CN113122580A

CN113122580A - Method and composition for treating MPS IH based on LEAPER technology

Info

Publication number: CN113122580A
Application number: CN202011626234.9A
Authority: CN
Inventors: 袁鹏飞; 赵艳霞; 刘能银; 易泽轩; 汤刚斌
Original assignee: Edigene Beijing Biotechnology Co ltd
Current assignee: Edigene Beijing Biotechnology Co ltd
Priority date: 2019-12-30
Filing date: 2020-12-30
Publication date: 2021-07-16

Abstract

The application relates to a method for targeted editing of RNA based on LEAPER technology, which comprises the steps of utilizing the LEAPER technology to safely and effectively perform in-vivo editing from adenosine to hypoxanthine base on RNA, accurately repairing the site of pathogenic mutation and achieving the purpose of treating all diseases caused by G > A mutation, such as MPS IH.

Description

Method and composition for treating MPS IH based on LEAPER technology

Technical Field

The application belongs to the field of gene Editing treatment, and particularly relates to a method for targeted Editing of RNA (ribonucleic acid) based on LEAPER (leveraging Endogenous ADAR for Programmable Editing on RNA) technology to treat MPS IH, which comprises the step of performing in-vivo site-directed Editing from A to I bases on RNA by utilizing LEAPER technology to treat diseases caused by G > A mutation, such as MPS IH.

Background

The Hurler syndrome (also called mucopolysaccharidosis IH, MPS IH) is the most serious of three subtypes IH, IH/S, IS of MPSI type, and is a disabling and lethal hereditary metabolic disease caused by the deficiency of α -L-Iduronidase (IDUA) in patients, which is Autosomal Recessive (AR). The root cause of herler's syndrome is caused by mutation of IDUA gene encoding IDUA protein located on chromosome 4 of human 4 at 4p16.3, and there are over 200 kinds of pathogenic mutations, among which the most common type is mutation from position 1205G to a on α -L-iduronidase cDNA, which results in the original tryptophan being changed to a stop codon, and further the finally translated protein being deficient in all amino acids (NM _000203.4(IDUA) -c.1205g-a (p.trp402ter)) after the position and losing the full enzymatic activity of IDUA. This type of mutation may account for 63% of the total population (Worldwide distribution of common IDUA pathological varieties, Poletto, Edina (2018.) Clinical genetics.94.10.1111/cge.13224.). alpha-L-iduronidase is responsible for the degradation of Glycosaminoglycans (GAGs) within lysosomes of cells. The Hurler syndrome has large inter-individual variation, can be normal at birth, has the earliest signs of facial contour roughness at 3-6 months, and then has symptoms of frontal bone protrusion, bone deformity, growth retardation, language disorder and the like, and patients usually live less than 10 years old.

There is no cure for herler's syndrome, and two treatments are currently approved: enzyme Replacement Therapy (ERT) and Hematopoietic Stem Cell Transplantation (HSCT). ERT has achieved good results in terms of visceral phenotype, including reduction of liver size, improvement of respiratory function, and overall improvement of patient mobility. Disadvantageously, it cannot reach the central nervous system and thus cannot prevent cognitive impairment. On the other hand, successful HSCT can prevent most clinical symptoms, including neurological symptoms, but must be treated before clinical symptoms appear (preferably before 8 months of age), but this treatment is only applicable to patients with severe disease conditions due to the high mortality rate of the treatment (Combination of enzyme replacement and nutritional step cell transfer as therapy for Hurler synchronization. solar, J (2008). Bone marrow transfer.41.531-5.10.1038/sj.bmt.1705934).

Currently, the principle of gene editing technology under study for treating herler syndrome is to insert a cDNA sequence encoding a normal IDUA protein into the genome of hepatocytes at a fixed point using zinc finger ribonuclease (ZFN) and Adeno-associated virus (AAV), but this method still fails to address the symptoms of systems such as the brain skeleton in herler syndrome, and off-target (off-target) caused by DNA editing is a problem that needs to be paid high attention.

Theoretically, in recent years, the rapidly developing genome editing technology crispr (clustered regular intercarried palindromic repeats) can also be used for treating the herler's syndrome. Many researchers and biotechnology companies are also working to put the technology into clinical use. For example, in 9 months of 2019, the clinical experiment result of editing stem cells by using CRISPR technology and returning the stem cells to patients for treating aids and leukemia is reported for the first time, and the clinical experiment result makes a great contribution to the transformation of the CRISPR technology in the gene therapy direction. Despite the great potential application prospect of the CRISPR technology, the technology has a series of defects, which lead to the conversion of the technology from scientific research stage to clinical treatment application. One of the problems is the core-acting enzyme used in CRISPR technology: cas 9. CRISPR-based DNA editing techniques, Cas9 or other nucleases possessing similar functions must be expressed exogenously, causing several problems. First, it is generally desirable that exogenously expressed nucleases generally have a large molecular weight, which drastically reduces the efficiency of their delivery into the body by viral vectors. Secondly, there is a potential for off-target nuclease due to exogenous expression of nucleases, which would make their use potentially carcinogenic. Finally, exogenously expressed nucleases are found in bacteria, rather than naturally occurring in humans or mammals, which makes it possible to elicit an immune response in a patient which may, on the one hand, cause damage to the patient himself, and on the other hand, may neutralize the exogenously expressed nuclease, thereby losing its desired activity or preventing further intervention.

In 2017, the Zhang Pioneu et al reported an RNA Editing technique (RNA Editing with CRISPR-Cas13, Cox et al, 2017) named REPAIR (RNA Editing for Programmable A to I replacement), which can achieve the same A to I Editing of target RNA by exogenously expressing Cas13-ADAR fusion protein and single guide RNA (sgRNA), but the method still needs the expression of exogenously expressed protein as CRISPR technique. The problem caused by the expression of foreign protein cannot be solved.

In 2019, month 1, the Thorsten Stafforst topic group reported a technique called RESTORE nucleic acid editing (recovery endogenous ADAR to specific trans for oligonucleotide-mediated RNA editing, Merkle et al, 2019). The technology can get rid of the dependence on foreign proteins. However, in the first place, the RESTORE technology requires a high editing efficiency in the presence of IFN-gamma, which is a key factor determining the development and severity of autoimmunity (Interferon-gamma and system autoimmunity, Pollard et al, 2013, which makes the application of the technology in the medical field significantly less important.

In 2019, PCT/CN2019/110782 and PCT/CN2020/084922 applications provided an engineered RNA that is partially complementary to a target transcript to recruit native ADAR1 or ADAR2 to change adenosine to inosine at a specific site in the target RNA, a method known as "leaper (exploiting Endogenous ADAR for Programmable Editing of RNA") and RNA recruiting ADAR may be referred to as "dRNA" or "arRNA". The dRNA comprises a complementary RNA sequence that hybridizes to the target RNA, and is capable of recruiting Adenosine Deaminase (ADAR) acting on the RNA to deaminate the target adenosine (A) in the target RNA.

Disclosure of Invention

The application provides a completely new technical scheme aiming at G-to-A mutation in the pathogenic gene of Hurler syndrome IDUA, particularly the highest mutation (NM-000203.4 (IDUA) -c.1205G-A (p.Trp402Ter)) so as to accurately edit mutation sites on target RNA.

Specifically, the present application provides at least the following technical solutions:

1. a method for targeted editing of a target RNA in a target cell based on the LEAPER technique, wherein the target RNA is an RNA containing a G to a mutation in the IDUA gene transcript, the method comprising:

delivering to the target cell a construct comprising adenosine deaminase recruiting RNA (arr) for editing a target RNA or encoding the arr, wherein the arr comprises a complementary RNA sequence that hybridizes to the target RNA, and wherein the arr is capable of recruiting Adenosine Deaminase (ADAR) acting on RNA to deaminate target adenosine (a) in the target RNA.

2. The method as in clause 1, wherein the arrRNA introduces base C, A, U or G that pairs with target A.

In some embodiments, the argrna introduces base C that pairs with target a. In some embodiments, the argrna introduces base a that pairs with target a. In some embodiments, the argrna introduces base U that pairs with target a. 3. The method of any of claims 1-2, wherein the arRNA is about 151-61nt, 131-66nt, 121-66nt, 111-66nt, 91-66nt, or 81-66nt in length. This application discloses and encompasses any natural number within the numerical range recited.

4. The method as described in item 3, wherein the length of the targeting base in the arRNA from the 3' end is 45-5nt, 40-5nt, 35-10nt, 25-15 n or 24-11 nt. This application discloses and encompasses any natural number within the numerical range recited.

5. The method as described in

item

3 or 4, wherein the length of the targeting base in the arrRNA from the 5' end is 80 to 30nt, 70 to 35nt, 60 to 40nt, 55 to 35nt, or 55 to 45 nt. This application discloses and encompasses any natural number within the numerical range recited.

6. The method of any one of items 1 to 5, wherein the target cell is a human cell.

7. The method of any one of items 1 to 6, wherein the target RNA is an RNA comprising a mutation site of NM-000203.4 (IDUA) -c.1205G-A (p.Trp402Ter).

8. The method of any one of items 1 to 7, wherein the arRNA comprises the sequence of: SEQ ID NO: 14. SEQ ID NO: 15. SEQ ID NO: 9. SEQ ID NO: 13. SEQ ID NO: 17. SEQ ID NO: 22. SEQ ID NO: 23. SEQ ID NO: 30. SEQ ID NO: 31 or SEQ ID NO: 34.

9. the method of any one of items 1-5, wherein the arRNA comprises a sequence selected from: SEQ ID NO: 44 or SEQ ID NO: 52.

10. the method of any one of items 1-9, wherein the arRNA is chemically modified.

11. The method as recited in clause 10, wherein the chemical modification comprises a 2-O '-methylation (2' -OMe) or a phosphorothioate modification.

12. The method as recited in item 11, wherein the chemical modification is selected from one or more of:

the first 3 and the last 3 nucleotides of the sequence are respectively modified by 2' -OMe,

the first 3 and last 3 internucleotide linkages are all phosphorothioate linkages,

all U in the sequence are modified by 2' -OMe,

the 3 'nearest neighbor base of the target base is 2' -OMe modified A,

the 5 'nearest neighbor base of the target base is 2' -OMe modified C,

the target base is connected with the 3 'nearest neighbor base and the 5' nearest neighbor base through phosphorothioate bonds respectively,

the first 5 and last 5 nucleotides are modified with 2' -OMe, respectively, and

the first 5 and last 5 internucleotide linkages are phosphorothioate linkages.

In some embodiments, the chemical modification is selected from one or more of:

CM 1: the first 3 nucleotides and the last 3 nucleotides of the sequence are respectively modified by 2' -OMe, and the connections between the first 3 nucleotides and the last 3 nucleotides are all phosphorothioate bonds; meanwhile, all U in the sequence is modified by 2' -OMe;

CM 2: the first 3 nucleotides and the last 3 nucleotides of the sequence are respectively modified by 2' -OMe, and the connections between the first 3 nucleotides and the last 3 nucleotides are all phosphorothioate bonds; meanwhile, the 3 'nearest neighbor base of the target base is 2' -OMe modified A;

CM 3: the first 3 nucleotides and the last 3 nucleotides of the sequence are respectively modified by 2' -OMe, and the connections between the first 3 nucleotides and the last 3 nucleotides are all phosphorothioate bonds; meanwhile, the 5 'nearest neighbor base of the target base is C modified by 2' -OMe;

CM 4: the first 3 nucleotides and the last 3 nucleotides of the sequence are respectively modified by 2' -OMe, and the connections between the first 3 nucleotides and the last 3 nucleotides are all phosphorothioate bonds; simultaneously, the target base is connected with the 3 'nearest neighbor base and the 5' nearest neighbor base through phosphorothioate bonds respectively; and

CM 6: the first 5 and the last 5 nucleotides of the sequence are respectively modified by 2' -OMe, and the connection between the first 5 and the last 5 nucleotides is a phosphorothioate bond. 13. The method of any one of claims 1-9, wherein said construct encoding said arRNA is a linear nucleic acid strand, a viral vector, or a plasmid.

14. The method of item 13, wherein the viral vector is an adeno-associated virus (AAV) vector or a lentiviral expression vector.

15. The method of any one of items 1-14, wherein the delivery modality is electrotransfection, lipofection, lipid-nanoparticle (LNP) delivery, or infection.

16. A method as described in clause 15, delivering to the target cell, via LNP, a construct comprising adenosine deaminase recruiting RNA (arRNA) for editing a target RNA or encoding the arRNA.

17. The method of any of items 1-16, wherein the delivered concentration of the argRNA is greater than or equal to 2.5, greater than or equal to 5nM, greater than or equal to 10nM, greater than or equal to 15nM, or greater than or equal to 20 nM.

In the above embodiments, the target cell comprises a hepatocyte or a fibroblast.

18. An arrrna or a coding sequence thereof for targeted editing of a target RNA in a target cell by LEAPER technology, the arrrna comprising or consisting of any one of the following sequences: SEQ ID NO: 14. SEQ ID NO: 15. SEQ ID NO: 9. SEQ ID NO: 13. SEQ ID NO: 17. SEQ ID NO: 22. SEQ ID NO: 23. SEQ ID NO: 30. SEQ ID NO: 31. SEQ ID NO: 34. SEQ ID NO: 44 or SEQ ID NO: 52.

19. a plasmid, viral vector, liposome, or lipid nanoparticle comprising the arRNA or coding sequence thereof of item 18.

20. A composition, preparation, kit or biological product comprising the arRNA or coding sequence thereof according to item 18, or the plasmid, viral vector, liposome or lipid nanoparticle according to item 19.

21. A method of treating MPS IH in an individual comprising correcting a G to a mutation associated with an MPS IH disease in a target cell of the individual with the method of any one of items 1-17.

22. The method of item 20, wherein the mutation is NM-000203.4 (IDUA) -c.1205G-A (p.Trp402Ter) mutation.

23. The method of

item

20 or 21, wherein the argRNA is used more frequently than or equal to 21 days/time, more frequently than or equal to 17 days/time, more frequently than or equal to 14 days/time, or more frequently than or equal to 10 days/time.

In some embodiments, the present application further relates to the use of a sequence selected from the group consisting of seq id no: SEQ ID NO: 14. SEQ ID NO: 15. SEQ ID NO: 9. SEQ ID NO: 13. SEQ ID NO: 17. SEQ ID NO: 22. SEQ ID NO: 23. SEQ ID NO: 30. SEQ ID NO: 31. SEQ ID NO: 34. SEQ ID NO: 44 or SEQ ID NO: 52.

by using the technical scheme of the application, the in vivo editing of bases from A to I on RNA in target cells (such as hepatocytes or fibroblasts) can be safely and effectively carried out, pathogenic mutation sites such as NM-000203.4 (IDUA) -c.1205G-A (p.Trp402Ter) mutation can be accurately repaired, the normal expression of proteins coded by RNA in vivo is recovered, and the purpose of treating MSP IH is achieved.

Drawings

FIG. 1 shows the detection of IDUA genotypes on GM06214 cells.

FIG. 2 shows the cell electrotransfection condition test.

FIGS. 3A-B show the design of arRNA for IDUApre-mRNA and mRNA, and the detection of cell function after editing; and designing an arRNA for IDUA pre-mRNA and mRNA, and detecting the editing efficiency of the cells.

FIG. 4A shows the design of IDUA-reporter cell line; and FIG. 4B shows the editing efficiency of detecting different lengths of arRNAs (symmetric truncations) on 293T-IDUA-Reporter.

FIGS. 5A-B show the detection of enzyme activity and editing efficiency at different time points after transfection of different lengths (symmetrically truncated) of the arRNA on GM06214 cells.

FIG. 6 shows IDUA enzyme activity and editing efficiency assays following lipofectamine RNAIMAX transfection of ARRNA (symmetric truncation, 3 'truncation and 5' truncation) in GM06214 cells.

FIG. 7A shows that the arRNAs targeting the human IDUA mutation site are reduced in base number one by one at the 3' end, preferably between 55-c-25 and 55-c-10, and the optimal length is selected by enzyme activity assay using GM06214 cells. 7B shows that the arRNA targeting the IDUA mutation site in mice decreases gradually every 5 bases at the 3' end between 55-c-55 and 55-c-10, and the optimal arRNA length sequence was selected by enzymatic activity assay using MPSI mouse MEF cells (MSPI MEF (MSPI mouse embryo fiber)).

FIG. 8A shows the optimum length range screened by gradually shortening the 5 'end length at the preferred 2 3' end lengths, and FIG. 8B shows the effect of the enzyme activity on the arRNA formed by base-by-base shortening of the 5 'end after fixing the 3' end length to 14nt, and the optimum arRNA length screened by combining FIGS. 8A and 8B.

FIG. 9 shows a comparison of the effect of different types of chemical modifications on the efficiency of ARRNA editing (in terms of enzymatic activity) at a preferred length of 2 ARRNAs.

FIGS. 10A-D show the efficiency of editing and the ability to produce functional IDUA proteins after editing by human and mouse arRNAs at different concentrations of arRNAs, at preferred lengths and preferred combinations of chemical modifications.

FIGS. 11A-D show IDUA enzyme activity measured in human or murine cells at various times after one transfection with a combination of preferred length and preferred chemical modification.

FIGS. 12A-B show the editing efficiency of the targeting site achieved by different means of arRNA delivery in human and mouse primary liver cells.

Figure 13 shows the efficiency of editing IDUA-targeting argrnas delivered with LNPs on primary cultured human and mouse liver cells.

FIG. 14 shows IDUA editing efficiency in mouse liver cells after screening for arRNAs targeting mouse IDUA mutations (SEQ ID NO: 52) were administered to mice via the tail vein at different concentrations for 24hrs after packaging into LNPs.

Detailed Description

Definition of

RNA editing refers to a natural process occurring in eukaryotic cells, and is editing from bases a (adenine) to I (hypoxanthine) occurring at the RNA level after DNA transcription and before protein translation, where hypoxanthine is recognized as G during translation, and editing a to I in RNA diversifies the transcriptome. The total amount of RNA is increased several fold by means of site-specific and precise alterations of the RNA molecule. This editing is catalyzed by adar (adenosine Deaminase activating RNA) protease and is called site-directed RNA editing. Editing of the coding region, which may occur in both intron and exon sequences, may also occur in non-coding sequences, and may redefine the protein coding sequence.

As used herein, "LEAPER technique", i.e. a technique for RNA editing by recruitment of endogenous ADAR using engineered RNA, refers to RNA editing techniques as reported in WO2020074001a 1. The engineered RNA, adenosine deaminase recruiting RNA (arrna), as used herein, refers to RNA that is capable of deaminating a target adenosine in RNA by recruiting ADAR or some complex comprising an ADAR domain.

As used herein, the term "Adenosine Deaminase (ADAR)" refers to a class of adenosine deaminases that are widely expressed in various tissues of eukaryotes, including mammals such as humans, and that catalyze the conversion of adenosine A to inosine I in RNA molecules. In turn, I is usually translated as G during eukaryotic protein synthesis.

As used herein, "complementary" to a nucleic acid refers to the ability of one nucleic acid to form hydrogen bonds with another nucleic acid through traditional Watson-Crick base pairing. Percent complementarity refers to the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (i.e., Watson-Crick base pairing) with another nucleic acid molecule (e.g., about 5, 6, 7, 8, 9, 10 out of 10 are about 50%, 60%, 70%, 80%, 90%, and 100% complementary, respectively). "completely complementary" means that all consecutive residues of a nucleic acid sequence form hydrogen bonds with the same number of consecutive residues in a second nucleic acid sequence. As used herein, "substantially complementary" refers to a degree of complementarity of at least any one of about 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% over a region of about 40, 50, 60, 70, 80, 100, 150, 200, 250 or more nucleotides, or to two nucleic acids that hybridize under stringent conditions. For a single base or a single nucleotide, according to Watson-Crick base pairing rules, A is said to be complementary or matched when it is paired with T or U, C and G or I, and vice versa; the other base pairing is referred to as non-complementary or non-matched.

"hybridization" refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized by hydrogen bonds between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding or in any other sequence specific manner. Sequences that are capable of hybridizing to a given sequence are referred to as "complementary sequences" to the given sequence.

As used herein, the term "electrotransfection" refers to an electroporation transfection technique which is a technique for delivering macromolecules such as DNA and the like to cells by temporarily forming pores or openings in cell membranes after applying an electric field to the cells for several microseconds to several milliseconds.

As used herein, the term "lipofection (Lipo)" refers to a transfection technique in which liposomes are used as a delivery vehicle in vivo and in vitro. Liposomes include neutral liposomes, which are liposomes that utilize a lipid membrane to encapsulate a macromolecule, such as a nucleic acid, for delivery into the cell membrane via the lipid membrane, and cationic liposomes; the cationic liposome is positively charged, and the transferred macromolecules are not pre-embedded in the cationic liposome, but automatically combined to the positively charged liposome due to the self-negative charge of the macromolecules to form a macromolecule-cationic liposome complex, so that the macromolecule-cationic liposome complex is adsorbed to the surface of a negatively charged cell membrane and is delivered into cells through endocytosis.

As used herein, the term "lipid-nanoparticle (LNP) delivery" refers to the transmembrane delivery of large molecules, e.g., nucleic acids, proteins, etc., through lipid nanoparticles into cells. Wherein, the lipid nanoparticle refers to a particle synthesized by mixing two phases, and comprises an ethanol phase containing ionizable lipid, helper phospholipid, cholesterol and PEG lipid and an acidic aqueous phase containing macromolecules such as nucleic acid and protein. For example, LNP coated with RNA can enter the cytoplasm by endocytosis.

Herein, NM _000203.4(IDUA) -c.1205g-a (p.trp402ter) mutation refers to a G to a mutation at position 1205 in the transcript of IDUA gene number 000203.4, which results in the conversion of the tryptophan (Trp) coding sequence at position 402 of the peptide chain translated by said transcript to a stop codon (Ter) such that the final translated amino acid is deleted for all amino acids after position 402, thereby losing the enzymatic activity of IDUA. Patients who develop this mutation can be rendered teratogenic or even lethal to the patient by the lack of active alpha-L-iduronidase that affects degradation of glucosaminoglycans in the cell lysosome. The protocol in this application, however, restores the activity of the IDUA enzyme by reversing this mutation at the transcriptional level.

As used herein, the term "target RNA" refers to a target RNA to be edited, which comprises an adenosine (a) to be edited. The target RNA may be mature mRNA or may be a pre-mRNA. More preferred in this application are mRNA precursors. Herein, a cell comprising the "target RNA" is referred to as a target cell. The adenosine to be edited is referred to as the "target base", "target adenosine" or "target a". In this application, "target base", "target adenosine" or "target a" may be used interchangeably. The base adjacent to the target adenosine at the 5 'end of the target RNA is referred to as the "5' adjacent base"; the base adjacent to the target adenosine at the 3 'end of the target RNA is referred to as the "3' adjacent base"; the base triplet consisting of the target base and its 3 'and 5' adjacent bases is referred to herein as a "target base triplet". When the arRNA hybridizes to the target RNA, the base on the arRNA opposite the target base is referred to as the "target base", and the base adjacent to the target base at the 5 'end of the a rRNA is referred to as the "5' nearest neighbor base"; the base adjacent to the target base at the 3 'end of the arRNA is referred to as the "3' nearest neighbor base"; the base triplets consisting of the targeting base and its 3 'and 5' nearest neighbors are referred to herein as "targeting base triplets".

As used herein, the term "construct" refers to a nucleic acid vector comprising a nucleic acid sequence, which may be a linear nucleic acid molecule, a plasmid, or a viral vector, and the like. The nucleic acid molecule may be single-stranded or double-stranded. The nucleic acid sequence may be a DNA sequence or an RNA sequence. In some embodiments, the nucleic acid sequence exerts its function directly without being transcribed, translated, or expressed. In some embodiments, the nucleic acid sequence is a DNA sequence that functions as an RNA molecule upon transcription to form RNA. In some embodiments, the nucleic acid sequence is RNA that functions, upon translation, as a polypeptide or protein. In some embodiments, the nucleic acid sequence is DNA that functions as a protein after being formed into a protein by transcription and translation steps. The construct can enter a target cell by being packaged into a virus, a lipid nanoparticle or an exosome, and can also enter the target cell by means of electrotransformation, microinjection, chemical transformation and the like.

As used herein, the term "delivery" refers to the introduction of biological macromolecules such as nucleic acids, proteins, etc. into the cell membrane from outside the cell membrane by some route. Such "delivery" is for example by means of electrotransfection, lipofection, lipid-nanoparticle delivery, viral delivery, exosome delivery and the like.

The term "modification" as used herein refers to a chemical or biological process, such as genetic engineering, to alter the composition or structure of a nucleic acid or protein such that one or more properties or functions of the nucleic acid or protein are altered.

Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

RNA editing method

The application provides a method for targeted editing of IDUA target RNA containing G to A mutation in target cells based on LEAPER technology, which comprises the following steps: delivering to the target cell a construct comprising adenosine deaminase recruiting RNA (arr) for editing a target RNA or encoding the arr, wherein the arr comprises a complementary RNA sequence that hybridizes to the target RNA, and wherein the arr is capable of recruiting Adenosine Deaminase (ADAR) acting on RNA to deaminate target adenosine (a) in the target RNA. In some embodiments, the target RNA is a mRNA precursor. In some embodiments, the target RNA is a mature mRNA. In some embodiments, the target RNA is an IDUA target RNA transcribed with a mutation site comprising NM _000203.4(IDUA) -c.1205g-a (p.trp402ter).

In some embodiments, the arRNA comprises base C, A, U or G that pairs with target a. The preferred order of base pairing to target A is C, A, U, G. That is, when the lengths of the arRNAs are uniform, the distances of the target bases from the 5 'end are uniform, the distances of the target bases from the 3' end are uniform, and the sequences of the arRNAs other than the target bases are completely uniform, the preferred order of the target bases is C > A > U > G. When the target base is C, the arRNA may be represented as X nt-C-Y nt, wherein X represents that the distance of the target base from the 5 'end of the arRNA is X nt, and Y represents that the distance of the target base from the 3' end of the arRNA is Y nt, wherein X and Y may represent any natural number.

In some embodiments, the target cell is a eukaryotic cell. In some embodiments, the target cell is a mammalian cell. In some embodiments, the target cell is a hepatocyte or a fibroblast. In some embodiments, the target cell is a human or mouse cell.

In some embodiments, the arrRNA is about 151-61nt, 131-66nt, 121-66nt, 111-66nt, 91-66nt, or 81-66nt in length. In some embodiments, the targeting base in the arRNA is 45-5nt, 40-5nt, 35-10nt, 25-15 n, or 24-11 nt in length from the 3' end. In some embodiments, the length of the targeting base from the 5' end in the arRNA is 80-30nt, 70-35nt, 60-40nt, 55-35 nt, or 55-45 nt. Wherein, the length of the target base from the 3 ' end refers to all the base numbers from the 3 ' nearest neighbor base to the 3 ' most terminal base of the target base; the length of the target base from the 5 ' end refers to all the base numbers from the 5 ' nearest neighbor base to the 5 ' most terminal base of the target base.

In some embodiments, the target cell is a human cell, and wherein the target RNA is an IDUA target RNA transcribed with a mutation site comprising NM-000203.4 (IDUA) -c.1205G-A (p.Trp402Ter), then the full length of the arRNA is ≧ 66nt, e.g., about 121-66nt, 111-66nt, 101-66nt, 91-66nt, or 81-66nt, i.e., the full length of the arRNA is selected from any natural number within the above length range, e.g.: 67nt, 68nt, 69nt, 70nt, 71nt, 72nt, 73nt, 74nt, 75nt, 76nt, 77nt, 78nt, 79nt, 80nt, 81nt, 82nt, 83nt, 84nt, 85nt, 86nt, 87nt, 88nt, 89nt, 90nt, 91nt, 95nt, 100nt, 110nt, 115nt, 120 nt. In some embodiments, the length of the targeting base from the 3 ' end in the arRNA is 45nt to 5nt, 40nt to 5nt, 35nt to 10nt, 25nt to 15nt, or 24nt to 11nt, i.e., the distance of the targeting base from the 3 ' end of the arRNA is selected from any natural number of the above-described ranges of lengths of the targeting base from the 3 ' end, such as: 12nt, 13nt, 14nt, 16nt, 17nt, 18nt, 19nt, 20nt, 21nt, 22nt, 23 nt. In some embodiments, the length of the targeting base from the 5 ' end in the arRNA is 80-30nt, 70-35nt, 60-40nt, 55nt-35nt, or 55nt-45nt, i.e. the distance of the targeting base from the 5 ' end of the arRNA is selected from any natural number of the above-mentioned ranges of lengths of the targeting base from the 5 ' end, such as: 46nt, 47nt, 48nt, 49nt, 50nt, 51nt, 52nt, 53nt, 54 nt. In some embodiments, the arRNA comprises a sequence selected from the group consisting of: SEQ ID NO: 14. SEQ ID NO: 15. SEQ ID NO: 9. SEQ ID NO: 13. SEQ ID NO: 17. SEQ ID NO: 22. SEQ ID NO: 23. SEQ ID NO: 30. SEQ ID NO: 31. SEQ ID NO: 34.

in some embodiments, the target cell is a mouse cell (e.g., a W392X mouse cell), and wherein the target RNA is a target RNA transcribed to comprise an IDUA mutation corresponding to the human W402X mutation. In some embodiments, the target cell is a W392X mouse cell. In some embodiments, the arRNA is about 121-53nt, 111-61nt, 101-61nt, 91-61nt, 81-61nt, 111-66nt, or 105-66nt long, i.e., the total length of the arRNA is selected from any natural number of the above length ranges, e.g.: 67nt, 68nt, 69nt, 70nt, 71nt, 72nt, 73nt, 74nt, 75nt, 76nt, 77nt, 78nt, 79nt, 80nt, 81nt, 82nt, 83nt, 84nt, 85nt, 86nt, 87nt, 88nt, 89nt, 90nt, 91nt, 95nt, 100nt, 110nt, 115nt, 120 nt. In some embodiments, the length of the targeting base in the arRNA from the 3 ' end is 55nt to 10nt or 50nt to 10nt, i.e. the distance of the targeting base of the arRNA from the 3 ' end is selected from any natural number of the above-mentioned range of lengths of the targeting base from the 3 ' end, such as: 11nt, 12nt, 13nt, 14nt, 16nt, 17nt, 18nt, 19nt, 20nt, 21nt, 22nt, 23nt, 24nt, 25nt, 26nt, 27nt, 28nt, 29nt, 30nt, 31nt, 32nt, 33nt, 34nt, 35nt, 37nt, 38nt, 39nt, 40nt, 41nt, 42nt, 43nt, 44nt, 45nt, 46nt, 47nt, 48nt, 49nt, 50 nt. In some embodiments, the length of the targeting base from the 5 ' end in the arRNA is 80-30nt, 70-35nt, 60-40nt, 55nt-35nt, or 55nt-45nt, i.e. the distance of the targeting base from the 5 ' end of the arRNA is selected from any natural number of the above-mentioned ranges of lengths of the targeting base from the 5 ' end, such as: 33nt, 36nt, 47nt, 46nt, 47nt, 48nt, 49nt, 50nt, 51nt, 52nt, 53nt, 54nt, 60nt, 65nt, 75 nt. In some embodiments, the arRNA comprises a sequence selected from the group consisting of: SEQ ID NO: 44 or SEQ ID NO: 52.

in some embodiments, the argrna is chemically modified. In some embodiments, the chemical modification is a 2-O' -methylation and/or phosphorothioate modification. In some embodiments, the chemical modification is selected from one or more of:

all U in the sequence are modified by 2' -OMe,

the 3 'nearest neighbor base of the target base is 2' -OMe modified A,

the 5 'nearest neighbor base of the target base is 2' -OMe modified C,

the first 5 and last 5 nucleotides are modified with 2' -OMe, respectively, and

the first 5 and last 5 internucleotide linkages are phosphorothioate linkages.

A construct encoding the arRNA is a construct comprising the arRNA coding sequence, as described herein. In some embodiments, the argrna is transcribed from the construct encoding the argrna after the construct encoding the argrna is delivered into the target cell. In some embodiments, the construct encoding the arRNA is a linear nucleic acid strand, a viral vector, or a plasmid. In some embodiments, the viral vector is an adeno-associated virus (AAV) or lentivirus. In some embodiments, when the construct encoding the argrna is delivered into the target cell, it inserts the sequence encoding the argrna into the genome of the target cell by homologous recombination or non-homologous recombination, etc., thereby continuing transcription to generate the argrna. In some embodiments, the construct encoding the arRNA is delivered to the target cell such that the sequence encoding the arRNA is present in the target cell as part of the free nucleic acid, such that the sequence encoding the arRNA can be transcribed over a period of time to produce the arRNA.

In some embodiments, the delivery is electrotransfection, lipofection, or lipid-nanoparticle (LNP) delivery or infection. In some embodiments, when the target cell is a liver cell, the delivery is LNP delivery. In some embodiments, when the target cell is a fibroblast, the delivering is lipofection. In some embodiments, the delivered concentration of the argRNA is ≧ 2.5-5nM, preferably ≧ 10-20nM, e.g., ≧ 15 nM. In the present application, the delivery concentration refers to the amount of arRNA contained in a volume unit of arRNA in the delivery system to the target cell when the arRNA construct is delivered to the target cell. The delivery system comprises an arRNA or a construct thereof, a target cell, and a liquid matrix surrounding the arRNA and the target cell. In some embodiments, the liquid medium may be cell culture medium, PBS, or other cytosolic isotonic solution that maintains cells in a stable viable state for a period of time. In some embodiments, the delivery system further comprises an agent that facilitates delivery.

arRNA

The present application also provides an arRNA that can be used to target-edit a target RNA in a target cell based on LEAPER technology, for example, a target RNA transcribed with a mutation site comprising NM _000203.4(IDUA) -c.1205g-a (p.trp402ter), to deaminate the target a in the target RNA as hypoxanthine I. And in the subsequent translation process of the target cell, I can be recognized as G, so that the mutation of G > A is recovered to G, and the target RNA can be translated into the correct protein after the target RNA is edited. In some embodiments, the target RNA is a mRNA precursor. In some embodiments, the target RNA is a mature mRNA.

In some embodiments, the introduction of the argrna into base pairing with target a (targeting base) editing efficiency is C, A, U, G, from large to small. In some embodiments, the target RNA is complementary to the target RNA in addition to the targeting base. In some embodiments, one or more bases of the argrna, in addition to the targeting base, forms a mismatch with the target RNA.

In some embodiments, the target cell is a eukaryotic cell. In some embodiments, the target cell is a mammalian cell. In some embodiments, the target cell is a hepatocyte or a fibroblast. In some embodiments, the target cell is a human or mouse cell (e.g., a W392X mouse cell).

in some embodiments, the target cell is a mouse cell (e.g., a W392X mouse cell), and wherein the target RNA is a target RNA transcribed to comprise an IDUA mutation corresponding to the human W402X mutation, then the arRNA is about 121-53nt, 111-61nt, 101-61nt, 91-61nt, 81-61nt, 111-66nt, or 105-66nt long, i.e., the full length of the arRNA is selected from any natural number of the above length ranges, e.g.: 67nt, 68nt, 69nt, 70nt, 71nt, 72nt, 73nt, 74nt, 75nt, 76nt, 77nt, 78nt, 79nt, 80nt, 81nt, 82nt, 83nt, 84nt, 85nt, 86nt, 87nt, 88nt, 89nt, 90nt, 91nt, 95nt, 100nt, 110nt, 115nt, 120 nt. In some embodiments, the length of the targeting base in the arRNA from the 3 ' end is 55nt to 10nt or 50nt to 10nt, i.e. the distance of the targeting base of the arRNA from the 3 ' end is selected from any natural number of the above-mentioned range of lengths of the targeting base from the 3 ' end, such as: 11nt, 12nt, 13nt, 14nt, 16nt, 17nt, 18nt, 19nt, 20nt, 21nt, 22nt, 23nt, 24nt, 25nt, 26nt, 27nt, 28nt, 29nt, 30nt, 31nt, 32nt, 33nt, 34nt, 35nt, 37nt, 38nt, 39nt, 40nt, 41nt, 42nt, 43nt, 44nt, 45nt, 46nt, 47nt, 48nt, 49nt, 50 nt. In some embodiments, the length of the targeting base from the 5 ' end in the arRNA is 80-30nt, 70-35nt, 60-40nt, 55nt-35nt, or 55nt-45nt, i.e. the distance of the targeting base from the 5 ' end of the arRNA is selected from any natural number of the above-mentioned ranges of lengths of the targeting base from the 5 ' end, such as: 33nt, 36nt, 47nt, 46nt, 47nt, 48nt, 49nt, 50nt, 51nt, 52nt, 53nt, 54nt, 60nt, 65nt, 75 nt. In some embodiments, the arRNA comprises a sequence selected from the group consisting of: SEQ ID NO: 44 or SEQ ID NO: 52.

in some embodiments, the argrna is transcriptionally expressed from a construct encoding the argrna. In some embodiments, the arRNA is expressed by in vitro transcription from a construct encoding the arRNA and purified. In some embodiments, the arrrna is directly expressed and exerts an editing effect in vivo from a construct encoding the arrrna. In some embodiments, the construct is selected from the group consisting of a viral vector, a plasmid, and a linear nucleic acid. In some embodiments, the virus is an AAV or lentivirus.

In some embodiments, the argrna is chemically synthesized. In some embodiments, the argrna is chemically modified. In some embodiments, the chemical modification is a 2-O' -methylation and/or phosphorothioate modification. In some embodiments, the chemical modification is selected from one or more of:

all U in the sequence are modified by 2' -OMe,

the 3 'nearest neighbor base of the target base is 2' -OMe modified A,

the 5 'nearest neighbor base of the target base is 2' -OMe modified C,

the first 5 and last 5 nucleotides are modified with 2' -OMe, respectively, and

the first 5 and last 5 internucleotide linkages are phosphorothioate linkages.

In some embodiments, the chemical modification is selected from one or more of:

CM 6: the first 5 and the last 5 nucleotides of the sequence are respectively modified by 2' -OMe, and the connection between the first 5 and the last 5 nucleotides is a phosphorothioate bond.

Construct

The present application also provides a construct encoding the aforementioned arRNA. In some embodiments, the construct is selected from the group consisting of a viral vector, a plasmid, and a linear nucleic acid. In some embodiments, the viral vector is an AAV vector or a lentiviral expression vector.

The application further provides viruses, up to nanoparticles, liposomes, exosomes or cells comprising the constructs.

Formulations and biologics

The present application also provides compositions, formulations, and biologics comprising any of the foregoing argrnas or any of the foregoing constructs that can be used to edit a target RNA transcribed with a mutation site comprising NM _000203.4(IDUA) -c.1205g-a (p.trp402ter) in a target cell to restore normal function of the IDUA gene. In some embodiments, the arRNA or construct is encapsulated in a liposome. In some embodiments, the arRNA or the construct is prepared to form a lipid nanoparticle. In some embodiments, the arRNA or the construct is introduced into the subject by viral delivery means (e.g., adeno-associated virus or lentivirus).

In some embodiments, the preparation comprising an arrrna is a therapeutic agent that can be delivered to a patient for treatment of a disease. In some embodiments, the input is a local injection, local perfusion or intravenous infusion, local perfusion, or local injection. In some embodiments, the agent is in a dosage form suitable for local injection into the liver, e.g., hepatic arterial infusion. In some embodiments, the agent is in a dosage form suitable for intramuscular injection. In some embodiments, the pharmaceutical agent is in a dosage form suitable for intravenous injection.

Reagent kit

The present application also provides a kit for editing a target RNA in a target cell comprising an arRNA as described above, a construct encoding the arRNA as described above or an agent as described above. The kit can be used for targeting target RNA transcribed with mutation sites comprising NM _000203.4(IDUA) -c.1205G-A (p.Trp402Ter) in editing target cells.

In some embodiments, the kit comprises an arRNA as described above or a construct encoding the arRNA as described above, and a staining aid, the arRNA or construct and the staining aid being packaged in separate containers. In some embodiments, the co-staining agent is a lipid solution. For example: lipo (Lipofectmine RNAiMAX Cat number: 13778150) of Yingwei Jiji or an agent having the same functional component as the Lipofectmine RNAiMAX Cat number.

In some embodiments, the kit further comprises instructions for use to inform the user of the various ingredients contained in the kit and their amounts, and/or the method of use of the kit.

Therapy method

The present application still further provides a method of treating mucopolysaccharidosis type IH in a subject comprising correcting for a G to a mutation with the IDUA gene, e.g., NM _000203.4(IDUA) -c.1205g-a (p.trp402ter) mutation, in the cells of the subject using the methods described above. In some embodiments, the disease comprises herler's syndrome. In some embodiments, when the subject is a human, wherein the frequency of use of the argRNA is ≥ 21 days/time, ≥ 17 days/time, ≥ 14 days/time or ≥ 10 days/time. In some embodiments, when the subject is a mouse, the frequency of use of the arRNA is ≧ 8 days/time. In some embodiments, the therapy uses a construct that encodes the arRNA, and the construct can integrate the sequence encoding the arRNA into the target cell, then the arRNA is used in a single dose.

The method for targeted editing of RNA by using LEAPER technology has the following advantages:

1. the method does not depend on the expression of foreign proteins, so that the loading and the delivery in a human body through a virus vector are not very difficult due to the overlarge molecular weight of the proteins; the off-target effect caused by the over-expression of the foreign protein can not be caused; the immune response and the damage of the organism caused by the expression of the foreign protein can not be caused; and gene editing failure caused by neutralizing exogenous editing enzymes or effector proteins due to pre-existing antibodies in the organism can be avoided.

2. This enzyme-directed site-specific RNA editing method provided herein is distinct from DNA editing, which is reversible and controllable. Diseases can be treated by recoding amino acid codons, and protein and RNA functions can be researched. Because the potential side effects of RNA editing are reversible, it is safer.

3. Compared with the prior art, the method can be completed by electrotransfection or lipofection after the arRNA is chemically synthesized, and can also be delivered to a patient to play a role through vectors such as adeno-associated virus (AAV), lentivirus and the like, so that the delivery means is more flexible and changeable in selection, and the editing efficiency is higher.

The preferred embodiments of the present invention have been described above in detail, but the present invention is not limited thereto. Within the scope of the technical idea of the invention, many simple modifications can be made to the technical solution of the invention, including combinations of various technical features in any other suitable way, and these simple modifications and combinations should also be regarded as the disclosure of the invention, and all fall within the scope of the invention.

The technical solution of the present invention will be further described with reference to the following specific examples, but the present invention is not limited to the following examples. Unless otherwise specified, the reagents referred to below are all commercially available. For the sake of brevity, the parameters of the procedures, steps and equipment used are not described in detail in part of the procedures, it being understood that these are well known to those skilled in the art and are reproducible. The cell (GM06214) used herein is a fibroblast cell from a patient with Hurler syndrome, available from Coriell, USA. Editing arRNA was synthesized by Syntheto, USA or Bexin Biotechnology, Inc., Sanger sequencing was performed by Beijing Rui Bo Biotechnology, Inc., and second generation sequencing was performed by Noo He biogenic bioinformatics technology, Inc. or the sequencing platform of rice in Zhongkou.

Examples

Example 1: detection of GM06214 mutant genotype

GM06214 cells (fibroblasts from Hurler syndrome patients) were placed in fibroblast culture medium (ScienCell, FM medium, cat # 2301) containing 15% serum, 1% fibroblast growth supplement (ScienCell, GFS, cat # 2301) was added, and the mixture was incubated at 37 ℃ with 5% CO₂Culturing in incubator for 2-3 days. When the cell confluence reached 90%, digestion was stopped with a fibroblast culture broth containing 15% serum after digestion with 0.25% pancreatin. By using

(TIANGEN Biotech (Beijing) Co., Ltd.) the cell DNA extraction kit (cat # DP304-03) performs DNA extraction according to the protocol.

Primer design of sequences upstream and downstream of the IDUA mutation site was performed using NCBI-Primer blast (website: https:// www.ncbi.nlm.nih.gov/tools/Primer-blast /). SEQ ID NO 1: CGCTTCCAGGTCAACAACAC (forward primer hIDUA-F1); SEQ ID NO 2: CTCGCGTAGATCAGCACCG (reverse primer hIDUA-R1). PCR reactions were performed and the PCR products were subjected to Sanger sequencing. The mutation pattern of the cells was determined to be a pathotype in which G was changed to A at position 15704 on the IDUA genome, as shown in FIG. 1.

Example 2: GM06214 cell electrotransfection condition screening

The cells were digested when GM06214 cells grew to approximately 90% confluence and counted after termination of digestion. In the case of electrotransfection, 600 ten thousand cells were resuspended in 400. mu.l of a premixed electrotransfection solution (Lonza, cat # V4XP-3024), 20ug of GFP plasmid (Lonza, cat # V4XP-3024 was added, and after mixing, 20. mu.l of the mixture was taken as one electrotransfection system, 7 electrotransfection conditions (see FIG. 2) plus 8 negative controls were tested using a Lonza nuclear transfectator, and each condition was repeated 2 times, after the electrotransfection, the cells were rapidly transferred to 2ml of a fibroblast culture solution (ScienCell, FM medium, cat # 2301) containing 15% serum, 2 wells per cell of each condition were inoculated in a culture plate, the cells were cultured in a 37 ℃ C., 5% CO2 culture box, 24 hours after the electrotransfection, one well of 2 wells per electrotransfection condition was digested, the proportion of GFP positive cells was measured using a flow cytometer, 48 hours after the electrotransfection, and the other well of the cells in 2 wells per electrotransfection condition was digested, the proportion of GFP positive cells was determined by flow cytometry. The optimal electrotransfection conditions for the resulting cells were those of the CA-137 group, as shown in FIG. 2.

Example 3: IDUA enzyme Activity and editing efficiency Studies after electrotransfection of arRNA in GM06214 cells

Aiming at sequences upstream and downstream of mutation sites of pre-mRNA (mRNA precursor) and match-mRNA (mature mRNA) after IDUA gene transcription, the following arRNA sequences are designed and synthesized: SEQ ID NO 3: GACGCCCACCGUGUGGUUGCUGUCCAGGACGGUCCCGGCCUGCGACACUUCGGCCCAGAGCUGCUCCUCAUCCAGCAGCGCCAGCAGCCCCAUGGCCGUGAGCACCGGCUU (Pre-55nt-c-55 nt); SEQ ID NO 4: GACGCCCACCGUGUGGUUGCUGUCCAGGACGGUCCCGGCCUGCGACACUUCGGCCCAGAGCUGCUCCUCAUCUGCGGGGCGGGGGGGGGCCGUCGCCGCGUGGGGUCGUUG (m-55nt-c-55 nt); SEQ ID NO 5: UACCGCUACAGCCACGCUGAUUUCAGCUAUACCUGCCCGGUAUAAAGGGACGUUCACACCGCGAUGUUCUCUGCUGGGGAAUUGCGCGAUAUUCAGGAUUAAAAGAAGUGC (Random-111nt), wherein the base corresponding to the mutation site in the synthetic arRNA is changed from T to C, forming an A-C mismatch. The length of the synthetic arRNA is preferably 111 nt. The cells were transfected using the optimal electrotransfection conditions obtained in example 2, and 48 hours after the electrotransfection, the cells were collected and subjected to enzyme activity measurement and editing efficiency detection.

And (3) detecting the editing efficiency:

the designed and synthesized arRNA was dissolved with RNase-free water (all-type gold, cat # GI 201-01) to a desired concentration and stored at-80 ℃. The cells were digested when GM06214 cells grew to approximately 90% confluence and counted after termination of digestion. 100 ten thousand cells were taken, 200pmol of argRNA was added to 100ul volume, and electrotransfection was performed under CA-137 conditions. At 48 hours after the electrotransfection, the cells were counted and the survival rate was measured. The cells were transferred to a RNase-free centrifuge tube, centrifuged, and the supernatant was discarded, followed by extraction of RNA using QIAGEN RNA extraction kit (QIAGEN, cat # 74134). According to the specification, by 5X 10⁵0.35ml of Buffer RLT Plus was added to each cell and mixed by pipetting (if frozen cells were used for RNA extraction directly, one wash with PBS was recommended). The lysed cell fluid was applied to a gDNA Eliminator spin column (spin column) and centrifuged at 8000g or more for 30s, discarding the column to leave the fluid. One volume of 70% ethanol was added, and the mixture was blown and mixed well, and immediately proceeded to the next step. Adding the liquid into a RNeasy MinElute rotary centrifugal column, centrifuging for 15s at more than or equal to 8000g, and discarding the waste liquid. To RNeasy MinElute spin column, 700. mu.l of Buffer RW1 was added, and the column was centrifuged at 8000g or more for 15 seconds, and the waste liquid was discarded. Add 500. mu.l Buffer RPE to RNeasy MinElute spin column, centrifuge at > 8000g for 15s, and discard waste liquid. Add 500. mu.l 80% ethanol to RNeasy MinElute spin column, centrifuge at > 8000g for 2 min, and discard waste liquid. RNeasy MinElute spin columns were placed on a new 2ml collection column and spun at top speed with the lid open for 5 minutes to allow the column to dry. The RNeasy MinElute spin column was placed on a new 1.5ml collection column, 14. mu.l of RNase-free water was added dropwise to the center of the column membrane, and the column was centrifuged at maximum speed for 1 minute to elute RNA.

The extracted RNA was subjected to concentration measurement using a Nanodrop (Thermo, cat # Nanodrop2000) and reverse transcription using 1ug of RNA (Thermo, reverse transcriptase cat # 28025013). The reverse transcription system was configured as in Table 1, and after 5 minutes of incubation at 65 ℃ it was immediately cooled in an ice bath. Incubation was continued for 50 minutes at 37 ℃. The reverse transcriptase was inactivated at 70 ℃ for 15 min. PCR was performed under the conditions shown in Table 3. After the PCR is finished, 2ul of PCR products are taken for agarose gel electrophoresis, and whether the concentration of the PCR products and the size of bands are correct or not is preliminarily judged according to the electrophoresis result. After purification, the PCR product was pooled and sent to the second generation for sequencing.

TABLE 1 reverse transcription System configuration-1

	Volume (ul)
		Total RNA (1ug)	X
Oligo dT
		1
10nM dNTP			1
	RNase-Free Water	10-X
Total volume			12

At 65 ℃ for 5 minutes, immediately transferred to ice.

TABLE 2 reverse transcription System configuration-2

TABLE 3 PCR conditions

And (3) enzyme activity detection:

GM06214 cells were digested, centrifuged, and resuspended in 28ul of 1 XPBS containing 0.1% Triton X-100 for 30 minutes on ice. Then 25ul of cell lysate was added to 25ul of substrate containing 190 μ M4-methylumbelliferyl- α -L-methacrylosidase (4-methylumbelliferyl- α -L-iduronidase) (Cayman,2A-19543-500, dissolved in 0.4M sodium formate buffer containing 0.2% Triton X-100, pH 3.5). Incubate for 90 minutes at 37 ℃ in the dark. 200ul of 0.5M NaOH/Glycine solution (Beijing chemical, NAOH, cat # AR 500G; Solaibao, Glycine cat # G8200) was added, pH 10.3, and the catalytic reaction was inactivated. Centrifuge at 4 ℃ for 2 minutes. The supernatant was transferred to a 96-well plate and fluorescence was measured using a 365nm excitation wavelength and a 450nm excitation wavelength using an Infinite M200 instrument (TECAN).

In the present application, all the data of the results of the enzyme activity assay are expressed as fold of the enzyme activity in GM01323 cells. Among them, GM01323 cells are fibroblasts from patients with Scheie syndrome. Scheie syndrome is a milder one of mucopolysaccharidosis, with much less symptoms than Hurler syndrome. Patients with Scheie syndrome often have a better prognosis, a generally normal lifespan, and can survive into adulthood. IDUA enzyme activity in fibroblasts of patients with Scheie syndrome is 0.3% of that of healthy human wild-type fibroblasts.

As shown in FIG. 3, the results showed that the arRNA targeted to the pre-mRNA (pre-mRNA) exhibited higher enzyme activity and editing efficiency, while the arRNA targeted to the mature mRNA (match-mRNA) exhibited significantly lower enzyme activity and editing efficiency. The arRNAs involved in the examples below are therefore all targeted to mRNA precursors (pre-mRNA).

Example 4: detection of IDUA target site editing efficiency following electrotransfection of arRNA on IDUA-reporter cell lines

As shown in FIG. 4A, a plasmid was constructed by inserting a sequence carrying the IDUA mutation site and about 100bp upstream and downstream between the sequences expressing mCherry and GFP proteins in a lentiviral plasmid. The plasmids constructed above are packaged into viruses to infect 293T cells, and IDUA-reporter (reporter) monoclonal cells are screened after the viruses are integrated into genomes. The monoclonal cell only expresses the mCherry protein because of the influence of the TAG stop codon at the IDUA mutation site in the inserted sequence, and the subsequent GFP protein can be normally expressed after the cell is edited by the arrRNA and TAG- > TGG occurs, and the expression of the GFP protein can be regarded as the editing efficiency of the arrRNA editing cell. We prefer to design 4 pieces of arRNAs with different lengths from 51nt to 111nt, and as shown in Table 4 below, the ratio of GFP in the cells was measured on days 1 to 7, respectively, after the cells were transfected with the arRNAs with different lengths under the electrotransfection conditions in example 2, to perform a preliminary test for editing efficiency. From fig. 4B, it can be seen that the most efficient editing sequence is 91 nt: 45-c-45, the highest peak edited to occur on day 2 (48 h). It can be seen that the longer the sequence, the higher the editing efficiency, in terms of the length of the arrRNA.

Table 4:

example 5: after electrotransfection of GM06214 cells with different lengths of arRNAs, intracellular IDUA was detected at different time points Enzyme activity and intracellular RNA editing efficiency

Different lengths of arRNAs were electrotransfected on GM06214 cells using the electrotransfection conditions of example 2 (see Table 4), and intracellular enzyme activity was examined on

days

2, 4, 6, 8, 10, 12, and 14 after electrotransfection and the efficiency of intracellular RNA editing was examined on

days

2 and 4, respectively, as described in example 3. From the results, as shown in fig. 5, 91 nt: 45-c-45 enzyme activity was highest and IDUA enzyme activity was still maintained at a high level at day 6 after electrotransfection. From the viewpoint of editing efficiency, 91nt and 111nt exhibit approximately the same editing efficiency.

Example 6: editing site A editing efficiency corresponding to different positions of the arRNA

Taking arRNA with the length of 111nt as an example, the editing efficiency of the targeted base corresponding to different positions of the arRNA is studied by simultaneously truncating from both ends of the mutation site and separately truncating from both ends of the 5 'end or the 3' end.

In this experiment, the introduction of arRNA into cells was performed in a lipofectamine RNAiMAX manner. First we truncated the arRNA sequence from both ends simultaneously, then extended to the fixed end and truncated from the other end, resulting in 14 arrnas and 4 equal-length random sequences, as shown in table 5 below. Detection of IDUA enzyme activity and RNA editing efficiency 48 hours after transfection found that 81 nt: 55nt-c-25nt (SEQ ID NO: 14), 71 nt: 55nt-c-15nt (SEQ ID NO: 15), 91 nt: 45nt-c-45nt (SEQ ID NO: 9), 91 nt: 55nt-c-35nt (SEQ ID NO: 13), 101 nt: 45nt-c-55nt (SEQ ID NO: 17) showed that IDUA enzyme activity and RNA editing efficiency were superior to those of other sequences in the tested sequences, as shown in FIG. 6.

Table 5:

example 7: length from 3' end of the target base versus editing efficiencyInfluence of (2)

In example 6, at 81 nt: 55-c-25, 71 nt: higher IDUA enzyme activity and editing efficiency were detected on the 55-c-15 sequence. To find the shortest and optimal length of the 3 'end, the sequence between 25nt (81 nt: 55-c-25) and 10nt (66 nt: 55nt-c-10nt) from the target base at the 3' end was truncated one by one as shown in Table 6. Finally, the optimal length of the targeted base from the 3' end is 24nt-11nt by IDUA enzyme activity determination, as shown in FIG. 7A. Furthermore, by comparison it can be seen that 80 nt: 55nt-c-24nt (SEQ ID NO: 22), 79 nt: 55nt-c-23nt (SEQ ID NO: 23), 72 nt: 55nt-c-16nt (SEQ ID NO: 30), 70 nt: 55nt-c-14nt (SEQ ID NO: 31), 67 nt: 55nt-c-11nt (SEQ ID NO: 34) can result in a mutation similar to SEQ ID NO: 14 and SEQ ID NO: 15 similar or higher IDUA enzyme activity.

In addition, we also performed the screening of the optimal length of the targeting base from the 3 'end of the arRNA targeting the mouse IDUA mutation site (mutation site corresponding to the human IDUA-W402X mutation), wherein the length of the 3' end of the arRNA from the targeting base is 55nt, and the length is truncated once every 5 bases, as shown in Table 7. The length of the target base from the 3' end in the screened mouse is 55nt to 10nt by the determination of the activity of the IDUA enzyme, and the optimal length is 55nt to 10nt, as shown in FIG. 7B. Wherein, 111 nt: 55nt-c-50nt (SEQ ID NO: 44) and 66 nt: 55nt-c-10nt (SEQ ID NO: 52) showed excellent editing efficiency.

Table 6:

table 7:

example 8: effect of 5' end Length on editing efficiency

We selected 2 different lengths of argrnas: 76 nt: 55-c-20, 71 nt: 55-c-15, the 5 'end was gradually truncated on the basis of a constant length of the 3' end, as shown in Table 8. The IDUA enzyme activity of the cells edited by the arRNA is higher when the length of the 5' end is between 55nt and 45nt, and the IDUA enzyme activity of the total length of the arRNA is significantly reduced between 65nt and 61nt, as determined by the IDUA enzyme activity test, as shown in FIG. 8A. When the length of the 3 'end is fixed at 14nt, the length of the 5' end is truncated from 51nt (total length is 66nt) one by one, and when the length of the 5 'end is truncated from 51nt to 50nt (total length is 65nt), the activity of IDUA enzyme is remarkably reduced, so that the total length of the arRNA required for truncation of the 5' end cannot be less than 66nt, as shown in FIG. 8B.

Table 8:

example 9: effect of RNA chemical modification on editing efficiency

Different types of chemical modifications to RNA during RNA synthesis can increase RNA stability and reduce the likelihood of off-target. The more common chemical modifications to RNA are 2' -OMe and thio, and we have experimentally selected 2 different lengths of arRNA: 71nt, 76nt, were subjected to different combinations of 2 chemical modification modes, as shown in Table 8. The meaning of the specific modification is shown as follows:

CM 1: the first 3 nucleotides and the last 3 nucleotides of the sequence are respectively modified by 2' -OMe, and the connections between the first 3 nucleotides and the last 3 nucleotides are all phosphorothioate bonds; meanwhile, all U in the sequence is modified by 2' -OMe.

CM 2: the first 3 nucleotides and the last 3 nucleotides of the sequence are respectively modified by 2' -OMe, and the connections between the first 3 nucleotides and the last 3 nucleotides are all phosphorothioate bonds; meanwhile, the 3 'nearest neighbor base of the target base is 2' -OMe modified A.

CM 3: the first 3 nucleotides and the last 3 nucleotides of the sequence are respectively modified by 2' -OMe, and the connections between the first 3 nucleotides and the last 3 nucleotides are all phosphorothioate bonds; meanwhile, the 5 'nearest neighbor base of the target base is 2' -OMe modified C.

CM 4: the first 3 nucleotides and the last 3 nucleotides of the sequence are respectively modified by 2' -OMe, and the connections between the first 3 nucleotides and the last 3 nucleotides are all phosphorothioate bonds; meanwhile, the target base is connected with the 3 'nearest neighbor base and the 5' nearest neighbor base through phosphorothioate bonds respectively.

CM 5: all nucleotides are modified with 2 ' -OMe except for the targeting base and 5 bases adjacent to the 5 ' end and 5 bases nearest to the 3 ' end; meanwhile, the connection between the first 3 nucleotides and the last 3 nucleotides of the sequence is a phosphorothioate bond connection.

In GM06214 cells transfected with different argRNAs to edit IDUA in cells, and cells 48 hours after transfection were collected for IDUA enzyme activity assay, from experimental results, the other modification combinations except CM5 (5 th modification: all 2' -OMe, except 11nt near the target base) had better enzyme activity, as shown in FIG. 9.

TABLE 9

Note: ro represents a nucleus which is not modified on the nucleotide and a connecting ester bond between the nucleotides is not modified; r represents the unmodified nucleus on the nucleotide and the nucleotide is connected by a phosphorothioate bond; mo represents that the 2' -OMe modified nucleotide is not modified by the ester bond between the nucleotides; m represents nucleotide and 2' -OMe modified nucleotide are connected by phosphorothioate bond.

Example 10: effect of chemical modification on editing efficiency

This example relates to 3 preferred arRNAs targeting the mutation site of human IDUA and 1 preferred arRNA targeting the mutation site of mouse IDUA, using chemical modification methods in the form of CM1, in GM06214 cells and MSPI MEF (MSPI mouse embryo fibroblast, MEF), fetal mice isolated from IDUA homozygous mutations (IDUA W392X mice, B6.129S-Idua)^tm1.1Kmke/J)(Wang D,Shukla C,Liu X,et al.Characterization of an MPS I-H knock-in mouse that carries a nonsense mutation analogous to the human IDUA-W402X mutation[published correction appears in Mol Genet Metab.2010Apr；99(4):439]Mol Genet Metab.2010; 99(1) 62-71.doi:10.1016/j.ymgme.2009.08.002)) cells.

From the experimental results of example 7, we selected 3 argrnas targeting human IDUA, the lengths of which are: 55nt-c-16nt,55nt-c-14nt,55nt-c-11nt, 1 arRNA targeting mouse IDUA: 55nt-c-10 nt. In addition, we also chose random arrRNA sequence RM-67CM1 as a control. From example 9 we selected the chemical modification of CM1 (all u: 2' -OMe) to synthesize the aforementioned IDUA-targeted argRNAs, as shown in Table 9. We performed transfection of a gradient of arRNA concentration on human GM06214 cells compared to MSPI mouse MEF. The concentration of arRNA was: 160nM, 80nM, 40nM, 20nM, 10nM, 5nM, 2.5nM, 1.25nM, 0.625nM for 9 concentrations. The cells were plated in 6-well plates, transfected 24hrs after plating, cells were digested 48hrs after transfection, half of the cells were taken for detection of IDUA enzyme activity, and half of the cells were extracted for detection of RNA editing efficiency. The results of the enzyme activity assay showed that a higher enzyme activity was achieved at the transfection concentration of arRNA of 2.5-5nM or higher, whereas the enzyme activity reached a plateau at 10-20nM or higher, as shown in FIGS. 10A and 10C, while IDUA enzyme activity and editing efficiency were different between human cells (GM06214) and mouse cells (MSPI MEF) when the same concentration of arRNA was transfected, as shown in FIGS. 10B and 10D.

Table 10:

note: ro represents that no modification is made on the nucleotide and the connecting ester bond between the nucleotides is not modified; r represents that the nucleotide is not modified and the nucleotides are connected by a phosphorothioate bond; mo represents that the 2' -OMe modified nucleotide is not modified in connection; m represents nucleotide and 2' -OMe modified nucleotide are connected by phosphorothioate bond.

Example 11: IDUA sustainable maintenance of protease Activity after editing by ArRNA

This experiment achieved significantly improved IDUA enzyme activity on GM06214 cells and MSPI MEF (mouse embryo fiber) cells by using 3 preferred arrnas targeting the mutation site of human IDUA and 1 preferred arRNA targeting the mutation site of mouse IDUA, and chemically modifying them in the CM1 manner, and could last for about 3 weeks or more.

In example 10 we performed a comparison of preferred IDUA-targeting argrnas in humans and mice at different concentrations 48hrs after transfection, in this example we chose a concentration of 20nM to compare IDUA enzymatic activity and editing efficiency at different times. As shown in FIG. 11A, we continuously tested 14 days of IDUA enzyme activity after the argRNA transfected GM06214 cells, the peak of enzyme activity after transfection was from day 4 to day 9, the enzyme activity at day 14 was still higher than that at day 2, and then we tested 2 days at a longer time point, which was day 17 and day 21 after transfection, respectively, and it can be seen from 10A that the enzyme activity at day 21 was still higher than that at day 1 after transfection, and the enzyme activity was about 6 to 10 times that of GM 01323. (editing efficiency is to be supplemented, FIG. 11B). We continuously tested IDUA enzyme activity for 8 days after arRNA transfection in MSPI MEF cells, and as can be seen in fig. 11C, the enzyme activity started at 24hrs after arRNA transfection was about 2 times that of GM1323 cells until day 8, and as can be seen from the editing efficiency test in fig. 11D, the editing efficiency of IDUA peaked for 24hrs and then continued to decline.

By comparison of human and mouse data we found that the peak editing of the arRNA in mice is 24hrs post-transfection and 48hrs in humans, and the duration of IDUA protease activity after editing is greater than 21 days in human cells and greater than 8 days in mice.

Example 12: effect of ArRNA delivery modality on editing efficiency

The experiment involved editing wild-type PPIB gene loci using LEAPER technology on primary cultured human and mouse liver cells, delivering arRNA in different ways, and screening for the optimal delivery.

"PPIB" refers to the wild site of human NM-000942 (PPIB Genomic chr15 (-): 64163082) UTR region or the wild site of mouse NM-011149 (PPIB Genomic chr9 (+): 66066490) UTR region. It may be a mature mRNA or a mRNA precursor. The UTR segment of PPIB presents a TAG, in this example a target was edited to test the efficiency of editing of the argrna in liver cells.

We designed and synthesized an arRNA (55nt-c-15nt) targeting the PPIB UTR region, as shown in Table 11. The synthesized arRNA was partially solubilized and dispensed at-80 ℃ for lipo (lipofectamine RNAImax) transfection, and the remainder was packaged as LNP. The method in the packaging reference of LNP (reference: Witzigmann D, Kulkarni J A, Leung J, et al. lipid nanoparticle technology for therapeutic gene regulation in the lipid [ J ]. Advanced Drug Delivery Reviews, 2020.; Kauffman K J, Dorkin J R, Yang J H, et al. optimization of lipid nanoparticles for mRNA Delivery in the viral tissue and the defined tissue Delivery designs [ J ]. Naurters, 20157315 (11): 7306.; Reis J, Kanagaraj S, yeast A, in. test control of calcium nanoparticles, 2010. 11): calcium carbonate Delivery and calcium carbonate Delivery systems [ J ]. 11): calcium carbonate J..

Human liver primary cells were purchased from LONZA (Cat: HUCPI) and the cells were resuscitated according to the manufacturer's instructions (Resuscitation Medium Cat: MCHT 50; plating Medium Cat: MP 100). After cell attachment, the cells were replaced with hepatocyte maintenance medium 5C (ref: Xiaong C, Du Y, Meng G, et al Long-term functional main of primary human hepatocytes in vitro [ J ] Science,2019,364 (6438): 399-.

Mouse liver Primary cells were isolated from C57BJ mice (ref: Charni-Natan M, Goldstein I.protocol for Primary Mouse liver Isolation [ J ]. STAR protocols,2020,1 (2): 100086.) and replaced with maintenance medium 5C after Isolation of liver cell adherence.

Delivery of arRNA was performed at 24hrs after recovery of human liver cells, and both LNP and Lipo were delivered at 20 nM. The delivery of arRNA was performed after 24hrs of isolated culture of mouse liver cells, and both LNP and Lipo were delivered at 20nM concentrations. Human and mouse liver cells harvested RNA at 24hrs and 48hrs post-arRNA delivery, respectively, and the editing efficiency was examined by secondary sequencing. As can be seen from fig. 12A, in human liver cells, the 48hrs editing efficiency after 2 modes of arg rna delivery was higher than 24hrs, while the editing efficiency of arg rna production by LNP delivery was better than Lipo delivery at 24hrs, with 48hrs editing efficiency being similar for both modes of delivery. As can be seen in fig. 12B, in the liver cells of mice, the editing efficiency after 2 modes of arRNA delivery was higher than 48hrs at 24hrs, while the editing efficiency produced by Lipo delivery of arRNA was higher than that of LNP delivery at 24hrs and 48hrs at the same time.

Thus, by comparison of PPIB site editing efficiency in liver primary cells, we can conclude that the peak of editing in mouse liver cells is 24hrs post-arRNA delivery, while the peak of editing in human liver cells is 48hrs, which is consistent with the data in human GM06214 cells and mouse MSPI MEF cells. Delivery of argRNA in human liver cells LNP is superior or equal to delivery of Lipo. Lipo is far superior to LNP delivery in liver cells of mice for delivery of arRNA.

Table 11:

example 13: editing efficiency of LNP delivery

This experiment relates to the study of the efficiency of IDUA editing by delivering IDUA's argrna using LNP on primary cultured human and mouse liver cells.

We designed and synthesized an arRNA targeting the wild-type site of the CDS region of human IDUA, as shown in table 12. Human and mouse argrnas (20nM) were delivered to human and mouse primary liver cells by LNP, respectively, and the editing efficiency was measured at 24 and 48 hours after delivery, respectively, as shown in fig. 13. From the figure we can see that in vitro primary cultured liver cells the editing efficiency of IDUA in humans can reach about 30% at 48 hours, and the highest editing efficiency in mice occurs at about 15% at 24 hours. It is further shown that LNP can achieve higher delivery efficiency in human cells, especially human liver primary cells.

TABLE 12

Example 14: therapeutic effect of argRNA against IDUA in MSPI model mice

The MPSI model mouse (Idua W392X mouse, B6.129S-Idua) was used in this experiment^tm1.1Kmke/J)(Wang D,Shukla C,Liu X,et al.Characterization of an MPS I-H knock-in mouse that carries a nonsense mutation analogous to the human IDUA-W402X mutation[published correction appears in Mol Genet Metab.2010

Apr；99(4):439].Mol Genet Metab.2010；99(1):62-71.

10.1016/j.ymgme.2009.08.002) that corresponds to the human IDUA-W402X mutation that prematurely terminates protein synthesis, which is prevalent in patients with Hurler mucopolysaccharidosis (MPS I-H) syndrome. Deficiency of the α -l-iduronidase enzyme leads to this lysosomal storage disease. No α -l-iduronidase activity was detected in brain and liver tissues of 5-week-old, 10-week-old and 30-week-old homozygous mice. Although mice homozygous for this mutation are viable and fertile, their average lifespan is 69 weeks. Homozygotes show progressive increase in urinary excretion of glycosaminoglycans (GAGs), as well as progressive accumulation of GAGs in tissues. Steady-state Idua mRNA levels were reduced by 30-50%. Histological analysis revealed progressive accumulation of purkinje cells, lysosomal storage contents in the cytoplasm of medullary neurons, and increased foam-like macrophage infiltration with age. The x-ray film showed that the zygomatic arch and femoral thickening was visible at 15 weeks of age and thickened at 35 weeks of age. At 35 weeks of age, femoral bone density increased and percent body fat decreased. We will select an arRNA targeting mouse mutant IDUA: 55nt-c-10ntCM1(SEQ ID NO: 52), packaged as LNP. Injecting the arRNA with different concentrations through tail veins, wherein the different concentrations are 0.1mg/kg respectively; 0.5 mg/kg; 2 mg/kg; 10 mg/kg. Mouse liver cells were taken 24hrs post-dose for IDUA editing efficiency assay, as shown in figure 14. Approximately 2% editing efficiency was detected in the 10mg/kg group 24 hours after dosing. The results of the example prove that the arRNA aiming at the IDUA of the MSPI model mouse can realize the accurate editing of the mutated IDUA gene in liver cells in vivo, correct the IDUA mutation and achieve the purpose of treating MPSI.

Sequence listing

<110> Boya Yingyin (Beijing) Biotechnology Ltd

<120> a method and composition for treating MPS IH based on LEAPER technology

<130> PD01321

<150> 201911397570.8

<151> 2019-12-30

<160> 62

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 1

cgcttccagg tcaacaacac 20

<210> 2

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 2

ctcgcgtaga tcagcaccg 19

<210> 3

<211> 111

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 3

gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60

cugcuccuca uccagcagcg ccagcagccc cauggccgug agcaccggcu u 111

<210> 4

<211> 111

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 4

gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60

cugcuccuca ucugcggggc gggggggggc cgucgccgcg uggggucguu g 111

<210> 5

<211> 111

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 5

uaccgcuaca gccacgcuga uuucagcuau accugcccgg uauaaaggga cguucacacc 60

gcgauguucu cugcugggga auugcgcgau auucaggauu aaaagaagug c 111

<210> 6

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 6

uaauccugaa uaucgcgcaa uuccccagca gagaacaucg cggugugaac gucccuuuau 60

accgggcagg uauagcugaa aucagcgugg c 91

<210> 7

<211> 71

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 7

uuucagcuau accugcccgg uauaaaggga cguucacacc gcgauguucu cugcugggga 60

auugcgcgau a 71

<210> 8

<211> 51

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 8

uuccccagca gagaacaucg cggugugaac gucccuuuau accgggcagg u 51

<210> 9

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 9

gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag cugcuccuca 60

ucugcggggc gggggggggc cgucgccgcg u 91

<210> 10

<211> 71

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 10

uguccaggac ggucccggcc ugcgacacuu cggcccagag cugcuccuca ucugcggggc 60

gggggggggc c 71

<210> 11

<211> 51

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 11

ggucccggcc ugcgacacuu cggcccagag cugcuccuca ucugcggggc g 51

<210> 12

<211> 101

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 12

gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60

cugcuccuca ucugcggggc gggggggggc cgucgccgcg u 101

<210> 13

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 13

gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60

cugcuccuca ucugcggggc gggggggggc c 91

<210> 14

<211> 81

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 14

gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60

cugcuccuca ucugcggggc g 81

<210> 15

<211> 71

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 15

gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60

cugcuccuca u 71

<210> 16

<211> 61

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 16

gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60

c 61

<210> 17

<211> 101

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 17

gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag cugcuccuca 60

ucugcggggc gggggggggc cgucgccgcg uggggucguu g 101

<210> 18

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 18

uguccaggac ggucccggcc ugcgacacuu cggcccagag cugcuccuca ucugcggggc 60

gggggggggc cgucgccgcg uggggucguu g 91

<210> 19

<211> 81

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 19

ggucccggcc ugcgacacuu cggcccagag cugcuccuca ucugcggggc gggggggggc 60

cgucgccgcg uggggucguu g 81

<210> 20

<211> 71

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 20

ugcgacacuu cggcccagag cugcuccuca ucugcggggc gggggggggc cgucgccgcg 60

uggggucguu g 71

<210> 21

<211> 61

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 21

cggcccagag cugcuccuca ucugcggggc gggggggggc cgucgccgcg uggggucguu 60

g 61

<210> 22

<211> 80

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 22

gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60

cugcuccuca ucugcggggc 80

<210> 23

<211> 79

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 23

gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60

cugcuccuca ucugcgggg 79

<210> 24

<211> 78

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 24

gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60

cugcuccuca ucugcggg 78

<210> 25

<211> 77

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 25

gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60

cugcuccuca ucugcgg 77

<210> 26

<211> 76

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 26

gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60

cugcuccuca ucugcg 76

<210> 27

<211> 75

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 27

gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60

cugcuccuca ucugc 75

<210> 28

<211> 74

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 28

gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60

cugcuccuca ucug 74

<210> 29

<211> 73

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 29

gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60

cugcuccuca ucu 73

<210> 30

<211> 72

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 30

gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60

cugcuccuca uc 72

<210> 31

<211> 70

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 31

gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60

cugcuccuca 70

<210> 32

<211> 69

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 32

gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60

cugcuccuc 69

<210> 33

<211> 68

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 33

gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60

cugcuccu 68

<210> 34

<211> 67

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 34

gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60

cugcucc 67

<210> 35

<211> 66

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 35

gacgcccacc gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag 60

cugcuc 66

<210> 36

<211> 71

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 36

ccaccgugug guugcugucc aggacggucc cggccugcga cacuucggcc cagagcugcu 60

ccucaucugc g 71

<210> 37

<211> 66

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 37

gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag cugcuccuca 60

ucugcg 66

<210> 38

<211> 61

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 38

guugcugucc aggacggucc cggccugcga cacuucggcc cagagcugcu ccucaucugc 60

g 61

<210> 39

<211> 56

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 39

uguccaggac ggucccggcc ugcgacacuu cggcccagag cugcuccuca ucugcg 56

<210> 40

<211> 66

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 40

ccaccgugug guugcugucc aggacggucc cggccugcga cacuucggcc cagagcugcu 60

ccucau 66

<210> 41

<211> 61

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 41

gugugguugc uguccaggac ggucccggcc ugcgacacuu cggcccagag cugcuccuca 60

u 61

<210> 42

<211> 56

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 42

guugcugucc aggacggucc cggccugcga cacuucggcc cagagcugcu ccucau 56

<210> 43

<211> 51

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 43

uguccaggac ggucccggcc ugcgacacuu cggcccagag cugcuccuca u 51

<210> 44

<211> 106

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 44

gacacccacu guaugauugc uguccaacac agccccagcc uuugagaccu cugcccagag 60

uuguucucca ucuauaagcc aagcagaggg cugaggcugu uggcuc 106

<210> 45

<211> 101

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 45

gacacccacu guaugauugc uguccaacac agccccagcc uuugagaccu cugcccagag 60

uuguucucca ucuauaagcc aagcagaggg cugaggcugu u 101

<210> 46

<211> 96

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 46

gacacccacu guaugauugc uguccaacac agccccagcc uuugagaccu cugcccagag 60

uuguucucca ucuauaagcc aagcagaggg cugagg 96

<210> 47

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 47

gacacccacu guaugauugc uguccaacac agccccagcc uuugagaccu cugcccagag 60

uuguucucca ucuauaagcc aagcagaggg c 91

<210> 48

<211> 86

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 48

gacacccacu guaugauugc uguccaacac agccccagcc uuugagaccu cugcccagag 60

uuguucucca ucuauaagcc aagcag 86

<210> 49

<211> 81

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 49

gacacccacu guaugauugc uguccaacac agccccagcc uuugagaccu cugcccagag 60

uuguucucca ucuauaagcc a 81

<210> 50

<211> 76

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 50

gacacccacu guaugauugc uguccaacac agccccagcc uuugagaccu cugcccagag 60

uuguucucca ucuaua 76

<210> 51

<211> 71

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 51

gacacccacu guaugauugc uguccaacac agccccagcc uuugagaccu cugcccagag 60

uuguucucca u 71

<210> 52

<211> 66

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 52

gacacccacu guaugauugc uguccaacac agccccagcc uuugagaccu cugcccagag 60

uuguuc 66

<210> 53

<211> 66

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 53

uaccgcuaca gccacgcuga uuucagcuau accugcccgg uauaaaggga cguucacacc 60

gcgaug 66

<210> 54

<211> 71

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 54

caccccauca gauggaagca cuagggccag gguggcacag aaccuuguga cuggccaccu 60

ucgucugugu g 71

<210> 55

<211> 71

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 55

ggaggcgaaa gcagcccgga cagcugaggc cggaagaggg uggggccgcg guggccaggg 60

agccggcgcc g 71

<210> 56

<211> 66

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 56

cccaccgugu gguugcuguc caggacgguc ccggccugcg acacuucggc ccagagcugc 60

uccuca 66

<210> 57

<211> 65

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 57

ccaccgugug guugcugucc aggacggucc cggccugcga cacuucggcc cagagcugcu 60

ccuca 65

<210> 58

<211> 64

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 58

caccgugugg uugcugucca ggacgguccc ggccugcgac acuucggccc agagcugcuc 60

cuca 64

<210> 59

<211> 63

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 59

accguguggu ugcuguccag gacggucccg gccugcgaca cuucggccca gagcugcucc 60

uca 63

<210> 60

<211> 62

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 60

ccgugugguu gcuguccagg acggucccgg ccugcgacac uucggcccag agcugcuccu 60

ca 62

<210> 61

<211> 61

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 61

cgugugguug cuguccagga cggucccggc cugcgacacu ucggcccaga gcugcuccuc 60

a 61

<210> 62

<211> 111

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 62

gacacccacu guaugauugc uguccaacac agccccagcc uuugagaccu cugcccagag 60

uuguucucca ucuauaagcc aagcagaggg cugaggcugu uggcucucuc a 111

Claims

2. The method of claim 1, wherein the arRNA comprises base C, A, U or G that pairs with target a.

3. The method of any of claims 1-2, wherein the arRNA is about 151-61nt, 131-66nt, 121-66nt, 111-66nt, 91-66nt, or 81-66nt in length.

4. The method of claim 3, wherein the length of the targeting base in the arrRNA from the 3' end is 45nt to 5nt, 40nt to 5nt, 35nt to 10nt, 25nt to 15n, or 24nt to 11 nt.

5. The method of claim 3 or 4, wherein the length of the targeting base in the arRNA from the 5' end is 80-30nt, 70-35nt, 60-40nt, 55-35 nt or 55-45 nt.

6. The method of claims 1-5, wherein the target cell is a human cell.

7. An arrrna or a coding sequence thereof for targeted editing of a target RNA in a target cell by LEAPER technology, the arrrna comprising or consisting of any one of the following sequences: SEQ ID NO: 14. SEQ ID NO: 15. SEQ ID NO: 9. SEQ ID NO: 13. SEQ ID NO: 17. SEQ ID NO: 22. SEQ ID NO: 23. SEQ ID NO: 30. SEQ ID NO: 31. SEQ ID NO: 34. SEQ ID NO: 44 or SEQ ID NO: 52.

8. a plasmid, viral vector, liposome, or lipid nanoparticle comprising the arRNA of claim 7 or a coding sequence thereof.

9. A composition or biological product comprising the arRNA or coding sequence thereof of claim 7, or the plasmid, viral vector, liposome, or lipid nanoparticle of claim 8.

10. A method of treating MPS IH in a subject, comprising correcting a G to a mutation associated with a MPS IH disease in a target cell of the subject using the method of claim 7.