUS-01 nucleotide sequence (SEQ ID NO:3).Described in enzyme action and sequence verification recombinant cloning vector DBN01-T, GUS-01 nucleotide sequence is correctly inserted into.

According to the method for above-mentioned structure recombinant cloning vector DBN02-T, by the described GUS-03 nucleotide sequence of synthesis even Entering on cloning vehicle pGEM-T, obtain recombinant cloning vector DBN03-T, wherein, GUS-03 is GUS-03 nucleotide sequence (SEQ ID NO:8).Described in enzyme action and sequence verification recombinant cloning vector DBN03-T, GUS-03 nucleotide sequence is correctly inserted into.

2, recombinant expression carrier is built

PCAMBIA2300 (CAMBIA mechanism can provide) carrier is transformed, utilizes conventional enzymatic cleavage methods to build Carrier is well-known to those skilled in the art, is removed the BsaI site on pCAMBIA2300 carrier by point mutation, will simultaneously Kanamycin expression cassette removes, and obtains pDBN skeleton carrier.Introduce cauliflower mosaic virus 35S to described pDBN skeleton carrier to open Mover and terminator and PMI expression cassette (prUbi+PMI+tNos), obtain expression vector DBN-PMI, for following carrier structure Build.

Enzyme action recombinant cloning vector DBN02-T and expression vector DBN-PMI is distinguished with restricted enzyme KpnI and SpeI, The GUS-02 nucleotide sequence fragment cut is inserted between KpnI and the SpeI site of expression vector DBN-PMI, utilizes routine Enzymatic cleavage methods carrier construction be well-known to those skilled in the art, be built into recombinant expression carrier DBN100677, its build Flow process (Kan: kanamycin gene as shown in Figure 2；RB: right margin；Pr35S-01: cauliflower mosaic virus 35 S promoter (SEQ ID NO:9)；GUS-02:GUS-02 nucleotide sequence (SEQ ID NO:6)；T35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:10)；PrUbi: maize ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:11)；PMI: phosphomamlose Sugar isomerase gene (SEQ ID NO:12)；The terminator (SEQ ID NO:13) of tNos: rouge alkali synthetase gene；LB: left Border).

Recombinant expression carrier DBN100677 heat shock method is converted escherichia coli T1 competent cell, its hot shock condition For 50 μ l escherichia coli T1 competent cells, 10 μ l plasmid DNA (recombinant expression carrier DBN100677), 42 DEG C of water-baths 30 seconds； 37 DEG C of shaken cultivation 1 hour (shaking table shake under 100rpm rotating speed)；Then at the LB containing 50mg/L kanamycin (Kanamycin) On solid plate (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L adjust pH to 7.5 with NaOH) Cultivating 12 hours under the conditions of temperature 37 DEG C, picking white colony, at LB fluid medium, (tryptone 10g/L, yeast extract Thing 5g/L, NaCl 10g/L, kanamycin 50mg/L, with NaOH adjust pH to 7.5) under the conditions of temperature 37 DEG C overnight incubation. Its plasmid of alkalinity extraction.The plasmid extracted is identified with after restricted enzyme KpnI and SpeI enzyme action, and positive colony is entered Row order-checking is identified, result shows that recombinant expression carrier DBN100677 nucleotides sequence between KpnI and SpeI site is classified as sequence Nucleotide sequence shown in SEQ ID NO:6, i.e. GUS-02 nucleotide sequence in table.

According to the method for above-mentioned structure recombinant expression carrier DBN100677, by KpnI and SpeI enzyme action recombinant cloning vector The described GUS-01 nucleotide sequence that DBN01-T cuts inserts expression vector DBN-PMI, obtains recombinant expression carrier DBN100774.Nucleotide sequence in enzyme action and sequence verification recombinant expression carrier DBN100774 is containing SEQ in promising sequence table Nucleotide sequence shown in ID NO:3, i.e. GUS-01 nucleotide sequence, described GUS-01 nucleotide sequence can connect described Pr35S promoter and t35S terminator.

According to the method for above-mentioned structure recombinant expression carrier DBN100677, by KpnI and SpeI enzyme action recombinant cloning vector The described GUS-03 nucleotide sequence that DBN03-T cuts inserts expression vector DBN-PMI, obtains recombinant expression carrier DBN100678.Nucleotide sequence in enzyme action and sequence verification recombinant expression carrier DBN100678 is containing SEQ in promising sequence table Nucleotide sequence shown in ID NO:8, i.e. GUS-03 nucleotide sequence, described GUS-03 nucleotide sequence can connect described Pr35S promoter and t35S terminator.

3, recombinant expression carrier converts Agrobacterium

Oneself is constructed correct recombinant vector DBN100677, DBN100678 and DBN100774 liquid nitrogen method be transformed into In Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT:18313-015), its conversion condition is: 100 μ l Agrobacteriums LBA4404,3 μ l plasmid DNA (recombinant expression carrier)；It is placed in 10min in liquid nitrogen, 37 DEG C of tepidarium 10min；Agriculture after converting Bacillus LBA4404 is inoculated in LB test tube and cultivates 2 hours under the conditions of temperature 28 DEG C, rotating speed are 200rpm, is applied to containing 50mg/L Rifampicin (Rifampicin) and 100mg/L kanamycin LB flat board on until growing positive monoclonal, picking Dan Ke Grand cultivation also extracts its plasmid, with restricted enzyme to recombinant expression carrier DBN100677, DBN100678 and DBN100774 Carrying out digestion verification after enzyme action, result shows that recombinant expression carrier DBN100677, DBN100678 and DBN100774 structure is complete Correctly.

Three, the acquisition of the Corn suspension cells system converted

1, the stripping of maize immature embryos

By the planting seed of neat for corn variety 319 (Q319) in greenhouse or big Tanaka, 7-after milpa grows up to pollination 12 days, the female fringe of harvesting corn, after the alcohol-pickled 5min that concentration is 75% (v/v), strip rataria, select a length of 0.6- The transparent rataria of 1.2mm is standby.

2, the acquisition of nascent callus

The above-mentioned maize immature embryos stripped is inoculated into calli induction media (MS salt 4.3g/L, N6 vitamin, proline 0.5g/L, caseinhydrolysate 0.1g/L, aspartic acid 0.2g/L, sucrose 30g/L, Mediben (Dicamba) 2mg/L, 2,4-D 1.5mg/L, picloram (Picloram) 2.2mg/L, kinetins (KT) 0.3mg/L, benayl aminopurine (BAP) 0.02mg/L, plant Thing gel 3g/L, pH5.8) on carry out the induction of callus, light culture 10-14 days under conditions of temperature 28 DEG C, be preferably 14 days, it is thus achieved that the nascent callus that protrusion of surface is obvious, color is fresh and tender, the speed of growth improves.

3, Corn suspension cells system is prepared

Corn suspension cells system initiates: be transferred to the described nascent callus obtained equipped with 75ml suspending nutrient solution SUS-1 (MS salt 4.3g/L, MS vitamin, proline 3 g/L, caseinhydrolysate 1.5g/L, sucrose 45g/L, Dicamba 1.5mg/L, 2,4-D 1mg/L, Picloram 5mg/L, pH5.8) aseptic triangular flask (150ml) in, each triangular flask connects Plant the described nascent callus of 5-8 grain, under the conditions of temperature is 28-30 DEG C of light culture, the above-mentioned triangular flask sealed is placed in and turns Speed is that on 100-150r/min constant-temperature table, concussion is cultivated.

The acquisition of Corn suspension cells system: carry out subculture for the first time after described nascent callus suspension culture 10-25 days, Being preferably 20 days, reject the callus that brownization is dead during subculture, in former triangular flask, reservation growth is vigorous, quality is hard, color The newborn callus of pool cadmium yellow, and on the basis of retaining half original suspending nutrient solution SUS-1, add new Semen Maydis and suspend Culture fluid SUS-1 is at triangular flask 75ml scale, under the conditions of temperature is 28-30 DEG C of light culture, and the above-mentioned triangular flask that will seal Being placed in rotating speed is that on 100-150r/min constant-temperature table, concussion is cultivated, in order to obtain substantial amounts of callus；Subculture the most weekly Once, each subculture is both needed to reject the callus that brownization is dead, retains newborn callus, and subculture all retains half every time Original suspending nutrient solution SUS-1, and add new suspending nutrient solution SUS-1 at triangular flask 75ml scale, it is 28-30 in temperature Under the conditions of DEG C light culture, it is that on 100-150r/min constant-temperature table, concussion is cultivated that described triangular flask is placed in rotating speed.Described nascent After callus suspension culture 35-45 days, preferably 40 days, gradually produce loosely organized multiple suspension cell groups, by described Suspension cell group is transferred to equipped with 75ml suspending nutrient solution SUS-2 (MS salt 4.3g/L, MS vitamin, proline 3 g/L, hydrolysis cheese Albumen 1.5g/L, sucrose 30g/L, Dicamba 1.5mg/L, pH5.8) in new aseptic triangular flask (150ml), each triangular flask Middle inoculation 20-30 grain described suspension cell group, under the conditions of temperature is 28-30 DEG C of light culture, puts the above-mentioned triangular flask sealed After rotating speed is that on 100-150r/min constant-temperature table, concussion is cultivated 5-7 days, multiple described suspension cells group can form dispersion Well, rise in value rapid Corn suspension cells system.

4, agriculture bacillus mediated Corn suspension cells system genetic transformation

Preculture: the described suspension cell group of preparation in described Corn suspension cells system is inoculated into PRE culture medium (MS salt 4.3g/L, N6 vitamin, proline 0.5g/L, caseinhydrolysate 0.1g/L, aspartic acid 0.79g/L, sucrose 30g/L, 2,4-D 2mg/L, plant gel 3g/L, pH5.8) on, under the conditions of temperature is 28-30 DEG C of light culture, preculture 4-7 they is standby, is preferably 5 days.

Pretreatment: the described Corn suspension cells group after preculture is carried out Agrobacterium and infects front pretreatment, i.e. 60 DEG C bakings Case heat treatment is ultrasonic Treatment 5 minutes after 5 minutes, and pretreated described Corn suspension cells group invades for follow-up Agrobacterium Dye.

The preparation of Agrobacterium bacterium solution: picking contains the Agrobacterium list of DBN100677, DBN100678 and DBN100774 respectively Bacterium colony, with rifle head respectively at solid YP culture plate (tryptone 10g/L, the yeast extract 5g/ containing 50mg/L kanamycin L, NaCl 5g/L, kanamycin 50mg/L, agar powder 15g/L) upper line, cultivate 2-3 days under 28 DEG C of dark conditions of temperature. Scraping the bacterial plaque on described solid YP culture plate, be further cultured for 1 day on new solid YP culture plate, scraping amounts to cultivates 3-4 days Bacterium colony, be suspended in 5mL liquid INF and infect culture medium (MS salt 4.3g/L, N6 vitamin, Dicamba 1.5mg/L, proline 0.5mg/L, sucrose 30g/L, inositol 0.1g/L, acetosyringone (AS) 50mg/L, pH5.4) in, Agrobacterium bacterium solution is mixed, Its concentration is adjusted to OD₆₆₀=0.5-0.6.

Agrobacterium infects Corn suspension cells group: above-mentioned pretreated described Corn suspension cells group be soaked in respectively 5-25min, preferably 25min in described Agrobacterium bacterium solution (20-30ml)；Infect Agrobacterium bacterium solution sucking-off after end, then will Described Corn suspension cells group is transferred on filter paper respectively, and air-dries 5-20min in superclean bench.

Agrobacterium co-cultures with Corn suspension cells group: shift infecting the described Corn suspension cells group after air-drying respectively To co-culturing culture medium (MS salt 4.3g/L, N6 vitamin, proline 0.5g/L, sucrose 30g/L, 2,4-D 2mg/L, acetyl fourth Ketone musk 50mg/L, sorbitol 36g/L, plant gel 3g/L, pH5.4) on, light culture at least 2 under the conditions of temperature 20-28 DEG C My god, preferably 5 days.

Obtained by above-mentioned steps and proceed to the Corn suspension cells system of DBN100677, proceed to the Semen Maydis suspension of DBN100678 carefully Born of the same parents are and proceed to the Corn suspension cells system of DBN100774.

Four, the functional verification of sgRNA mode chimeric with intron

Take the Corn suspension cells group proceeding to DBN100678 and the Corn suspension cells group work proceeding to DBN100677 respectively For (Jefferson R.A., Burgess S.M., Hirsh D.Beta-glucuronidase such as sample, reference Jefferson from Escherichia coliasa gene fusion marker.Proc.Natl.Acad.Sci.,1986,83:8447- 8454) method, seals dyeing two days by staining solution 37 DEG C, checks the expression way of GUS from histochemistry.Institute State being mainly composed of of staining solution: 0.1M NaPO4,0.01M EDTA (pH8.0), the 0.5mM potassium ferricyanide, 0.5mM ferrous iron cyanogen Changing potassium, the bromo-4-of 0.5mg/ml 5-chloro-3-indole-β-D-glucosiduronic acid (X-gluc), wherein X-gluc can be thin by transgenic In born of the same parents produce gus protein decomposition in situ and generate blue precipitate, such that it is able to location gus protein expression.Jade after dyeing Rice suspension cell is rolled into a ball and is checked under anatomic microscope and take a picture.Simultaneously using proceed to the Corn suspension cells of DBN100774 roll into a ball as Comparison, carries out detection according to the method described above and analyzes, and above experiment sets 3 repetitions.

The experimental result of the GUS dyeing of Corn suspension cells group is as shown in Figure 3.Test result indicate that proceeding to as comparison The Corn suspension cells group stained area of DBN100774 is maximum, shows that gus protein is expressed completely；The Semen Maydis proceeding to GUS-02 hangs Floating cell mass stained area is less, shows to be inserted into the chimeric mode within intron with sgRNA, has part gus protein permissible Express, reduced by only the intensity that gus protein is expressed, but have no effect on part of intron and shear；The Semen Maydis proceeding to GUS-03 suspends Cell mass does not develops the color, and shows, by the chimeric mode that intron sequences partial replacement is sgRNA, to have impact on cutting of intron Cut so that gus protein is not expressed.

Above-mentioned the selection result shows: sgRNA is inserted into the chimeric mode (GUS-02 nucleotide sequence) within intron no Affecting part of intron to shear, sgRNA can be transcribed, and can be expressed by II type promoters driven.

Second embodiment, the Activity determination of II type promoters driven CRISPR/Cas9 system

One, the vector construction of II type promoters driven CRISPR/Cas9 system

1, recombinant clone shears carrier is built

IGUS-02-Cas9 nucleotide sequence (as shown in SEQ ID NO:14 in sequence table, wherein Cas9 nucleotide sequence As shown in SEQ ID NO:15 in sequence table) synthesized by Nanjing Genscript Biotechnology Co., Ltd..IGUS-02-by synthesis Cas9 nucleotide sequence is connected on cloning vehicle pGEM-T (Promega, Madison, USA, CAT:A3600), and operating procedure is pressed Promega Products pGEM-T carrier description is carried out, and obtains recombinant clone shears carrier DBN04-T, and it builds flow process such as Shown in Fig. 4, (wherein, Amp represents ampicillin resistance gene；F1 represents the origin of replication of phage f1；LacZ is that LacZ rises Beginning codon；SP6 is SP6RNA polymerase promoter；T7 is t7 rna polymerase promoter；IGUS-02-Cas9 is chimeric sequences IGUS-02+Cas9 nucleotide sequence (SEQ ID NO:14；Cas9 aminoacid sequence is as shown in SEQ ID NO:16)；MCS is many Cloning site).

According to the method for 1 in first embodiment two, recombinant clone shears carrier DBN04-T heat shock method is converted large intestine Bacillus T1 competent cell, and positive colony is carried out sequence verification, result shows to insert in recombinant clone shears carrier DBN04-T The described iGUS-02-Cas9 nucleotides sequence entered is classified as the nucleotide sequence shown in SEQ ID NO:14, i.e. iGUS-in sequence table 02-Cas9 nucleotide sequence is correctly inserted into.

2, build without target spot recombinant expression carrier

GUUS expression cassette (pr35S-02+GUUS+ is introduced to according to expression vector DBN-PMI described in 2 in first embodiment two TNos), obtain expression vector DBN-PMI-GUUS, for following vector construction.

With restricted enzyme KpnI and SpeI enzyme action recombinant clone shears carrier DBN04-T and expression vector DBN-respectively PMI-GUUS, is inserted into the iGUS-02-Cas9 nucleotide sequence fragment cut in expression vector DBN-PMI-GUUS, and often utilizes The enzymatic cleavage methods carrier construction of rule is well-known to those skilled in the art, is built into recombinant expression carrier DBN100777, its structure Build flow process (Kan: kanamycin gene as shown in Figure 5；RB: right margin；Pr35S-01: cauliflower mosaic virus 35 S promoter (SEQ ID NO:9)；IGUS-02-Cas9: chimeric sequences iGUS-02+Cas9 nucleotide sequence (SEQ ID NO:14)；T35S: Cauliflower mosaic virus 35S terminator (SEQ ID NO:10)；Pr35S-02: cauliflower mosaic virus 35 S promoter (SEQ ID NO:17)；GUUS: the gus gene (as shown in SEQ ID NO:18) containing 45CS1 target sequence；TNos: rouge alkali synthetase The terminator (SEQ ID NO:13) of gene；PrUbi: maize ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:11)； PMI: Phophomannose isomerase gene (SEQ ID NO:12)；LB: left margin).

According to the method for 2 in first embodiment two, recombinant expression carrier DBN100777 heat shock method is converted large intestine bar Bacterium T1 competent cell, its plasmid of alkalinity extraction, the plasmid extracted is identified with after restricted enzyme KpnI and SpeI enzyme action, Positive colony is carried out sequence verification, and result shows the described iGUS-02-Cas9 inserted in recombinant expression carrier DBN100777 Nucleotides sequence is classified as the nucleotide sequence shown in SEQ ID NO:14 in sequence table, i.e. iGUS-02-Cas9 nucleotide sequence is correct Insert.

3, the design of primers of target spot and target spot vector construction

According to the principle of Cas9 albumen identification PAM sequence (NGG/NGGNG), CRISPRDirect website (http: // Crispr.dbcls.jp/) screen and derive from a target sequence (20bp) of Semen Maydis, i.e. 45CS1 target sequence, such as SEQ Shown in ID NO:19.

45CS1 forward primer:ggtctccaaacCCCAAGAGCGGGCGAGGTAG, such as SEQ ID NO:20 institute Show；

45CS1 reverse primer:ggtctcgaaaaCCTACCTCGCCCGCTCTTGGG, such as SEQ ID NO:21 institute Show；

Wherein, the bold case lower case letters that above-mentioned primer 5 ' is held is protection base, and italic lowercase is restriction enzyme site BsaI, Lower case with underscore is the sticky end of restriction enzyme site BsaI, normal font capitalization be 45CS1 target sequence or Its reverse complementary sequence.

Described 45CS1 forward primer and described 45CS1 reverse primer include 45CS1 target sequence respectively, the two reverse mutual Mending, template each other, carry out PCR amplification with Pfu enzyme (NEB), PCR system is as follows:

PCR reaction condition is: 98 DEG C of denaturations 30s, subsequently into following circulation: 98 DEG C of degeneration 10s, 56-60 DEG C of annealing 30s, 72 DEG C extend 30s/kb, 30-32 circulation altogether, and last 72 DEG C extend 5-10min；In 4 DEG C of preservations.

Used Column kit (purchased from Beijing Quanshijin Biotechnology Co., Ltd) that above-mentioned PCR primer is crossed post pure Changing, concrete grammar is with reference to its product description；BsaI enzyme action PCR primer and expression vector DBN100777, cut glue and reclaim corresponding enzyme After cutting product, by the expression vector DBN100777 product after enzyme action and PCR primer according to the ratio of 1:10 with T4 ligase in temperature Connecting 30min at spending 16 DEG C, it is well-known to those skilled in the art for utilizing conventional enzymatic cleavage methods carrier construction, is built into target Point carrier DBN100775, it builds flow chart (Kan: kanamycin gene as shown in Figure 6；RB: right margin；Pr35S-01: flower Cauliflower mosaic virus 35S promoter (SEQ ID NO:9)；45CS1:45CS1 target site sequence (SEQ ID NO:19)；45CS1+ IGUS-02-Cas9: comprise the chimeric sequences iGUS-02+Cas9 nucleotide sequence (SEQ ID NO:22) of 45CS1 target sequence； T35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:10)；Pr35S-02: cauliflower mosaic virus 35 S promoter (SEQ ID NO:17)；GUUS: the gus gene (as shown in SEQ ID NO:18) containing 45CS1 target sequence；TNos: kermes The terminator (SEQ ID NO:13) of alkali synthase gene；PrUbi: maize ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:11)；PMI: Phophomannose isomerase gene (SEQ ID NO:12)；LB: left margin).

According to the method for 2 in first embodiment two, recombinant expression carrier DBN100775 heat shock method is converted large intestine bar Bacterium T1 competent cell, its plasmid of alkalinity extraction, positive colony, after KpnI and AscI enzyme action is identified, is carried out by the plasmid of extraction Sequence verification, result shows that in target spot carrier DBN100775, GUS target site sequence is correctly inserted into.

4, recombinant expression carrier converts Agrobacterium

Oneself is constructed correct recombinant expression carrier DBN100777 and DBN100775 liquid nitrogen method is transformed into Agrobacterium In LBA4404 (Invitrgen, Chicago, USA, CAT:18313-015), its conversion condition is: 100 μ l Agrobacteriums LBA4404,3 μ l plasmid DNA (recombinant expression carrier)；It is placed in 10min in liquid nitrogen, 37 DEG C of tepidarium 10min；Agriculture after converting Bacillus LBA4404 is inoculated in LB test tube and cultivates 2 hours under the conditions of temperature 28 DEG C, rotating speed are 200rpm, is applied to containing 50mg/L Rifampicin and 100mg/L kanamycin LB flat board on until growing positive monoclonal, picking Colony Culture also extracts Its plasmid, carries out digestion verification with restricted enzyme to after recombinant expression carrier DBN100777 and DBN100775 enzyme action, knot Fruit shows that recombinant expression carrier DBN100777 and DBN100775 structure are the most correct.

Two, the acquisition of the Corn suspension cells system of instantaneous conversion

The acquisition of Corn suspension cells system and the genetic transformation such as first of agriculture bacillus mediated Corn suspension cells system are implemented Described in example three.It is derived from proceeding to the Corn suspension cells system of DBN100777, proceeding to the Corn suspension cells of DBN100775 System and proceed to the Corn suspension cells system of DBN100774.

Three, the Activity determination of II type promoters driven CRISPR/Cas9 system

According to the method described in first embodiment four, detection proceeds to the GUS of the Corn suspension cells system of DBN100775 and lives Property, simultaneously to proceed to the Corn suspension cells group of DBN100777 as negative control, suspend proceeding to the Semen Maydis of DBN100774 Cell mass, as positive control, carries out detection according to the method described above and analyzes, and above experiment sets 3 repetitions.

The experimental result of the GUS dyeing of Corn suspension cells group is as shown in Figure 7: the Semen Maydis proceeding to DBN100775 suspends thin Born of the same parents group's stained area is relatively big, and substantially suitable with positive control dye levels, negative control does not develops the color.Above-mentioned experiment Result shows: proceeds to Cas9 albumen in the Corn suspension cells group of DBN100775 and can normally be translated and sgRNA can be turned Record, both interact, and shear the 45CS1 target spot between GUUS so that GUUS reverts to gus protein, it is possible to be colored.

As can be seen here, it is inserted into the chimeric mode within intron when target spot and sgRNA use, and is operably coupled to Cas9 During albumen, under the driving of II type promoter, Cas9 albumen can normally be translated and sgRNA can be transcribed, and both are mutual Effect, shears target position, i.e. (target spot and sgRNA are inserted into inside intron Cas9/sgRNA under II type promoters driven Chimeric mode) system can normally exercise shearing and/or editting function.

Verify after 3rd embodiment, stable conversion that constitutive promoter drives the activity of CRISPR/Cas9 system

One, the selection of rice genome target spot

According to the principle of Cas9 albumen identification PAM sequence (NGG/NGGNG), CRISPR-Plant website (http: // Www.genome.arizona.edu/crispr/CRISPRsearch.html) screen and derive from 2 target spot sequences of Oryza sativa L. Row, specifying information is as follows:

Target spot 1 sequence: TTTACTGGGAGTTATGAAAC, as shown in SEQ ID NO:23；

Target spot 2 sequence: GGACGAGTCCAGATGCACCG, as shown in SEQ ID NO:24.

Two, constitutive promoter drives the vector construction of CRISPR/Cas9 system

1, build without target spot recombinant expression carrier

Cauliflower mosaic virus 35 S promoter and end is introduced to according to pDBN skeleton carrier described in 2 in first embodiment two Only son and Hpt expression cassette (prUbi+Hpt+tNos), obtain expression vector DBN-Hpt, for following vector construction.

With recombinant clone shears carrier described in 1 in restricted enzyme KpnI and SpeI respectively enzyme action the second embodiment one DBN04-T and expression vector DBN-Hpt, is inserted into expression vector DBN-by the iGUS-02-Cas9 nucleotide sequence fragment cut In Hpt, it is well-known to those skilled in the art for utilizing conventional enzymatic cleavage methods carrier construction, is built into recombinant expression carrier DBN100000, its carrier structure (Kan: kanamycin gene as shown in Figure 8；RB: right margin；Pr35S-01: Cauliflower Mosaic Virus 35S promoter (SEQ ID NO:9)；IGUS-02-Cas9: chimeric sequences iGUS-02+Cas9 nucleotide sequence (SEQ ID NO:14)；T35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:10)；PrUbi: maize ubiquitin (Ubiquitin) base Because of promoter (SEQ ID NO:11)；Hpt: hygromycin phosphotransferase gene (SEQ ID NO:25)；TNos: nopaline synthesizes The terminator (SEQ ID NO:13) of enzyme gene；LB: left margin).

According to the method for 2 in first embodiment two, recombinant expression carrier DBN100000 heat shock method is converted large intestine bar Bacterium T1 competent cell, its plasmid of alkalinity extraction, the plasmid extracted is identified with after restricted enzyme KpnI and AscI enzyme action, Positive colony is carried out sequence verification, and result shows the described iGUS-02-Cas9 inserted in recombinant expression carrier DBN100000 Nucleotides sequence is classified as the nucleotide sequence shown in SEQ ID NO:14 in sequence table, i.e. iGUS-02-Cas9 nucleotide sequence is correct Insert.

2, the design of primers of target spot and target spot vector construction

Select target spot 1 sequence, as shown in SEQ ID NO:23；Therefore target spot 1 forward primer: ggtctccaaacTTTACTGGGAGTTATGAAAC, as shown in SEQ ID NO:26；Target spot 1 reverse primer: ggtctcgaaaaCGTTTCATAACTCCCAGTAAA, as shown in SEQ ID NO:27；

Select target spot 2 sequence, as shown in SEQ ID NO:24；Therefore target spot 2 forward primer: ggtctccaaacGGACGAGTCCAGATGCACCG, as shown in SEQ ID NO:28；Target spot 2 reverse primer: ggtctcgaaaaCCGGTGCATCTGGACTCGTCC, as shown in SEQ ID NO:29；

Wherein, the bold case lower case letters that above-mentioned primer 5 ' is held is protection base, and italic lowercase is restriction enzyme site BsaI, Lower case with underscore is the sticky end of restriction enzyme site BsaI, and normal font capitalization is target sequence or it is reverse Complementary series.

According to the method for 3 in the second embodiment one, being built into target spot 1 carrier DBN-A, its carrier structure is as shown in Figure 9 (Kan: kanamycin gene；RB: right margin；Pr35S-01: cauliflower mosaic virus 35 S promoter (SEQ ID NO:9)；Target Point 1: target spot 1 sequence (SEQ ID NO:23)；Target spot 1+iGUS-02-Cas9: comprise chimeric sequences iGUS-02 of target spot 1 sequence + Cas9 nucleotide sequence (SEQ ID NO:30)；T35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:10)； PrUbi: maize ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:11)；Hpt: hygromycin phosphotransferase gene (SEQ ID NO:25)；The terminator (SEQ ID NO:13) of tNos: rouge alkali synthetase gene；LB: left margin).

According to the method for 3 in the second embodiment one, being built into target spot 2 carrier DBN-B, its carrier structure is as shown in Figure 10 (Kan: kanamycin gene；RB: right margin；Pr35S-01: cauliflower mosaic virus 35 S promoter (SEQ ID NO:9)；Target Point 2: target spot 2 sequence (SEQ ID NO:24)；Target spot 2+iGUS-02-Cas9: comprise chimeric sequences iGUS-02 of target spot 2 sequence + Cas9 nucleotide sequence (SEQ ID NO:31)；T35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:10)； PrUbi: maize ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:11)；Hpt: hygromycin phosphotransferase gene (SEQ ID NO:25)；The terminator (SEQ ID NO:13) of tNos: rouge alkali synthetase gene；LB: left margin).

According to the method for 2 in first embodiment two, target spot 1 carrier DBN-A and target spot 2 carrier DBN-B is used heat shock respectively Method convert escherichia coli T1 competent cell, its plasmid of alkalinity extraction, the plasmid of extraction through KpnI and AscI enzyme action identify after, Respectively positive colony being carried out sequence verification, result shows target spot 1 carrier DBN-A and target spot 2 carrier DBN-B point of impact on target 1 sequence All it is correctly inserted into target spot 2 sequence.

3, recombinant expression carrier converts Agrobacterium

Oneself is constructed correct target spot 1 carrier DBN-A and target spot 2 carrier DBN-B liquid nitrogen method is transformed into Agrobacterium In LBA4404 (Invitrgen, Chicago, USA, CAT:18313-015), its conversion condition is: 100 μ l Agrobacteriums LBA4404,3 μ l plasmid DNA (recombinant expression carrier)；It is placed in 10min in liquid nitrogen, 37 DEG C of tepidarium 10min；Agriculture after converting Bacillus LBA4404 is inoculated in LB test tube and cultivates 2 hours under the conditions of temperature 28 DEG C, rotating speed are 200rpm, is applied to containing 50mg/L Rifampicin and 100mg/L kanamycin LB flat board on until growing positive monoclonal, picking Colony Culture also extracts Its plasmid, carries out digestion verification, result with restricted enzyme to after target spot 1 carrier DBN-A and target spot 2 carrier DBN-B enzyme action Show that target spot 1 carrier DBN-A and target spot 2 carrier DBN-B structure are the most correct.

Three, the rice plant converted is obtained

For agriculture bacillus mediated rice conversion, briefly, (China accounts for rice material by Beijing rice varieties China to be accounted for seed Golden Nong Huazhong industry company limited provides) be seeded in inducing culture (N6 salt 3.1g/L, N6 vitamin, casein 300mg/L, Maltose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, plant gel 3g/L, pH5.8) on, lure from Mature Embryos of Rice Derive callus (step 1: wound healing induction step), afterwards, preferably callus, contact wound healing group with agrobacterium suspension Knitting, wherein described target spot 1 carrier DBN-A and described target spot 2 carrier DBN-B can be transferred on callus by Agrobacterium respectively At least one cell (step 2: infect step).In this step, callus preferably immerses agrobacterium suspension (OD₆₆₀ =0.3, infect culture medium (N6 salt 3.1g/L, N6 vitamin, casein 300mg/L, sucrose 30g/L, glucose 10g/L, acetyl Syringone (AS) 40mg/L, 2,4 dichlorophenoxyacetic acid (2,4-D) 2mg/L, pH5.4)) in start inoculation.Callus with Agrobacterium co-cultures one period (3 days) (step 3: co-culture step).Preferably, callus after infecting step at solid Culture medium (N6 salt 3.1g/L, N6 vitamin, casein 300mg/L, sucrose 30g/L, glucose 10g/L, acetosyringone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, plant gel 3g/L, pH5.8) upper cultivate.The stage is co-cultured at this After, there is " recovery " step.In " recovery " step, recovery media (N6 salt 3.1g/L, N6 vitamin, casein 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, plant gel 3g/L, pH5.8) at least exist It is a kind of that oneself knows the antibiotic (cephamycin 150-250mg/L) of suppression Agrobacterium growth, without the selective agent of vegetable transformant (step 4: recovering step).Preferably, callus does not has on the solid medium of selective agent to cultivate, to disappear there being antibiotic Convalescent period is provided except Agrobacterium and for infected cell.Then, the callus of inoculation is in the culture medium containing selective agent (hygromycin) The transformed calli (step 5: select step) that upper cultivation growth selection.Preferably, callus is having selective agent Screening solid medium (N6 salt 3.1g/L, N6 vitamin, casein 300mg/L, sucrose 5g/L, hygromycin 50mg/L, 2,4-bis- Chlorophenoxyacetic acid (2,4-D) 2mg/L, plant gel 3g/L, pH5.8) upper cultivation, cause the cell selective growth converted.So After, callus regeneration becomes plant (step 6: regeneration step), it is preferable that the wound healing group of growth in the culture medium containing selective agent It is woven in the upper cultivation of solid medium (N6 division culture medium and MS root media) with aftergrowth.

The resistant calli that screening obtains transfers to described N6 division culture medium (N6 salt 3.1g/L, N6 vitamin, cheese Element 300mg/L, sucrose 20g/L, hygromycin 50mg/L, 6-benzyl aminoadenine 2mg/L, naa 1mg/L, plant gel 3g/ L, pH5.8) on, cultivate differentiation at 25 DEG C.Differentiation seedling out transfers to described MS root media (MS salt 2.15g/L, MS Vitamin, casein 300mg/L, sucrose 15g/L, plant gel 3g/L, pH5.8) on, cultivate to about 10cm high at 25 DEG C, move To hot-house culture.In greenhouse, every day cultivates at 28 DEG C, it is thus achieved that the T of conversion₀Rice plant.

Four, after stable conversion, constitutive promoter drives the functional verification of CRISPR/Cas9 system

Sequencing result is as shown in table 1, it is thus achieved that target spot 1 mutant DBN-A Oryza sativa L. T₀Plant number is 25 strains, its mutation efficiency (mutation efficiency=correspondence mutant quantity/mutant T₀Plant sum × 100%) it is 35.2%；Obtain target spot 2 mutant DBN-B Oryza sativa L. T₀Plant number is 21 strains, and its mutation efficiency is 29.5%.

Table 1, constitutive promoter drive the reality of application on CRISPR/Cas9 system rice genome after stable conversion Test result

Carrier/project	Corresponding mutant number (strain)	Mutation efficiency (%)
			DBN-A (target spot 1)	25	16.2
DBN-B (target spot 2)	21	70
			Conventional CRISPR/Cas9 carrier (target spot 1)	32	19
Conventional CRISPR/Cas9 carrier (target spot 2)	25	81

Above-mentioned test result indicate that: target spot 1 carrier DBN-A described in stable conversion and the Oryza sativa L. of described target spot 2 carrier DBN-B In plant, sgRNA can be transcribed by constitutive promoter, and can exercise editting function to obtain sudden change with Cas9 protein binding Body, and mutation efficiency is suitable with conventional CRISPR/Cas9 carrier system.

As can be seen here, in the transformant after stable conversion, when target spot and sgRNA use be inserted within intron embedding Conjunction mode, and when being operably coupled to Cas9 albumen, under the driving of II type constitutive promoter, Cas9 albumen can normally be turned over Translating and sgRNA can be transcribed, both interact, and shear target position, i.e. Cas9/ under the driving of II type constitutive promoter SgRNA (target spot and sgRNA are inserted into the chimeric mode within intron) system can normally exercise shearing and/or editor's merit Can, and mutation efficiency is suitable with conventional CRISPR/Cas9 carrier system.

Verify after 4th embodiment, stable conversion that specificity promoter drives the activity of CRISPR/Cas9 system

One, the selection of Maize genome target spot

According to the principle of Cas9 albumen identification PAM sequence (NGG/NGGNG), CRISPR-Plant website (http: // Www.genome.arizona.edu/crispr/CRISPRsearch.html) 2 derived from one gene of Semen Maydis are screened Individual target sequence, specifying information is as follows:

Target spot 3:ATCATACCTGAGCAGCCTCC, as shown in SEQ ID NO:32；

Target spot 4:CGAACGACCTCGATGTGCAC, as shown in SEQ ID NO:33.

Two, specificity promoter drives the vector construction of CRISPR/Cas9 system

1, build without target spot recombinant expression carrier

The cauliflower mosaic virus promoter pr35S-01 of DBN100777 described in 2 in second embodiment one is replaced by flower Powder specific expression promoter prAmy, is built into recombinant expression carrier DBN100778, its carrier structure (Kan: card as shown in figure 11 That mould plain gene；RB: right margin；PrAmy: Semen Maydis alpha amylase gene promoter (SEQ ID NO:34)；IGUS-02-Cas9: Chimeric sequences iGUS-02+Cas9 nucleotide sequence (SEQ ID NO:14)；T35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:10)；Pr35S-02: cauliflower mosaic virus 35 S promoter (SEQ ID NO:17)；GUUS: containing 45CS1 target spot sequence The gus gene (as shown in SEQ ID NO:18) of row；The terminator (SEQ ID NO:13) of tNos: rouge alkali synthetase gene； PrUbi: maize ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:11)；PMI: Phophomannose isomerase gene (SEQ ID NO:12)；LB: left margin).

According to the method for 2 in first embodiment two, recombinant expression carrier DBN100778 heat shock method is converted large intestine bar Bacterium T1 competent cell, its plasmid of alkalinity extraction, reflects the plasmid extracted with after restricted enzyme BamHI and KpnI enzyme action Fixed, positive colony is carried out sequence verification, it is correct that result shows that recombinant expression carrier DBN100778 builds.

2, the design of primers of target spot and target spot vector construction

Select target spot 3 sequence, as shown in SEQ ID NO:32；Therefore target spot 3 forward primer: ggtctccaaacATCATACCTGAGCAGCCTCC, as shown in SEQ ID NO:35；Target spot 3 reverse primer: ggtctcgaaaaCGGAGGCTGCTCAGGTATGAT, as shown in SEQ ID NO:36；

Select target spot 4 sequence, as shown in SEQ ID NO:33；Therefore target spot 4 forward primer: ggtctccaaacCGAACGACCTCGATGTGCAC, as shown in SEQ ID NO:37；Target spot 4 reverse primer: ggtctccaaaaCGTGCACATCGAGGTCGTTCG, as shown in SEQ ID NO:38；

Wherein, the bold case lower case letters that above-mentioned primer 5 ' is held is protection base, and italic lowercase is restriction enzyme site BsaI, Lower case with underscore is the sticky end of restriction enzyme site BsaI, and normal font lower case is target sequence or it is reverse Complementary series.

According to the method for 3 in the second embodiment one, being built into target spot 3 carrier DBN-C, its carrier structure is as shown in figure 12 (Kan: kanamycin gene；RB: right margin；PrAmy: Semen Maydis alpha amylase gene promoter (SEQ ID NO:34)；Target spot 3: Target spot 3 sequence (SEQ ID NO:32)；Target spot 3+iGUS-02-Cas9: comprise chimeric sequences iGUS-02+ of target spot 3 sequence Cas9 nucleotide sequence (SEQ ID NO:39)；T35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:10)； Pr35S-02: cauliflower mosaic virus 35 S promoter (SEQ ID NO:17)；GUUS: the GUS base containing 45CS1 target sequence Because of (as shown in SEQ ID NO:18)；The terminator (SEQ ID NO:13) of tNos: rouge alkali synthetase gene；PrUbi: Semen Maydis Ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:11)；PMI: Phophomannose isomerase gene (SEQ ID NO: 12)；LB: left margin)

According to the method for 3 in the second embodiment one, being built into target spot 4 carrier DBN-D, its carrier structure is as shown in figure 13 (Kan: kanamycin gene；RB: right margin；PrAmy: Semen Maydis alpha amylase gene promoter (SEQ ID NO:34)；Target spot 4: Target spot 4 sequence (SEQ ID NO:33)；Target spot 4+iGUS-02-Cas9: comprise chimeric sequences iGUS-02+ of target spot 4 sequence Cas9 nucleotide sequence (SEQ ID NO:40)；T35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:10)； Pr35S-02: cauliflower mosaic virus 35 S promoter (SEQ ID NO:17)；GUUS: containing the GUS of 45CS1 target site sequence Gene (as shown in SEQ ID NO:18)；The terminator (SEQ ID NO:13) of tNos: rouge alkali synthetase gene；PrUbi: beautiful Rice ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:11)；PMI: Phophomannose isomerase gene (SEQ ID NO: 12)；LB: left margin)

According to the method for 2 in first embodiment two, target spot 3 carrier DBN-C and target spot 4 carrier DBN-D is used heat shock respectively Method converts escherichia coli T1 competent cell, its plasmid of alkalinity extraction, and the plasmid of extraction is identified through BamHI and KpnI enzyme action After, respectively positive colony being carried out sequence verification, result shows target spot 3 carrier DBN-C and target spot 4 carrier DBN-D point of impact on target 3 sequence Row and target spot 4 sequence are all correctly inserted into.

3, recombinant expression carrier converts Agrobacterium

Oneself is constructed correct target spot 3 carrier DBN-C and target spot 4 carrier DBN-D liquid nitrogen method is transformed into Agrobacterium In LBA4404 (Invitrgen, Chicago, USA, CAT:18313-015), its conversion condition is: 100 μ l Agrobacteriums LBA4404,3 μ l plasmid DNA (recombinant expression carrier)；It is placed in 10min in liquid nitrogen, 37 DEG C of tepidarium 10min；Agriculture after converting Bacillus LBA4404 is inoculated in LB test tube and cultivates 2 hours under the conditions of temperature 28 DEG C, rotating speed are 200rpm, is applied to containing 50mg/L Rifampicin and 100mg/L kanamycin LB flat board on until growing positive monoclonal, picking Colony Culture also extracts Its plasmid, carries out digestion verification, result with restricted enzyme to after target spot 3 carrier DBN-C and target spot 4 carrier DBN-D enzyme action Show that target spot 3 carrier DBN-C and target spot 4 carrier DBN-D structure are the most correct.

Three, obtain the milpa converted and can use following method？

The Agrobacterium infestation method used according to routine, combines the rataria and the 4th of 31 (Z31) by the corn variety of aseptic culture The Agrobacterium that in embodiment two, recombinant expression carrier described in 3 converts co-cultures, with build in the 4th embodiment two 1 and 2 T-DNA in recombinant expression carrier DBN100778, DBN-C and DBN-D is transferred in maize chromosome group, it is thus achieved that proceed to The milpa of DBN100778, proceed to the milpa of DBN-C and proceed to the milpa of DBN-D.

For agriculture bacillus mediated corn transformation, briefly, from Semen Maydis, separate immature rataria, suspend with Agrobacterium Liquid contact rataria, wherein Agrobacterium can be by can be by the T-DNA in recombinant expression carrier DBN100778, DBN-C and DBN-D Being transferred at least one cell (step 1: infect step) of one of rataria, in this step, rataria preferably immerses Agrobacterium Suspension (OD₆₆₀=0.4-0.6, infects culture medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 68.5g/ L, glucose 36g/L, acetosyringone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH5.3)) in open Dynamic inoculation.Rataria and Agrobacterium co-culture one period (3 days) (step 2: co-culture step).Preferably, rataria is infecting step At solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 20g/L, glucose 10g/L, acetyl after Zhou Syringone (AS) 100mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivate.Training altogether at this After the stage of supporting, can there is selective " recovery " step.In " recovery " step, recovery media (MS salt 4.3g/L, MS Vitamin, casein 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) in At least exist a kind of oneself know suppression Agrobacterium growth antibiotic (cephamycin), without vegetable transformant selective agent (step Rapid 3: recovering step).Preferably, rataria does not has on the solid medium of selective agent to cultivate, to eliminate agriculture bar there being antibiotic Bacterium also provides convalescent period for infected cell.Then, the rataria of inoculation is cultivated in the culture medium containing selective agent (mannose) and selects Select the transformed calli (step 4: select step) grown.Preferably, rataria is having the screening solid medium of selective agent (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 5g/L, mannose 12.5g/L, 2,4 dichlorophenoxyacetic acid (2, 4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation, cause the cell selective growth converted.Then, callus regeneration becomes Plant (step 5: regeneration step), it is preferable that the callus of growth is at solid medium (MS in the culture medium containing selective agent Division culture medium and MS root media) above cultivate with aftergrowth.

The resistant calli that screening obtains transfers to described MS division culture medium (MS salt 4.3g/L, MS vitamin, cheese Element 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, mannose 5g/L, agar 8g/L, pH5.8) on, cultivate at 25 DEG C Differentiation.Differentiation seedling out transfer to described MS root media (MS salt 2.15g/L, MS vitamin, casein 300mg/L, Sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH5.8) on, cultivate to about 10cm high at 25 DEG C, move to greenhouse training Support to solid.In greenhouse, every day cultivates 16 hours at 28 DEG C, cultivates 8 hours at 20 DEG C.

Four, after stable conversion, specificity promoter drives the functional verification of CRISPR/Cas9 system

Obtained 19 strains by said method respectively and proceed to the T of DBN-C₀Milpa and 21 strains proceed to the T of DBN-D₀ Milpa.T is cultivated in greenhouse₀Plant, gathers in the crops the T of each strain respectively₁Seed.

19 strains are proceeded to the T of DBN-C₀Milpa and 21 strains proceed to the T of DBN-D₀The T of milpa₁Seed (each strain sowing 20 seeds) carries out little basin plantation in greenhouse, after planting 10 days, it is thus achieved that 19 strains proceed to DBN-C's T₁Milpa and 21 strains proceed to the T of DBN-D₁Milpa, extracts T respectively₁The leaf DNA of milpa by surveying Sequence carries out the detection of mutation efficiency.

Sequencing result is as shown in table 2, and 3 strains proceed to the T of DBN-C₀Milpa there occurs sudden change, its mutation efficiency (the T proceeding to DBN-C of mutation efficiency=correspondence sudden change₀The T of the strain number of milpa/proceed to DBN-C₀The strain of milpa Sum × 100%) it is 21%；2 strains proceed to the T of DBN-D₀Milpa there occurs sudden change, and its mutation efficiency is 9.5%.

Table 2, specificity promoter drive the reality of application on CRISPR/Cas9 system Maize genome after stable conversion Test result

Carrier/project	Corresponding mutant number (strain)	Sum (strain)	Mutation efficiency (%)
				DBN-C (target spot 3)	4	19	21
DBN-D (target spot 4)	2	21	9.5

Above-mentioned test result indicate that: target spot 3 carrier DBN-C described in stable conversion and the Semen Maydis of described target spot 4 carrier DBN-D In plant, sgRNA can be transcribed by specificity promoter, and can exercise editting function to obtain sudden change with Cas9 protein binding Body.

As can be seen here, in the transformant after stable conversion, when target spot and sgRNA use be inserted within intron embedding Conjunction mode, and when being operably coupled to Cas9 albumen, under the driving of II type specificity promoter, Cas9 albumen can normally be turned over Translating and sgRNA can be transcribed, both interact, and shear target position, i.e. Cas9/ under II type specificity promoters driven SgRNA (target spot and sgRNA are inserted into the chimeric mode within intron) system can normally exercise shearing and/or editor's merit Energy.

In sum, target spot and sgRNA Yu Cas9 protein integration in an expression cassette, and are used II type to open by the present invention Mover drives expresses, and has not only widened sgRNA available promoter scope, has been advantageously implemented the gene editing of specific tissue, Eliminate the restriction for target spot the first bit base simultaneously, expand the target spot range of choice, and vector construction mistake can be reduced The quantity of expression cassette, simplification carrier in journey, moreover it is possible to avoid owing to multiple expression cassettes use identical promoter to occur restructuring to lead The problem causing the loss of subelement；The editor obtained by the gene editing system of the II type promoters driven effect that the present invention provides Rate is suitable with conventional system, and may be directly applied in actual production.

It should be noted last that, above example is only in order to illustrate technical scheme and unrestricted, although ginseng According to preferred embodiment, the present invention is described in detail, it will be understood by those within the art that, can be to the present invention Technical scheme modify or equivalent, without deviating from the spirit and scope of technical solution of the present invention.

Claims (28)

1. a chimeric sequences, it is characterised in that comprising sgRNA sequence and can shear sequence, described sgRNA sequence is inserted and interleave The inside of sequence.

Chimeric sequences the most according to claim 1, it is characterised in that described sgRNA sequence is inserted inside described intervening sequence Both sides, position the most at least retain the described intervening sequence of a length of 12bp.

Chimeric sequences the most according to claim 1 or claim 2, it is characterised in that described chimeric sequences also includes target sequence.

4. according to chimeric sequences described in any one of claim 1-3, it is characterised in that described intervening sequence is intron sequences.

5. a genome editing system, it is characterised in that it is characterized in that, including a) and b):

A) chimeric sequences described in any one of claim 1-4；

B) Cas9 albumen.

Genome editing system the most according to claim 5, it is characterised in that described chimeric sequences and the described Cas9 egg of coding White nucleotide sequence effectively connects.

7. according to genome editing system described in claim 5 or 6, it is characterised in that described chimeric sequences is operably coupled to adjust Control sequence.

Genome editing system the most according to claim 7, it is characterised in that described regulating and controlling sequence includes II type promoter And/or localization domain.

Genome editing system the most according to claim 8, it is characterised in that described II type promoter includes that composing type starts Son, tissue-specific promoter and inducible promoter.

Genome editing system the most according to claim 9, it is characterised in that described constitutive promoter includes Brassica oleracea L. var. botrytis L. Mosaic virus 35 S promoter or ubiquitin promoter.

11. genome editing systems according to claim 9, it is characterised in that described tissue-specific promoter includes flower Powder specific expressing promoter, root-specific express promoter, chlorenchyma specific expressing promoter or endosperm specificity table Reach promoter.

12. genome editing systems according to claim 9, it is characterised in that described inducible promoter includes that chemistry lures Conductivity type promoter, cold-induced type promoter, Heat-inducible promoter or virus induction type promoter.

13. 1 kinds by the genome editing system of II type promoters driven, it is characterised in that include a), b) and c):

A) II type promoter；

B) chimeric sequences described in any one of claim 1-4；

C) Cas9 albumen.

14. according to genome editing system described in claim 13, it is characterised in that described chimeric sequences and the described Cas9 of coding The nucleotide sequence of albumen effectively connects.

15. according to genome editing system described in claim 13 or 14, it is characterised in that described chimeric sequences is operably coupled to Described II type promoter.

16. according to genome editing system described in any one of claim 13-15, it is characterised in that described II type starts attached bag Include constitutive promoter, tissue-specific promoter and inducible promoter.

17. according to genome editing system described in claim 16, it is characterised in that described constitutive promoter includes Brassica oleracea L. var. botrytis L. Mosaic virus 35 S promoter or ubiquitin promoter.

18. according to genome editing system described in claim 16, it is characterised in that described tissue-specific promoter includes flower Powder specific expressing promoter, root-specific express promoter, chlorenchyma specific expressing promoter or endosperm specificity table Reach promoter.

19. according to genome editing system described in claim 16, it is characterised in that described inducible promoter includes that chemistry lures Conductivity type promoter, cold-induced type promoter, Heat-inducible promoter or virus induction type promoter.

20. 1 kinds of expression cassettes, it is characterised in that comprise the core of genome editing system described in coding any one of claim 5-12 By the nucleic acid sequence of the genome editing system of II type promoters driven described in acid sequence or coding any one of claim 13-19 Row.

21. 1 kinds of recombinant expression carriers, it is characterised in that comprise genome editor system described in coding any one of claim 5-12 System nucleotide sequence or or coding any one of claim 13-19 described in by the genome editing system of II type promoters driven Expression cassette described in nucleotide sequence or claim 20.

22. 1 kinds of methods realizing genome editor, it is characterised in that be included in organism expression claim 5-12 arbitrary Described in the described genome editing system of item or any one of claim 13-19 by the genome editor of II type promoters driven it is System.

23. 1 kinds of methods editing target site sequence, it is characterised in that include genome described in any one of claim 5-12 Editing system imports in the organism comprising target site sequence.

The method of 24. 1 kinds of plants producing genome editor, it is characterised in that include introducing coding power in Plant Genome Profit requires the nucleotide sequence of genome editing system described in any one of 5-12 or encodes described in any one of claim 13-19 by II The nucleotide sequence of the genome editing system of type promoters driven.

25. 1 kinds of methods producing genome editor's plant seed, it is characterised in that include producing method described in claim 24 The plant selfing of raw genome editor, thus obtain and there is genome editor's plant seed.

26. 1 kinds of methods cultivating genome editor plant, it is characterised in that including:

Plant described genome editor's plant seed that method described at least one claim 25 produces；Described seed is made to grow up to Plant.

By II described in genome editing system described in 27. 1 kinds of any one of claim 5-12 or any one of claim 13-19 The genome editing system of type promoters driven purposes in obtaining genome mutation biology.

28. 1 kinds of test kits, it is characterised in that include that genome editing system described in any one of claim 5-12 or right are wanted Seek the genome editing system by II type promoters driven described in any one of 13-19, be used for realizing genome editor.