CN110862988A

CN110862988A - sgRNA, CREBRF dot-pattern-modified Bama miniature pig constructed by sgRNA and application of sgRNA and CREBRF dot-pattern-modified Bama miniature pig

Info

Publication number: CN110862988A
Application number: CN201911235759.7A
Authority: CN
Inventors: 李莹莹; 樊娜娜; 赖良学
Original assignee: Guangzhou Institute of Biomedicine and Health of CAS
Current assignee: Guangzhou Institute of Biomedicine and Health of CAS
Priority date: 2019-12-05
Filing date: 2019-12-05
Publication date: 2020-03-06
Anticipated expiration: 2039-12-05
Also published as: CN110862988B

Abstract

The invention provides a sgRNA, a CREBRF dot map variant Bama miniature pig constructed by the sgRNA and application of the sgRNA, wherein the sgRNA comprises a nucleic acid sequence shown as SEQ ID NO. 1 or SEQ ID NO. 2. The CREBRF gene point mutation is carried out by adopting a scheme of combining CRISPR/Cas9 and homologous recombination, the designed gRNA has specific binding property to a target site near a 1370 site of the CEREBRF gene, and the CRISPR/Cas9 can be guided to carry out specific recognition cutting near the target site, so that double-stranded DNA break is formed to promote homologous recombination repair with an exogenous single-stranded DNA as a template, and the point mutation is introduced; the prepared mutant Bama miniature pig has typical obesity phenotype and can be used as a model organism in the research and development field of obesity and diabetes treatment drugs.

Description

sgRNA, CREBRF dot-pattern-modified Bama miniature pig constructed by sgRNA and application of sgRNA and CREBRF dot-pattern-modified Bama miniature pig

Technical Field

The invention belongs to the technical field of biology, and relates to sgRNA, a CREBRF dot map variant Bama miniature pig constructed by the sgRNA and application of the sgRNA.

Background

In recent years, with the improvement of economic level and life quality, the probability of obesity and diabetes is obviously increased, the two diseases are influenced by various factors such as environment, heredity and the like, and no effective radical medicine exists so far.

Naka et al (Naka et al, A missense variant, Rs373863828-A (p. Arg457Gln), of CREBRF and body mass index in Oceanic publications, Journal of human Genetics (2017), 1-3) reported in 2017, missense mutation was made at 1370 base of human CREBF gene, G was mutated to A, so that amino acid 457, from arginine (Arg) to glutamine (Gln), Rs373863828, and people (homozygote or heterozygote) carrying this A allele point mutation were not susceptible to diabetes, although obese in phenotype, thereby triggering our thinking of the disease-related association of obesity and diabetes. Generally, obese persons have an increased chance of developing diabetes, particularly type II diabetes, which is generally accompanied by symptoms of obesity; however, in the Samoan population, the person with this mutation had a high BMI but had a normal blood glucose and a low risk of diabetes.

Therefore, in order to find the relevance of obesity and diabetes, a CREBRF gene point mutation method is constructed, the relation between obesity and diabetes after the CREBRF gene is subjected to point mutation Arg457Gln (R457Q) is researched, a blood sugar protection mechanism is researched, and the method has important significance in the field of developing obesity and diabetes treatment medicines.

Disclosure of Invention

Aiming at the defects and actual requirements of the prior art, the invention provides a sgRNA, a CREBRF dot-pattern variant Bama miniature pig constructed by the sgRNA and application of the sgRNA, wherein the sgRNA guides CRISPR/Cas9 to perform specific recognition and cutting near a target site of a CREBRF gene, promotes homologous recombination taking exogenous single-stranded DNA as a template, and realizes the purpose of introducing point mutation Arg457Gln into the CREBRF gene.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the invention provides a sgRNA comprising a nucleic acid sequence as set forth in SEQ ID NO. 1 or SEQ ID NO. 2;

SEQ ID NO:1：5’-CACCggatgctaaggccatctgaa-3’；

SEQ ID NO:2：5’-AAACTTCAGATGGCCTTAGCATCC-3’。

in the invention, sgRNA shown as SEQ ID NO: 1-2 guides CRISPR/Cas9 to perform specific recognition and cutting near a target site to form Double-stranded DNA (Double Strand Breaks, DSB) and promote homologous recombination repair by using an exogenous single-stranded DNA as a template, thereby introducing point mutation.

In a second aspect, the present invention provides a sgRNA expression vector including the sgRNA of the first aspect.

Preferably, the promoter of the sgRNA includes the U6 promoter.

In a third aspect, the present invention provides a method for preparing the sgRNA expression vector of the second aspect, the method comprising the steps of:

(1) designing sgRNA from a fifth exon sequence of the CEREBRF gene;

(2) and inserting the obtained sgRNA into an expression vector to obtain the sgRNA expression vector.

In a fourth aspect, the present invention provides a vector composition including the sgRNA expression vector of claim 2.

Preferably, the vector composition further comprises a Cas9 expression vector.

In a fifth aspect, the present invention provides a single-stranded DNA comprising the nucleic acid sequence shown in SEQ ID NO. 3;

SEQ ID NO:3：

ctcacaccatcacagcaagagaggatgctGagAccaAGCgaGtggaaccaagacactttgccgagtaacatgtatcagaaaaatgg。

3, the single-stranded DNA SEQ ID NO is 86bp in total length, two sides of the single-stranded DNA SEQ ID NO are homologous arms, G at the 1370 position is replaced by A, and meanwhile, in order to prevent the CRISPR/Cas9 from carrying out secondary targeting on a target site, a synonymous mutation is designed at a recognition site of sgRNA, wherein an upper case base is the synonymous mutation, and an underlined base is 1370G > A.

In a sixth aspect, the present invention provides a host cell transfected with any one of or a combination of at least two of the sgRNA of the first aspect, the sgRNA expression vector of the second aspect, the vector composition of the fourth aspect, or the single-stranded DNA of the fifth aspect.

Preferably, the host cell contains the point mutation Arg457 Gln.

Preferably, the host cell comprises any one of or a combination of at least two of 293 cells, 293T cells, 293F cells or porcine fetal fibroblasts, preferably porcine fetal fibroblasts.

In a seventh aspect, the present invention provides a method for mutating a CREBRF gene, the method comprising:

co-transfecting a sgRNA according to the first aspect or a sgRNA expression vector according to the second aspect with a Cas9 expression vector and a single-stranded DNA according to the fifth aspect into a host cell, and performing a point mutation of the CREBRF gene, Arg457 Gln; or

Co-transfecting the vector composition according to the fourth aspect and the single stranded DNA according to the fifth aspect into a host cell, and carrying out the point mutation Arg457Gln of the CREBRF gene.

In an eighth aspect, the present invention provides a pharmaceutical composition comprising any one of the sgRNA of the first aspect, the sgRNA expression vector of the second aspect, the vector composition of the fourth aspect, the single-stranded DNA of the fifth aspect, or the host cell of the sixth aspect, or a combination of at least two thereof.

Preferably, the pharmaceutical composition further comprises any one or a combination of at least two of a pharmaceutically acceptable carrier, excipient or diluent.

In a ninth aspect, the invention provides an obese model organism, wherein the obese model organism is a point mutant Arg457Gln Bama miniature pig.

In the invention, the pig is used as an obesity model organism because the pig is a model animal closest to human, compared with model animals such as mice and rabbits, the cardiovascular anatomical structure and function, lipoprotein distribution and size, obesity tendency and species habit of the pig are highly similar to those of human, and particularly, the pig and the human have high similarity in genetics and metabolism determined by genetics; similar to human beings, brown fat disappears after the pigs live, and the brown fat has the capacity of adjusting energy balance and related processes thereof and can accurately simulate the obesity phenotype of the human body; in addition, the pig has a fat layer with enough thickness, can realize accurate measurement of fat cells or mesenchymal cells, does not need to mix different layers or fat tissues of different animals, enables the pig to become the best model animal for researching human diseases such as obesity, diabetes and complications thereof, and plays a considerable role in future medical research.

In a tenth aspect, the present invention provides a sgRNA according to the first aspect, a sgRNA expression vector according to the second aspect, a vector composition according to the fourth aspect, a single-stranded DNA according to the fifth aspect, a host cell according to the sixth aspect, a pharmaceutical composition according to the eighth aspect, or an obesity model organism according to the ninth aspect, for use in the preparation of a medicament for the treatment of obesity and/or diabetes.

Compared with the prior art, the invention has the following beneficial effects:

(1) the CREBRF gene point mutation is carried out by adopting a scheme of combining CRISPR/Cas9 and homologous recombination, the designed gRNA has specific binding property to a target site near a 1370 site of the CEREBRF gene, and can guide CRISPR/Cas9 to carry out specific recognition and cutting near the target site, form Double-stranded DNA (Double strand StrandBreaks, DSB) and promote homologous recombination repair with an exogenous single-stranded DNA as a template, so that the point mutation is introduced;

(2) homologous arms are arranged on two sides of the single-stranded DNA designed by the invention, G is replaced by A at the 1370 position, and meanwhile, in order to prevent the CRISPR/Cas9 from carrying out secondary targeting on a target site, synonymous mutation is designed at the recognition site of sgRNA, so that after the Cas9 protein is subjected to gene cutting, the homologous mutation is connected in a homologous recombination mode, and the point mutation Arg457Gln is introduced into CEREBRF;

(3) the point mutation Arg457Gln Bama miniature pig constructed by the method has the advantages that the size and the weight of the pig are obviously increased, the thickness of abdominal fat is 5 times of that of a wild pig, and the pig can be used as an obesity model organism and has wide application prospect in the research and development field of obesity and diabetes treatment medicines.

Drawings

FIG. 1 shows the results of the amino acid sequence alignment of CREBRF of human and Bama miniature pigs;

FIG. 2 shows CRBEBRF R457Q^-/--sequencing results of PFF positive cell clones;

FIG. 3 shows the sequencing result of CRBEBRF gene of CREBRF R457Q clone pig;

FIG. 4 is a comparison of CREBRF R457Q cloned pigs and wild-type Bama miniature pigs, with CREBRF R457Q cloned pigs on the left and wild-type Bama miniature pigs on the right;

fig. 5(a) is abdominal fat thickness of CREBRF R457Q cloned pigs, fig. 5(B) is abdominal fat thickness of wild type bama miniature pigs;

fig. 6 shows the blood glucose changes in CREBRF R457Q cloned pigs and wild-type bama pigs;

FIG. 7 shows the ratio of LDL, total cholesterol, and triglycerides in the blood of CREBRF R457Q cloned pigs and wild-type Bama miniature pigs;

FIG. 8 shows the CREBRF R457Q clone pig F1 generation piglets;

FIG. 9 shows the sequencing results of CRBEBRF gene of CREBRF R457Q clone pig F1 generation piglet.

Detailed Description

To further illustrate the technical means adopted by the present invention and the effects thereof, the present invention is further described below with reference to the embodiments and the accompanying drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting of the invention.

The examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The reagents or apparatus used are conventional products commercially available from normal sources, not indicated by the manufacturer.

Example 1 CEREBRF sequence alignment of human and Bama miniature pigs

This example confirms the construction of an obesity model organism using Bama miniature pigs by comparing the homology of the CEREBRF gene of humans to Bama miniature pigs.

As shown in fig. 1, the results of the alignment of the CREBRF amino acid sequences of human and bama miniature pigs show that the amino acids at 457 th position of human and bama miniature pigs are arginine, and the identity is more than 99%; meanwhile, the CEREBRF gene of the human and Bama miniature pigs is G at the 1370 position, and the identity is more than 94%. Therefore, the Bama miniature pig has high genetic similarity with human, and the construction of an obesity model organism by using the Bama miniature pig is determined.

The CEREBRF gene sequence is shown in SEQ ID NO. 4, underlined base is 1370G, SEQ ID NO. 4:

TGACAAGGATGATGATATTAGTGATACTTTCTCTGAACCAGGCTATGAAAATGATTCTGTAGAAGACCTGAAGGAGGTGACTTCAATATCTTCACGGAAGAGAGGTAAAAGAAGATACTTCTGGGAGTATAGTGAACAACTTACACCATCACAGCAAGAGAGGATGCTGAGACCATCTGAGTGGAACCGAGATACTTTGCCAAGTAATATGTATCAGAAAAATGGCTTACATCATGGAAAATATGCAGTAAAGAAGTCACGGAGAACTGATGTAGAAGACCTGACTCCAAATCCTAAAAAACTCCTCCAGATAGGCAATGAACTTCGGAAACTGAATAAGGTGATTAGTGACCTGACTC。

example 2 CEREBRF sequence alignment between Bama miniature pig individuals

This example determines the presence or absence of a SNP site in Barmary pigs at position 1370 of the CEREBRF gene by aligning the homology of the CEREBRF gene between individual Barmary pigs.

The primers shown in SEQ ID NO. 5-6 are adopted to carry out CEREBRF gene amplification, the amplified product is sequenced to obtain a result shown in SEQ ID NO. 7, the base marked by underlining is 1370G, and SNP does not exist at 1370 site of the CEREBRF gene between different individuals of Bama miniature pigs.

CREBRF-F(SEQ ID NO:5)：5’-ATCTTTTTGTTTGTCCTGATTGGGT-3’；

CREBRF-R(SEQ ID NO:6)：5’-GAAGGAAGGGGGAAGGGATAC-3’；

Porcine CREBRF gene (SEQ ID NO: 7):

tgtgaatagtgcttcagtgaacatcatggtgtattcttcccagtttttgatggggttatttgttttcctgtgggtctgtttcattgttttctcaatcttaggtgaaggtacaaaaaaagtatcatacactaaccaaagagaaacctaaggaatatagacagtgtcgttatctctattattctctaagtattttatgagttagagatttctgtgttaaaagttattttatagatttggtttattatctttgacatgctaataatgctttcagaaagtgtcacatggcaaatagaagagatctttttgtttgtcctgattgggtcattgaaatttatggaacttaaaaaattgggatttttttttaaggctatgaaaatgattctgtggaagacttgaaagaaatgacttcaatatcctctcggaaaagaggtaaaagaaggtacttctgggagtatagtgaacaactcacaccatcacagcaagagaggatgctaaggccatctgaatggaaccgagacactttgccgagtaacatgtatcagaaaaatggcttacatcatggtaagagaggattgtgatcatgtatattgtatcccttcccccttccttccttccttccctccctccctctcccccctttctttccttccttcctcttatttttgaaatacagctgacatacagtattatgttactttcaggtgtatttcatagtgatttgacattcgcctacatcatgaaatgatcaccacggtagtcttagtaatcatctatccctgatatttcctgtcactttaaacagagatactaaaccataatgcttaatcattatgcattatacgaaggtattcagcccctgctaacaactggagaatagaacagtagagctgccatgtttgctgtgactactcttcattcacaaataacttttatcagtgttgagagccgtcacctacacag。

EXAMPLE 3 1370 site mutation of CEREBRF Gene

In this example, a recognition sequence of sgRNA and a single-stranded DNA obtained by mutating G at position 1370 to a were designed near position 1370 of CEREBRF gene of bama pig by using CRISPR/Cas9 technology. Wherein the sgRNA shown as SEQ ID NO 1-2 enables CRISPR/Cas9 to be at a target site SEQ ID NO 8(tggPAM region) to form Double-stranded DNA break (DSB) and promote homologous recombination repair with exogenous single-stranded DNA SEQ ID NO 3(ssoDNA) as template; the CREBRFigogo-G1 (SEQ ID NO:1) and CREBRFigogo-G2 (SEQ ID NO:2) have BbsI cutting sites at both ends, the single-stranded DNA SEQ ID NO:3 has a full length of 86bp, two sides are homologous arms, G is replaced by A at 1370, and in order to prevent the CRISPR/Cas9 from carrying out secondary targeting on a target site, synonymous mutations are designed at the recognition site of sgRNA.

CREBRFoligogo-g1(SEQ ID NO:1)：CACCggatgctaaggccatctgaa；

CREBRFoligogo-g2(SEQ ID NO:2)：AAACTTCAGATGGCCTTAGCATCC；

SEQ ID NO:8：

ccatcacagcaagagaggatgctaaggccatctgaatggaaccgagacactttgccgagtaacatgtatc。

The method comprises the following specific steps:

adding BbsI enzyme cutting sites at two ends of the recognition sequence, annealing to form a DNA double chain with a cohesive end, reacting in a connecting instrument at 16 ℃ for 15-20 min to perform enzyme cutting reaction, then connecting a U6-gRNA expression vector recovered from the same BbsI enzyme cutting glue, gently mixing the components, selecting bacteria after connection, performing plasmid small extraction for preliminary identification, and further sequencing to determine positive clone; transforming the positive clones into large quality-improving grains; the plasmid is concentrated to the concentration of more than 2.5 mug/muL for electrically transfecting cells;

wherein, the annealing to form a viscous end system is shown in table 1, the enzyme cutting system is shown in table 2, and the connecting system is shown in table 3;

TABLE 1 annealing formation system

Reagent composition	Volume (μ L)
		CREBRFoligogo-g1	10
CREBRFoligogo-g2	10
		Annealing buffer	5
ddH₂O	25

TABLE 2 enzyme digestion System

Reagent composition	Volume (μ L)
		U6 vector	20
BbsI	2
		Enzyme digestion buffer solution	5
ddH₂O	23

TABLE 3 ligation reaction System

Reagent composition	Volume (μ L)
		Double-stranded fragments formed by annealing	4.5(40ng)
Enzyme-cleaved U6 vector	0.5(50ng)
		Ligation buffer	5

Transforming the constructed U6-CREBRF-gPRAF expression vector into Top10 competent cells, selecting 20 clones, carrying out preliminary identification by extracting gel, further carrying out sequencing identification, transforming positive clones into a large number of extracted plasmids, and concentrating the plasmids; in addition, a large amount of plasmids are extracted from the human CRISPR/Cas9 plasmid, and the plasmids are concentrated;

co-transfecting the obtained human CRISPR/Cas9 plasmid, the U6-CREBRF-gPRAF expression vector and the single-stranded DNA SEQ ID NO:3 into porcine fetal fibroblasts according to the proportion of hCas9(6900 ng/mu L), gRNA (3000 ng/mu L) and ssoDNA (10 mu g/mu L) which is 10:3: 5;

changing the liquid the next day after electrotransformation, dividing the cells into 50 discs, wherein the cell density is 5-8 cells under each visual field, and performing drug screening by using G418, wherein the concentration of the G418 is 800 mug/mL in the first three days and 1000 mug/mL in 4-6 days; removing the drug, changing the normal culture medium, and changing the medium every day to observe the cell clone formation;

starting to form cell clone cluster at day 4, picking out clone about day 9, leaving 1/3 cells for cell lysis to extract genomic DNA, PCR amplifying target site and DNA sequencing of amplified product, the result is shown in FIG. 2, and the obtained positive cell clone (CRBEBRF R457Q)^-/-PFF) G at position 1370 of the CREBRF gene is replaced by A.

EXAMPLE 4 construction of CREBRF Gene Point mutation cloned embryos

With CREBRF R457Q^-/-PFF as donor cell for somatic cell nuclear transfer, essentially comprising the following steps: taking a recipient oocyte and a donor cell, removing a chromosome from the recipient oocyte, transferring a donor nucleus into the enucleated oocyte, manually activating the reconstructed oocyte, and performing embryo transfer (transferring the reconstructed embryo into a embryo).

Transplanting the cloned embryo into a recipient sow in the same estrus through an oviduct on the next day of nuclear transplantation, and obtaining a cloned pig after the gestation period; extracting cloned pig genome, carrying out PCR amplification on CREBRF gene fragment, sequencing, and obtaining the CREBRF gene point mutation cloned pig as shown in figure 3.

As shown in fig. 4, the head and body weight of the CREBRF R457Q cloned pig were significantly increased compared to the wild-type control group; as shown in table 4, fig. 5(a) and fig. 5(B), the abdominal fat thickness of the CREBRF R457Q clone pig was 50mm, which is 5 times that of the wild-type pig, and the body weight was about 2.5 times that of the wild-type pig, and it was found that the CREBRF R457Q point mutation obese pig model was successfully constructed.

TABLE 4

Type (B)	Thickness of adult abdominal fat (mm)	Body weight (kg)
			CREBRF point mutant Bama miniature pig	50	～50
Wild type Bama miniature pig	10	～20

As shown in table 5, the mutant pigs gained more and more rapidly body weight over time.

TABLE 5 weight change (kg)

Pig type	Pig ear horn	Body weight 2019.6.3	Body weight 2019.7.3	Body weight 2019.7.26
					Wild type	9232	21.5	28	32
Wild type	9249	31.5	36	45.5
					Mutant forms	901502	48	51.5	61.5
Mutant forms	901608	48	46.5	52.5

The OGTT experiment was performed, as shown in table 6 and fig. 6, the fast rise of blood glucose and slow regulation of blood glucose in CREBRF point-mutant pigs were one of the obesity manifestations compared to wild-type control pigs; as shown in fig. 7, CREBRF point mutant pigs showed significantly higher blood low density lipoprotein (LDL-CH), Total Cholesterol (TCHOL), and Triglycerides (TRIG) levels, consistent with the obese phenotype, compared to wild-type control pigs.

TABLE 6 OGTT test

Fig. 8 shows CRBEBRF gene sequencing results of F1 piglets of CREBRF R457Q cloned pigs, and fig. 9 shows CRBEBRF gene sequencing results of F1 piglets of CREBRF R457Q cloned pigs, compared with synonymous mutations, and the remaining mutations are wild type boar self-bands except the 1370 site mutation, which indicates that the point mutation type bama miniature pigs with stably inherited CREBRF R457Q are obtained.

In conclusion, the CREBRF gene is subjected to point mutation by adopting a scheme combining CRISPR/Cas9 and homologous recombination, the designed gRNA guides CRISPR/Cas9 to perform specific recognition and cleavage near a target site, double-stranded DNA break is formed to promote homologous recombination repair by taking an exogenous single-stranded DNA as a template, homologous arms are arranged on two sides of the single-stranded DNA, G is replaced by A at the 1370 position, and a synonymous mutation is designed at the recognition site of the sgRNA, so that the homologous recombination repair method is favorable for connecting the protein after Cas9 protein is subjected to gene cleavage, and the point mutation Arg457Gln is introduced into CEREBRF; the point mutation Arg457Gln Bama miniature pig constructed by the method has the advantages that the size and the weight of the pig are obviously increased, the thickness of abdominal fat is 5 times of that of a wild pig, and the point mutation Arg457Gln miniature pig has wide application prospect in the research and development field of obesity and diabetes treatment medicines.

The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.

SEQUENCE LISTING

<110> Guangzhou biomedical and health research institute of Chinese academy of sciences

<120> sgRNA, CREBRF dot map variant Bama miniature pig constructed by sgRNA and application of sgRNA and CREBRF dot map variant Bama miniature pig

<130>20191118

<160>8

<170>PatentIn version 3.3

<210>1

<211>24

<212>DNA

<213> Artificial Synthesis

<400>1

caccggatgc taaggccatc tgaa 24

<210>2

<211>24

<212>DNA

<213> Artificial Synthesis

<400>2

aaacttcaga tggccttagc atcc 24

<210>3

<211>86

<212>DNA

<213> Artificial Synthesis

<400>3

ctcacaccat cacagcaaga gaggatgctg agaccaagcg agtggaacca agacactttg 60

ccgagtaaca tgtatcagaa aaatgg 86

<210>4

<211>359

<212>DNA

<213> Artificial Synthesis

<400>4

tgacaaggat gatgatatta gtgatacttt ctctgaacca ggctatgaaa atgattctgt 60

agaagacctg aaggaggtga cttcaatatc ttcacggaag agaggtaaaa gaagatactt 120

ctgggagtat agtgaacaac ttacaccatc acagcaagag aggatgctga gaccatctga 180

gtggaaccga gatactttgc caagtaatat gtatcagaaa aatggcttac atcatggaaa 240

atatgcagta aagaagtcac ggagaactga tgtagaagac ctgactccaa atcctaaaaa 300

actcctccag ataggcaatg aacttcggaa actgaataag gtgattagtg acctgactc 359

<210>5

<211>25

<212>DNA

<213> Artificial Synthesis

<400>5

atctttttgt ttgtcctgat tgggt 25

<210>6

<211>21

<212>DNA

<213> Artificial Synthesis

<400>6

gaaggaaggg ggaagggata c 21

<210>7

<211>960

<212>DNA

<213> Artificial Synthesis

<400>7

tgtgaatagt gcttcagtga acatcatggt gtattcttcc cagtttttga tggggttatt 60

tgttttcctg tgggtctgtt tcattgtttt ctcaatctta ggtgaaggta caaaaaaagt 120

atcatacact aaccaaagag aaacctaagg aatatagaca gtgtcgttat ctctattatt 180

ctctaagtat tttatgagtt agagatttct gtgttaaaag ttattttata gatttggttt 240

attatctttg acatgctaat aatgctttca gaaagtgtcacatggcaaat agaagagatc 300

tttttgtttg tcctgattgg gtcattgaaa tttatggaac ttaaaaaatt gggatttttt 360

tttaaggcta tgaaaatgat tctgtggaag acttgaaaga aatgacttca atatcctctc 420

ggaaaagagg taaaagaagg tacttctggg agtatagtga acaactcaca ccatcacagc 480

aagagaggat gctaaggcca tctgaatgga accgagacac tttgccgagt aacatgtatc 540

agaaaaatgg cttacatcat ggtaagagag gattgtgatc atgtatattg tatcccttcc 600

cccttccttc cttccttccc tccctccctc tccccccttt ctttccttcc ttcctcttat 660

ttttgaaata cagctgacat acagtattat gttactttca ggtgtatttc atagtgattt 720

gacattcgcc tacatcatga aatgatcacc acggtagtct tagtaatcat ctatccctga 780

tatttcctgt cactttaaac agagatacta aaccataatg cttaatcatt atgcattata 840

cgaaggtatt cagcccctgc taacaactgg agaatagaac agtagagctg ccatgtttgc 900

tgtgactact cttcattcac aaataacttt tatcagtgtt gagagccgtc acctacacag 960

<210>8

<211>70

<212>DNA

<213> Artificial Synthesis

<400>8

ccatcacagc aagagaggat gctaaggcca tctgaatgga accgagacac tttgccgagt 60

aacatgtatc 70

Claims

1. An sgRNA, which is characterized by comprising a nucleic acid sequence shown as SEQ ID NO. 1 or SEQ ID NO. 2.

2. A sgRNA expression vector, comprising the sgRNA of claim 1;

preferably, the promoter of the sgRNA includes the U6 promoter.

3. A method of preparing the sgRNA expression vector of claim 2, comprising the steps of:

(1) designing sgRNA from a fifth exon sequence of the CEREBRF gene;

4. A vector composition, comprising the sgRNA expression vector of claim 2;

preferably, the vector composition further comprises a Cas9 expression vector.

5. A single-stranded DNA comprising a nucleic acid sequence shown as SEQ ID NO. 3.

6. A host cell transfected with any one of, or a combination of at least two of, the sgRNA of claim 1, the sgRNA expression vector of claim 2, the vector composition of claim 4, or the single-stranded DNA of claim 5;

preferably, the host cell is present at the point mutation Arg457 Gln;

7. A method for mutating a CREBRF gene, comprising:

co-transfecting the sgRNA of claim 1 or the sgRNA expression vector of claim 2 with a Cas9 expression vector and the single-stranded DNA of claim 5 into a host cell, performing a point mutation of the CREBRF gene, Arg457 Gln; or

Co-transfecting a host cell with the vector composition of claim 4 and the single stranded DNA of claim 5 and carrying out the point mutation Arg457Gln of the CREBRF gene.

8. A pharmaceutical composition comprising any one of the sgRNAs of claim 1, the sgRNA expression vector of claim 2, the vector composition of claim 4, the single-stranded DNA of claim 5, or the host cell of claim 6, or a combination of at least two thereof;

9. An obesity model organism, which is a point mutation Arg457Gln Bama miniature pig.

10. Use of the sgRNA of claim 1, the sgRNA expression vector of claim 2, the vector composition of claim 4, the single-stranded DNA of claim 5, the host cell of claim 6, the pharmaceutical composition of claim 8, or the obesity model organism of claim 9 in the preparation of a medicament for the treatment of obesity and/or diabetes.