CN109321548B

CN109321548B - Cas9 protein, CRISPR/Cas9 system, mushroom gene editing method and application

Info

Publication number: CN109321548B
Application number: CN201811256669.1A
Authority: CN
Inventors: 陆玲; 岳尚; 魏华; 王亭立
Original assignee: Nanjing Normal University
Current assignee: Nanjing Normal University
Priority date: 2018-10-26
Filing date: 2018-10-26
Publication date: 2021-02-09
Anticipated expiration: 2038-10-26
Also published as: CN109321548A

Abstract

The invention discloses a Cas9 protein, a CRISPR/Cas9 system, a mushroom gene editing method and application. The invention optimizes the codon of the human Cas9 protein according to the preference of the pleurotus eryngii genome codon use to obtain a nucleotide sequence for encoding Cas9, screens 4 promoters which are used for transcribing sgRNA and can highly express U6snRNA genes, and establishes a genetic transformation system which takes resistance change caused by endogenous gene mutation as a selection marker. Experimental results show that the system established by the invention can successfully and efficiently carry out editing such as deletion, insertion, knockout and the like on the pleurotus eryngii gene pyrG. The gene editing technology can be applied and popularized to other mushroom varieties except pleurotus eryngii, and is applied to mushroom variety improvement and metabolic pathway regulation.

Description

Cas9 protein, CRISPR/Cas9 system, mushroom gene editing method and application

Technical Field

The invention relates to a gene editing technology, in particular to a Cas9 protein, a CRISPR/Cas9 system, a mushroom gene editing method and application in the gene editing technology.

Background

Edible fungi are a general term for higher fungi and the like having large-sized fleshy fruit bodies or sclerotium tissues, which are edible. The edible fungi have huge biological activity, can produce various secondary metabolites, and particularly find new active substances with great potential in the aspect of pharmaceutical research. In addition, compared with chemical drugs, the natural product extracted from the edible fungi has the characteristics of low toxicity and low side effect, so the edible fungi is a potential natural drug resource. Pleurotus eryngii (Pleurotus eryngii) belongs to the Basidiomycotina, Hymenomycetes, Basidiomycotina, Agaricales, Pleurotaceae, Pleurotus, and has high medicinal value. With the continuous and deep research of basic theory and application technology, it is very urgent to develop a set of efficient gene editing technology in Pleurotus eryngii.

With the improvement of the living standard of human beings, the demand of the edible fungi which has natural medicine and health care efficacy is huge. The development of a new technology for genetic modification of pleurotus eryngii has important significance for revealing the genetic improvement of important medicinal action mechanism and characters of the pleurotus eryngii. The gene editing technology realizes the accurate, site-specific and genetic modification of genes in situ of a genome, and is an ideal way for genetic improvement and molecular design of pleurotus eryngii.

As a new third-generation artificial nuclease technology, the RNA-mediated CRISPR-Cas9 system becomes a popular technology researched at home and abroad at present by virtue of the advantages that the system is simple and convenient to construct, the targeting accuracy is high, the construction cost is low, and the multiple designed sites can be edited at fixed points, and the technology is successfully applied to plants, bacteria, yeasts, fishes and mammalian cells. The research explores a technology for performing site-specific editing on pleurotus eryngii genomes by using a CRISPR-Cas9 system, and builds a technical platform for efficient site-specific editing of pleurotus eryngii and other mushroom genomes.

Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) are an acquired system of self-immune defense formed by bacteria and archaea in the course of evolution. The CRISPR-Cas9 system is characterized in that an invasion sequence is selected as a new spacer sequence to be inserted into a gene locus of CRISPR-Cas9, the spacer sequence has a prototypical spacer-associated motif (PAM), CRISPR RNA (CRISPR-derived RNA, crRNA) and trans-acting RNA (trans-activating RNA, tracrRNA) are used for specifically recognizing a target sequence, and Cas9 protein is used for shearing at 3-4bp upstream of the PAM sequence to form a flat end, so that Non-homologous end repair (Non-homologous end join, NHEJ) and homologous-mediated end repair (HR) occur.

The technical problems currently existing include the following two points: (1) in the absence of an effective screening marker, a commonly used exogenous hygromycin resistance gene (hph) cannot be stably integrated into the genome of pleurotus eryngii, and a hph fragment of a transformant is lost after passage, so that the transformant after gene editing cannot be obtained. (2) Pleurotus eryngii is a diploid basidiomycete, and homozygotes cannot be obtained by gene knockout by using a traditional homologous recombination method, so that the prior art brings great difficulty to gene knockout. (3) At present, no established gene site-directed editing technology of pleurotus eryngii exists at home and abroad.

Disclosure of Invention

The purpose of the invention is as follows: the invention provides a Cas9 protein, and the Cas9 protein can be used in a CRISPR/Cas9 system. The invention also provides a CRISPR/Cas9 system composed of the Cas9 protein for editing a target genome. The invention also provides a method for editing the mushroom gene and a mushroom cell strain capable of editing the gene, wherein the cell strain is an pleurotus eryngii uracil auxotrophic strain losing the function of the orotidine-5' -phosphate decarboxylase.

The technical scheme is as follows: in order to overcome the defects of the prior art, the invention provides a Cas9 protein suitable for a CRISPR/Cas9 system in a first aspect, and the coding sequence of the Cas9 protein is shown as SEQ ID NO. 3. The Cas9 protein used in the invention is a human Cas9 protein with codon degeneracy characteristics optimized according to the codon preference of mushroom genome.

The second aspect of the invention provides a polynucleotide encoding the above Cas9 protein, the sequence of which is shown in SEQ ID No. 3.

In a third aspect, the invention provides an expression vector comprising a polynucleotide encoding a Cas9 protein.

The fourth aspect of the invention provides an editing tool of a DNA genome fragment, which is a CRISPR/Cas9 system, wherein the CRISPR/Cas9 system comprises the above Cas9 protein, a polynucleotide encoding the Cas9 protein, and an expression vector containing the polynucleotide of the Cas9 protein; to achieve editing of the DNA genome fragment, the CRISPR/Cas9 system further comprises one or more sgrnas for the DNA fragment of interest.

The fifth aspect of the invention provides a CRISPR/Cas9 vector for mushroom gene editing, wherein the CRISPR/Cas9 vector is a recombinant vector for mushroom gene editing obtained by loading a Cas9 protein, a U6 promoter and a nucleotide sequence of sgRNA on a plasmid; the nucleotide sequence of the U6 promoter is selected from SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 or SEQ ID NO. 7.

In order to improve the transcription efficiency and the identification of the target cell strain after gene editing, the recombinant vector also comprises a GFP nucleotide sequence and nucleotide sequences of left and right homologous arms of the target gene.

The sixth aspect of the invention provides a U6 promoter applying CRISPR/Cas9 vector, and the nucleotide sequence of the U6 promoter is selected from SEQ ID No.4, SEQ ID No.5, SEQ ID No.6 or SEQ ID No. 7. The invention identifies 4 pleurotus eryngii U6snRNA promoters for transcribing sgRNA, and can efficiently start the transcription of the sgRNA.

The seventh aspect of the invention provides an editing method of a mushroom cell strain genome fragment, which is to transfect a mushroom cell strain with the CRISPR/Cas9 vector and edit a target gene of the mushroom cell strain.

In order to improve the editing success rate of the genome segment of the mushroom cell line and the universality of the gene editing tool, resistance screening is carried out on a target cell line, wherein the mushroom cell line is Cbx^RResistant cell lines.

The Cbx^RThe resistant cell strain is obtained by carrying out site-directed mutagenesis on the 240 th bit group of amino acid in the sdhB gene sequence of the coding succinate dehydrogenase-iron-sulfur protein subunit, and the mutated sdhB gene sequence is shown as SEQ ID NO. 2.

The eighth aspect of the invention provides a mushroom cell line for gene editing, wherein the mushroom cell line is Cbx^RIn the resistant cell strain, the sdhB gene of a wild-type succinate dehydrogenase-iron-sulfur protein subunit is shown in SEQ ID No.1, the amino acid in the 240 th bit group coded in the sdhB gene sequence of the succinate dehydrogenase-iron-sulfur protein subunit is subjected to site-specific mutation (His to Leu, CAC to CTC), and the mutated sdhB gene sequence is shown in SEQ ID No. 2.

The genome editing tool of the present invention edits the pyrG gene of Pleurotus eryngii.

Screening a DNA sequence which is complementary with a specific DNA sequence base on an exon at the N end of the pyrG gene, wherein the DNA sequence is characterized by conforming to the arrangement sequence of 5' -GGN (17) GG, 5' -GGN (17) CGG or 5' -G (17) GGNGG and serving as sgRNA of a target gene, the pyrG-sgRNA target sequence is positioned on the exon, the sequence is unique, and the nucleotide sequence is shown as SEQ ID NO. 8.

The recombinant plasmid is prepared by utilizing the sgRNA, and is obtained by the following method: cas9 protein (shown in SEQ ID NO.3 in sequence), U6 promoter (with a nucleotide sequence selected from SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 or SEQ ID NO.7), sgRNA, pyrG Donor DNA (GFP fragment), and pyrG homologous arm sequence are loaded into the plasmid

-Blunt Zero Cloning Kit plasmid to obtain recombinant plasmid, transfecting Pleurotus eryngii cell strain with the recombinant plasmid, and editing pyrG gene of Pleurotus eryngii cell strain

The pleurotus eryngii cell strain is treated as follows: collecting Pleurotus eryngii mycelium, and sterilizing with ddH₂And washing twice. Preparing a lywallzyme enzymolysis liquid for hydrolyzing the cell wall of the pleurotus eryngii, and carrying out enzymolysis on pleurotus eryngii hyphae to obtain protoplasts of the pleurotus eryngii for transfection.

Further, the gene sequence of the coding gene of the pleurotus eryngii succinate dehydrogenase-iron-sulfur protein subunit is obtained by cloning, and the site-specific mutation is carried out on the 240 th group amino acid of the coding region of the succinate dehydrogenase-iron-sulfur protein subunit and is connected with

Obtaining a recombinant plasmid from a Blunt Zero Cloning Kit plasmid, transfecting an Pleurotus eryngii strain to obtain Cbx^RResistant strains, in the use of Cbx^RThe resistant Pleurotus eryngii cell line was subjected to pyrG gene editing.

Has the advantages that: (1) the invention provides an optimized Cas9 protein, which has the codon preference of pleurotus eryngii genome and is used for genome editing of mushroom cell strains; (2) the invention provides 4U 6 promoters for transcribing sgRNA, which can efficiently start the transcription of the sgRNA; (3) the invention provides a system for completing screening by using resistance change caused by endogenous gene mutation as a selective marker of pleurotus eryngii, which overcomes the defect that a common exogenous hygromycin resistance gene (hph) cannot be stably integrated into a pleurotus eryngii genome so as to cause that a transformant with edited genes cannot be stably obtained; (4) the invention provides an sgRNA capable of specifically positioning pyrG gene and targeted knockout of pyrG gene.

Drawings

FIG. 1 is a schematic diagram of sequencing by site-directed mutagenesis of the succinate dehydrogenase-iron-sulfur protein subunit (SdhB) of Pleurotus eryngii according to the present invention;

FIG. 2 shows the Cbx of the present invention^RThe result shows that the gene coding the iron-sulfur protein subunit (SdhB) can grow on a culture medium containing the carboxin bacteriostatic agent after site-directed mutation;

FIG. 3 is a structural diagram of a fragment of the sgRNA transcribed by the U6 promoter according to the present invention;

FIG. 4 is a recombinant plasmid map of sgRNA for knocking out Pleurotus eryngii pyrG gene, optimized Cas9 protein encoding gene and exogenous GFP fragment to be inserted, constructed in the present invention;

FIG. 5 is a schematic diagram of a successful disruption of the function of the pyrG gene of Pleurotus eryngii according to the present invention, showing that the transformants were unable to grow on Minimal Medium (MM), indicating a loss of function of the pyrG gene; whereas WT and pyrG transformants grew normally in medium supplemented with UU (pyrimidine nucleotides).

Detailed Description

Example 1: construction of Pleurotus eryngii genetic system using resistance change caused by endogenous gene mutation as selection marker

1.1 cloning Gene sequence (including promoter and terminator) coding Pleurotus eryngii succinate dehydrogenase-iron-sulfur protein subunit (SdhB) into plasmid (3015 bp)

-Blunt Zero Cloning Kit) as shown in SEQ ID NO. 1.

1.2 designing a pair of reverse complementary primers containing mutation sites, wherein the primer sequences are as follows, and Mutant-F and Mutant-R represent a forward primer and a reverse primer respectively:

Mutant-F：GTTCCGCTGCCTCACCATCT

Mutant-R：AGATGGTGAGGCAGCGGAAC

1.3PCR system: 25 mul of high fidelity enzyme; 2. mu.l of each primer; 18 mul of water; plasmid template 3. mu.l.

1.4PCR reaction conditions are pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 15 s; annealing at 56 ℃ for 15 s; extending for 72 ℃ for 2 min; a total of 32 cycles; finally, the extension is carried out for 5 min.

1.5 after PCR reaction, 10. mu.l of PCR reaction solution was taken; 1 μ l of DpnI; 2. mu.l of 10xT Buffer; and 7. mu.l of water. The enzyme was inactivated by reaction at 37 ℃ for 1 hour in 20. mu.l of the reaction solution, followed by heat treatment at 70 ℃ for 15 min.

1.6 directly transforming the reaction solution in the previous step into escherichia coli competent cells, and coating the plate overnight; selecting a single colony with correct recombination, shaking the colony for 12-15h, extracting a plasmid, and sequencing to obtain Cbx^RResistant plasmids

Blunt-Zero-sdhB, sequencing results in SEQ ID No. 2.

1.7 sequencing and results prove that point mutation does occur at the histidine conserved site at position 240 of the iron-sulfur protein subunit (SdhB), the codon CAC is mutated into CTC, and a site-directed mutagenesis scheme of the pleurotus eryngii succinate dehydrogenase-iron-sulfur protein subunit (SdhB) is shown in a figure 1.

1.8 will express

Plasmid of-Blunt-Zero-sdhB was transfected by the PEG-mediated transfection of protoplasts and transformants were selected using a bacteriostatic carboxin.

1.9 selection of transformants, DNA extraction, sequencing and transfection

Successful transformant strains of the-Blunt-Zero-sdhB plasmid could indeed grow on resistant carboxin plates, as shown in FIG. 2, and were sequenced correctly. The established pleurotus eryngii endogenous transformation system is proved to be an important screening marker for pleurotus eryngii gene editing.

1.10 the endogenous transformation system constructed by the characteristic that the methionine point mutation of iron-sulfur protein subunit (SdhB)240 bit generates resistance to the carboxin is crucial to the later editing of Pleurotus eryngii related genes, and can be used as the basis for editing the Pleurotus eryngii related genes.

Example 2: construction of plasmid for transcribing sgRNA and expressing Cas9 protein

2.1 optimization of codon preference of human Cas9 protein

The preference of 64 codons for coding corresponding amino acids is analyzed according to the coding sequence of the pleurotus eryngii genome, the codons are rearranged on the human-derived Cas9 protein, and finally the sequence information of the Cas9 protein which can be stably expressed in pleurotus eryngii is optimized, and is shown in SEQ ID No. 3.

2.2 cloning of the Pgpd promoter, a high expression promoter of Pleurotus eryngii

The primers are as follows:

Pgpd-R:AGTCACAAGGGATGGGTGGT

Pgpd-F：GCGAACACTCAAAGCAAAG

the PCR system is as follows: 25 mul of high fidelity enzyme; 2. mu.l of each primer; 18 mul of water; WT template 3. mu.l.

The PCR reaction conditions are as follows: pre-denaturation at 95 deg.C for 5 min; denaturation at 95 ℃ for 15 s; annealing at 56 ℃ for 15 s; extending for 72 ℃ for 2 min; a total of 32 cycles; finally, the extension is carried out for 5 min.

2.3 cloning of the Aspergillus nidulans trpC terminator

The primers are as follows:

trpC-F:AAAGCCTTCGAGCGTCCCA

trpC-R:TCCTGCCCGTCACCGAGAT

the PCR system is as follows: 25 mul of high fidelity enzyme; 2. mu.l of each primer; 18 mul of water; plasmid template 3. mu.l.

2.4 fusion PCR

Three sections of Pgpd promoter, optimized human Cas9 protein with Pleurotus eryngii preference and aspergillus nidulans trpC terminator are fused and connected

A recombinant plasmid was formed in the Blunt Zero Cloning Kit plasmid

-Blunt Zero-Pgpd-Cas9-trpC。

2.5 selection of sgRNA targets

The target sequence of the sgRNA on the pyrG gene is located on the exon of the pyrG gene near the N-terminal, as shown in SEQ ID NO. 8.

2.6 identification of the sgRNA promoter Pol III RNA polymerase promoter

4U 6snRNA promoters (promoter) are identified from the genome of the pleurotus eryngii, and the sequences are shown as SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO. 7.

2.7 cloning of the sgRNA splice fragment (scaffold).

sgRNA scaffold was amplified from PX330 plasmid (plasmid).

sgRNA scaffold-F：GTTTTAGAGCTAGAAATAGC

sgRNA scaffold-R：AAAAAAGCACCGACTCGGTGCC

2.8 according to the concentration of the U6 promoter and the sgRNA scaffold, the U6 promoter and the sgRNA scaffold are mixed in equal proportion, the two fragments are connected together by fusion PCR to form a U6-sgRNA-scaffold fragment, and NotI-U6-sgRNA-scaffold-NotI fragments are formed by adding NotI enzyme cutting sites at the two ends of the fusion fragment as shown in figure 3.

2.9

Single cleavage of the NotI site of Blunt Zero-Pgpd-Cas 9-trpC.

2.10 will

The single-digested fragment of NotI site of Blunt Zero-Pgpd-Cas9-trpC and the NotI-U6-sgRNA-scaffold-NotI fragment described in 2.9 were recombinantly ligated.

2.11 recombination System the following:

4 ul Single enzyme digestion vector

-Blunt Zero-Pgpd-Cas9-trpC

1. mu.l NotI-U6-sgRNA-scaffold-NotI fragment

2μl 5xCE II Buffer

1μl

Recombinant enzyme

Adding water to 10 μ l, incubating at 37 deg.C for 30min, directly converting Escherichia coli competent cells, and plating overnight; selecting the single colony successfully recombined, shaking the bacteria for 12-15h, and extracting the plasmid

-Blunt Zero-Pgpd-Cas9-trpC-U6-sgRNA-Scaffold。

2.12 cloning DNA fragments of the left and right homology arms (Donor) of the gene (pyrG) site to be edited, wherein the sequence of the left homology arm is shown as SEQ ID NO.17, the sequence of the right homology arm is shown as SEQ ID NO.18, and the sequence of the homology arms is accessed to both ends of the gene site to be edited.

2.13 fusion PCR three sections of pyrG left homology arm, GFP fragment, pyrG right homology arm were fused, the sequence was a GFP fragment inserted with pyrG Donor DNA (GFP fragment) as template repair, and the result is shown in SEQ ID NO. 19. The left and right arms carry the speI linker to form the speI-pyrG left arm-GFP-pyrG right arm-speI, respectively.

2.14 plasmids

Single cleavage of the speI site of Blunt Zero-Pgpd-Cas 9-trpC-U6-sgRNA-Scaffold.

2.15

-single-cut fragment of the speI site of Blunt Zero-Pgpd-Cas9-trpC-U6-sgRNA-Scaffold and pyrG left arm-GFP-pyrG right arm of the speI linker as described above in 2.13).

2.16 recombination system as follows:

4 ul Single enzyme digestion vector

-Blunt Zero-Pgpd-Cas9-trpC-U6-gRNA-Scaffold

Mu.l of long homology arm pyrG Donor DNA (GFP fragment)

2μl 5xCE II Buffer

1μl

Recombinant enzyme

Blunt Zero-Pgpd-Cas9-trpC-U6-sgRNA-Scaffold-pyrG-Donor-DNA (GFP fragment), and the recombinant plasmid map constructed is shown in FIG. 4.

Example 3: acquisition of Pleurotus eryngii pyrG gene knockout vegetative mutant strain

In example 2

Transfection by means of PEG-mediated protoplast transfection of a plasmid of-Blunt-Zero-Pgpd-Cas 9-trpC-U6-gRNA-scaffold-pyrG-Donor-DNA (GFP fragment).

3.1 PEG mediated transfection of protoplasts was performed as follows:

3.1.1 collecting Pleurotus eryngii hyphae, sterilizing with ddH₂And washing twice.

3.1.2 preparing a lywallzyme enzymolysis liquid for hydrolyzing the cell wall of the pleurotus eryngii, filtering and sterilizing, transferring the collected hypha into the enzymolysis liquid, and carrying out enzymolysis for about 3.5 hours in a shaking table at the temperature of 28 ℃ and the rotating speed of 80 rpm.

3.1.3 after the enzymatic hydrolysis is finished, the product is transferred into a 50ml centrifuge tube, 10ml of bridging Buffer is added, 5000rpm is carried out, and centrifugation is carried out for 15min at 4 ℃.

3.1.4 after centrifugation, the white protoplast layer was gently pipetted into another 50ml centrifuge tube using a pipette gun and centrifuged at 4 ℃ for 10min with the same volume of STC Buffer added at 5000 rpm.

3.1.5 remove the supernatant, add 1ml STC Buffer and mix the protoplast, put into the refrigerator for future use.

3.1.6 protoplasts and plasmids after vacuum concentration in a volume of 100. mu.l with a pipette

-Blunt-Zero-Pgpd-Cas9-trpC-U6-gRNA-scaffold-pyrG-Donor-DNA (GFP fragment) was gently mixed, placed on ice for 50min, added with 1.25ml of PEG solution, placed at room temperature for 25min, added with 10ml of the transformation upper medium, poured into the lower medium poured in advance, and cultured at 28 ℃ for 15 days.

3.2 selecting the pyrG edited transformant, and carrying out the inoculation on a basic culture medium (MM), wherein the result of the inoculation is shown in figure 5, which shows that the transformant can not grow in the basic culture medium (MM), and the pyrG gene function is lost; whereas WT and pyrG edited transformants grew normally in UU (pyrimidine nucleotide) supplemented medium.

3.3 DNA sequencing analysis is carried out on the transformant, the editing sites of the target genes are analyzed, and the analysis results are shown in Table 1.

TABLE 1 sequencing results of site-directed editing of auxotrophic strains with non-homologous end repair of the Pleurotus eryngii pyrG Gene

According to the sequencing results of Table 1, it was found that: the orotidine-5' -phosphate decarboxylase (OMPDC) encoded by the pyrG gene of Pleurotus eryngii is capable of converting orotate contained in the medium into pyrimidine nucleotides, so that Pleurotus eryngii which has impaired the function of pyrG gene cannot grow normally on basal medium (MM). A total of 30 transformants are selected, and sequencing results of the transformants prove that the pyrG gene does complete different types of editing such as insertion and deletion at an expected editing target spot, as shown in SEQ ID NO.9-16, 25 mutants causing frame shift mutation (10 mutants with non-homologous end repair and 15 mutants with homologous end repair and GFP sequence insertion) are detected at a cleavage site CGCTGTA of the Cas9 protein, the mutation rate is 83.3%, wherein sequencing results of a part of transformants are shown in Table 1, and the target gene pyrG is inserted and deleted at a sequence position targeted by sgRNA, so that the pyrG gene is subjected to frame shift mutation, and gene knockout is successful.

The complementary and paired DNA sequence of the target recognition sequence is SEQ ID NO.8, the sequence of the recruited Cas9 protein is SEQ ID NO.3, and the optimized Cas9 protein is accurately edited at the designed target site in a fixed point mode according to the preference of pleurotus eryngii genome codons. The optimized U6-Cas9 system can efficiently edit a series of genes such as pleurotus eryngii pyrG and the like, and the editing efficiency is very high.

Sequence listing

<110> university of Nanjing university

<120> Cas9 protein, CRISPR/Cas9 system, mushroom gene editing method and application

<160> 19

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3015

<212> DNA

<213> Pleurotus eryngii sdhB gene (Pleurotus eryngii-sdhB gene)

<400> 1

tggctccctt agtcacatac tgtcaaggct cttttagaga acttttctca agcagcgtga 60

aagcctagtt ggtatcgacg aaagcggaaa gataccaaga tatcacggca ttcgtagctt 120

cgccgaggga atgacatagg cgggtataac ctcctttgag ttgagacgaa agtgtggctt 180

caaactcacg tcctcaataa gcgctcgcga catcgcggat tcacatcaca ccactctcca 240

agaatctctc gttcaaaggt atcctgtatt tgtaagtcaa gccaacgttt attccatgat 300

acaaggctgg ccacattcat ggtattctct ccgtaaatag ccatttacca cccatgacac 360

gacatattcg gattcctgcc gcttgtgaac caaccgttca actgtgcaaa cgctaataca 420

tggcttctga gactcccaac gttgtttgga gaaaaattct caaaaacggc tgccgaagac 480

ctaagccagt gttgctccta cattttctca acactcgata gaagctgcaa ctaggtcaac 540

aaagttggca ttccatcgcc tttgactaca aattgattcg gggggttcga cgatggacac 600

catgagcgag ctttgtccgt tacgacgaga acatccgaag tcccatcctc tcctgaactc 660

ttcaagacca ccattcaagg gaatttcgag gtctcggagc gccgttgaac ccaggttttc 720

gggtgacacc tcaattgctt tccccctttt ctgaccagag tccccgaggt acagcccggg 780

tacggcacat attctacctt gtaaacctca ctcataacgt tccgaggaga gtggcatcac 840

acagcgcgct ggcctaatag tggtgtcaag ttggaaggga agcgagtcgg ggtcattggg 900

actggggcca gcgccgagtt cagatcatcc aagaagcagg caaattggca caagggctcg 960

tggtattcca gcgtacaccg aatctgacat tccgcttgcg acaacccacg caagccaaag 1020

tgtcagaagt tgtcgaaatg caatggaatc atgttcacga agaggccttg ggtagtgacc 1080

ctatcaggta aacaagtatc gtcgatttct tgacacttct agctgctccg tccacgtgta 1140

taccttcgac tcaccattga agagcatgat gggcgcaaag attacgttct atcgctcttc 1200

tctctttact ttgataatcg aaagctgcac tactcagcgc cgcaattata catgtttttc 1260

taaaaatcta ccgactcacc gctgacgcgc tgacggccgg taagcttcaa gtaacctgca 1320

gttccaatcg ggcaatttca aagtgtgccg gcatttaccg aagagtaaca tgcgccctct 1380

gattggttcg gatcgcgagg gctcctttcc cgctccgaat tcacgcgacg ggatcccgcc 1440

gcatctctcc tcttcaccgt cgtcgttgac gtccccgaaa cacagaaatc accgaatcat 1500

gcaggcgctc acctccaggt cgttggctcg ctcaccccgc tcgattcgtt ctttctccac 1560

ttcgtgtgga aggtggcagg ctgagctcct ccagaagccc gttctccaga aagaattcaa 1620

gatctaccgt tgggtgagct gagacgcttg tgtatccaga tgtgttgctc acattgtggc 1680

acagaatccg gatgaaccag ccaagaagcc tcatctccaa tcgtacacca ttgacttgaa 1740

ccagacgggc cccatggtac gtacaattcc aaggcgattg tctctatgct cacgggctcg 1800

tagattctgg acgctcttat caagatcaag aacgaaatcg atcctacgct cacattccgt 1860

cgttcgtgta gagaagggat ttgcggctcg tgcgcgatga atattgacgg acagaacacg 1920

ttggcttgcc tgtgccgaat tgaccgtaac gccagcaagg acagcaagat ctaccctttg 1980

ccgcacagta tgacatgtct tttggttcct aatagcattg actgacggtc agttacagtg 2040

tacatcgtga aagacctcgt acccgacctc acacttttct acaagcagta caagtccatc 2100

aagccttacc tgcagaacga caatgtcccc gagagggagc acctccagtc gccagaggac 2160

cgcaagaagc tggacgggat gtatgaatgc atcctgtgcg cgtgctgcag cacatcgtgt 2220

cccagctatt ggtggaacca agatgagtat ttggaccggc tgctttgatg gccgcgtata 2280

ggtggattgc ggactcacga gtgcgttatg ttgccgtcga tacatgctct cattcatagt 2340

ctaacatttc gcaggatacg tatggcgcac aacgcaagga acatttccag aatgagatga 2400

gtttgttccg ctgcctcacc atcttcaatt gtacgtcgct ttcgccttga tatggattgg 2460

ctgttaatca tatcccttct caaggctctc gcacttgtcc aaagggcctc aaccctgcga 2520

aagccattgc agagatcaag ctcgcgctcg ctactgagta aaccctagtc aacagccacg 2580

gatcaaaagc attaagtcag aggcagattt ctttcctgta gcagttcgca gttcttttca 2640

cttcatcgta tggtgtccat tgcagacatc taatcatatt cattctatca catccacttg 2700

ttcttgagcc actcttaagg taggcatacc ctcggtctca cttgcggtgc tgtacgaaac 2760

aagaacggat acatattcta tattctatgg gacatctaac gactcaggca attcatagtc 2820

tactaggctc aacatcgaga gcgaagaagg gatacgacgt gtagccgtcg gagtccacgc 2880

tgccaggtct gtagtaatcc tttctatcac ctttttccac ttgccaatca ttcttcagtc 2940

gcagcggcaa atcgggctat cgtccagcac tcgaactcag ccaacacctc tcctcaggac 3000

gaaggaaggc ttacg 3015

<210> 2

<211> 3015

<212> DNA

<213> Pleurotus eryngii sdhB gene (Pleurotus eryngii-sdhB gene)

<400> 2

tggctccctt agtcacatac tgtcaaggct cttttagaga acttttctca agcagcgtga 60

aagcctagtt ggtatcgacg aaagcggaaa gataccaaga tatcacggca ttcgtagctt 120

cgccgaggga atgacatagg cgggtataac ctcctttgag ttgagacgaa agtgtggctt 180

caaactcacg tcctcaataa gcgctcgcga catcgcggat tcacatcaca ccactctcca 240

agaatctctc gttcaaaggt atcctgtatt tgtaagtcaa gccaacgttt attccatgat 300

acaaggctgg ccacattcat ggtattctct ccgtaaatag ccatttacca cccatgacac 360

gacatattcg gattcctgcc gcttgtgaac caaccgttca actgtgcaaa cgctaataca 420

tggcttctga gactcccaac gttgtttgga gaaaaattct caaaaacggc tgccgaagac 480

ctaagccagt gttgctccta cattttctca acactcgata gaagctgcaa ctaggtcaac 540

aaagttggca ttccatcgcc tttgactaca aattgattcg gggggttcga cgatggacac 600

catgagcgag ctttgtccgt tacgacgaga acatccgaag tcccatcctc tcctgaactc 660

ttcaagacca ccattcaagg gaatttcgag gtctcggagc gccgttgaac ccaggttttc 720

gggtgacacc tcaattgctt tccccctttt ctgaccagag tccccgaggt acagcccggg 780

tacggcacat attctacctt gtaaacctca ctcataacgt tccgaggaga gtggcatcac 840

acagcgcgct ggcctaatag tggtgtcaag ttggaaggga agcgagtcgg ggtcattggg 900

actggggcca gcgccgagtt cagatcatcc aagaagcagg caaattggca caagggctcg 960

tggtattcca gcgtacaccg aatctgacat tccgcttgcg acaacccacg caagccaaag 1020

tgtcagaagt tgtcgaaatg caatggaatc atgttcacga agaggccttg ggtagtgacc 1080

ctatcaggta aacaagtatc gtcgatttct tgacacttct agctgctccg tccacgtgta 1140

taccttcgac tcaccattga agagcatgat gggcgcaaag attacgttct atcgctcttc 1200

tctctttact ttgataatcg aaagctgcac tactcagcgc cgcaattata catgtttttc 1260

taaaaatcta ccgactcacc gctgacgcgc tgacggccgg taagcttcaa gtaacctgca 1320

gttccaatcg ggcaatttca aagtgtgccg gcatttaccg aagagtaaca tgcgccctct 1380

gattggttcg gatcgcgagg gctcctttcc cgctccgaat tcacgcgacg ggatcccgcc 1440

gcatctctcc tcttcaccgt cgtcgttgac gtccccgaaa cacagaaatc accgaatcat 1500

gcaggcgctc acctccaggt cgttggctcg ctcaccccgc tcgattcgtt ctttctccac 1560

ttcgtgtgga aggtggcagg ctgagctcct ccagaagccc gttctccaga aagaattcaa 1620

gatctaccgt tgggtgagct gagacgcttg tgtatccaga tgtgttgctc acattgtggc 1680

acagaatccg gatgaaccag ccaagaagcc tcatctccaa tcgtacacca ttgacttgaa 1740

ccagacgggc cccatggtac gtacaattcc aaggcgattg tctctatgct cacgggctcg 1800

tagattctgg acgctcttat caagatcaag aacgaaatcg atcctacgct cacattccgt 1860

cgttcgtgta gagaagggat ttgcggctcg tgcgcgatga atattgacgg acagaacacg 1920

ttggcttgcc tgtgccgaat tgaccgtaac gccagcaagg acagcaagat ctaccctttg 1980

ccgcacagta tgacatgtct tttggttcct aatagcattg actgacggtc agttacagtg 2040

tacatcgtga aagacctcgt acccgacctc acacttttct acaagcagta caagtccatc 2100

aagccttacc tgcagaacga caatgtcccc gagagggagc acctccagtc gccagaggac 2160

cgcaagaagc tggacgggat gtatgaatgc atcctgtgcg cgtgctgcag cacatcgtgt 2220

cccagctatt ggtggaacca agatgagtat ttggaccggc tgctttgatg gccgcgtata 2280

ggtggattgc ggactcacga gtgcgttatg ttgccgtcga tacatgctct cattcatagt 2340

ctaacatttc gcaggatacg tatggcgcac aacgcaagga acatttccag aatgagatga 2400

gtttgttccg ctgcctcacc atcttcaatt gtacgtcgct ttcgccttga tatggattgg 2460

ctgttaatca tatcccttct caaggctctc gcacttgtcc aaagggcctc aaccctgcga 2520

aagccattgc agagatcaag ctcgcgctcg ctactgagta aaccctagtc aacagccacg 2580

gatcaaaagc attaagtcag aggcagattt ctttcctgta gcagttcgca gttcttttca 2640

cttcatcgta tggtgtccat tgcagacatc taatcatatt cattctatca catccacttg 2700

ttcttgagcc actcttaagg taggcatacc ctcggtctca cttgcggtgc tgtacgaaac 2760

aagaacggat acatattcta tattctatgg gacatctaac gactcaggca attcatagtc 2820

tactaggctc aacatcgaga gcgaagaagg gatacgacgt gtagccgtcg gagtccacgc 2880

tgccaggtct gtagtaatcc tttctatcac ctttttccac ttgccaatca ttcttcagtc 2940

gcagcggcaa atcgggctat cgtccagcac tcgaactcag ccaacacctc tcctcaggac 3000

gaaggaaggc ttacg 3015

<210> 3

<211> 4272

<212> DNA

<213> Gene sequence of Cas9 protein of Pleurotus eryngii (Pleurotus eryngii Cas9 protein gene)

<400> 3

atggactaca aggaccacga cggcgactac aaggatcacg acatcgacta caaagacgac 60

gacgacaaga tggcgcccaa gaagaagcgc aaggtcggca tccacggcgt ccccgcagct 120

gacaagaaat actccatcgg cctggacatc ggcaccaaca gcgtcggatg ggctgttatc 180

accgacgaat acaaagtccc atccaagaag ttcaaggtcc tcggtaacac cgacagacac 240

tccatcaaga agaacctcat cggagctctc ctcttcgact ccggagaaac cgctgaagcc 300

accagactca aaagaaccgc ccgccgccgc tacacccgca gaaaaaaccg catctgctac 360

ctccaagaaa tcttctccaa cgaaatggct aaggtcgacg actccttctt ccaccgcctc 420

gaagaatcct tcctcgtcga agaagacaag aagcacgaac gccaccctat cttcggcaac 480

atcgtcgacg aagtcgctta ccacgaaaag taccctacca tctaccacct ccgcaagaag 540

ctcgtcgact ccaccgacaa ggctgacctc cgcctcatct acctcgctct cgctcacatg 600

atcaagttcc gcggccactt cctcatcgaa ggcgacctca accctgacaa ctccgacgtc 660

gacaagctct tcatccaact cgtccaaacc tacaaccaac tcttcgaaga aaaccctatc 720

aacgcttccg gcgtcgacgc taaggctatc ctctccgctc gcctctccaa gtcccgccgc 780

ctcgaaaacc tcatcgctca actccctggc gaaaagaaga acggcctctt cggcaacctc 840

atcgctctct ccctcggcct cacccctaac ttcaagtcca acttcgacct cgctgaagac 900

gctaagctcc aactctccaa ggacacctac gacgacgacc tcgacaacct cctcgctcaa 960

atcggcgacc aatacgctga cctcttcctc gctgctaaga acctctccga cgctatcctc 1020

ctctccgaca tcctccgcgt caacaccgaa atcaccaagg ctcctctctc cgcttccatg 1080

atcaagcgct acgacgaaca ccaccaagac ctcaccctcc tcaaggctct cgtccgccaa 1140

caactccctg aaaagtacaa ggaaatcttc ttcgaccaat ccaagaacgg ctacgctggc 1200

tacatcgacg gcggcgcttc ccaagaagaa ttctacaagt tcatcaagcc tatcctcgaa 1260

aagatggacg gcaccgaaga actcctcgtc aagctcaacc gcgaagacct cctccgcaag 1320

caacgcacct tcgacaacgg ctccatccct caccaaatcc acctcggcga actccacgct 1380

atcctccgcc gccaagaaga cttctaccct ttcctcaagg acaaccgcga aaagatcgaa 1440

aagatcctca ccttccgcat cccttactac gtcggccctc tcgctcgcgg caactcccgc 1500

ttcgcttgga tgacccgcaa gtccgaagaa accatcaccc cttggaactt cgaagaagtc 1560

gtcgacaagg gcgcttccgc tcaatccttc atcgaacgca tgaccaactt cgacaagaac 1620

ctccctaacg aaaaggtcct ccctaagcac tccctcctct acgaatactt caccgtctac 1680

aacgaactca ccaaggtcaa gtacgtcacc gaaggcatgc gcaagcctgc tttcctctcc 1740

ggcgaacaaa agaaggctat cgtcgacctc ctcttcaaga ccaaccgcaa ggtcaccgtc 1800

aagcaactca aggaagacta cttcaagaag atcgaatgct tcgactccgt cgaaatctcc 1860

ggcgtcgaag accgcttcaa cgcttccctc ggcacctacc acgacctcct caagatcatc 1920

aaggacaagg acttcctcga caacgaagaa aacgaagaca tcctcgaaga catcgtcctc 1980

accctcaccc tcttcgaaga ccgcgaaatg atcgaagaac gcctcaagac ctacgctcac 2040

ctcttcgacg acaaggtcat gaagcaactc aagcgccgcc gctacaccgg ctggggccgc 2100

ctctcccgca agctcatcaa cggcatccgc gacaagcaat ccggcaagac catcctcgac 2160

ttcctcaagt ccgacggctt cgctaaccgc aacttcatgc aactcatcca cgacgactcc 2220

ctcaccttca aggaagacat ccaaaaggct caagtctccg gccaaggcga ctccctccac 2280

gaacacatcg ctaacctcgc tggctcccct gctatcaaga agggcatcct ccaaaccgtc 2340

aaggtcgtcg acgaactcgt caaggtcatg ggccgccaca agcctgaaaa catcgtcatc 2400

gaaatggctc gcgaaaacca aaccacccaa aagggccaaa agaactcccg cgaacgcatg 2460

aagcgcatcg aagaaggcat caaggaactc ggctcccaaa tcctcaagga acaccctgtc 2520

gaaaacaccc aactccaaaa cgaaaagctc tacctctact acctccaaaa cggccgcgac 2580

atgtacgtcg accaagaact cgacatcaac cgcctctccg actacgacgt cgaccacatc 2640

gtccctcaat ccttcctcaa ggacgactcc atcgacaaca aggtcctcac ccgctccgac 2700

aagaaccgcg gcaagtccga caacgtccct tccgaagaag tcgtcaagaa gatgaagaac 2760

tactggcgcc aactcctcaa cgctaagctc atcacccaac gcaagttcga caacctcacc 2820

aaggctgaac gcggcggcct ctccgaactc gacaaggctg gcttcatcaa gcgccaactc 2880

gtcgaaaccc gccaaatcac caagcacgtc gctcaaatcc tcgactcccg catgaacacc 2940

aagtacgacg aaaacgacaa gctcatccgc gaagtcaagg tcatcaccct caagtccaag 3000

ctcgtctccg acttccgcaa ggacttccaa ttctacaagg tccgcgaaat caacaactac 3060

caccacgctc acgacgctta cctcaacgct gtcgtcggca ccgctctcat caagaagtac 3120

cctaagctcg aatccgaatt cgtctacggc gactacaagg tctacgacgt ccgcaagatg 3180

atcgctaagt ccgaacaaga aatcggcaag gctaccgcta agtacttctt ctactccaac 3240

atcatgaact tcttcaagac cgaaatcacc ctcgctaacg gcgaaatccg caagcgccct 3300

ctcatcgaaa ccaacggcga aaccggcgaa atcgtctggg acaagggccg cgacttcgct 3360

accgtccgca aggtcctctc catgcctcaa gtcaacatcg tcaagaagac cgaagtccaa 3420

accggcggct tctccaagga atccatcctc cctaagcgca actccgacaa gctcatcgct 3480

cgcaagaagg actgggaccc taagaagtac ggcggcttcg actcccctac cgtcgcttac 3540

tccgtcctcg tcgtcgctaa ggtcgaaaag ggcaagtcca agaagctcaa gtccgtcaag 3600

gaactcctcg gcatcaccat catggaacgc tcctccttcg aaaagaaccc tatcgacttc 3660

ctcgaagcta agggctacaa ggaagtcaag aaggacctca tcatcaagct ccctaagtac 3720

tccctcttcg aactcgaaaa cggccgcaag cgcatgctcg cttccgctgg cgaactccaa 3780

aagggcaacg aactcgctct cccttccaag tacgtcaact tcctctacct cgcttcccac 3840

tacgaaaagc tcaagggctc ccctgaagac aacgaacaaa agcaactctt cgtcgaacaa 3900

cacaagcact acctcgacga aatcatcgaa caaatctccg aattctccaa gcgcgtcatc 3960

ctcgctgacg ctaacctcga caaggtcctc tccgcttaca acaagcaccg cgacaagcct 4020

atccgcgaac aagctgaaaa catcatccac ctcttcaccc tcaccaacct cggcgctcct 4080

gctgctttca agtacttcga caccaccatc gaccgcaagc gctacacctc caccaaggaa 4140

gtcctcgacg ctaccctcat ccaccaatcc atcaccggcc tctacgaaac ccgcatcgac 4200

ctctcccaac tcggcggcga caagcgccct gctgctacca agaaggctgg ccaagctaag 4260

aagaagaagt aa 4272

<210> 4

<211> 695

<212> DNA

<213> Pleurotus eryngii U6 Promoter 1(Pleurotus eryngii U6 Promoter1)

<400> 4

cccatatgag catcttgatc aaccaacgaa ggccaagtgg ggcacaggtc ttctaccgtc 60

ctgggtgtgt caggttgcgc cggctacaaa tcatcctgct ccgatgtaga ttacgaccac 120

ggggatggaa gaatgtggac tggagacgtc cgcgtggtat acccgtaccg gctgggaggg 180

agcgagagac agagatggtg gcggaagcag acactaggga ttgcccaacg gcaatggaca 240

taccttgctt agaattgtgt ttgcaatgag actttactac gaaggacacc ccgtcgctca 300

acttgcggtc gaacttactc aatggttgag gagaacgaga actttgaaaa ttcagaataa 360

gtggattctt gtgcctacag ttggcgcagt gcgggctacc gaaaatctgt gccatttgtc 420

attcttcgaa ccactatcgc aatgtttttg gtagtaagtt caaggtggag tggtgtgtcg 480

acatcttttg tcaacctcgt cgaacttcac gcaaagcgtc ggagcggaga tactgccatt 540

caacaagagt acggtgcgca agtacggtga gagagtcaag actgcgcgcg attcgagccc 600

acgtgctacc aggcactgcc actgtgatcg aacccagtga gctggacaaa acacagcact 660

cagtggacgc cgtagcaaca gtactaacaa agact 695

<210> 5

<211> 453

<212> DNA

<213> Pleurotus eryngii U6 Promoter 2(Pleurotus eryngii U6 Promoter2)

<400> 5

gacctccgcc aactatacat ctaagcacac gccttggaaa atccaagtct ggagaggcga 60

ggacgggttt gttaagagaa tggtgaatgt tgatagtctt gttgtgtcgc ccagtcctgt 120

tgaaaagtta ctccaccccc gttctgaata ttgcagtcaa cctaacacac aggtacgcgt 180

aaagtattta cgccttcgtg acctatcgaa tgttccacgg ccccaaactt ccatgctcta 240

tcaggtacag acacaatcaa acttccgtga tatacgtgcc attcttgaca agtttcctca 300

ggaaatagat caagtcgaaa atacccctac acaaggacag acaataggta tcgcaatgag 360

cccctttcag ttggcgggta cccctgggaa gctcgcgcgc tgaacaaaac gcacaagtca 420

tgttgtatcc agtcaacacg agcaacaact att 453

<210> 6

<211> 707

<212> DNA

<213> Pleurotus eryngii U6 Promoter 3(Pleurotus eryngii U6 Promoter3)

<400> 6

agaaagccca gagttaccgt cagtcattgt cagcaccact gcttgtcaat gtcaatcgct 60

tcttgttgtt cctatatata tactagggat cgcccggcgg cgcttcaaaa tataccttgc 120

gtgggttggc atctcggttt cagtcctgct gcctccgttg ttttgcacac ccatctgtgt 180

cgaacgtcct gctttccaga atcccgcaca gcctcggagc atttcccaac gtctttctgg 240

gttgttatgg taggatacca ttcatttgcc gcgtccatac agaacgttgc tgttgacacg 300

gcacccgagt gaggatctct attccgaaga tgcaaggttg gcggcgctca acaaagatac 360

tgcgcagaag ttcggcaagc agtagggggg actcagagat tcagtgaagg gaacagtaca 420

ttgcgagcga cagtgcaggg agcattcctg tatacaagat taatattatt gtatgaatgt 480

aaattaggtg tgacttctga gggagcgtgg tagcgttgac gaccaccagc gcttcaaacg 540

tgggaatgtg cttgttgaga atcccgacga attgggcgag ttccagggag ggggacctag 600

ctttccaagc aaggtaatat atatataggg gtacacgtga tggacttcgc gaactgaaca 660

aaatacgaag ctcaggtcca gggctccttc ttcatacatt aattaat 707

<210> 7

<211> 793

<212> DNA

<213> Pleurotus eryngii U6 Promoter 4(Pleurotus eryngii U6 Promoter4)

<400> 7

gcgtgtcatc cttgcgcagg ggccatgcta atcttctctg tatcgttcca attttttcgt 60

atgtcacccc gaaggggaca atagttgttg ctcgtgttga ctggatacaa catgacttgt 120

gcgttttgtt cagcgcgcga gcttcccagg ggtacccgcc aactgaaagg ggctcattgc 180

gattacctat tgtctgtcct tgtgtagggg tattttcgac ttgatctatt tcctgaggaa 240

acttgtcaag aatggcacgt atatcacgga agtttgattg tgtctgtacc tgatagagca 300

tggaagtttg gggccgtgga acattcgata ggtcacgaag gcgtaaatac tttacgcgta 360

cctgtgtgtt agttgactgc aatattcaga acgggggtgg agtaactttt caacaggact 420

gggcgacaca acaagactat caacattcac cattctctaa caaacccgtc ctcgcctctc 480

cagactggat ttttccaagg cgtgtgctta gatgtatagt tggcggaggt ctcgcggacg 540

agctgttcgt tgatttctat accgattcca ggacctgcga aacaaggcgt cagatataaa 600

gtcttagaca acgaagatgc agttgacttg ccatggagca acccaagatg gccttccttg 660

atctcaaaca ccgatgggtg cgaaaggtag gtgtacaagt cagcctcttg atcactttca 720

ggagatacat tgtagtgtat ctatgcaatt acaatatgtt actgcgttaa gcaacgggag 780

tgtgtgataa cgc 793

<210> 8

<211> 19

<212> DNA

<213> target site of Pleurotus eryngii pyrG Gene (Pleurotus eryngii pyrG sgRNA)

<400> 8

ggcaatcatc gacgctgta 19

<210> 9

<211> 920

<212> DNA

<213> WT type Pleurotus eryngii pyrG gene (wild type Pleurotus eryngii pyrG)

<400> 9

atgagctcaa agggagtcca ggcattgtca tatgtccaaa gggctgacaa ctacaccaat 60

cctgctgcga aggaactgct tctcaccatg gaacgcaaga agtccaacct ttccgttagc 120

gtggatgtga cgaaatcaag agatttcctg gcaatcatcg acgctgtagg gccatatgcc 180

tgtttaatca aggtaaaccg acctcatttg ttgcacaata ctcgggatct gatgcccaga 240

tctgcgaaag actcatgttg atatacttga agattttgac tttacgttga ttgaaagctt 300

gcaagctttg agcaaaaaac atgacttcat gatcttcgag gacagaaagt ttgcagacat 360

aggtgccact cttcgtagct caacttgaat cgccgttcac agcgcttgta ggaaacaccg 420

ttgcgttaca gtattcaagt ggcgtgcatc gcatcgcgag ttggtcgcag atcacgaatg 480

cccactcagt ccctggtcca tccatcgtcg cagggctttc ttcagtaggc ttacccctcg 540

gacggggtct cctcctcttg gcagaaatga gcacggcggg aaaccttgct gtgggccaat 600

acacagaaga gacttatcag atggctcgcg atcaccggga cttcgtaatc gggttcattg 660

gacaaagacg cccatctggc gagggagatg aggatttcct agtcctgaca cccggagtag 720

gattggatgt gaaggcagat ggtatggggc agcagtacag aacgcctcgc gaagtcatct 780

tggaatcagg ttgcgatgtg attattgtag gacgagggat atatgggaaa gattacagct 840

tgactgaagc catcgctcag caagcggaga ggtaccggga atcggggtgg agcgcatact 900

tagaaaggtg taaatcgtaa 920

<210> 10

<211> 54

<212> DNA

<213> transformant 1 of Pleurotus eryngii pyrG gene fragment (transformation 1 of Plieurotus eryngii pyrG gene segment)

<400> 10

aatcaagaga tttcctggca atcatcgacc gcttgtaggg ccatatgcct gttt 54

<210> 11

<211> 51

<212> DNA

<213> transformant 2 of Pleurotus eryngii pyrG gene fragment (transformation 2 of Plieurotus eryngii pyrG gene segment)

<400> 11

aatcaagaga tttcctggca atcatcgacg gtagggccat atgcctgttt a 51

<210> 12

<211> 43

<212> DNA

<213> transformant 3 of Pleurotus eryngii pyrG gene fragment (transformation 3 of Plieurotus eryngii pyrG gene segment)

<400> 12

aatcaagaga tttcctggca atgtagggcc atatgcctgt tta 43

<210> 13

<211> 46

<212> DNA

<213> transformant 4 of Pleurotus eryngii pyrG gene fragment (transformation 4 of Plieurotus eryngii pyrG gene segment)

<400> 13

aatcaagaga tttcctggca atcattgtag ggccatatgc ctgttt 46

<210> 14

<211> 46

<212> DNA

<213> transformant 5 of Pleurotus eryngii pyrG gene fragment (transformation 5 of Pleurotus eryngii pyrG gene fragment)

<400> 14

aatcaagaga tttcctggca atcatgtagg gccatatgcc tgttta 46

<210> 15

<211> 120

<212> DNA

<213> transformant 6 of the Pleurotus eryngii pyrG gene fragment (transformation 6 of the Pleurotus eryngii pyrG gene fragment)

<400> 15

aatcaagaga tttcctggca atcatcgacg ctaataatat taatcttgta tacaggaatg 60

ctccctgcac tgtcgctcgc aatgtactgt tcccttcacg tagggccata tgcctgttta 120

<210> 16

<211> 173

<212> DNA

<213> transformant 7 of Pleurotus eryngii pyrG gene fragment (transformation 7 of Pleurotus eryngii pyrG gene segment)

<400> 16

aatcaagaga tttcctggca atcatcgacg ctaaagctcg aggaacggac agtaactctg 60

cccgatccca aaccgaagct gaaactagca cacaaaccta tcattgagac tataggtgat 120

actaacgcgg aaaagtcgag cttgaattcg aagtagggcc atatgcctgt tta 173

<210> 17

<211> 923

<212> DNA

<213> left homology arm sequence of Pleurotus eryngii pyrG gene (Pleurotus eryngii pyrG Upstream homologus sequence)

<400> 17

gaatcaaggc tcacctctgc tttataatcc cctcgatctg ggagactccg cgaccgacgt 60

attctgatat ccctacatca gtctctctga acttgtaccc agagccgtct tcagccttct 120

caggtcgagg tacgcctagg agaacgtggc ttgggggtag aatgtcgtcg gcatgcccat 180

ctttgggcgg ggcagtatct gtcgtgactt cgggatcgga ttcctcggaa ggggacgtgg 240

gttctagaga atcctctaat ctagcacgtt ttgaggcgcg ttcaagactc tccgcctcgg 300

cttcgtgttt gagagacatg atcgaagtta ttttgcgaga tggcaagatc acgcgccaga 360

ttgaactcga accatcacca tctcgaggtt tcccacggtt gactcccagt tctcgaggct 420

catcgtcagc cacgcacagg cttccaatgc ctctcttgca ctacgacgac gaggaaaggc 480

agcatggtct cctgccaggg ggtgcttctt ctttaaggag cttaaatgaa gttcacgccc 540

tctgagtcct ggaagggcta tagacttcct ggtgtcggtg ctcccttggt aaaggagctt 600

aaactgggta tatccacgcc tgagtcctgg aatgatgaaa cttccttcgc tatgcctcta 660

tgtccaacac taccttacca accattatca tgcccaccgt ccttgcctgc agcgttaatt 720

cgttgtactc aacccgtacc gcgtcttagt agctttagca tacctgctgc ggtatataaa 780

tgcagacatt aatgaaaata aaaataaaag gcatgatcac gcgcttagta gatgttagat 840

ttcacagccc ctgtctttca ccaaaacgtc ggagccatgt cgaaggttca tccacttccc 900

gaaggcacct actttcaacc atc 923

<210> 18

<211> 996

<212> DNA

<213> sequence of right homology arm of Pleurotus eryngii pyrG gene (Pleurotus eryngii pyrG downstream homologus sequence)

<400> 18

ccgacctcat ttgttgcaca atactcggga tctgatgccc agatctgcga aagactcatg 60

ttgatatact tgaagatttt gactttacgt tgattgaaag cttgcaagct ttgagcaaaa 120

aacatgactt catgatcttc gaggacagaa agtttgcaga cataggtgcc actcttcgta 180

gctcaacttg aatcgccgtt cacagcgctt gtaggaaaca ccgttgcgtt acagtattca 240

agtggcgtgc atcgcatcgc gagttggtcg cagatcacga atgcccactc agtccctggt 300

ccatccatcg tcgcagggct ttcttcagta ggcttacccc tcggacgggg tctcctcctc 360

ttggcagaaa tgagcacggc gggaaacctt gctgtgggcc aatacacaga agagacttat 420

cagatggctc gcgatcaccg ggacttcgta atcgggttca ttggacaaag acgcccatct 480

ggcgagggag atgaggattt cctagtcctg acacccggag taggattgga tgtgaaggca 540

gatggtatgg ggcagcagta cagaacgcct cgcgaagtca tcttggaatc aggttgcgat 600

gtgattattg taggacgagg gatatatggg aaagattaca gcttgactga agccatcgct 660

cagcaagcgg agaggtaccg ggaatcgggg tggagcgcat acttagaaag gtgtaaatcg 720

taaaaaggtg taaatcgtaa ttgatccatt acacccttgc aaactagaaa agcgtatatc 780

tgcacagaca gtctatcggc cacttcaggc ttttgtcgta gaagaaagga aaataacgta 840

caaagagtgg tttccgctta acccgcccta ttgatttggt tcgtattgta cacatggcgc 900

agctcaatca tcgatatcga agacatcttc attatcttgt ttcgaccgtg aagcggacga 960

aaccttgtaa agctgatcta tctggtttgt tggcgc 996

<210> 19

<211> 2636

<212> DNA

<213> insertion of GFP sequence into the left and right homology arms of the Pleurotus eryngii pyrG gene (Pleurotus eryngii pyrG gene homologus sequence and GFP)

<400> 19

gaatcaaggc tcacctctgc tttataatcc cctcgatctg ggagactccg cgaccgacgt 60

attctgatat ccctacatca gtctctctga acttgtaccc agagccgtct tcagccttct 120

caggtcgagg tacgcctagg agaacgtggc ttgggggtag aatgtcgtcg gcatgcccat 180

ctttgggcgg ggcagtatct gtcgtgactt cgggatcgga ttcctcggaa ggggacgtgg 240

gttctagaga atcctctaat ctagcacgtt ttgaggcgcg ttcaagactc tccgcctcgg 300

cttcgtgttt gagagacatg atcgaagtta ttttgcgaga tggcaagatc acgcgccaga 360

ttgaactcga accatcacca tctcgaggtt tcccacggtt gactcccagt tctcgaggct 420

catcgtcagc cacgcacagg cttccaatgc ctctcttgca ctacgacgac gaggaaaggc 480

agcatggtct cctgccaggg ggtgcttctt ctttaaggag cttaaatgaa gttcacgccc 540

tctgagtcct ggaagggcta tagacttcct ggtgtcggtg ctcccttggt aaaggagctt 600

aaactgggta tatccacgcc tgagtcctgg aatgatgaaa cttccttcgc tatgcctcta 660

tgtccaacac taccttacca accattatca tgcccaccgt ccttgcctgc agcgttaatt 720

cgttgtactc aacccgtacc gcgtcttagt agctttagca tacctgctgc ggtatataaa 780

tgcagacatt aatgaaaata aaaataaaag gcatgatcac gcgcttagta gatgttagat 840

ttcacagccc ctgtctttca ccaaaacgtc ggagccatgt cgaaggttca tccacttccc 900

gaaggcacct actttcaacc atcatgagta aaggagaaga acttttcact ggagttgtcc 960

caattcttgt tgaattagat ggtgatgtta atgggcacaa attttctgtc agtggagagg 1020

gtgaaggtga tgcaacatac ggaaaactta cccttaaatt tatttgcact actggaaaac 1080

tacctgttcc atggccaaca cttgtcacta ctttctctta tggtgttcaa tgcttttcaa 1140

gatacccaga tcatatgaag cggcacgact tcttcaagag cgccatgcct gagggatacg 1200

tgcaggagag gaccatcttc ttcaaggacg acgggaacta caagacacgt gctgaagtca 1260

agtttgaggg agacaccctc gtcaacagga tcgagcttaa gggaatcgat ttcaaggagg 1320

acggaaacat cctcggccac aagttggaat acaactacaa ctcccacaac gtatacatca 1380

tggccgacaa gcaaaagaac ggcatcaaag ccaacttcaa gacccgccac aacatcgaag 1440

acggcggcgt gcaactcgct gatcattatc aacaaaatac tccaattggc gatggccctg 1500

tccttttacc agacaaccat tacctgtcca cacaatctgc cctttcgaaa gatcccaacg 1560

aaaagagaga ccacatggtc cttcttgagt ttgtaacagc tgctgggatt acacatggca 1620

tggatgaact atacaaataa ccgacctcat ttgttgcaca atactcggga tctgatgccc 1680

agatctgcga aagactcatg ttgatatact tgaagatttt gactttacgt tgattgaaag 1740

cttgcaagct ttgagcaaaa aacatgactt catgatcttc gaggacagaa agtttgcaga 1800

cataggtgcc actcttcgta gctcaacttg aatcgccgtt cacagcgctt gtaggaaaca 1860

ccgttgcgtt acagtattca agtggcgtgc atcgcatcgc gagttggtcg cagatcacga 1920

atgcccactc agtccctggt ccatccatcg tcgcagggct ttcttcagta ggcttacccc 1980

tcggacgggg tctcctcctc ttggcagaaa tgagcacggc gggaaacctt gctgtgggcc 2040

aatacacaga agagacttat cagatggctc gcgatcaccg ggacttcgta atcgggttca 2100

ttggacaaag acgcccatct ggcgagggag atgaggattt cctagtcctg acacccggag 2160

taggattgga tgtgaaggca gatggtatgg ggcagcagta cagaacgcct cgcgaagtca 2220

tcttggaatc aggttgcgat gtgattattg taggacgagg gatatatggg aaagattaca 2280

gcttgactga agccatcgct cagcaagcgg agaggtaccg ggaatcgggg tggagcgcat 2340

acttagaaag gtgtaaatcg taaaaaggtg taaatcgtaa ttgatccatt acacccttgc 2400

aaactagaaa agcgtatatc tgcacagaca gtctatcggc cacttcaggc ttttgtcgta 2460

gaagaaagga aaataacgta caaagagtgg tttccgctta acccgcccta ttgatttggt 2520

tcgtattgta cacatggcgc agctcaatca tcgatatcga agacatcttc attatcttgt 2580

ttcgaccgtg aagcggacga aaccttgtaa agctgatcta tctggtttgt tggcgc 2636

Claims

1. A CRISPR/Cas9 vector for pleurotus eryngii gene editing is characterized in that the CRISPR/Cas9 vector is a recombinant vector for editing pleurotus eryngii genes, which is obtained by loading a Cas9 protein, a U6 promoter and a nucleotide sequence of sgRNA on a plasmid; the nucleotide sequence of the U6 promoter is selected from SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 or SEQ ID NO. 7; the nucleotide sequence of the Cas9 protein is shown as SEQ ID NO. 3; the nucleotide sequence of the sgRNA is shown in SEQ ID NO. 8.

2. The CRISPR/Cas9 vector for Pleurotus eryngii gene editing according to claim 1, wherein the recombinant vector further comprises a GFP nucleotide sequence and nucleotide sequences of left and right homologous arms of a target gene.

3. A U6 promoter applied to the CRISPR/Cas9 vector of claim 1 or claim 2, wherein the nucleotide sequence of the U6 promoter is selected from SEQ ID No.4, SEQ ID No.5, SEQ ID No.6 or SEQ ID No. 7.

4. A method for editing genome fragments of Pleurotus eryngii strains, which is characterized in that the Pleurotus eryngii strains are transformed by the CRISPR/Cas9 vector as claimed in claim 1 or claim 2, and target genes of the Pleurotus eryngii strains are edited.

5. The method for editing genomic fragments of Pleurotus eryngii strain according to claim 4, wherein said strain is Pleurotus eryngii strainCbx ^RResistant strains.