RU2780677C1 - METHOD FOR EDITING THE GJB2 GENE TO CORRECT THE PATHOGENIC VARIANT OF c.del35G IN HUMAN CELLS CULTURED IN VITRO - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to the field of biotechnology, in particular to a method for editing the GJB2 gene based on the CRISPR-Cas system to correct the variant c.del35G in a human cell cultured in vitro, excluding human germline cells.

EFFECT: invention is effective for correcting a section of the human genome smaller than 120 nucleotides carrying the c.del35G mutation in the human GJB2 gene to a variant of the healthy human genome with a synonymous replacement of C.G30C in the GJB2 gene in cells cultured in vitro.

1 cl, 1 tbl, 1 ex, 2 dwg

Description

The invention relates to cellular, molecular biology, experimental biology and medicine, can be used to change the genome of human cells cultured in vitro.

The present invention is not intended to modify the genetic integrity of human germline cells, nor is it intended to use human embryos.

The method allows changing the genome of a small region (up to 120 nucleotides) of chromosome 13 to correct the mutation of the pathogenic genotype c.del35G of the GJB2 gene (rs80338939 polymorphism). The phenotypic manifestation of this mutation is (DFNB1) non-syndromic autosomal recessive deafness (GJB2 mutations and degree of hearing loss: a multicenter study. American Journal of Human Genetics. Snoeckx, R.L. et al., 2005; 77:945-957). The method can be used to create models for the prevention of genetically determined deafness at the genetic level, to test methods of experimental genetic therapy.

Editing (changing) the genome of living cells has been actively developed in recent decades (ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends in Biotechnology. Gaj T. et al., 2013; VOLUME 31, ISSUE 7, P397-405 ). Currently, the components of CRISPR-Cas systems that have gained popularity are used as the main tools for editing the genomes of various organisms from protozoa to mammals (CRISPR Genome Editing: How to Make a Fantastic Method Even Better. Cells. Brakebusch C, 16 February 2021; 10, 408) . Human cell genome editing is aimed at treating and preventing many diseases, and is performed in model experiments (CRISPR-based RNA editing: Diagnostic applications and therapeutic options. Expert Review of Molecular Diagnostics. Gulei D. et al., 2019; 19, 83-88 ) and in clinical trials (numbers at ClinicalTrials.gov, NCT03655678 for CLIMB THAL-111, NCT03745287 for CLIMB SCD-121, NCT04601051 for NTLA-2001). The safety of genetic editing is an acute issue (Latest Developed Strategies to Minimize the Off-Target Effects in CRISPR-Cas-Mediated Genome Editing. Cells. Naeem M. et al., 2 July 2020; 9, 1608).

Genetic editing by the CRISPR-Cas method always includes the delivery of DNA and/or RNA and/or protein components, which ultimately leads to the appearance in cells of the CRISPR-Cas protein effector systems in combination with guide RNA: these can be plasmids, viral vectors with DNA or mRNA, protein-RNA complexes, viral capsids containing protein-RNA complexes (Genome editing in primary cells and in vivo using viral-derived Nanoblades loaded with Cas9-sgRNA ribonucleoproteins. Nature communications. Mangeot P.E. et al., 03 January 2019; 10, 45). The safest delivery methods that introduce the minimum number of off-target effects are those that deliver already purified protein with guide RNA, and not RNA or DNA constructs that lead to protein synthesis by cell machinery (Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection. Journal of Biotechnology Liang, X. et al., 2015; 208, 44-53. Evaluation and reduction of CRISPR off-target cleavage events. Nucleic Acid Therapeutics. Vakulskas, C. A. et al., 6 Aug 2019; Vol. 29, No. 4). At the same time, these proteins and guide RNAs are often subjected to engineering: changes in order to increase the efficiency of targeting the genome and to create fundamentally new ways to change the genome, combined with each other only by the principle of complementary attachment of the guide RNA to the target DNA sequence (Genome editing with CRISPR -Cas nucleases, base editors, transposases and prime editors, Nature biotechnology, Anzalone, A.V. et al., 22 June 2020; 38, 824-844). Donor DNA molecules used to initiate homology-directed repair are also subjected to technology-improving modifications (Improved genome editing efciency and fexibility using modifed oligonucleotides with TALEN and CRISPR-Cas9 nucleases. Cell Reports. Renaud, J.-B. et al., 2016; 14 , 2263-2272).

As for the target gene subject to change in the present invention: the c.35delG mutation in the GJB2 gene (rs80338939 polymorphism dbSNP number), which we have chosen, is the most common genetically associated cause of autosomal recessive deafness in Russia (Updated carrier rates for c.35delG (GJB2) associated with hearing loss in Russia and common c.35delG haplotypes in Siberia BMC Medical Genetics Zytsar M.V. et al., 07 August 2018; 19, 138). Homozygous carriage of this mutation causes severe hearing loss in the vast majority of people (GJB2 mutations and degree of hearing loss: a multicenter study. American Journal of Human Genetics. Snoeckx, R.L. et al., 2005; 77:945-957). There is no fully functional hearing-restoring GJB2 genetic deafness therapy. The only way to partially restore hearing is the expensive surgical procedure of cochlear implantation (Benefits of bilateral cochlear implantation: a review. Current Opinion in Otolaryngology & Head and Neck Surgery Brown K.D. et al., October 2007). Thus, the goal of genetic modification is a mutation that causes a socially significant disease that does not have a full-fledged method of treatment.

A known method of genetic modification of human cells using gene therapy DNA vector (WO 2021137742, A1). This method expresses the selected HFE gene using a bacterial plasmid DNA delivered to the cells. Within the framework of the invention, the method was tested, among other things, in skin cells of patients (in the human body, and not in cells cultured in vitro). The disadvantages of this invention are: prolonged and uncontrolled expression of the HFE gene from the DNA template, which is not critical in the framework of the invention, but is not applicable to enzymes that carry out genetic editing; this method does not imply a change in the genome of human cell chromosomes, however, despite the precautions, it cannot completely exclude the possibility of integration into the cell genome, because uses double-stranded plasmid DNA. This method focuses on genes other than GJB2 and thus cannot be used to solve the problem of our invention.

A known method of changing the genome of animal embryos (US2020385753, A1). The method relies on the work of the enzymes cytidine deaminases or adenosine deaminases and components of CRISPR-Cas systems connected with these enzymes into one polypeptide by genetic engineering. CRISPR-Cas components are not capable of creating cuts in DNA (for example, the so-called dCas9), this is an advantage of the invention that increases the safety of genetic exposure. The disadvantages of this method are: not the ability to change the genome, producing deletions or insertions of nucleotides; the ability to produce only a limited set of substitutions of one nucleotide for another (only within the framework of the functioning of deaminase enzymes); despite the statement about the efficiency of the method for embryos of any mammals, the efficiency of the method was demonstrated only on mouse embryos; in a number of variations of the method (for example, with microinjection into the zygote), an mRNA solution of molecules encoding the genes of editing enzymes was used; this does not allow controlling the dosage of enzymes and makes the method less safe.

A known method of local (no more than 90 nucleotides) genetic editing of mouse embryos (RU 2757121, C1). The method is carried out using elements of the CRISPR-Cas system. The components of the CRISPR-Cas system and donor DNA in a buffer solution (10 mM Tris-HCl pH 7.4 and 0.1 mM EDTA) are introduced into the mouse zygote 12 hours after fertilization. The CRISPR-Cas components initiate a double-stranded DNA cut (break) at a selected location (in the 6th exon of the GNAO1 gene) and are: mRNA with the cas9 sequence of the Streptococcus pyogenes gene, guide RNA (guide RNA) 5'-GCTTTCCCTGACTCCCTGC-3 '. The donor DNA serves as a template for homologous repair produced by mouse zygote proteins and is a 90-nucleotide single-stranded DNA sequence complementary to the incision site. The disadvantages of this method are: translation of the Cas9 protein from mRNA, which does not allow to control the exact amount of protein in the zygote, compared with the delivery of the purified protein, and on average increases the number of undesirable editing effects; selection of donor DNA of a sufficiently short length (90 nucleotides), which reduces the likelihood of homologous-directed repair; donor DNA in a relatively high concentration (5 µM), this can have a cytotoxic effect on cells; the introduction of a mixture of genome-editing components is carried out 12 hours after fertilization, which is later than the start of the S-phase (and the start of DNA copying), which increases the risk of mosaicism in the organism developing from the zygote. This method focuses on genes other than GJB2 and thus cannot be used to solve the problem of our invention.

A known method of changing the entire GJB2 gene of the embryo of pigs (CN110511962, A). The method uses the creation of two cuts of both DNA strands in the porcine zygote genome to replace the entire porcine GJB2 gene with a human one. In this case, the human gene has mutations that lead to hearing impairment in humans. The disadvantages of the method are: the use of two cuts of both DNA strands, which leads to a high probability of deletion of the entire gene. The invention focuses on the animal model and does not involve human cells or cell lines. This method does not propose a genetic correction of the mutation (genetic therapy), but on the contrary, creates mutations in the genome of pigs, leading to hearing loss.

A method is known that temporarily replaces the GJB2 gene in a human cell (US 2021079406, A1). The method uses an AAV viral vector to deliver DNA carrying the correct copy of the gene into human or animal cells. Some time after delivery, the DNA exists in the cell and provides the presence of a functioning protein encoded by the GJB2 gene. This method does not ensure the permanent presence of the correct functioning protein, but only its temporary expression (as long as the DNA of the viral vector is present in the cell). Also, the gene is under a promoter that does not provide gene expression at a level identical to a healthy cell. An incorrect expression level (both lower and higher) can lead to pathogenic processes and even cell death.

The problem to which this invention is directed is the inevitable severe hearing loss in people with the c.del35G mutation in the homozygous form, and the lack of measures that fully restore hearing, as well as the absence of genetic therapy that corrects this mutation. Thus, there is a need for methods to restore hearing in humans who are homozygous c.del35G carriers. The genome editing method we have chosen eliminates the original cause of hearing loss, the c.del35G mutation.

The technical result achieved in the implementation of the invention is to create the possibility of correcting a portion of the human genome less than 120 nucleotides in size, carrying the c.del35G mutation in the human GJB2 gene, to a variant of the healthy human genome (variant of the reference human genome) with a synonymous replacement of C.G30C in the gene GJB2 in cells cultured in vitro.

The essence of the invention is as follows.

A CRISPR/Cas9-based GJB2 gene editing method is proposed to correct the c.del35G variant in a human cell cultured in vitro, excluding human germline cells. A mixture for editing is prepared, including a guide RNA containing the sequence of SEQ ID NO: 1, a DNA oligonucleotide representing the sequence 5'-T*C*GTCTTTTCCAGAGCAAACCGCCCAGAGTAGAAGATGGATTGGGGCACGCTGCAGAC GATCCTCGGGGGTGTGAACAAACACTCCACCAGCATTGGAAAGATCTGGCTCACCGTCC*T*C*T-3', where * is an internucleotide bond, and Streptococcus pyogenes Cas9 protein with a molar ratio: Cas9 protein/guide RNA/DNA oligonucleotide equal to 1:1.1:2. This mixture is then delivered to a human cell cultured in vitro.

Thus, the editing mixture is prepared to contain the Streptococcus pyogenes Cas9 protein, synthetic guide RNA (A Programmable Dual-RNA-Guided DNA Endonuclease in Adaptive Bacterial Immunity. Science. Jinek M. et al., 17 August 2012) containing the target sequence (spacer SEQ ID NO: 1, donor oligonucleotide, which is the sequence 5'-T*C*GTCTTTTCCAGAGCAAACCGCCCAGAGTAGAAGATGGATTGGGGCACGCTGCAGAC GATCCTCGGGGGTGTGAACAAACACTCCACCAGCATTGGAAAGATCTGGCTCACCGTCC*T*C*T-3', where * is an internucleotide bond (The 2-N Mole ratio of Cas9 protein , guide RNA and DNA of the oligonucleotide is 1:1.1:2.

A feature of the proposed donor oligonucleotide is the presence of a phosphorothioate internucleotide bond between 1 and 2, 2 and 3, 117 and 118, 118 and 119, 119 and 120 nucleotides.

A method for correcting the c.del35G mutation of the human GJB2 gene in cells cultivated under in vitro conditions has been developed. We carried out the use of the original guide RNA for local genome modification in the vicinity of the c.del35G mutation using the CRISPR-Cas method. The original guide RNA is as safe as possible for other regions of the human genome: 99 out of 100 possible specificity scores on the CFD Specificity score (Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nature Biotechnology. Doench J. et al. , 18 January 2016).

The invention includes specific sequences: guide RNA for operation of CRISPR-Cas components, donor DNA oligonucleotide for homologous-targeted repair by the cell.

At the same time, other parts of the process, such as cell type, delivery method, culture, genetic analysis, may vary and be performed by any of the common methods. The invention is not limited to a particular type of cells, excluding human germline cells, their cell culture method, editing mixture delivery method, and genetic analysis.

A method for genetic editing of the GJB2 gene in order to correct the pathogenic c.del35G variant in human cells cultured in vitro, excluding human germline cells, includes the following steps: preparing a mixture for editing, delivering the mixture to living cells, culturing the cells, collecting part of the cells, preparation of NGS libraries for genetic analysis, genetic analysis by the NGS method.

To edit the GJB2 gene to correct the c.del35G mutation in human cells cultured in vitro, the following steps are used:

1. Prepare a solution of purified Cas9 protein from the Streptococcus pyogenes CRISPR-Cas system (or any modification of this protein capable of making double-strand cuts in DNA) at a concentration greater than 3 times the final concentration, in a solution of 300 mM NaCl, 10 mM Tris-HCl, 0.1 mM EDTA, 1 mM DTT, 50% Glycerol, pH 7.4 at 25°C. Protein solution stored at -20°C until mixed.

2. On ice, thaw a guide RNA solution in pure water without RNases containing the target sequence (spacer sequence) SEQ ID NO: 1 at a concentration greater than 3 times the final concentration. Before use, store at a temperature of 0-4 ° C, use no later than 30 minutes after defrosting.

3. Thaw a solution of single-stranded DNA in pure water without RNases with a concentration higher than 3 times the final concentration of the donor oligonucleotide 5'-T*C*GTCTTTTCCAGAGCAAACCGCCCAGAGTAGAAGATGGATTGGGGCACCGCTGCAGAC GATCCTCGGGGGTGTGAACAAACACTCCACCAGCATTGGAAAGATCTGGCTCACCGTCC*T*C*T-3'io, where * is an internucleotide bond. Before use, store at a temperature of 0-4 ° C, use no later than 3 hours after defrosting.

4. Immediately before delivery to cells, mix Cas9, guide RNA, donor oligonucleotide in a molar ratio of 1:1.1:2 in a sterile solution of 150 mM KCl and 20 mM HEPES-NaOH, pH 7.5.

5. Incubate the solution for at least 10 minutes and no more than 25 minutes in the temperature range of 20-37°C.

6. Deliver the prepared solution to the cage by any of the available methods.

7. After cell delivery, cultivate individual time, but not less than 12 hours. In case of delivery to primary dermal fibroblasts, culturing for 24-48 hours is recommended. After that, the cells can be used further.

8. To analyze the results of editing, some of the cells obtained during the procedure are selected, lysed, and DNA suitable for genetic analysis is isolated from the cells.

9. For genetic analysis, select from 5 to 500 ng of DNA obtained from selected cells.

10. Mix the DNA with the components of the PCR reaction with a total volume of 50 µl. DNA polymerase with corrective 3'>5' exonuclease activity can be used according to the manufacturer's protocol. As primers, use oligonucleotides 5'-CATGGCTACGATCCGACTTTGTGCATTCGTCTTTTCCAGAGC-3' and 5'-GCTTGGCCCTCCGACTTACACCTCCTTTGCAGCCACAA-3'. These oligonucleotides are designed to prepare samples for NGS sequencing on the DNBSEQ platform. It is possible to adapt this protocol for any other NGS platform.

11. PCR to carry out the temperature program:

11.1. 95°C 32 minutes

11.2. 10 cycles:

11.2.1. 95°C 20 seconds

11.2.2. 56°C 1 minute

11.2.3. 72°C 40 seconds

11.3. 22 cycles:

11.3.1. 95°C 20 seconds

11.3.2. 69°C 20 seconds

11.3.3. 72°C 35 seconds

11.4. 72°C 2 minutes

11.5. 4°C storage

12. Add 25 µl of magnetic particles (AMPure XP or equivalent).

13. 5 minutes incubation at room temperature, put on a magnetic stand, take the supernatant into a new tube. Discard magnetic particles from this step.

14. Add 100 µl of magnetic beads (AMPure XP or equivalent) to the supernatant.

15. 5 minutes incubation at room temperature, put on a magnetic stand, take the supernatant.

16. Wash twice with 200 µl of 80% ethanol on a magnetic rack, collect ethanol, dry for 5 minutes with the lid open.

17. Add 20 µl of ultrapure water (grade 1 according to GOST R 52501-2005, hereinafter “mQ_water”), mix, incubate for 5 minutes on the table.

18. Transfer to a magnetic rack, remove 18 µl of supernatant, transfer to a new tube.

19. Measure the concentration using the Qubit dsDNA HS kit, depending on the initial amount of DNA, take 2 µl or more.

20. Analyze the obtained amplicons by gel electrophoresis, make sure that the length of the PCR product is about 200-240 base pairs (bp).

21. Select from 20 to 300 ng of DNA obtained in step 18 of the amplicon for the next PCR reaction.

22. Collect the PCR reaction with the KAPA HiFi PCR Kit (KR0368, KAPA BIOSYSTEMS or equivalent) according to the manufacturer's protocol. As primers, use oligonucleotides 5'-/5Phos/GAACGACATGGCTACGATCCGACTT-3' and 5'-TGTGAGCCAAGGAGTTGNNNNNNNNNNTTGTCTTCCTAAGACCGCTTGGCCTCCGACT-3', where 5'-/5Phos/ means the phosphate group at the 5' end of the primer, NNNNNNNNNN - 10 nucleotides of the NGS index, DNBSEQ library platform for example, index 121 would have the sequence TTGATCAAGG.

23. PCR to carry out the temperature program:

23.1. 95°C 3 minutes

23.2. 3-6 cycles (depending on the amount of DNA in p. 21):

23.2.1. 98°C 20 seconds

23.2.2. 56°C 50 seconds

23.2.3. 72°C 50 seconds

23.3. 72°C 1 minute

23.4. 4°C storage.

24. Purify the reaction and measure the concentration identical to paragraphs. 14-19

25. Analyze the obtained amplicons by gel electrophoresis, make sure that the length of the PCR product is about 250-270 bp.

26. Sequence the resulting NGS library on the DNBSEQ platform.

27. In the obtained data, determine the genotype of cells subjected to genetic editing.

Fig. 1. DNA electrophoresis of NGS libraries prepared in accordance with the proposed method for a sample of cells not subjected to genetic editing (Non-ed.), a sample of cells subjected to genetic editing (Ed.), and for negative control of the process of preparing NGS libraries.

Fig. 2. The result of the interpretation of genotyping of cell samples subjected to (Non-ed.) not subjected to genetic editing, a sample of cells subjected to genetic editing (Ed.). Visualization of genotyping and individual NGS reads by software.

Example

In the example, we used our own editing method on plate cultured dermal fibrolasts by following steps. 1-27 above. Dermal fibroblasts have a homozygous c.del35G genotype. Approximately 100,000 fibroblasts were used for each experiment. The editing mixture was delivered using the Lipofectamine™ CRISPRMAX™ Cas9 reagent (CMAX00 Invitrogen).

In FIG. 1 shows the results of gel electrophoresis (point 25) of the implementation of the method. The following samples were taken (from left to right): negative control without DNA (Negative control), DNA from primary dermal fibroblasts before editing by the proposed method (Unedited), DNA from primary fibroblasts after editing by the proposed method (Edited). PCR products are visible - DNA fragments of the correct length based on the amplicons of the GJB2 gene, namely the site subjected to editing. The result in Fig. 1 are NGS libraries. A negative control is provided to prove the specificity of the PCR reaction to the DNA of the sample.

In FIG. 2 and the table show the results of genotyping of the obtained NGS sequencing data. The fibroblast genotype before editing only supports c.del35G. After editing, a fraction of the reads (0.5%) maintain a healthy genotype without c.del35G with a synonymous replacement for C.G30C. This means that a part of the population (about 1%) of the cells acquired the corrected version of the GJB2 gene.

Thus, the presented data confirm the creation of the possibility of correcting a region of the human genome with a size of less than 120 nucleotides, carrying the c.del35G mutation in the human GJB2 gene, to a variant of the healthy human genome (variant of the reference human genome) with a synonymous replacement of C.G30C in the GJB2 gene; and providing a method for checking the results of the genome change at the site of the mutation repair.

--->

Listing of nucleotide sequences

<110> Federal state budget institution

"National Medical Research Center for Obstetrics,

Gynecology and Perinatology named after academician V.I. Kulakov"

Ministry of Health of the Russian Federation (Federalnoe

gosudarstvennoe biudzhetnoe uchrezhdenie "Natsionalnyi meditsinskii

issledovatelskii tsentr akusherstva ginekologii i perinatologii

nameni academika V.I. Kulakova" Ministerstva zdravookhraneniia

Russian Federatsii)

<120> GJB2 gene editing method to correct pathogenic

c.del35G variant in human cells cultured in vitro

<160> 2

<210> SEQ ID NO: 1

<211> 20

<212> RNA

<213> Artificial

<220>

<223> Part of guide RNA<400>1

gggcacgcug cagacgaucc 20

<210> SEQ ID NO: 2

<211> 120

<212> DNA

<213> Artificial

<220>

<223> Donor oligonucleotide in which the link between nucleotides 1 and 2,

2 and 3, 117 and 118, 118 and 119, 119 and 120 is phosphorothioate

internucleotide bond

<400> 2

tcgtcttttc cagagcaaac cgccgagt agaagatgga ttggggcacg ctgcagacga 60

tcctcggggg tgtgaacaaa cactccacca gcattggaaa gatctggctc accgtcctct 120

<---

Claims (1)

Method for editing the GJB2 gene based on the CRISPR-Cas system for correcting the c.del35G variant in a human cell cultured in vitro, excluding human germline cells, in which an editing mixture is prepared, including a guide RNA containing the sequence of SEQ ID NO: 1, DNA oligonucleotide representing the sequence 5'-T*C*GTCTTTTCCAGAGCAAACCGCCCAGAGTAGAAGATGGATTGGGGCACCGCTGCAGAC GATCCTCGGGGGTGTGAACAAACACTCCACCAGCATTGGAAAGATCTGGCTCACCGTCC*T*C*T-3', where * is a phosphorothioate internucleotide bond, and Streptococcus pyogenes protein Cas9 with a molar ratio of DNA / oligonucleotide: oligonucleotide: protein: 1:1,1:2, after which this mixture is delivered to a human cell cultured in vitro.

Images