CN111778252B - SgRNA for targeted knockout of SST gene, CRISPR/Cas9 system and application thereof - Google Patents

Abstract

The invention provides a sgRNA for targeted knockout of SST genes, a CRISPR/Cas9 system and application thereof, belonging to the technical field of gene knockout. The invention provides an sgRNA for targeted knockout of an SST gene, which comprises SST sgRNA1 and SST sgRNA2, and also provides a CRISPR/Cas9 system containing the sgRNA. The CRISPR/Cas9 system is transfected into porcine kidney fibroblasts, positive cells obtained by screening are obtained, high gene deletion efficiency is obtained, meanwhile, the CRISPR/Cas9 system can improve the growth speed of pigs by carrying out complete gene knockout on porcine SST genes, so that the economic benefit of pig raising industry is improved, and meanwhile, the CRISPR/Cas9 system has very important significance for further researching the functions of the SST genes and the correlation between the SST genes and certain diseases.

Description

SgRNA for targeted knockout of SST gene, CRISPR/Cas9 system and application thereof

Technical Field

The invention belongs to the technical field of gene knockout, and particularly relates to sgRNA for targeted knockout of SST genes, a CRISPR/Cas9 system and application thereof.

Background

The SST gene is located on a pig chromosome 13, has the length of 1183bp and comprises 2 exons. It is currently believed that the primary function of SSTs in mammals is to regulate animal growth by inhibiting the secretion of growth hormones through either direct or indirect action. In animal husbandry production, measures are adopted to reduce the content of the SST in an animal body, weaken or eliminate the inhibition of the SST on a digestive system, and relieve the inhibition of the SST on growth hormone and insulin-like growth factor 1, so that the growth speed and the body size of the animal are improved. However, these inhibition measures are not suitable for fundamental long-term inhibition studies.

The CRISPR-Cas9 gene editing technology is that after a specific DNA sequence is identified through a short single-stranded guide RNA (sgRNA), Cas9 protein is guided to be positioned on the specified DNA sequence to be cut to form a double-strand break, and then non-homologous end connection or homologous recombination is carried out on the double-strand break region to repair the damaged sequence, so that the directional modification of genome DNA is realized.

At present, the CRISPR-Cas9 system is widely applied as a gene editing tool, overcomes the defects of complicated steps, long time consumption, low efficiency and the like of the traditional gene editing technology, and meets the gene editing requirements in most fields by using fewer components, convenient operation and higher efficiency. However, the deletion effect of the CRISPR-Cas9 system in the prior art is yet to be further improved.

Disclosure of Invention

In view of the above, the present invention aims to provide an sgRNA with a targeted knockout SST gene, which has high specific binding to an SST gene.

The invention also aims to provide a CRISPR/Cas9 system for targeted knockout of the SST gene, which has higher deletion rate of the SST gene and can be used for SST gene silencing of porcine cell strains.

The invention provides an sgRNA for targeted knockout of an SST gene, which comprises an SST sgRNA1 and an SST sgRNA 2;

the nucleotide sequence of the SST sgRNA1 is shown in a sequence table SEQ ID No. 1;

the nucleotide sequence of the SST sgRNA2 is shown in a sequence table SEQ ID No. 2.

The invention provides a CRISPR/Cas9 system for targeted knockout of SST genes, wherein the CRISPR/Cas9 system comprises the sgRNA.

The invention provides a construction method of the CRISPR/Cas9 system, which comprises the following steps:

1) digesting a CRISPR/Cas9 vector pSpCas9(BB) -2A-Puro by BbsI to obtain a linearized expression vector;

2) the SST sgRNA1 and SST sgRNA2 of the targeted knockout SST gene are respectively connected with an enzyme-digested pSpCas9(BB) -2A-Puro vector to obtain pSpCas9(BB) -2A-Puro-SST sgRNA1 and pSpCas9(BB) -2A-Puro-SST sgRNA2 of the targeted knockout SST gene, and a CRISPR/Cas9 system of the targeted knockout SST gene is constructed.

The invention provides a kit for targeted knockout of SST genes, which comprises the CRISPR/Cas9 system.

The invention provides an application of the CRISPR/Cas9 system or the kit in preparation of a cell strain with an SST gene knocked out.

Preferably, the cell line comprises porcine kidney fibroblasts.

Preferably, the knockout fragment of the SST gene is shown as SEQ ID No. 3.

Preferably, the preparation method of the cell strain with the SST gene knocked out comprises the steps of transfecting the CRISPR/Cas9 system with the SST gene knocked out in a targeted mode into the cell strain, and obtaining the cell strain with the SST gene knocked out through positive screening.

The invention provides application of the CRISPR/Cas9 system or the kit in livestock production.

The invention provides an identification method of double sgRNA site targeted knockout SST genes, which comprises the following steps:

extracting the genome DNA of the cell to be detected;

performing PCR amplification by using the genome DNA as a template and an amplification primer pair, detecting a PCR amplification product, wherein the length of a wild type fragment is 416bp, and the length of a fragment subjected to gene knockout is 380 bp; in the amplification primer pair, the nucleotide sequence of the upstream primer is shown as SEQ ID No. 4; the nucleotide sequence of the downstream primer is shown as SEQ ID No. 5.

The invention provides an sgRNA for targeted knockout of an SST gene, which comprises SST sgRNA1 and SST sgRNA 2. The SST sgRNA1 and the SST sgRNA2 both use the first exon as a targeting region, can quickly and efficiently target SST genes, and provide guarantee for the subsequent realization of the functional inactivation of the SST genes.

The invention provides a CRISPR/Cas9 system for targeted knockout of SST genes, wherein the CRISPR/Cas9 system comprises the sgRNA. The CRISPR/Cas9 system is transfected into porcine kidney fibroblasts, positive cells obtained by screening are selected to obtain 13 monoclonals in total, 11 positive cells with SST deletion mutation are detected, the deletion efficiency is 78.6%, 4 monoclonals are deleted, 7 biallels are deleted, and the biallel deletion efficiency is 53.8%.

Meanwhile, the CRISPR/Cas9 system provided by the invention carries out complete gene knockout on the SST gene of the pig, can improve the growth speed of the pig, thereby improving the economic benefit of the pig raising industry, and therefore, the CRISPR/Cas9 system can be applied to livestock breeding; on the other hand, the CRISPR/Cas9 system is of great significance for further research on the function of SST genes and the correlation between SST genes and certain diseases.

Drawings

FIG. 1 is a schematic representation of the targeted location of porcine SST-sgRNA1 and SST-sgRNA2 on the porcine genome;

fig. 2 is a schematic diagram of a Cas9 sgRNA expression vector with a guide sequence inserted;

FIG. 3-A shows the restriction electrophoretogram of pSpCas9(BB) -2A-Puro-SST sgRNA1 and pSpCas9(BB) -2A-Puro-SST sgRNA2 plasmids; wherein M is DNA marker; 1 is pSpCas9(BB) -2A-Puro-SST sgRNA1 plasmid; 2 is a linearized pSpCas9(BB) -2A-Puro-SST sgRNA1 plasmid; 3 is pSpCas9(BB) -2A-Puro-SST sgRNA2 plasmid; 4 is linearized pSpCas9(BB) -2A-Puro-SST sgRNA 2; FIG. 3-B is a sequencing plot of the plasmids pSpCas9(BB) -2A-Puro-SST sgRNA1 and pSpCas9(BB) -2A-Puro-SST sgRNA 2;

FIG. 4 is a morphological picture of isolated primary porcine kidney fibroblasts under microscopic observation;

FIG. 5 is a schematic diagram of deletion of an SST gene;

FIG. 6 is an electrophoresis image of PCR products of monoclonal cells.

Detailed Description

The invention provides an sgRNA for targeted knockout of an SST gene, which comprises an SST sgRNA1 and an SST sgRNA 2; the nucleotide sequence of the SST sgRNA1 is shown in a sequence table SEQ ID No. 1; the nucleotide sequence of the SST sgRNA2 is shown in a sequence table SEQ ID No. 2. The sgRNA of the invention takes a first exon as a targeting region, and the accurate positioning of two sites of porcine SST sgRNA1 and SST sgRNA2 on the porcine genome is on the No.1 exon of the SST coding region of No.13 chromosome (see figure 1). The design conditions are as follows: the length of sgRNA is 20nt, and the core sequence is NNNNNNNNNNNNNNNNNNNN (20) -NGG (SEQ ID No. 6); adding CACCG at the 5 'end of the sense strand template, and adding AAAC at the 5' end of the antisense strand template to make the oligonucleotide chain complementary with the cohesive tail end of the vector plasmid. CACC is added at the 5 'end of the coding strand template, AAAC is added at the 3' end of the non-coding strand template, and the CACC and the AAAC are complementary with a sticky end formed after BbsI enzyme digestion, so that 2 pairs of CRISPR oligonucleotide chains are designed. The SST targeting site and the sgRNA oligonucleotide sequence are sequentially an SST-sgRNA1oligo coding strand (SEQ ID No.7, CACCGGCCGCGCTCTCCATCGTCC), an SST-sgRNA1oligo non-coding strand (SEQ ID No.8, AAACGGACGATGGAGAGCGCGGCC), an SST-sgRNA2oligo coding strand (SEQ ID No.9, CACCGTGACGGAGTCGGGGATCCGA) and an SST-sgRNA2oligo non-coding strand (SEQ ID No.10, AAACTCGGATCCCCGACTCCGTCAC). The source of the sgRNA is not particularly limited in the present invention, and any sgRNA known in the art may be used, for example, it is synthesized by entrusted gene synthesis.

The invention provides a CRISPR/Cas9 system for targeted knockout of SST genes, wherein the CRISPR/Cas9 system comprises the sgRNA. According to the invention, after the specific DNA sequence of the SST gene is specifically identified by utilizing the targeting property of the sgRNA, the Cas9 protein is guided to be positioned on the DNA sequence of the SST gene for cutting to form double-strand break, so that the normal biological function of the gene is prevented, the inhibition of the SST on growth hormone and insulin-like growth factor 1 is relieved, and the growth speed and the body size of an animal are further improved.

The invention provides a construction method of the CRISPR/Cas9 system, which comprises the following steps:

1) digesting a CRISPR/Cas9 vector pSpCas9(BB) -2A-Puro by BbsI to obtain a linearized expression vector;

2) the SST sgRNA1 and SST sgRNA2 of the targeted knockout SST gene are respectively connected with an enzyme-digested pSpCas9(BB) -2A-Puro vector to obtain pSpCas9(BB) -2A-Puro-SST sgRNA1 and pSpCas9(BB) -2A-Puro-SST sgRNA2 of the targeted knockout SST gene, and a CRISPR/Cas9 system of the targeted knockout SST gene is constructed.

In the present invention, the pSpCas9(BB) -2A-Puro is available from Addgene. The method for digesting the BbsI is not particularly limited, and a BbsI digestion method known in the art can be adopted. The method of the present invention is not particularly limited, and any method known in the art may be used. After the ligation, the ligation product is preferably screened, and the plasmid containing the target fragment is verified to be a positive plasmid through PCR amplification. The copy ratio of pSpCas9(BB) -2A-Puro-SST sgRNA1 to pSpCas9(BB) -2A-Puro-SST sgRNA2 is preferably 1: 1. The pSpCas9(BB) -2A-Puro-SST sgRNA1 and pSpCas9(BB) -2A-Puro-SST sgRNA2 respectively take pSpCas9(BB) -2A-Puro vector as a framework, and an expression vector with the sequences of hspCs 9 gene, CRISPRRArraray and tracrRNA (see figure 2) is adopted.

The invention provides a kit for targeted knockout of SST genes, which comprises the CRISPR/Cas9 system. The kit preferably further comprises a reagent for transfection and a reagent for identification of a knock-out gene. The transfection reagent includes a common transfection reagent. The reagent for identifying a knocked-out gene preferably includes a PCR amplification primer pair, a reagent for PCR amplification, and the like. The nucleotide sequence of the upstream primer of the PCR amplification primer pair is shown as SEQ ID No. 4; the nucleotide sequence of the downstream primer is shown as SEQ ID No. 5. In the invention, the use method of the kit preferably comprises the steps of transfecting the CRISPR/Cas9 system for targeting the knockout of the SST gene into a cell strain, and obtaining the cell strain for knocking out the SST gene through positive screening. Preferably, the method also comprises the step of performing PCR amplification identification on the obtained cell strain by using a reagent for identifying the knocked-out gene, wherein the length of a wild type fragment is 416bp (SEQ ID No.11, ACGAGGGTAATGGTGCGTAAAAGCGCTGGTGAGATCTGGGGGCGCCTCCTAGTCTGACGTCAGAGAGAGAGTTTAAAAAGGGGGAGACGGTGGCGAGCGCACAAGCCGCTTCAGGAGTCGCGAGGTTCAGAGCCGTCGCTGCTGCCTGCAAATCGACTCCTAGAGTTTGACCAACCGCGCTCTAGCTCGGCTTCTCTGGCCGCTGCCGAGATGCTGTCCTGCCGCCTCCAGTGCGCGCTGGCCGCGCTCTCCATCGTCCTGGCTCTGGGCGGTGTCACTGGCGCGCCCTCGGATCCCCGACTCCGTCAGTTTCTGCAGAAGTCCCTGGCTGCTGCCGCTGGGAAGCAGGTAAGGAGACTCCCTCGACGCCTTCTTTCCCCTCTCGCGAATCCCCTAACCTTACCTTAGCCTTGCCC, and the length of the fragment after gene knockout is 380bp (SEQ ID No.12, ATCCCCGACTCCGTCAGTTTCTGCAGAAGTCCCTGGCTGCTGCCGCTGGGAAGCAGGTAAGGAGACTCCCTCGACGCCTTCTTTCCCCTCTCGCGAATCCCCTAACCTTACCTTAGCCTTGCCCACGAGGGTAATGGTGCGTAAAAGCGCTGGTGAGATCTGGGGGCGCCTCCTAGTCTGACGTCAGAGAGAGAGTTTAAAAAGGGGGAGACGGTGGCGAGCGCACAAGCCGCTTCAGGAGTCGCGAGGTTCAGAGCCGTCGCTGCTGCCTGCAAATCGACTCCTAGAGTTTGACCAACCGCGCTCTAGCTCGGCTTCTCTGGCCGCTGCCGAGATGCTGTCCTGCCGCCTCCAGTGCGCGCTGGCCGCGCTCTCCATCG), and the condition of gene knockout is judged according to the length of the PCR amplified fragment.

The invention provides an application of the CRISPR/Cas9 system or the kit in preparation of a cell strain with an SST gene knocked out. The invention is applicable to all eukaryotic cells, and for the purpose of illustrating the preparation method, the examples of the invention are described in detail by taking porcine kidney fibroblasts as an example. The knockout fragment of the SST gene is preferably shown as SEQ ID No.3 (TCCTGGCTCTGGGCGGTGTCACTGGCGCGCCCTCGG). According to the preparation method of the cell strain with the SST gene knocked out, the CRISPR/Cas9 system with the SST gene knocked out in a targeted mode is preferably transfected into the cell strain, and the cell strain with the SST gene knocked out is obtained through positive screening.

The invention provides application of the CRISPR/Cas9 system or the kit in livestock production. In the livestock production, the CRISPR/Cas9 system or the kit blocks the normal biological function of the gene by targeting the SST gene, relieves the inhibition of the SST on growth hormone and insulin-like growth factor 1, and is helpful for improving the growth speed and the body size of animals.

The invention provides an identification method of double sgRNA site targeted knockout SST genes, which comprises the following steps: extracting the genome DNA of the cell to be detected;

performing PCR amplification by using the genome DNA as a template and an amplification primer pair, detecting a PCR amplification product, wherein the length of a wild type fragment is 416bp, and the length of a fragment subjected to gene knockout is 380 bp; in the amplification primer pair, the nucleotide sequence of the upstream primer is shown as SEQ ID No. 4; the nucleotide sequence of the downstream primer is shown as SEQ ID No. 5.

The method for extracting the genomic DNA of the cell to be tested is not particularly limited in the present invention, and an extraction method known in the art, for example, a kit, may be used.

In the invention, the PCR amplification system is as follows: premix Taq 10. mu.L, SST-E1-F1. mu.L, SST-E1-R1. mu.L, DNA template 2. mu.L, ddH₂O6 mu L; the PCR amplification reaction program comprises pre-deformation at 94 ℃ for 2min, denaturation at 94 ℃ for 30s, annealing at 57 ℃ for 30s, extension at 72 ℃ for 30s, 30 cycles and total extension at 72 ℃ for 5 min. The double sgRNAs are used as the target RNA, and compared with the single sgRNA, the double sgRNA has the function of more efficiently targeted silencing SST gene, and obtains higher gene deletion efficiency.

The sgRNA targeting to knock-out SST gene and the CRISPR/Cas9 system and application thereof provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

Example 1

Construction of Cas9 sgRNA knockout plasmid

1.1 selection and Synthesis of sgRNA

Selecting a first exon of a porcine SST gene (GenBank accession number: NC-010455.5) as a targeting region, and designing sgRNA for the targeting region by using a website (http:// crispor.tefor.net), wherein the design conditions are as follows: the length of sgRNA is 20nt, and the core sequence is NNNNNNNNNNNNNNNNNNNN (20) -NGG (SEQ ID No. 6); adding CACCG at the 5 'end of the sense strand template, and adding AAAC at the 5' end of the antisense strand template to make the oligonucleotide chain complementary with the cohesive tail end of the vector plasmid. Finally, two suitable targets were selected, namely SST-sgRNA1 and SST-sgRNA 2. CACC is added at the 5 'end of the coding strand template, AAAC is added at the 3' end of the non-coding strand template, and the CACC and the AAAC are complementary with a sticky end formed after BbsI enzyme digestion, so that 2 pairs of CRISPR oligonucleotide chains are designed.

SST targeting site and sgRNA oligonucleotide sequences:

example 2

Vector construction

1.2.1 digestion of pSpCas9(BB) -2A-Puro plasmid with BbsI, the reaction system is as follows:

composition (I)	Adding amount of
		pSpCas9(BB) -2A-Puro plasmid	1μg
BbsI enzyme	2μL
		FDbuffer	2μL
ddH2O	To 50 μ L
		Total	50μL

The preparation method comprises the steps of adding the components in sequence on ice, fully and uniformly mixing, and carrying out enzyme digestion in a circulating water bath at 37 ℃ for 2 hours.

1.2.2 recovery of the cleavage products according to Novozam gel recovery kit instructions.

1.2.3 sgRNA oligo annealing and double strand formation

Each pair of oligonucleotides synthesized by the company was diluted to 10. mu. mol/L and mixed in the following ratio: 16 μ L ddH₂O, 2. mu.L of 10 XNEB Buffer 3, 1. mu.L of sense strand and 1. mu.L of antisense strand, mixing, denaturing at 95 ℃ for 5min, and then naturally annealing at room temperature for 1h to form double strands.

1.2.4 pSpCas9(BB) -2A-Puro-SST sgRNA plasmid construction

The oligonucleotide double strands SST sgRNA1 and SST sgRNA2 were linked to linearized pSpCas9(BB) -2A-Puro, respectively, in a ligation reaction system: 1 μ L of linearized PX459, 3 μ L of annealing product, 5 μ L of Solution I, plus ddH₂O to 10. mu.L. Mixing the above components thoroughly, placing in 37 deg.C water bath, and connecting for 2 h; after ligation was complete, the plates were placed on ice for transformation.

1.2.5 transformation of E.coli DH 5. alpha

Adding 5 mu L of the ligation product into 50 mu L of competent cell DH5 alpha, flicking and uniformly mixing, carrying out ice standing for 30min, carrying out heat shock at 42 ℃ for 90s, taking out and carrying out ice standing for 5min, adding 1mL of antibody-free culture medium, shaking for resuscitation for 45min, coating on a plate containing an aminobenzyl antibody, selecting a monoclonal antibody for continuous culture, carrying out enzyme digestion verification after plasmid extraction, and detecting whether the ligation is correct through sequencing, wherein the sequencing primer is universal primer U6. FIG. 3 shows the results of plasmid digestion and sequencing. As can be seen from FIG. 3, recombinant plasmids were successfully constructed and designated pSpCas9(BB) -2A-Puro-SST sgRNA1 and pSpCas9(BB) -2A-Puro-SST sgRNA2, respectively.

Example 3

Electroporation transfection of porcine kidney fibroblasts

1.1 Primary reagents and materials

1-3 days old male large white piglets come from the experimental pig farm of the animal husbandry and veterinary research institute of agricultural academy of sciences of Hubei province; the G418 antibiotic was purchased from Sigma; DMEM, DPBS, fetal bovine serum, DMSO and other cell culture and cryopreservation reagents were purchased from Gibco. Electrotransfer buffer was self-prepared by the laboratory.

1.2 isolation and culture of pig Kidney fibroblasts

Taking 1 newborn male big white pig of 1-3 d, and carrying out deep anesthesia by intraperitoneal injection of pentobarbital sodium (50 mg); the body surface of the big white pig is fully cleaned and disinfected by 75 percent alcohol, then the kidneys on the two sides are taken out by using a sterilized medical surgical instrument in an aseptic operation mode, soaked in the 75 percent alcohol and moved to a super-clean workbench.

The kidneys were repeatedly washed with DPBS containing 2% antibiotics (penicillin 132mg/L, streptomycin 200mg/L), then the kidney envelope was carefully peeled off with surgical scissors and then soaked in 75% alcohol for about 30 seconds to adequately disinfect and avoid contamination. Kidney was washed 2 times with DPBSPlacing the tissue into a cell culture dish with a diameter of 60mm, and shearing the tissue into a size of about 1mm by an ophthalmic scissors³The small pieces of tissue.

Small pieces of tissue were dispensed into six well plates, approximately 9 pieces per well, and the surrounding tissue was aspirated as dry as possible. Inverting in a constant temperature incubator for 4h, adding 500 μ L of culture medium containing 15% serum and 1% double antibody when the tissue block is tightly adhered to the bottom of the culture dish. At 39 ℃ 5% CO₂After 24h of incubation in the cell culture incubator, 2mL of complete medium was added. Observing the morphology and growth state of the cells every day, and changing the liquid according to the state of the cells to prevent the cells from being polluted. After about 7 days of culture, the fibroblasts grow into pieces around the tissue block, and when the confluence degree gradually reaches 90%, the tissue block is picked up to obtain primary cells. The growth state of the kidney fibroblast is good and fusiform, and the cell is transparent and has clear edge when being observed under a microscope. After passage, the growth is rapid, and the six-hole plate can grow over 2-3 days. After the cells are digested one day before transfection and passaged, the cells are in a logarithmic growth phase at the time of transfection, the activity is best, and the transfection effect is best (see figure 4).

1.3 culture and electroporation transfection of porcine kidney fibroblasts

DMEM medium containing 15% fetal calf serum and 1% double antibody in CO₂Fibroblasts were cultured in an incubator at 37 ℃ at a concentration of 5%. One day before transfection, digesting porcine kidney fibroblasts into single cell suspension by pancreatin according to the proportion of 0.25-1 × 10⁶Cells/well cells were seeded in 6-well plates and were co-transfected with two recombinant plasmids by electroporation when the cells were in logarithmic growth phase with confluence at around 80%, without experiments in which the two plasmids were separately transfected. The transfection conditions were 120V/cm, the pulse time was 3ms, and the plasmid addition was 4 mg/mL.

1.4 puromycin screening

After 48h of cell transfection, the cells were re-inoculated to make about 10000 cells per well in the six-well plate, and the cells were recovered to a better state by continuing the culture. After further culturing for 48 hours, the medium was replaced with a new one, puromycin was added at a puromycin concentration of 1.75 ng/. mu.L, and the survival state of the cells was observed every day. Adding puromycin for about 72h, replacing with new culture medium without puromycin, extracting DNA of cells, and performing PCR detection.

1.5 screening and culture of monoclonal cells

After the individual cells screened by puromycin proliferated into cell masses, the cell masses were observed under a microscope with an appropriate size, and the positions of the cell masses were marked on the bottom of the culture dish with a marker pen. The medium was removed and washed twice with DPBS. A cloning ring was picked up with sterile forceps, the bottom of the cloning ring was stained with sterile petrolatum, the cloning ring was gently placed on a selected clone, and pressed evenly with forceps until the cloning ring was stable on a petri dish and sealed. Add 50. mu.L of 0.25% pancreatin to the cloning ring, add 100. mu.L of medium when the cells begin to round, blow up the cells and aspirate into a 96-well plate, add 100. mu.L of medium to the cloning ring, add to the corresponding well after aspiration. And 2d, replacing the culture medium once, and carrying out passage to a 24-well plate after the cells in the 96-well plate grow to full, and finally carrying out passage to a 6-well plate.

Example 4

Genotyping of monoclonal cells

DNA of untransfected cells, cells 48h after transfection, and the above-prepared monoclonally propagated cells were extracted for PCR amplification, respectively. Primers were designed on both sides of the first exon, and the sequences were SST-E1-F: 5'-ACGAGGGTAATGGTGCGTAA-3' (SEQ ID No.4), SST-E1-R: 5'-CCTTACCTTAGCCTTGCCC-3' (SEQ ID No.5) wild type fragment 416bp, edited fragment 380 bp. The PCR amplification system is as follows: premix Taq 10. mu.L, SST-E1-F1. mu.L, SST-E1-R1. mu.L, DNA template 2. mu.L, ddH₂O6 mu L, pre-deforming for 2min at 94 ℃; the reaction procedure is as follows: denaturation at 94 ℃ for 30s, annealing at 57 ℃ for 30s, extension at 72 ℃ for 30s, 30 cycles, and total extension at 72 ℃ for 5 min. The PCR amplification products were separated by electrophoresis on a 2.5% agarose gel at 90V and the PCR products from the monoclonal cells were sent to the company for sequencing.

The gene deletion positions are shown in FIG. 5. The sequencing result shows that the nucleotide sequence of the silenced SST gene is shown as SEQ ID No.12, and the nucleotide sequence of the wild type SST gene is shown as SEQ ID No. 11.

Statistical Gene deletion efficiency

A total of 13 single clones were selected from the above experiments, and the electrophoresis results of the PCR products are shown in FIG. 6. Primers are designed on both sides of the sgRNA1 and the sgRNA2 target points, and a fragment between the two target points is amplified. Lane 1 is 100bp DNA Ladder, and lanes 2-14 are the amplification results of the selected monoclonal cell template. Two of the clones (lanes 2 and 3) had no fragment deletion, four clones (lane 4/5/6/7) had a single allele deletion, and seven clones (lane 8/9/10/11/12/13/14) had a double allele deletion. The results showed that 11 positive cells with 78.6% deletion efficiency (11/13) were detected for the deletion mutation of SST, 4 of which were single allele deletions and 7 of which were biallelic (single allele deletion means deletion of the gene on one of the pair of homologous chromosomes, the other allele not being deleted; biallelic deletion means deletion of both alleles controlling expression of SST on the pair of homologous chromosomes), and 53.8% biallelic deletion efficiency (7/13).

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> institute of zootechnics of academy of agricultural sciences of Hubei province

<120> sgRNA for targeted knockout of SST gene, CRISPR/Cas9 system and application thereof

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tgacggagtc ggggatccga 20

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gccgcgctct ccatcgtcc 19

<210> 3

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tcctggctct gggcggtgtc actggcgcgc cctcgg 36

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

acgagggtaa tggtgcgtaa 20

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ccttacctta gccttgccc 19

<210> 6

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

nnnnnnnnnn nnnnnnnnnn ngg 23

<210> 7

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

caccggccgc gctctccatc gtcc 24

<210> 8

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aaacggacga tggagagcgc ggcc 24

<210> 9

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

caccgtgacg gagtcgggga tccga 25

<210> 10

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

aaactcggat ccccgactcc gtcac 25

<210> 11

<211> 416

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

acgagggtaa tggtgcgtaa aagcgctggt gagatctggg ggcgcctcct agtctgacgt 60

cagagagaga gtttaaaaag ggggagacgg tggcgagcgc acaagccgct tcaggagtcg 120

cgaggttcag agccgtcgct gctgcctgca aatcgactcc tagagtttga ccaaccgcgc 180

tctagctcgg cttctctggc cgctgccgag atgctgtcct gccgcctcca gtgcgcgctg 240

gccgcgctct ccatcgtcct ggctctgggc ggtgtcactg gcgcgccctc ggatccccga 300

ctccgtcagt ttctgcagaa gtccctggct gctgccgctg ggaagcaggt aaggagactc 360

cctcgacgcc ttctttcccc tctcgcgaat cccctaacct taccttagcc ttgccc 416

<210> 12

<211> 380

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

atccccgact ccgtcagttt ctgcagaagt ccctggctgc tgccgctggg aagcaggtaa 60

ggagactccc tcgacgcctt ctttcccctc tcgcgaatcc cctaacctta ccttagcctt 120

gcccacgagg gtaatggtgc gtaaaagcgc tggtgagatc tgggggcgcc tcctagtctg 180

acgtcagaga gagagtttaa aaagggggag acggtggcga gcgcacaagc cgcttcagga 240

gtcgcgaggt tcagagccgt cgctgctgcc tgcaaatcga ctcctagagt ttgaccaacc 300

gcgctctagc tcggcttctc tggccgctgc cgagatgctg tcctgccgcc tccagtgcgc 360

gctggccgcg ctctccatcg 380

<210> 13

<211> 1183

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

atgctgtcct gccgcctcca gtgcgcgctg gccgcgctct ccatcgtcct ggctctgggc 60

ggtgtcactg gcgcgccctc ggatccccga ctccgtcagt ttctgcagaa gtccctggct 120

gctgccgctg ggaagcaggt aaggagactc cctcgacgcc ttctttcccc tctcgcgaat 180

cccctaacct taccttagcc ttgcccctcc tcccttgggt ggacttagga ggtggtccca 240

aagagtatcg gtgcttttct gggtccctta ggcaccaaat ctctcaggaa aactttcaaa 300

gtccagaatt cctttttacc tctttgtttt ttccctcttt gatcagcgca gtaggtcaca 360

gttcaggtga gttctttggc tttcaagaaa attctaagat ctggggaact gagctcgagg 420

ggatgatggc atctatccgc ggtgctgacc atgggaggtg ctgacccagg tgctgaaagc 480

gcggacctct gaagcttcct aagcagtacc tcccacccat gcagcagggc tgggggctga 540

agggcacaac agctagaaca caatatgttt acgactgtga aaagtcttgt ttcccacagt 600

tgatttagta aaaatggtaa gaacaattct attttgtagc tcatgatatg gaaattgagt 660

taaataaaat gttggcatat attttacctt tgctaactaa tgatgttcta tttctttcta 720

tgtgtgagtt ctaaacctgt agacactaaa accttgcaga aacatttgag tttttaaagc 780

ttccttgtgt aacttggtaa attataacaa cagccctgtt tttatatcct taacctattt 840

taagcattac acaaagtgca catagaaaat tgggggttgg atgtgattaa atctgttttt 900

taaaccaagc ttttccattt ctttttcact atcctcattc tcatccccct ccccctccca 960

ttccacacag gaactggcca agtacttctt ggcggagctg ctctctgaac ccaaccagac 1020

agagaacgat gccctggagc ctgaagattt gtcccaggct gctgagcagg atgaaatgag 1080

gctggagctg cagagatcag ctaactcaaa cccggccatg gcaccccgag aacgcaaagc 1140

tggctgcaag aatttcttct ggaagacttt cacatcctgt tag 1183

<210> 14

<211> 1147

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

atgctgtcct gccgcctcca gtgcgcgctg gccgcgctct ccatcgatcc ccgactccgt 60

cagtttctgc agaagtccct ggctgctgcc gctgggaagc aggtaaggag actccctcga 120

cgccttcttt cccctctcgc gaatccccta accttacctt agccttgccc ctcctccctt 180

gggtggactt aggaggtggt cccaaagagt atcggtgctt ttctgggtcc cttaggcacc 240

aaatctctca ggaaaacttt caaagtccag aattcctttt tacctctttg ttttttccct 300

ctttgatcag cgcagtaggt cacagttcag gtgagttctt tggctttcaa gaaaattcta 360

agatctgggg aactgagctc gaggggatga tggcatctat ccgcggtgct gaccatggga 420

ggtgctgacc caggtgctga aagcgcggac ctctgaagct tcctaagcag tacctcccac 480

ccatgcagca gggctggggg ctgaagggca caacagctag aacacaatat gtttacgact 540

gtgaaaagtc ttgtttccca cagttgattt agtaaaaatg gtaagaacaa ttctattttg 600

tagctcatga tatggaaatt gagttaaata aaatgttggc atatatttta cctttgctaa 660

ctaatgatgt tctatttctt tctatgtgtg agttctaaac ctgtagacac taaaaccttg 720

cagaaacatt tgagttttta aagcttcctt gtgtaacttg gtaaattata acaacagccc 780

tgtttttata tccttaacct attttaagca ttacacaaag tgcacataga aaattggggg 840

ttggatgtga ttaaatctgt tttttaaacc aagcttttcc atttcttttt cactatcctc 900

attctcatcc ccctccccct cccattccac acaggaactg gccaagtact tcttggcgga 960

gctgctctct gaacccaacc agacagagaa cgatgccctg gagcctgaag atttgtccca 1020

ggctgctgag caggatgaaa tgaggctgga gctgcagaga tcagctaact caaacccggc 1080

catggcaccc cgagaacgca aagctggctg caagaatttc ttctggaaga ctttcacatc 1140

ctgttag 1147

Claims (10)

1. An sgRNA for targeted knockout of a porcine SST gene, comprising SST sgRNA1 and SST sgRNA 2;

the nucleotide sequence of the SSTSsgRNA 1 is shown as a sequence table SEQ ID No. 1;

the nucleotide sequence of the SSTSsgRNA 2 is shown in a sequence table SEQ ID No. 2.

2. A CRISPR/Cas9 system for targeted knockout of porcine SST genes, wherein the CRISPR/Cas9 system comprises the sgRNA of claim 1.

3. The method of constructing the CRISPR/Cas9 system of claim 2, comprising the steps of:

1) digesting a CRISPR/Cas9 vector pSpCas9(BB) -2A-Puro by BbsI to obtain a linearized expression vector;

2) the SSTSSGRNA 1 and SSTSSGRNA 2 of the pig SST gene targeted knockout are respectively connected with an enzyme-digested pSpCas9(BB) -2A-Puro vector to obtain pSpCas9(BB) -2A-Puro-SSTSSGRNA 1 and pSpCas9(BB) -2A-Puro-SSTSSGRNA 2 of the pig SST gene targeted knockout, and a CRISPR/Cas9 system of the pig SST gene targeted knockout is constructed.

4. A kit for targeted knockout of porcine SST genes, comprising the CRISPR/Cas9 system of claim 2.

5. Use of the CRISPR/Cas9 system according to claim 2 or the kit according to claim 4 for the preparation of a cell strain with a porcine SST gene knocked out.

6. The use of claim 5, wherein said cell line comprises porcine kidney fibroblasts.

7. The use of claim 5, wherein the knockout fragment of the porcine SST gene is set forth as SEQ ID No. 3.

8. The application of any one of claims 5 to 7, wherein the preparation method of the cell strain with the porcine SST gene knocked out comprises the steps of transfecting the CRISPR/Cas9 system with the targeted SST gene knocked out according to claim 2 into the cell strain, and carrying out positive screening to obtain the cell strain with the SST gene knocked out.

9. Use of the CRISPR/Cas9 system of claim 2 or the kit of claim 4 to increase pig growth rate and size.

10. A method for identifying a pig SST gene targeted by double sgRNA sites is characterized by comprising the following steps: extracting the genome DNA of the cell to be detected;

performing PCR amplification by using the genomic DNA as a template and an amplification primer pair, detecting an obtained PCR amplification product, and judging the gene knockout condition according to the length of a wild type fragment of 416bp and the length of a fragment after gene knockout of 380 bp; in the amplification primer pair, the nucleotide sequence of the upstream primer is shown as SEQ ID No. 4; the nucleotide sequence of the downstream primer is shown as SEQ ID No. 5;

the double sgRNA site includes SSTsgRNA1 and SSTsgRNA 2;

the nucleotide sequence of the SSTSsgRNA 1 is shown as a sequence table SEQ ID No. 1;

the nucleotide sequence of the SSTSsgRNA 2 is shown in a sequence table SEQ ID No. 2.

Images