CN111733160A

CN111733160A - Method for performing CKIP-1 gene knockout on mesenchymal stem cells by using CRISPR-Cas9 system

Info

Publication number: CN111733160A
Application number: CN202010613315.9A
Authority: CN
Inventors: 王兴; 杨旭源; 张新慧
Original assignee: Wanlei Life Sciences Shenyang Co ltd
Current assignee: Wanlei Life Sciences Shenyang Co ltd
Priority date: 2020-06-30
Filing date: 2020-06-30
Publication date: 2020-10-02

Abstract

The invention provides a method for performing CKIP-1 gene editing on mesenchymal stem cells by using a CRISPR-Cas9 system, in particular relates to establishment of a human mesenchymal stem cell line with CKIP-1 gene knockout, and is used for subsequent researches on bone tissue physiological functions and wound repair and regeneration. A specific gRNA is constructed and obtained, and the gene editing efficiency of the CRISPR-Cas9 in the mesenchymal stem cell to CKIP-1 can be obviously improved. The CKIP-1 gene knockout constructed by the invention forms frame shift mutation on the genome level, so that the CKIP-1 gene knockout cell line can be transmitted to the next generation along with cell division and proliferation to form a stable CKIP-1 gene knockout cell line.

Description

Method for performing CKIP-1 gene knockout on mesenchymal stem cells by using CRISPR-Cas9 system

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a method for knocking out a mesenchymal stem cell CKIP-1 gene by using a CRISPR-Cas9 technology.

Background

Mesenchymal Stem Cells (MSCs), also known as mesenchymal stromal cells (mesenchyme cells), originate from early-developing mesoderm and ectoderm and are present in almost all biological tissue types, such as bone marrow, adipose tissue and dental pulp. MSCs are pluripotent stem cells that have self-renewal capacity and differentiate into a variety of cell types, including osteoblasts, adipocytes, muscle cells, hepatocytes, steroid-producing cells, skeletal muscle cells, smooth muscle cells, motor neurons, and endothelial cells, among others. Meanwhile, the biological active factors such as a large number of cell factors and growth factors can be secreted and produced, and the biological active factors act on a microenvironment in a paracrine mode to play roles in promoting angiogenesis, resisting fibrosis, resisting apoptosis and regulating immunity. In addition, MSCs have significant homing capacity and can migrate to the site of injury for immunomodulation, site-specific differentiation, support hematopoiesis, and the like. More importantly, neither autologous nor allogeneic MSCs generally elicit an immune response in the host. These characteristics make MSC excellent candidate cells for cell therapy, widely used in experiments, clinical studies and genetic engineering, for regeneration of bones, hearts, cartilages, central nerves, skin, etc., and have wide application prospects in the field of tissue repair.

The gene editing technology mainly studies the relationship between gene-related functions and phenotypes, has become a research hotspot of modern molecular biology, and is expected to be used for treating major diseases such as human genetic diseases, cancers, autoimmune diseases and the like in the future. The CRISPR/Cas system is widely existed in bacteria and archaea, and can degrade exogenous DNA such as virus or phage under the guidance of RNA. The CRISPR-Cas system is divided into I, II and III types, wherein Cas9 endonuclease RNase in the II type system cuts precursor crRNA into mature crRNA, the mature crRNA contains a non-repetitive spacer sequence which is complementary and paired with target DNA, and the target DNA sequence is cut by the Cas9 protein guided by the recognition of a PAM sequence. The modern common gene editing technology CRISPR-Cas9 is modified by the method that artificially designed guide RNA (gRNA) and Cas9 form a recombinant plasmid, the gRNA guides Cas9 nuclease to combine and cut a target genome, so that double DNA strands are broken, and the broken double-stranded DNA is repaired by a DNA repair system naturally existing in cells, thereby completing mutation modification of the target DNA. The CRISPR-Cas9 technology can realize gene editing functions such as gene site-directed knockout, knock-in, mutation and the like, is widely applied to genome editing of various cells and model animals at present, and makes a great breakthrough in disease treatment.

Casein kinase 2-interacting protein 1(Casein kinase 2-interacting protein-1, CKIP-1) is an important factor found in recent years to negatively regulate bone formation. Data show that the expression of CKIP-1 is significantly increased after glucocorticoid-induced osteoporotic rat osteoblasts and glucocorticoid-treated osteoblasts in vitro (Liu J, Lu C, Wu X, equivalent. targeting osteoinductive tissue kinase-2interacting protein-1to enhanced Smart-dependent BMP signaling and reverse bone formation reduction-induced osteoporotic [ J ]. Scientific Reports,2017,7: 41295); bone formation in healthy and osteoporotic mice was promoted following targeted silencing of CKIP-1 (Guo B, Zhang B, Zheng L, et. therapeutic RNA interference targeting CKIP-1with a cross-species sequence to bone formation. bone 2014; 59: 76-88). SiCKIP-1 can enhance the osteogenic and adipogenic differentiation capacity of BMSCs (Jia S, Yang X, Song W, et al. incorporation of osteopenic and adipogenic small interfering RNAs inter-cardiac span for bone tissue engineering. int J Nanomedicine. 2014; 9: 5307-inter 5316). Therefore, CKIP-1 can be used as a new bone defect repair target, and the osteogenic differentiation capacity of the MSCs can be enhanced by knocking out the gene. In addition, based on the pluripotency of the MSCs, in order to research the role of CKIP-1 in osteogenic differentiation and deepen understanding of bone metabolism and bone reconstruction, establishing the CKIP-1-knocked-out MSCs becomes particularly important.

Content of research

The invention aims to provide a method for knocking out a CKIP-1 gene of a MSCs cell by using a CRISPR-Cas9 technology.

The invention also aims to provide a CKIP-1 gene knockout MSCs cell line prepared by the method and application of the cell line as a tissue engineering seed cell in research and maintenance of physiological functions of bone tissues and wound repair and regeneration.

In order to achieve the above object, the present invention firstly provides a target of CRISPR-Cas9 system, and specific selectable target sites designed according to exon 6 of human CKIP-1 gene sequence are as follows (underlined part represents PAM motif):

CKIP1-sgRNA1:5’to 3’TGAGAGCTTTCGGGTTGACCTGG

CKIP1-sgRNA2:5’to 3’GGTCTGAGTCCGCTCTCCGCCGG

CKIP1-sgRNA3:5’to 3’ACTGCTTGCCCGGTCTGCGGAGG

CKIP1-sgRNA4:5’to 3’AAGCAGTCTCTCCCGACCTTGGG

CKIP1-sgRNA5:5’to 3’CAGAATCCGGCGGAGACCGAGGG

CKIP1-sgRNA6:5’to 3’CCGGTACTGACTGTGCGGGGTGG

the invention also provides a CKIP-1 gene targeting vector, which is a gRNA expression vector based on a CRISPR-Cas9 system.

The starting vector for constructing the gRNA expression vector of the CRISPR-Cas9 system is pX458, and is a forward oligonucleotide sequence obtained by adding CACC to the 5 'end of the DNA sequence of the gRNA action site and a reverse oligonucleotide sequence obtained by adding AAAC to the 5' end of the complementary strand. And (3) connecting double-stranded DNA formed by annealing the two complementary sequences with a pX458 vector subjected to BbsI enzyme digestion to construct the DNA.

Transfecting MSCs cells by using the targeting vector to obtain editing positive cells, and carrying out PCR sequencing and identification.

The specific PCR primer sequences used to identify the target-positive cell clones were as follows:

CKIP-1.F：GACCTTGGACTTGATCCAAGAGGAAG

CKIP-1.R：GTGGAGTGGTCAGACTGTGTCTTTAC

positive cells were edited by flow sorting, followed by propagation and harvesting of the desired stem cells.

The invention provides a method for constructing a mesenchymal stem cell line with a CKIP-1 gene knockout function, which has the following advantages:

firstly, the CKIP-1 gene is knocked out from the MSCs by using a CRISPR-Cas9 system, is simple and rapid, and can be used as an ideal tissue engineering seed cell.

And (II) based on the CRISPR-Cas9 method, compared with means such as silencing, interference and knock-down, the CKIP-1 can be knocked out more effectively.

And (III) constructing CKIP-1 knocked-out MSCs, screening and optimizing to obtain the optimal sgRNA, and having high knocking-out efficiency and stable passage.

Drawings

FIG. 1 shows a pX458 plasmid.

Fig. 2 is a site diagram of sgRNA insertion in pX 458.

FIG. 3 is a PCR electrophoresis identification chart of pX458-sgRNA colonies. Lanes 1 and 2: sgRNA1, lanes 3 and 4: sgRNA2, lanes 5 and 6: sgRNA3, lanes 7 and 8: sgRNA4, lanes 9 and 10: sgRNA5, lanes 11 and 12: sgRNA6, lane 13: DL2000 Marker.

Fig. 4 is a sequencing graph for validation of sgRNA3 activity.

FIG. 5 is a comparison graph of sequence comparison of CKIP-1 gene in a monoclonal MSC cell strain after CKIP-1 gene knockout by flow sorting.

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

pSpCas9(BB) -2A-GFP (PX458) plasmid: addgene, Inc., catalog No. 48138.

Human mesenchymal stem cells: wuhan Punuo Sai Life technologies, Inc., product code CP-H166.

Example 1 construction of CRISPR expression vectors

1.1 selection and design of gRNAs targeting the human CKIP1 Gene

The sequence of human CKIP1 gene is searched on Genebank, a target site is designed on the exon 6, and a proper target site is searched by an online design tool (http:// crispr. mit. edu /) and the design principle of gRNA, wherein the sequence is as follows:

CKIP1-sgRNA1：5’to 3’TGAGAGCTTTCGGGTTGACCTGG

CKIP1-sgRNA2：5’to 3’GGTCTGAGTCCGCTCTCCGCCGG

CKIP1-sgRNA3：5’to 3’ACTGCTTGCCCGGTCTGCGGAGG

CKIP1-sgRNA4：5’to 3’AAGCAGTCTCTCCCGACCTTGGG

CKIP1-sgRNA5：5’to 3’CAGAATCCGGCGGAGACCGAGGG

CKIP1-sgRNA6：5’to 3’CCGGTACTGACTGTGCGGGGTGG

according to the above gRNA, a forward oligonucleotide sequence was obtained by adding CACC to the 5 'end of the gRNA, and a reverse oligonucleotide sequence was obtained by adding AAAC to the 5' end of the complementary strand, and the forward and reverse oligonucleotide sequences were synthesized, respectively. Forward direction: 5' -CACCGNNNNNNNNNNNNNNNNNNNN reverse: CNNNNNNNNNNNNNNNNNNNNCAAA-5' design of the corresponding oligonucleotide sequence SEQ ID NO: 3-SEQ ID NO: 14 (i.e., sgRNA 1-6).

1.2 Synthesis of gRNA oligonucleotide sequence of targeting CKIP1 Gene and construction of eukaryotic expression vector

1.2.1 Using BbsI endonuclease, pSpCas9(BB) -2A-GFP (PX458) plasmid (Addgene plasmid ID:48138, hereinafter abbreviated as pX458) was digested in water bath at 37 ℃ for 1 hour, after completion, 1% agarose gel electrophoresis was performed, and linearized fragments were recovered using DNA gel recovery kit (Wan Biol.). The enzyme digestion system is as follows:

FD BbsI(FD BpiI)	1μL
		10×FD buffer	5μL
pX458	10μL(500ng/μL)
		ddH₂O	34μL
total up to	50μL

1.2.2 sequencing the target sequence as SEQ ID NO: 3-SEQ ID NO: 14, annealing the corresponding oligonucleotide chains to form short double-stranded DNA with sticky ends, and reacting in the following system:

and (3) uniformly mixing the reaction system in a 200 mu L PCR tube, centrifuging the mixture for a short time to the bottom of the PCR tube, and slowly annealing the PCR tube in a PCR instrument according to the following procedures:

37℃	30min
		95℃	5min
95℃～22℃	-1.5℃/min

1.2.3 the annealed Oligo double strand and the digested linearized pX458 of BbsI were ligated overnight at 16 ℃ in the following reaction system:

product recovered by enzyme digestion	1μL
		Annealed product	1μL
T4 DNA Ligase	1μL
		T4 Ligase buffer	1μL
ddH₂O	6μL
		Total of	10μL

1.2.4 the ligated product was transformed into competent E.coli DH 5. alpha. cells, spread evenly on LB solid medium plates containing 100. mu.g/mL ampicillin, and cultured overnight in a 37 ℃ incubator to give single colonies.

1.3 picking single colony for amplification culture and extracting plasmid

1.3.1 prepare several 200. mu.L sterile PCR tubes containing 20. mu.L sterile water and label, pick single colony from the overnight-cultured medium plate, mix well with sterile water in the PCR tubes, transfer 2. mu.L of the above bacterial suspension to another empty sterile PCR tube, and formulate a PCR reaction system according to the following table, mix all components and centrifuge briefly to the bottom of the tube:

bacterial suspension	2μL
		2×PCR master Mix	12.5μL
Upstream primer hU6F	1μL
		Downstream primer Oligo (-)	1μL
ddH₂O	8.5μL
		Total of	25μL

And (3) putting the PCR reaction system into a PCR instrument, and carrying out PCR amplification according to the following procedures:

1.3.2 taking the PCR product to carry out 2% agarose gel electrophoresis verification, inoculating the corresponding residual bacterial suspension of the amplified target band into LB liquid culture medium containing 100 mug/mL ampicillin, and culturing for 12-16h at the temperature of 37 ℃ at 200 r/min.

1.3.3 the above bacterial solution (5 mL) was collected and subjected to endotoxin-free plasmid miniprep kit (omega, E.Z.N.A.).

Endo-Free Plasmid Mini Kit I) instructions for Plasmid extraction.

Using the above procedure, a total of 6 endotoxin-free gene-editing plasmids were obtained.

Example 2 establishment of model of CKIP-1 Gene knockout mesenchymal Stem cell

2.1 conventional recovery and passaging of human mesenchymal stem cells at 2 × 10⁵And inoculating each cell/well into a 6-well culture plate, and respectively transfecting the cells by adopting 6 plasmids when the cells grow to 60-70 percent of fusion degree, wherein the specific steps are as follows:

solution 1: Opti-MEM 100uL + lip 30006. mu.L, solution 2: Opti-MEM 100. mu.L + DNA 2. mu.g + p 30005. mu.L. Adding the solution 1 into the solution 2, and standing for 10-15min at room temperature.

Slowly dropping the mixture into cells, shaking gently, and placing the cells at 37 deg.C with 5% CO₂Culturing in an incubator, adding pancreatin digestion adherent cells after transfection for 48h, centrifuging and collecting, discarding waste liquid, adding 1mL PBS buffer solution to resuspend the cells, taking 500 mu L of the cells and putting the 500 mu L of the cells into an original six-hole plate for continuous culture, putting the rest cells into a 1.5mL centrifuge tube, operating according to the instruction of a tissue genome DNA small-amount purification kit (Wanyi organisms), and extracting genome DNA.

2.2 after the genome is successfully extracted, the following PCR system is prepared in a sterile 200 mu LPCR tube and used for the amplification of the target gene:

genomic DNA	1μL
		2×PCR master Mix	12.5μL
Upstream primer CKIP-1.F	1μL
		Downstream primer CKIP-1.R	1μL
ddH₂O	9.5μL
		Total of	25μL

Mixing the reaction system uniformly, centrifuging the mixture to the bottom of the tube for a short time, putting the tube into a PCR instrument, and amplifying the mixture according to the following procedures:

2.3 purification of the PCR product, sequencing and analysis of the sequencing results, see FIG. 4. The results show that SEQ id no: 7, a sequencing peak map shows disordered overlapping peaks from 119 th base (corresponding to the mutation hot spot position of sgRNA), and the results show that the sequence of SEQ ID NO: the sgRNA plasmid corresponding to 7 has a good gene editing effect on human CKIP-1.

And 2.4, diluting and culturing the plasmid transfected cells with good gene editing effect, sorting the cells with GFP marks by using a flow cytometer, counting, inoculating 1 cell per well into a 96-well culture plate, carrying out amplification culture, observing fluorescence under a microscope, and identifying cell clones. Extracting cell DNA and carrying out target site PCR, connecting PCR product with T vector, transforming, selecting 2 positive clones, extracting plasmid, and sequencing, the result is shown in figure 5. The results showed that the target site sequence was SEQ ID NO: 7 gRNA can make target site generate frame shift mutation, and can establish stable and reliable CKIP-1 gene knockout MSCs model.

Finally, it should be noted that the above embodiments are only used for illustrating the technical solutions of the present invention and not for limiting, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

Sequence listing

<110> Shenyang Wan class Biotech Co., Ltd

<120> method for CKIP-1 gene knockout of mesenchymal stem cells by using CRISPR-Cas9 system

<160>14

<170>SIPOSequenceListing 1.0

<210>1

<211>26

<212>DNA

<213> human (Homo sapiens)

<400>1

gaccttggac ttgatccaag aggaag 26

<210>2

<211>26

<212>DNA

<213> human (Homo sapiens)

<400>2

gtggagtggt cagactgtgt ctttac 26

<210>3

<211>25

<212>DNA

<213> human (Homo sapiens)

<400>3

caccgtgaga gctttcgggt tgacc 25

<210>4

<211>25

<212>DNA

<213> human (Homo sapiens)

<400>4

aaacggtcaa cccgaaagct ctcac 25

<210>5

<211>25

<212>DNA

<213> human (Homo sapiens)

<400>5

caccgggtct gagtccgctc tccgc 25

<210>6

<211>25

<212>DNA

<213> human (Homo sapiens)

<400>6

aaacgcggag agcggactca gaccc 25

<210>7

<211>25

<212>DNA

<213> human (Homo sapiens)

<400>7

caccgactgc ttgcccggtc tgcgg 25

<210>8

<211>25

<212>DNA

<213> human (Homo sapiens)

<400>8

aaacccgcag accgggcaag cagtc 25

<210>9

<211>25

<212>DNA

<213> human (Homo sapiens)

<400>9

caccgaagca gtctctcccg acctt 25

<210>10

<211>25

<212>DNA

<213> human (Homo sapiens)

<400>10

aaacaaggtc gggagagact gcttc 25

<210>11

<211>25

<212>DNA

<213> human (Homo sapiens)

<400>11

caccgcagaa tccggcggag accga 25

<210>12

<211>25

<212>DNA

<213> human (Homo sapiens)

<400>12

aaactcggtc tccgccggat tctgc 25

<210>13

<211>25

<212>DNA

<213> human (Homo sapiens)

<400>13

caccgccggt actgactgtg cgggg 25

<210>14

<211>25

<212>DNA

<213> human (Homo sapiens)

<400>14

aaacccccgc acagtcagta ccggc 25

Claims

1. A CRISPR-Cas9 targeted CKIP-1 gene knockout and a specific sgRNA thereof are characterized in that the sgRNA of the 6 th exon of the specific targeted CKIP-1 gene is firstly designed and obtained; secondly, sgRNA of the CKIP-1 gene is constructed to an expression vector system, and then the vector system is transfected into mesenchymal stem cells to obtain a CKIP-1 gene knockout cell strain.

2. The sgRNA of claim 1, having a DNA sequence as set forth in seq id NO: 7 and SEQ ID NO: 8, the sgRNA is unique in target sequence on CKIP-1 gene.

3. The sgRNA of claim 2 that specifically targets exon 6 of the CKIP-1 gene, wherein the primers comprise a primer pair directed at exon 6 of the CKIP-1 gene:

CKIP-1. F: as shown in SEQ ID NO: 1 is shown in the specification;

CKIP-1. R: as shown in SEQ ID NO: 2, respectively.

4. The system for constructing sgRNA of CKIP-1 gene to an expression vector according to claim 1, which is a CRISPR-Cas9 recombinant expression vector pSpCas9(BB) -2A-GFP (PX458) for targeting to knock-out CKIP-1 gene, and is characterized in that: a recombinant expression vector containing sgRNA specifically targeting exon 6 of CKIP-1 gene and Cas9 protein.

5. The system of claim 4, wherein: can be introduced into gene editing cells and screened to obtain positive cells.

6. Use of the system of claim 4 in the preparation of an agent for mesenchymal stem cell gene editing.

7. The use of claim 6, wherein the mesenchymal stem cells are human mesenchymal stem cells (hMSCs) CP-H166.