CN113122524B

CN113122524B - Novel method for targeted editing of RNA

Info

Publication number: CN113122524B
Application number: CN202011642469.7A
Authority: CN
Inventors: 袁鹏飞; 易泽轩; 刘能银
Original assignee: Beijing Jiyin Medical Technology Co ltd
Current assignee: Beijing Jiyin Medical Technology Co ltd
Priority date: 2019-12-31
Filing date: 2020-12-31
Publication date: 2023-03-24
Anticipated expiration: 2040-12-31
Also published as: CN113122524A

Abstract

The present application relates to a method of deaminating a target cytosine in a target RNA in a cell comprising introducing into the cell a modified adenosine deaminase protein or a catalytic domain thereof or a construct expressing the modified adenosine deaminase protein or the catalytic domain thereof and a construct comprising or expressing an arRNA oligonucleotide that recruits the modified adenosine deaminase protein or the catalytic domain thereof to the target RNA. Also, the present application provides an engineered composition or system for RNA editing and the use of the engineered composition or system to correct T to C mutations for the treatment of diseases.

Description

Novel method for targeted editing of RNA

Technical Field

The application belongs to the field of gene Editing treatment, and particularly creates a method for target-oriented RNA Editing named CUSPER (C to U Specific Programmable Editing of RNA), which comprises the step of Editing accurate sites from C to U bases on RNA by using a CUSPER technology and can be used for treating diseases caused by T to C mutation.

Background

In recent years, genome editing techniques such as CRISPR (Clustered regularly interspersed short palindromic repeats) have been rapidly developed and have profound effects on many fields of biology and medicine. Many researchers and biotechnology companies are also working to put the technology into clinical use. A product 11 published by professor Duncorkui of Beijing university, duncorkui and collaborators in 2019, beijing university, firstly reports that the CRISPR technology is used for editing stem cells and returning the stem cells to patients so as to treat AIDS and leukemia of the stem cells, and makes a great contribution to the transformation of the CRISPR technology in the direction of gene therapy.

Despite the great application prospect of the CRISPR technology, the technology has a series of defects, which leads to the difficult transformation of the technology from scientific research stage to clinical treatment application. One of the problems is the core-acting enzyme used in CRISPR technology: cas9. CRISPR-based DNA editing techniques, cas9 or other nucleases possessing similar functions must be exogenously expressed, posing several problems. First, nucleases that require exogenous expression often have large molecular weights, which dramatically reduces the efficiency of their delivery into the body by viral vectors. Secondly, there is a potential for off-target nuclease in this approach due to exogenous expression of nucleases, which would lead to a potential carcinogenic risk in its use. Finally, exogenously expressed Cas9 and other similar nucleases are found in bacteria, but not naturally occurring in humans or mammals, which may cause an immune response in patients, which may cause damage to the patients themselves, and on the other hand may neutralize exogenously expressed nucleases, thereby losing their desired activity and affecting the therapeutic effect.

In 2017, the zhanfeng professor of the massachusetts institute of technology and its subject group reported an RNA Editing technology named REPAIR (RNA Editing for Programmable a to I Replacement), which can realize the Editing of a to I of a target RNA by exogenously expressing Cas13-ADAR fusion protein and single guide RNA (sgRNA), but the method still needs the expression of foreign proteins like CRISPR technology. The problem caused by the expression of foreign protein cannot be solved.

In month 1 2019, the Thorsten Stafforst group reported a single base editing technique for RNA known as RESTORE (recovery endogenous ADAR to specific trans for oligonucleotide-mediated rnaedition, merkle et al, 2019). The RESTORE can get rid of the dependence on foreign proteins, but the RESTORE technology needs to have higher editing efficiency under the premise of the existence of IFN-gamma, and the IFN-gamma is a key factor 9 for determining the development and severity of autoimmunity, so that the application of the technology in the medical field is greatly reduced. On the other hand, the RESTORE technology also uses a guide RNA, and the guide RNA used in the RESTORE technology is chemically synthesized oligonucleotide, and the synthesized oligonucleotide needs to artificially introduce a large amount of chemical modification to ensure the stability of the oligonucleotide. Among these chemical modifications, there are some non-natural modifications, so that the oligonucleotide may be toxic or immunogenic; yet another part of the modification results in different conformations of the same base strand, so that for the same RNA sequence there may be tens of different conformational combinations, which increases the difficulty of its delivery into the cell.

Article published in Nature Biotechnology by professor of Weiwensheng university, beijing university in 7 months in 2019 ⁴ In (1), a nucleic acid editing technique is reported for the first time: LEAPER (Leveraging Endog entries ADAR for Programming of RNA). Different from the CRISPR technology, on one hand, the technology gets rid of the dependence on the overexpression of exogenous nuclease in principle, can be completed by chemically synthesizing RNA, and can also be delivered to a patient to play a role by vectors such as adeno-associated virus (AAV), lentivirus and the like, so that the selection of a delivery means is more flexible and changeable, and the technology has greater advantages in the process of converting into the medical field; on the other hand, this technique can only achieve adenosine a to creatinine I (creatinine I is recognized as bird anhydride G during protein translation) editing, making it ineffective for other mutations, such as T to C mutations. Furthermore, similar to CRISPR technology, this technology also requires a stretch of RNA as a guide to recruit endogenous nucleases to the site of desired editing. This guide RNA was named "arRNA" (adar-recovering RNA).

In the 7 th month in 2019,the group of subjects taught by Zhang Feng professor reported a new technique named RESCUE (RNA Editing for Specific C to U Exchange) ¹ . The technology makes different mutation attempts on the ADAR catalytic domain responsible for the reaction based on the Cas13-ADAR basic skeleton reported by the subject group in 2017. And finally, the A-to-I editing activity of the ADAR catalytic structure domain is modified into the C-to-U editing activity, so that the C-to-U editing on the RNA of a specific site is realized, and the accurate editing range of the base is further expanded. However, the technology still needs to exogenously express the fusion protein after mutation of Cas13 and ADAR, and cannot solve the problems caused by expression of the bacterial protein.

Disclosure of Invention

In order to solve the above problems in the gene editing technology, so as to apply the gene editing technology to the medical field better, it is urgently needed to find a targeted gene editing technology which is easy to deliver and can correct T to C mutations efficiently and accurately.

The application creates a novel RNA Editing technology CUSPER (C to U Specific Prog random Editing of RNA), which does not depend on the expression of Cas13b from bacteria and expands the application range of RNA Editing from A to I to C to U.

In the application, on one hand, because the expression of macromolecular proteins derived from bacteria is not required, the potential risk of an immune system and the influence on the system editing efficiency caused by the attack of the immune system on foreign proteins are reduced; on the other hand, with the need for introducing significant reductions in protein molecular weight, the delivery modes thereof have become more flexible, and may include chemical transformation and biological delivery, such as AAV delivery, etc. Therefore, the technical scheme provided by the application not only solves the technical problem of single base editing from C to U, but also improves the safety, stability and use flexibility of an editing system, is more beneficial to in vivo application, and has better application prospect in the field of biomedicine.

In particular, the present application relates to:

1. an engineered composition or system for RNA editing comprising:

1) A modified adenosine deaminase protein or a catalytic domain thereof, or a construct expressing the modified adenosine deaminase protein or the catalytic domain thereof, wherein the adenosine deaminase protein or the catalytic domain thereof is modified to have an activity of catalyzing cytidine deamination, and

2) Recruiting the modified adenosine deaminase protein or catalytic domain thereof to an arRNA of a target RNA or a construct comprising the arRNA or a coding sequence thereof;

wherein the recruitment of the adenosine deaminase protein or catalytic domain thereof to the target RNA causes deamination of the target cytidine in the target RNA.

In some embodiments, the construct expressing the modified adenosine deaminase protein or catalytic domain thereof and the construct comprising the coding sequence of the arRNA are the same construct. In some embodiments, the construct expressing the modified adenosine deaminase protein or catalytic domain thereof and the construct comprising the coding sequence of the arRNA are separate constructs.

In some embodiments, a modified adenosine deaminase protein of the present application is a protein having cytidine deamination activity by deletion, addition, or substitution of one or more amino acids of an adenosine deaminase protein (e.g., an ADAR2 protein). In some embodiments, a modified adenosine deaminase protein of the present application is an adenosine deaminase protein (e.g., an ADAR2 protein) or a protein whose catalytic domain is cytidine deamination activity via substitution of one or more amino acids. In some embodiments, the modified adenosine deaminase protein of the present application comprises the following mutational modifications: E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T, wherein the amino acid number of the mutational modification is identical to the amino acid number in NP-001103.1. In some embodiments, the modified adenosine deaminase protein of the present application comprises a protein with other ADAR2 homologous proteins as reference sequences and corresponding mutations E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T.

In some embodiments, the engineered compositions or systems of the present application for RNA editing comprise the catalytic domain of the modified adenosine deaminase protein described above. In some embodiments, the catalytic domain is a catalytic domain of the modified adenosine deaminase protein described above.

2. The engineered composition or system of clause 1, wherein the adenosine deaminase is mutationally modified at one or more sites to have an activity to deaminate cytidine into uridine.

3. The engineered composition or system of clause 2, wherein the adenosine deaminase protein or catalytic domain thereof is an ADAR2 protein or homologous protein thereof or catalytic domain thereof.

4. The engineered composition or system of clause 3, wherein the mutational modification comprises: E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T, wherein the amino acid number of the mutational modification is identical to the amino acid number in NP-001103.1.

In some embodiments, the modified adenosine deaminase protein or catalytic domain thereof is a homologous protein to NP _001103.1 protein, having mutations corresponding to: E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T.

5. The engineered composition or system of any one of items 1-4, wherein the targeting base of the arRNA opposite the target cytidine is A, U, C, or G when hybridized to the target RNA.

6. The engineered composition or system described in clause 5, wherein the targeting base is U or C.

7. The engineered composition or system of any one of items 1-6, wherein:

the argrna comprises an unpaired nucleotide at one or more positions upstream, downstream, or upstream and downstream of a target base corresponding to the target RNA to form a nucleotide mismatch with the one or more positions upstream, downstream, or upstream and downstream of the target base.

8. The engineered composition or system of clause 7, wherein the 3' nearest neighbor of the argRNA targeting base forms a mismatch with the target RNA.

9. The engineered composition or system of clause 8, wherein the 3' nearest neighbor base of the targeting base forms a G-G mismatch with the target RNA when the arRNA is hybridized to the target RNA.

10. The engineered composition or system of any one of items 1-9, wherein the 5' nearest neighbor base of the targeting base does not form a mismatch with the target RNA when the arRNA is hybridized to the target RNA.

11. The engineered composition or system of clause 10, wherein the 5' nearest neighbor base of the targeting base is U.

12. The engineered composition or system of clause 9, wherein when the arrrna hybridizes to a target RNA, the order of preference of the bases in the target RNA opposite the 5' nearest neighbor base of the targeted base of the arrrna is G or C, U or a from high to low (G ≈ C > U ≈ a).

13. The engineered composition or system of any one of items 1-6, wherein a target base triplet formed by the target base and its 5 'and 3' adjacent bases forms a mismatch only at the target base when the arRNA is hybridized to the target RNA, wherein the target base triplet is selected from the group consisting of: ACG, ACC, UCC, UCG, CCC, CCG, UCA, UCU.

14. The engineered composition or system of any of claims 1-13, wherein the arrrna is >50nt, >55nt, >60nt, >65nt, >70nt, >75nt, >80nt, >85nt, >90nt, >95nt, >100nt, >105nt, >110nt, >115nt, >120nt long. In some embodiments, the arrRNA is about 151-53nt, 131-61nt, 121-61nt, 111-65, 101-71nt, 91-71nt, 81-71nt in length. In some embodiments, the length of the arRNA is any positive integer within the length range defined in this section.

15. The engineered composition or system of any one of items 1-14, wherein the targeting bases in the arRNA are equal in length from the 3 'end and the 5' end.

16. The composition of any one of items 1 to 14, wherein the length of the target base in the arrRNA from the 3' end is 45 to 5nt,40 to 5nt,35 to 10nt,25nt to 15nt,24nt to 11nt. In some embodiments, the length of the arRNA is any positive integer within the length range defined in this section.

17. The engineered composition or system of any of clauses 1-14, wherein the targeted bases in the arRNA are 80-30nt,70-35nt,60-40nt,55nt-35nt,55nt-45nt in length from the 5' end. In some embodiments, the length of the arRNA is any positive integer within the length range defined in this section.

18. The engineered composition or system of any one of items 1-17, wherein the arRNA is chemically modified.

19. The engineered composition or system of clause 18, wherein the chemical modification comprises a 2 '-O-methyl modification or an internucleotide 3' thio modification.

20. A method of deaminating a target cytosine in a target RNA in a cell, comprising introducing into the cell:

1) Modified adenosine deaminase protein or catalytic domain thereof or construct expressing the modified adenosine deaminase protein or catalytic domain thereof, and

2) Recruitment of the modified adenosine deaminase protein or catalytic domain thereof to an arRNA of the target RNA or a construct comprising the arRNA or a coding sequence thereof, wherein the adenosine deaminase protein or catalytic domain thereof is modified with activity to catalyze the deamination of cytidine, wherein the arRNA comprises a complementary RNA sequence that hybridizes to the target RNA, and wherein recruitment of the adenosine deaminase protein or catalytic domain thereof to the target RNA causes deamination of the target cytidine in the target RNA.

In some embodiments, a modified adenosine deaminase protein of the present application is a protein having cytidine deamination activity by deletion, addition, or substitution of one or more amino acids of an adenosine deaminase protein (e.g., an ADAR2 protein). In some embodiments, a modified adenosine deaminase protein of the present application is an adenosine deaminase protein (e.g., an ADAR2 protein) or a protein whose catalytic domain is cytidine deamination activity via substitution of one or more amino acids. In some embodiments, the modified adenosine deaminase protein of the present application comprises the following mutational modifications: E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T, wherein the amino acid number of the mutational modification is identical to the amino acid number in NP-001103.1. In some embodiments, the modified adenosine deaminase protein of the present application comprises a protein with other ADAR2 proteins as reference sequences and having corresponding mutations in E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T.

In some embodiments, the engineered compositions or systems of the present application for RNA editing comprise the catalytic domain of the modified adenosine deaminase protein described above.

21. The method of clause 20, wherein the construct expressing the modified adenosine deaminase protein or catalytic domain thereof and the construct comprising the coding sequence of the arRNA are the same construct and are introduced into the cell at the same time, or the construct expressing the modified adenosine deaminase protein or catalytic domain thereof and the construct comprising the coding sequence of the arRNA are separate constructs that are introduced into the cell at the same time or separately.

22. The method of clause 20 or 21, wherein the adenosine deaminase is mutationally modified at one or more sites to have an activity to deaminate cytidine into uridine.

23. The method of clause 22, wherein the adenosine deaminase protein or catalytic domain thereof is an ADAR2 protein or homologous protein thereof or catalytic domain thereof.

24. The method of item 23, wherein the mutational modification comprises: E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T, wherein the amino acid number of the mutational modification is identical to the amino acid number in NP-001103.1.

25. The method of any one of items 21 to 24, wherein the targeting base of the arrrna relative to the target cytidine is a, U, C, or G when hybridized to the target RNA.

26. The method described in clause 25, wherein the targeting base is U or C.

27. The method of any one of items 21-26, wherein:

the arRNA comprises an unpaired nucleotide at one or more positions upstream, downstream, or upstream and downstream of a target base corresponding to the target RNA to form a nucleotide mismatch with one or more positions upstream, downstream, or upstream and downstream of the target base.

28. The method of clause 27, wherein the 3' nearest neighbor of the argRNA targeting base forms a mismatch with the target RNA.

29. The method of clause 28, wherein when the arrRNA is hybridized to the target RNA, the 3' nearest neighbor of the targeting base forms a G-G mismatch with the target RNA.

30. The method of any one of claims 21-29, wherein the 5' nearest neighbor base of the targeting base does not form a mismatch with the target RNA when the arRNA hybridizes to the target RNA.

31. The method of clause 30, wherein the 5' nearest neighbor base of the targeting base is U.

32. The method of clause 29, wherein when the arrRNA hybridizes to the target RNA, the order of preference of the bases in the target RNA that are opposite to the 5' nearest neighbor base of the targeted base of the arrRNA is G or C, U, or A from high to low (G ≈ C > U ≈ A).

33. The method of any one of items 21-26, wherein a target base triplet formed by the target base and its 5 'and 3' adjacent bases forms a mismatch only at the target base when the arRNA is hybridized to the target RNA, wherein the target base triplet is selected from the group consisting of: ACG, ACC, UCC, UCG, CCC, CCG, UCA, UCU.

34. The method of any of items 21-33, wherein the arRNA is >50nt, >55nt, >60nt, >65nt, >70nt, >75nt, >80nt, >85nt, >90nt, >95nt, >100nt, >105nt, >110nt, >115nt, >120nt long. In some embodiments, the argRNA is about 151-53nt, 1131-61nt, 121-61nt, 111-65, 101-71nt, 91-71nt, 81-71nt long. In some embodiments, the length of the arRNA is any positive integer within the length range defined in this section.

35. The method of any one of items 21-34, wherein the targeted bases in the arRNA are of equal length from the 3 'end and the 5' end.

36. The method of any one of items 21 to 34, wherein the length of the target base in the arrRNA from the 3' end is 45 to 5nt,40 to 5nt,35 to 10nt,25nt to 15nt,24nt to 11nt. In some embodiments, the length of the arRNA is any positive integer within the length range defined in this section.

37. The method of any one of items 21 to 34, wherein the length of the targeted base in the arRNA from the 5' end is 80 to 30nt,70 to 35nt,60 to 40nt,55nt to 35nt,55nt to 45nt. In some embodiments, the length of the arRNA is any positive integer within the length range defined in this section.

38. The method of any one of items 21-37, wherein said arRNA is chemically modified.

39. The method of clause 38, wherein the chemical modification comprises a 2 '-O-methyl modification or an internucleotide 3' thio modification.

40. The method of any one of claims 21-39, wherein the cell is a mammalian cell.

41. A method of treating a disease caused by a T to C mutation, comprising deaminating a target base C in a messenger RNA transcribed from a T to C mutation to correct the mutation using a method as in any one of items 21 to 39.

42. A modified adenosine deaminase protein, wherein the adenosine deaminase protein is ADAR2 comprising an E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T mutant modification, wherein the amino acid numbering of the mutant modification is consistent with the amino acid numbering in NP _001103.1, the ADAR2 protein having activity to catalyze cytidine deamination by the mutant modification.

In some embodiments, the modified adenosine deaminase protein or catalytic domain thereof is a homologous protein to NP _001103.1 protein, with mutations corresponding to the mutations: E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T.

43. Use of a modified adenosine deaminase protein as described in clause 42, for catalyzing the deamination of cytidine to uridine.

Drawings

Figure 1 shows the BFP reporter and the target base to be C to U edited.

FIG. 2 shows the selection of target bases when designing guide RNAs for the CUSPER and RESCUE techniques and the design rules for targeting bases adjacent to a point, when the point is targeted to U.

FIG. 3 shows the testing of the CUSPER editing system. In the figure, "/" indicates that no corresponding plasmid or argRNA was added, and only the same volume of water was added.

Figure 4 shows the bias of the LEAPER technique on the adjacent upstream and downstream bases of the target base. The arrow in the figure shows the preference of the LEAPER technique for the 5 'neighbor upstream when the 3' neighbor of the target base is A, corresponding to FIG. 3.

FIG. 5 shows the preference of the RESCUE technique for the target base adjacent upstream and downstream bases. The arrow in the figure shows the preference of the RESCUE technique for the 5 'adjacent base when the 3' adjacent base is A, corresponding to FIG. 3.

FIG. 6 shows the results of repeated tests on the CUSPER editing system. In the figure, "/" indicates that the corresponding plasmid or arRNA was not added but only the same volume of water was added.

FIG. 7 shows the mRNA and corresponding arRNA sequences for target C without mismatches to U and its adjacent bases.

FIG. 8 shows the efficiency of C to U RNA editing for all 16 combinations of 3 'and 5' adjacent bases with no mismatches between the U and its adjacent bases for target C

Detailed Description

In order to solve the dilemma that the prior gene Editing technology generally depends on heterologous foreign proteins and realize accurate single base Editing on more types of bases, the application creates an RNA Editing technology CUSPER (C to U Specific Programmable Editing of RNA). The CUSPER expands the application range of RNA editing from A to I to editing from C to U, and avoids introducing foreign proteins into cells due to the use of the enzyme protein expressed by mammals for editing, thereby improving the safety and enabling the whole gene editing process to be more efficient and convenient.

Definition of

As used herein, the "CUSPER technique" is the original technique in the context of the present disclosure, wherein CUSPER is an abbreviation for "C to U Specific Programmable Editing of RNA", i.e., "Specific Programmable RNA Editing to convert cytidine C to uridine U". This technique uses a short length of RNA that can complementarily hybridize to the target RNA, recruiting a modified adenosine deaminase protein or a protein comprising its catalytic domain to the target RNA to deaminate the target cytidine, which converts it to uridine. Wherein the modified adenosine deaminase protein or a protein comprising a catalytic domain thereof is modified to have an activity to catalyze the deamination of cytosine. The short RNA capable of complementarily hybridizing with the target RNA is the arrRNA. As used herein, "ar-recovering RNA" refers to a single-stranded RNA that can recruit adenosine deaminase protein or a catalytic domain thereof to a target RNA, which recruits the adenosine deaminase protein or the catalytic domain thereof to the target RNA to deaminate the target cytidine in the target RNA. As used herein, "complementary" to a nucleic acid refers to the ability of one nucleic acid to form hydrogen bonds with another nucleic acid through traditional Watson-Crick base pairing. Percent complementarity refers to the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (i.e., watson-Crick base pairing) with another nucleic acid molecule (e.g., about 5, 6, 7, 8, 9, 10 out of 10 are about 50%,60%,70%,80%,90%, and 100% complementary, respectively). "completely complementary" means that all consecutive residues of a nucleic acid sequence form hydrogen bonds with the same number of consecutive residues in a second nucleic acid sequence. As used herein, "substantially complementary" refers to a degree of complementarity of at least any one of about 70%,75%,80%,85%,90%,95%,97%,98%,99% or 100% over a region of about 40, 50, 60, 70, 80, 100, 150, 200, 250 or more nucleotides, or to two nucleic acids that hybridize under stringent conditions. For a single base or a single nucleotide, according to the Watson-Crick base pairing rules, A is said to be complementary or matched when it is paired with T or U, C is said to be G or I, and vice versa; the other base pairs are referred to as non-complementary or non-matched.

"hybridization" refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized by hydrogen bonds between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson Crick base pairing, hoogstein binding or in any other sequence specific manner. Sequences that are capable of hybridizing to a given sequence are referred to as "complementary sequences" to the given sequence.

As used herein, the term "delivery" refers to the introduction of biological macromolecules such as nucleic acids, proteins, etc. into the cell membrane from outside the cell membrane by some route. Such "delivery" is for example by means of electrotransfection, lipofection, lipid-nanoparticle delivery, viral delivery, exosome delivery and the like.

As used herein, the term "target RNA" refers to a target RNA to be edited, which comprises a cytidine to be edited. The target RNA may be a mature mRNA or a mRNA precursor. The cytidine to be edited is referred to as a "target base," "target cytidine", or "target C". The base adjacent to the target cytidine at the 5 'end of the target RNA is referred to as the "5' adjacent base"; the base adjacent to the target cytidine at the 3 'end of the target RNA is referred to as the "3' adjacent base"; the base triplet consisting of the target base and its 3 'and 5' adjacent bases is referred to herein as a "target base triplet". When the arRNA is hybridized to the target RNA, the base on the arRNA opposite the target base is referred to as the "target base", and the base adjacent to the target base at the 5 'end of the arRNA is referred to as the "5' nearest neighbor base"; the base adjacent to the target base at the 3 'end of the arRNA is called the "3' nearest neighbor base"; the base triplets consisting of the targeting base and its 3 'and 5' nearest neighbors are referred to herein as "targeting base triplets".

Herein, the length of the targeting base from the 3' end refers to all the base numbers from the 3' nearest neighbor base to the 3' endmost base of the targeting base; the length of the target base from the 5' end refers to all the base numbers from the 5' nearest neighbor base to the 5' most terminal base of the target base.

As used herein, the term "Adenosine Deaminase (ADAR)" refers to a class of Adenosine deaminases that are widely expressed in various tissues of eukaryotes, including mammals such as humans, and that catalyze the conversion of Adenosine A to inosine I in RNA molecules.

In the present application, the E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T mutation refers to a series of mutations that occur in the ADAR2 protein, wherein the amino acid numbering of the mutational modifications is identical to the amino acid numbering in NP-001103.1, i.e.NP-001103.1 is used as a reference sequence. It will be appreciated by those skilled in the art that the amino acid numbering in the mutations may vary for different reference sequences of the ADAR2 protein. Thus, as used herein, the E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T mutations include mutations in the reference sequences of the different ADAR2 proteins corresponding to the amino acid positions of the mutations, the ADAR2 proteins being modified by the mutations to have the activity of catalyzing cytidine deamination. Accordingly, modified adenosine deaminase proteins provided herein include ADAR2 with NP _001103.1 as a reference sequence and comprising E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T mutational modifications, as well as ADAR2 with a different ADAR2 protein as a reference sequence and comprising corresponding mutational modifications.

As used herein, the term "construct" refers to a nucleic acid vector comprising a nucleic acid sequence, which may be a linear nucleic acid molecule, a plasmid, or a viral vector, and the like. The nucleic acid molecule may be single-stranded or double-stranded. The specific nucleic acid sequence may be a DNA sequence or an RNA sequence. In some embodiments, the nucleic acid sequence exerts its function directly without being transcribed, translated, or expressed. In some embodiments, the nucleic acid sequence is a DNA sequence that functions as an RNA molecule upon transcription to form RNA. In some embodiments, the nucleic acid sequence is RNA that functions, upon translation, as a polypeptide or protein. In some embodiments, the nucleic acid sequence is DNA that functions as a protein after being formed into a protein by transcription and translation steps. The construct can enter the cell by being packaged into a virus, a lipid nanoparticle or an exosome, and can also enter the cell by means of electrotransformation, microinjection, chemical transformation and the like.

The term "modification" as used herein refers to a change in the composition or structure of a nucleic acid or protein by chemical means, such as genetic engineering, whereby one or more properties or functions of the nucleic acid or protein are altered. For example, in the present application, an adenosine deaminase protein or its catalytic domain has the effect of catalyzing cytidine deamination after modification, e.g., addition, deletion, and/or mutation of one or more amino acids.

Engineered compositions or systems

The present application provides an engineered composition or system for RNA editing comprising:

1) A modified adenosine deaminase protein or a catalytic domain thereof or a construct expressing the modified adenosine deaminase protein or the catalytic domain thereof, wherein the adenosine deaminase protein or the catalytic domain thereof is modified with an activity of catalyzing cytidine deamination, and

In some embodiments, a modified adenosine deaminase protein of the present application is a protein having cytidine deamination activity by deleting, adding, or substituting one or more amino acids from an adenosine deaminase protein (e.g., an ADAR2 protein). In some embodiments, a modified adenosine deaminase protein of the present application is an adenosine deaminase protein (e.g., an ADAR2 protein) or a protein whose catalytic domain is cytidine deamination activity via substitution of one or more amino acids. In some embodiments, the modified adenosine deaminase protein of the present application comprises the following mutational modifications: E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T, wherein the amino acid number of the mutational modification is identical to the amino acid number in NP-001103.1. In some embodiments, the modified adenosine deaminase protein of the present application comprises a protein with other ADAR2 homologous proteins as reference sequences and corresponding mutations E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T.

In some embodiments, the engineered compositions or systems of the present application for RNA editing comprise a modified adenosine deaminase protein or catalytic domain thereof as described above. In some embodiments, the catalytic domain is a catalytic domain of the modified adenosine deaminase protein described above.

In some embodiments, the adenosine deaminase is mutationally modified at one or more sites to have an activity to deaminate cytidine into uridine. In some embodiments, the adenosine deaminase protein or catalytic domain thereof is an ADAR2 protein or a homologous protein thereof or a catalytic domain of the ADAR2 protein or a catalytic domain of a homologous protein of the ADAR2 protein. In some embodiments, the mutational modification comprises: E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T, wherein the amino acid number of the mutational modification is identical to the amino acid number in NP-001103.1.

In some embodiments, the modified adenosine deaminase protein or catalytic domain thereof is expressed by introducing into a cell a construct selected from any of a linear nucleic acid, a plasmid, and a viral vector. In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell.

In some embodiments, the targeting base of the argrna relative to the target cytidine is a, U, C, or G when hybridized to the target RNA. In some embodiments, the preferred target base order is U > C > A ≈ G, i.e., an ARRNA with a target base of U or C typically has a higher editing efficiency when compared to a plurality of ARRNA sequences in which all bases other than the target base are identical. Thus preferably, in some embodiments, the targeting base is U or C.

In some embodiments, the argrna comprises an unpaired nucleotide at one or more positions upstream, downstream, or upstream and downstream of a target base corresponding to the target RNA to form a nucleotide mismatch with one or more positions upstream, downstream, or upstream and downstream of the target base. In some embodiments, the 3' nearest neighbor base of the argrna targeting base forms a mismatch with the target RNA. In some embodiments, the 3' nearest neighbor of the targeting base forms a G-G mismatch with the target RNA when the arRNA hybridizes to the target RNA. In some embodiments, the 5' nearest neighbor base of the targeting base does not form a mismatch with the target RNA when the arRNA hybridizes to the target RNA. In some embodiments, the 5 'nearest neighbor base of the targeting base does not form a mismatch with the target RNA, and wherein the 5' nearest neighbor base of the targeting base is U. In some embodiments, when the arRNA hybridizes to a target RNA, the order of preference of the bases in the target RNA relative to the 5' nearest neighbor base of the targeted base of the arRNA is from high to low as G or C, U or a. In some embodiments, one or more bases other than the argrna targeting triplet form a mismatch with the target RNA when the argrna is complementarily hybridized to the target RNA. And in some embodiments, the mismatch may further improve the efficiency of targeted editing based on the arRNA.

In some embodiments, when the arRNA is hybridized to a target RNA, the target base triplets formed by the target base and its 5 'and 3' adjacent bases form mismatches only at the target base, and the target base in the arRNA is of equal length from the 3 'end and the 5' end, preferably wherein the target base triplets are selected from the group consisting of: ACG, ACC, UCC, UCG, CCC, CCG, UCA, UCU. In some embodiments, when the argrna is hybridized to a target RNA, a target base triplet formed by the target base and its 5 'and 3' adjacent bases forms a mismatch only at the target base, and the target base is not equal in length from the 3 'end and the 5' end in the argrna, wherein the target base triplet is selected from the group consisting of: ACG, ACC, UCC, UCG, CCC, CCG, UCA, UCU.

In some embodiments, the arRNA is >50nt, >55nt, >60nt, >65nt, >70nt, >75nt, >80nt, >85nt, >90nt, >95nt, >100nt, >105nt, >110nt, >115nt, >120nt long. In some embodiments, the argRNA is about 151-53nt, 131-61nt, 121-61nt, 111-65, 101-71nt, 91-71nt, 81-71nt long. In some embodiments, the length of the arRNA is any positive integer within the length range defined in this section.

In some embodiments, the targeting base in the arRNA is equal in length from the 3 'end and the 5' end. In some embodiments, the targeting base in the arRNA is not equal in length from the 3 'end and the 5' end. In some embodiments, the length of the targeting base in the arRNA from the 3' end is 45-5nt,40-5nt,35-10nt,25nt-15nt,24nt-11nt. In some embodiments, the length is selected from any positive integer within the length range defined herein.

In some embodiments, the length of the targeted base in the arRNA from the 5' end is 80-30nt,70-35nt,60-40nt,55nt-35nt,55nt-45nt. In some embodiments, the length is selected from any positive integer within the length range defined herein. In some embodiments, the length of the targeting base in the arRNA from the 5' end is greater than 80.

In some embodiments, the argrna is chemically synthesized. In some embodiments, the argrna is an oligonucleotide. In some embodiments, the argrna is chemically modified. In some embodiments, the chemical modification comprises a 2 '-O-methyl modification or an internucleotide 3' thio modification. In some embodiments, the chemical modification is selected from one or more of:

the first 3 and the last 3 nucleotides of the sequence are respectively modified by 2' -OMe,

the first 3 and last 3 internucleotide linkages are all phosphorothioate linkages,

all U in the sequence are modified by 2' -OMe,

the 3 'nearest neighbor base of the target base is 2' -OMe modified A,

the 5 'nearest neighbor base of the target base is 2' -OMe modified C,

the target base is connected with the 3 'nearest neighbor base and the 5' nearest neighbor base respectively through a phosphorothioate bond,

the first 5 and last 5 nucleotides are modified with 2' -OMe, respectively, and

the first 5 and last 5 internucleotide linkages are phosphorothioate linkages.

In some embodiments, the argrna is encoded by a construct and transcribed. In some embodiments, the construct is selected from a linear nucleic acid strand, a viral vector, or a plasmid.

Method for editing RNA

The present application provides a method of deaminating a target cytosine in a target RNA in a cell, CUSPER (programmed C to U RNA editing), comprising introducing into the cell 1) and 2) the following:

2) Recruiting the modified adenosine deaminase protein or catalytic domain thereof to an arRNA of the target RNA or a construct comprising the arRNA or a coding sequence thereof. Wherein the adenosine deaminase protein or catalytic domain thereof is modified with activity to catalyze cytidine deamination, the argRNA comprises a complementary RNA sequence that hybridizes to the target RNA, and recruitment of the adenosine deaminase protein or catalytic domain thereof to the target RNA causes deamination of the target cytidine in the target RNA.

In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is a mouse cell.

In some embodiments, a modified adenosine deaminase protein of the present application is a protein having cytidine deamination activity by deletion, addition, or substitution of one or more amino acids of an adenosine deaminase protein (e.g., an ADAR2 protein). In some embodiments, a modified adenosine deaminase protein of the present application is an adenosine deaminase protein (e.g., an ADAR2 protein) or a protein whose catalytic domain is cytidine deamination activity via substitution of one or more amino acids. In some embodiments, the modified adenosine deaminase protein of the present application comprises the following mutational modifications: E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T, wherein the amino acid number of the mutational modification is identical to the amino acid number in NP-001103.1. In some embodiments, the modified adenosine deaminase protein of the present application comprises a protein with other ADAR2 proteins as reference sequences and corresponding mutations E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T.

One skilled in the art will appreciate that the construct expressing the modified adenosine deaminase protein or catalytic domain thereof comprises a coding sequence for the modified adenosine deaminase protein or catalytic domain thereof. In some embodiments, the construct expressing the modified adenosine deaminase protein or catalytic domain thereof is the same construct as a construct comprising the coding sequence of the arRNA. In some embodiments, the construct expressing the coding sequence for the modified adenosine deaminase protein or catalytic domain thereof is a different construct than the construct comprising the coding sequence for the arRNA, i.e., the coding sequence for the modified adenosine deaminase protein or catalytic domain thereof and the coding sequence for the arRNA are located on different constructs, respectively. In some embodiments, the different constructs are two or more than two. In some embodiments, the different constructs are introduced into the cell simultaneously or separately. It should be understood that different constructs referred to in this paragraph are not the same construct and do not indicate that the different constructs belong to different classes of constructs, respectively. In some embodiments, the construct expressing the modified adenosine deaminase protein or catalytic domain thereof and the construct recruiting the modified adenosine deaminase protein or catalytic domain thereof to the target RNA or a construct comprising the arRNA or a construct comprising a coding sequence of the arRNA are introduced into the same cell. In some embodiments, a modified adenosine deaminase protein or catalytic domain thereof or a construct expressing the modified adenosine deaminase protein or catalytic domain thereof, and a plurality of argrnas or constructs comprising the same or coding sequences of the same are introduced into a cell to achieve high-throughput editing of a target RNA, wherein the plurality of argrnas are argrnas targeting different target RNAs, or are argrnas targeting different target base (e.g., C) sites of the same target RNA.

Thus, the present application also encompasses a method for high throughput editing of a target cytosine in a target RNA in a cell comprising introducing into the cell 1) and 2) the following:

a plurality of (e.g., 2 or more, 5 or more, 10 or more) argrnas that recruit the modified adenosine deaminase protein or its catalytic domain to the target RNA or a construct comprising the argrnas or a coding sequence thereof, wherein the adenosine deaminase protein or its catalytic domain is modified to have an activity of catalyzing cytidine deamination, the plurality of (e.g., 2 or more, 5 or more, 10 or more) argrnas comprise complementary RNA sequences that hybridize to the target RNAs, respectively, and recruitment of the adenosine deaminase protein or its catalytic domain to the target RNA causes deamination of the target cytidine in the target RNA.

In some embodiments, the construct expressing the modified adenosine deaminase protein or catalytic domain thereof and the construct comprising the coding sequence of the arRNA are the same construct, or the construct expressing the modified adenosine deaminase protein or catalytic domain thereof and the construct comprising the coding sequence of the arRNA are separate constructs, which are introduced into the cell simultaneously or separately.

In some embodiments, the adenosine deaminase is mutationally modified at one or more sites to have an activity to deaminate cytidine into uridine.

In some embodiments, the adenosine deaminase protein or catalytic domain thereof is an ADAR2 protein or homologous protein thereof or catalytic domain thereof.

In some embodiments, the mutational modification comprises: E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T, wherein the amino acid number of the mutational modification is identical to the amino acid number in NP-001103.1. In some embodiments, the construct is selected from the group consisting of a viral vector, a plasmid, and a linear nucleic acid. In some embodiments, the modified adenosine deaminase protein or catalytic domain thereof or a construct expressing the modified adenosine deaminase protein or catalytic domain thereof and the oligonucleotide that recruits the modified adenosine deaminase protein or catalytic domain thereof to or a construct that transcribes the arRNA of the target RNA are introduced into the cell by viral infection, chemical transfection, electrotransfection, exosome delivery, or nano-lipid particle delivery.

In some embodiments, the adenosine deaminase is mutationally modified at one or more sites to have an activity to deaminate cytidine into uridine. In some embodiments, the adenosine deaminase protein or catalytic domain thereof is an ADAR2 protein or homologous protein thereof, or catalytic domain thereof. In some embodiments, the mutational modification comprises: E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T, wherein the amino acid number of the mutational modification is identical to the amino acid number in NP-001103.1.

In some embodiments, the targeting base of the arRNA opposite the target cytidine is a, U, C, or G when hybridized to the target RNA. In some embodiments, the targeting base of the arRNA opposite the target cytidine when hybridized to the target RNA is preferably U or C.

In some embodiments, the argrna comprises an unpaired nucleotide at one or more positions upstream, downstream, or upstream and downstream of a target base corresponding to the target RNA to form a nucleotide mismatch with one or more positions upstream, downstream, or upstream and downstream of the target base. In some embodiments, the 3' nearest neighbor of the argrna targeting base forms a mismatch with the target RNA. In some embodiments, the 3' nearest neighbor base of the targeting base forms a G-G mismatch with the target RNA when the arRNA hybridizes to the target RNA. In some embodiments, the 5' nearest neighbor base of the targeting base does not form a mismatch with the target RNA when the arRNA hybridizes to the target RNA. In some embodiments, the 5' nearest neighbor base of the targeting base is U. In some embodiments, when the arRNA hybridizes to a target RNA, the order of preference of the bases in the target RNA relative to the 5' nearest neighbor base of the targeted base of the arRNA is from high to low as G or C, U or a (G ≈ C > U ≈ a). In some embodiments, when the arRNA is hybridized to a target RNA, the base in the target RNA opposite the 5' nearest neighbor base of the targeted base of the arRNA is preferably G or C. In some embodiments, when the arRNA hybridizes to a target RNA, the base in the target RNA that is opposite the 5' nearest neighbor base of the targeting base of the arRNA is most preferably G. In some embodiments, one or more bases other than the argrna targeting triplet form a mismatch with the target RNA when the argrna is complementarily hybridized to the target RNA. And in some embodiments, the mismatch may further improve the efficiency of targeted editing based on the arRNA.

In some embodiments, the targeting base in the arRNA is equal in length from the 3 'end and the 5' end. In some embodiments, the targeting base in the arRNA is not equal in length from the 3 'end and the 5' end. In some embodiments, the length of the targeting base in the arRNA from the 3' end is 45-5nt,40-5nt,35-10nt,25nt-15nt,24nt-11nt. In some embodiments, the length is any positive integer within the range of lengths defined herein.

In some embodiments, the length of the targeted base in the arRNA from the 5' end is 80-30nt,70-35nt,60-40nt,55nt-35nt,55nt-45nt. In some embodiments, the length is any positive integer within the range of lengths defined herein. In some embodiments, the length of the targeting base in the arRNA from the 5' end is greater than 80.

In some embodiments, the argrna is or is comprised in an oligonucleotide. In some embodiments, the oligonucleotide is chemically modified. In some embodiments, the chemical modification comprises a 2 '-O-methyl modification or an internucleotide 3' thio modification. In some embodiments, the chemical modification is selected from one or more of:

all U in the sequence are modified by 2' -OMe,

the 3 'nearest neighbor base of the target base is 2' -OMe modified A,

the 5 'nearest neighbor base of the target base is 2' -OMe modified C,

the target base is connected with the 3 'nearest neighbor base and the 5' nearest neighbor base through phosphorothioate bonds respectively,

the first 5 and last 5 nucleotides are modified with 2' -OMe, respectively, and

the first 5 and last 5 internucleotide linkages are phosphorothioate linkages.

RNA editing-related enzyme protein and use thereof

The present application provides a modified adenosine deaminase protein, wherein the adenosine deaminase protein is ADAR2, comprising the following amino acid mutations in ADAR2 corresponding to Genebank accession No. NP _ 001103.1: E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T, or amino acid mutation at the corresponding position of the homologous ADAR2 protein of NP _001103.1, wherein the ADAR2 protein is modified by the mutation to have the activity of catalyzing cytidine deamination.

The application also provides the application of the modified adenosine deaminase protein in catalyzing cytidine deamination to be converted into uridine. In some embodiments, the use of catalyzing the deamination of cytidine to uridine occurs intracellularly. In some embodiments, the use of catalyzing the deamination of cytidine to uridine occurs extracellularly.

Methods of treating diseases

The present application provides a method of treating a disease caused by a T to C mutation comprising deaminating a target base C in a messenger RNA transcribed from a T to C mutation to correct the mutation using a method of editing RNA as described above.

In some embodiments, the method of treating a disease caused by a T to C mutation comprises injecting an engineered composition or system as described previously into a subject. In some embodiments, the treatment will comprise injecting into the subject 1) and 2) below.

2) Recruiting the modified adenosine deaminase protein or catalytic domain thereof to an arRNA of the target RNA or a construct comprising the arRNA or a coding sequence thereof. Wherein the adenosine deaminase protein is the RNA editing-related enzyme protein.

In some embodiments, the injection is intravenous, arterial infusion, intramuscular, subcutaneous, or intratumoral.

In some embodiments, the disease caused by a T to C mutation includes a genetic disease and cancer.

Kit and preparation

The present application also provides a kit for catalyzing the conversion of cytidine deamination to uridine. In some embodiments, the kit comprises an engineered composition or system as previously described. In some embodiments, the kit comprises a construct encoding or expressing the modified adenosine deaminase protein or catalytic domain thereof in the engineered composition system and/or an arRNA recruiting the modified adenosine deaminase protein or catalytic domain thereof to a target RNA.

The method for targeted editing of RNA by using the CUSPER technology has the following advantages:

on one hand, when a new technology recruits an editing protein (such as Adenosine Deaminase (ADAR)), unlike the RESCUE technology, a guide RNA containing a Cas13b recruitment backbone needs to be designed, and bacterial-derived Cas13b overexpression is not needed, so that the length of the exogenously expressed protein is reduced, so that loading by a viral vector and in-vivo delivery in a human body are easy and various, and meanwhile, the possibility of gene editing failure caused by neutralizing exogenously expressed nuclease can be reduced, so that the method has a significant advantage over the RESCUE technology when applied to the medical field.

On the other hand, unlike the LEAPER technique, which only enables the editing of RNA with a range of applications from A to I, the new system broadens the editing to C to U, which makes many genetic diseases that present a T to C mutation on the genome, and other applications that require C to be converted to T/U, treatable with the technology of the present application.

Therefore, compared with the prior art, the technology of the application has wider application range and is safer and more effective.

The preferred embodiments of the present invention have been described above in detail, but the present invention is not limited thereto. Within the scope of the technical idea of the invention, many simple modifications can be made to the technical solution of the invention, including combinations of various technical features in any other suitable way, and these simple modifications and combinations should also be regarded as the disclosure of the invention, and all fall within the scope of the invention.

The technical solution of the present invention will be further described with reference to the following specific examples, but the present invention is not limited to the following examples. Unless otherwise specified, the reagents referred to below are all commercially available. For the sake of brevity, the parameters of the procedures, steps and equipment used are not described in detail in part of the procedures, it being understood that these are well known to those skilled in the art and are reproducible.

Examples

Example 1: molecular construction of modified ADAR2 and BFP reporter systems

1. Mutant ADAR2-r16-293T constructsBuilding (2)

The catalytic domain of ADAR2 (RNA adenosine deaminase 2) was mutagenized by reference to the RESCUE technique reported in reference 1 at the same site as r16 in reference (dADAR 2 (E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T) r16,https://benchling.com/s/seq-19Ytwwh0i0vSIbyXYZ95) Wherein the amino acid number of the mutational modification is consistent with the amino acid number in NP-001103.1. The ADAR2 coding sequence fragment containing the above mutation was synthesized in vitro using conventional DNA synthesis techniques in the art and inserted between the ADAR2 XmaI and AscI cleavage sites of the pLenti-ADAR2 plasmid vector (pLenti-ADAR 2 plasmid backbone as donated by professor wevensheng) by enzymatic ligation. The plasmid constructed through the above procedure was designated pLenti-ADAR2-r16, and the ADAR2 gene containing the above mutation was designated ADAR2-r16. The full-length cDNA sequence of ADAR2-r16 is: SEQ ID NO 1. By means of a second generation lentiviral packaging system (pCAG-VSVG manufactured by Arthur Nienhuis)&Patrick Salmonmon benefit (Addge plasma #35616, http:// n2t. Net/addge: 35616; pCMVR8.74 was awarded by Didier Trono (Addgene plasma #22036;http://n2t.net/addgene:22036(ii) a Adid: addgene _ 22036)) pLenti-ADAR2-r16 were packaged into lentiviruses and used to infect 293T cells and resistance selection was performed 48 hours later using a final concentration of 10ug/ml of blisticin (Solarbio B9300). Cells that survived the screening were called ADAR2-r16-293T.

SEQ ID NO 1：

ATGGATATAGAAGATGAAGAAAACATGAGTTCCAGCAGCACTGATGTGAAGGAAAACCGCAATCTGGACAACGTGTCCCCCAAGGATGGCAGCACACCTGGGCCTGGCGAGGGCTCTCAGCTCTCCAATGGGGGTGGTGGTGGCCCCGGCAGAAAGCGGCCCCTGGAGGAGGGCAGCAATGGCCACTCCAAGTACCGCCTGAAGAAAAGGAGGAAAACACCAGGGCCCGTCCTCCCCAAGAACGCCCTGATGCAGCTGAATGAGATCAAGCCTGGTTTGCAGTACACACTCCTGTCCCAGACTGGGCCCGTGCACGCGCCTTTGTTTGTCATGTCTGTGGAGGTGAATGGCCAGGTTTTTGAGGGCTCTGGTCCCACAAAGAAAAAGGCAAAACTCCATGCTGCTGAGAAGGCCTTGAGGTCTTTCGTTCAGTTTCCTAATGCCTCTGAGGCCCACCTGGCCATGGGGAGGACCCTGTCTGTCAACACGGACTTCACATCTGACCAGGCCGACTTCCCTGACACGCTCTTCAATGGTTTTGAAACTCCTGACAAGGCGGAGCCTCCCTTTTACGTGGGCTCCAATGGGGATGACTCCTTCAGTTCCAGCGGGGACCTCAGCTTGTCTGCTTCCCCGGTGCCTGCCAGCCTAGCCCAGCCTCCTCTCCCTGCCTTACCACCATTCCCACCCCCGAGTGGGAAGAATCCCGTGATGATCTTGAACGAACTGCGCCCAGGACTCAAGTATGACTTCCTCTCCGAGAGCGGGGAGAGCCATGCCAAGAGCTTCGTCATGTCTGTGGTCGTGGATGGTCAGTTCTTTGAAGGCTCGGGGAGAAACAAGAAGCTTGCCAAGGCCCGGGCTGCGCAGTCTGCCCTGGCCGCCATTTTTAACTTGCACTTGGATCAGACGCCATCTCGCCAGCCTATTCCCAGTGAGGGTCTTCAGCTGCATTTACCGCAGGTTTTAGCTGACGCTGTCTCACGCCTGGTCATAGGTAAGTTTGGTGACCTGACCGACAACTTCTCCTCCCCTCACGCTCGCAGAATAGGTCTGGCTGGAGTCGTCATGACAACAGGCACAGATGTTAAAGATGCCAAGGTGATATGTGTTTCTACAGGATCTAAATGTATTAATGGTGAATACCTAAGTGATCGTGGCCTTGCATTAAATGACTGCCATGCAGAAATAGTATCTCGGAGATCCTTGCTCAGATTTCTTTATACACAACTTGAGCTTTACTTAAATAACGAGGATGATCAAAAAAGATCCATCTTTCAGAAATCAGAGCGAGGGGGGTTTAGGCTGAAGGAGAATATACAGTTTCATCTGTACATCAGCACCTCTCCCTGTGGAGATGCCAGAATCTTCTCACCACATGAGGCAATCCTGGAAGAACCAGCAGATAGACACCCAAATCGTAAAGCAAGAGGACAGCTACGGACCAAAATAGAGGCTGGTCAGGGGACGATTCCAGTGCGCAACAATGCGAGCATCCAAACGTGGGACGGGGTGCTGCAAGGGGAGCGGCTGCTCACCATGTCCTGCAGTGACAAGATTGCACGCTGGAACGTGGTGGGCATCCAGGGATCACTGCTCAGCATTTTCGTGGAGCCCATTTACTTCTCGAGCATCATCCTGGGCAGCCTTTACCACGGGGACCACCTTTCCAGGGCCATGTACCAGCGGATCTCCAACATAGAGGACCTGCCACCTCTCTACACCCTCAACAAGCCTTTGCTCACAGGCATCAGCAATGCAGAAGCACGGCAGCCAGGGAAGGCCCCCATATTCAGTGTCAACTGGACGGTAGGCGACTCCGCTATTGAGGTCATCAACGCCACGACTGGGAAGGGAGAGCTGGGCCGCGCGTCCCGCCTGTGTAAGCACGCGTTGTACTGTCGCTGGATGCGTGTGCACGGCAAGGTTCCCTCCCACTTACTACGCTCCAAGATTACCAAGCCCAACGTGTACCATGAGACAAAGCTGGCGGCAAAGGAGTACCAGGCCGCCAAGGCGCGTCTGTTCACAGCCTTCATCAAGGCGGGGCTGGGGGCCTGGGTGGAGAAGCCCACCGAGCAGGACCAGTTCTCACTCACGCCCGATTACAAGGATGACGACGATAAGTAG

Construction of BFP reporter System

The BFP reporter was constructed with reference to reference 7, and all BFP (blue fluorescent protein) cDNA sequences were synthesized in vitro, with the specific sequences: SEQ ID NO 2. The BFP cDNA sequence was cloned into pCDH-CMV plasmid vector through a multiple cloning site behind the CMV promoter (pCDH-CMV plasmid backbone as conferred by Kazuhiro Oka, addge plasma #72265 http:// n2t. Net/addge: 72265 RRID. The target base to be edited in the reporter is base C at position 199 of the BFP sequence, corresponding to position 66 histidine, see FIG. 1.

SEQ ID NO 2：

ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCTGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCCACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGCGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTGA

The base at position 198,199 and 200 of the sequence is CCA in sequence, named BFP-CCA and abbreviated as C. When base C at position 199 is edited to U at the RNA level by deamination, the BFP fluorescent protein changes from original blue fluorescence to green fluorescence, so that a signal can be detected by the flow cytometer FITC (Fluorescein isothiocyanate) channel. Since the codon 198 (base 196, 197 and 198) encodes threonine for ACC, ACA, ACT and ACG after mutation from C to A, T and G, the mutation at this position is synonymous. This allows the reporter to simultaneously determine and compare the C to U editing efficiency when the adjacent bases 5' upstream of the target base are different on the mRNA. Site-directed mutagenesis kits can be used therefor (

Site-Directed Mutagenesis Kit, NEB E0554S) to introduce a mutation into the 198 position base, so that the 198,199,200 three position bases are: GCA, named BFP-GCA, abbreviated as G; ACA, named BFP-ACA, abbreviated as A; TCA is named BFP-UCA abbreviated as U. />

Example 2: preliminary testing of the CUSPER System

Design and Synthesis of ArRNA

The arRNA used in this example comprises an antisense RNA complementary to the target mRNA, with the target base located in the middle of the arRNA, and extending bilaterally with the same length 5 'upstream and 3' downstream. Due to the restriction of the synthesis length, RNA with a length of 91nt was selected for in vitro synthesis in this example. As shown in FIG. 3, when the 46 th nucleotide of the argRNA is A, U, G, C, it is abbreviated as A ^ A, U ^ G ^ C, and C ^ C, respectively. The specific sequences of the four synthetic arRNAs are shown in Table 1 below. As shown in fig. 2, different from the LEAPER technique design method, the design of four arrnas in this batch of experiments was performed using different target bases, i.e., the arrnas at positions 46, a, U, G, and C, respectively, because the purpose of the experiments was to determine the editing efficiency when the target base is mismatched with the target base on the arRNA. And the 5 'nearest neighbor base at position 47 of the arRNA (corresponding to position 198 of the reporter) is designed according to the target triplet base of the BFP sequence before mutation introduction (i.e., CCA), i.e., the 5' nearest neighbor base (position 47) of the arRNA targeting base is U complementary to a. This means that the design of the arRNA is consistent with the LEAPER technique if and only if the reporting system for subsequent testing is BFP-CCA, i.e.: when the arRNA hybridizes to the target RNA, there is a mismatch only at the target base; when the reporter system is BFP-GCA, BFP-TCA or BFP-ACA, the design of the arRNA not only has a mismatch at the target base, but also has a mismatch at the 3' adjacent base of the target base of the arRNA.

TABLE 1

Note: capital letters only highlight differences between sequences, and the difference in case of the same letter does not represent the difference in base.

C to U edit test

ADAR2-r16-293T was plated at 300000 cells/well in 6-well plates and 24 hours after plating, transfected with Lipofectamine 3000 (Invitrogen L3000015), with the transfection procedure performed as described. Duplicate experiments were performed with different concentrations of Lipofectamine 3000 transfection reagent as per the instructions, using 3.75 μ L of Lipofectamine 3000 per well for replicate 1 and 7.5 μ L of Lipofectamine 3000 per well 2. Each well was added 2.5. Mu.g of BFP reporter plasmid (selected from the group consisting of BFP-GCA, abbreviated G; BFP-ACA, abbreviated A; BFP-TCA, abbreviated T; BFP-CCA, abbreviated C) and 25pmol of chemically synthesized arRNA. FITC channel signal intensity was measured 48h post-transfection by FACS. The Mean Fluorescence Intensity (MFI) statistics for positive cells are shown in FIG. 3.

In FIG. 3, the mRNA row indicates the BFP reporter plasmid added to the corresponding well, and the arRNA row indicates the arRNA added to the corresponding well. In a BFP report system, three basic groups 198,199 and 200 are CCA in an original sequence, and when C at position 198 is changed into A, T or G, corresponding amino acid at position 65 is threonine, so that the 198 position changes of four different report systems, namely BFP-GCA, BFP-CCA, BFP-ACA and BFP-TCA, cannot cause the original protein function change. When the 199 th C is edited to be U, the codons formed by 199,200 and 201 are changed from CAC to UAC, and the corresponding 66 th amino acid is changed from Histidine (Histidine, his and H) to Tyrosine (Tyrosine, tyr and Y), so that the fluorescence conversion from BFP to GFP is realized. As shown in FIG. 3, the background GFP signal MFI of the reporter was approximately 5X 10 when no arRNA was added ⁴ (mRNA row is marked U, arRNA row is marked/reporter; and mRNA row is marked A, arRNA is marked/reporter). When C at position 199 was mutated to T by a point mutation at the DNA level, the MFI of the GFP signal was about 2.4X 10 ⁶ ～3.1×10 ⁶ About 100 times higher than the background value. Thus, if all of the C's at 199 were changed to U's at the RNA level, this would result in an approximately 100-fold increase in GFP MFI.

On the basis of the DNA level with no change in C199, as shown in FIG. 3, the MFI of GFP was increased to more than 5X 10 at the most when the argRNA was added ⁵ The fluorescence intensity exceeds 20% of that after mutation of the C-point 199 to T at the DNA level. This demonstrates that the technology of the present application can alter the final protein by converting C at position 199 to U at the transcriptional level without altering the DNA sequenceAnd (4) performing functions.

In the LEAPER technical literature (Qu et al, 2019, original 2f, corresponding to FIG. 4 of the present application), when the target base is 3' adjacent to the target base (e.g., N) ² Position shown) is a, the bias of the LEAPER technique to the 5 'adjacent base (shown as N1 position) of the target base (referring to the efficiency of editing obtained for the same argrna when the 5' upstream base is a, U, G or C) is: u shape>C≈A>G. In the RESCUE technology literature (Abudayyeh et al, 2019, artwork 1c, corresponding to fig. 5 of the present application) when the 3 'adjacent base of the target base is a, the preference of the RESCUE technology for the 5' adjacent base of the target base is: u is approximately equal to A>>C ≈ G. In the CUSPER technique of the present application, we have surprisingly found that when the 3' adjacent base of the target base is A, the preference for the 5' upstream base of the target base is different from both the LEAPER technique and the RESCUE technique, as shown in FIG. 3, and if the fixed arRNA is U ^ or C ^ with higher editing efficiency, we can see that the preference for the 5' upstream base of the present application is: g>C>>U≈A。

3. Further determination of the base preference of CUSPER

To further determine the editing capabilities and base bias of CUSPER, we further repeated example 2, part 2, as shown in FIG. 6. In contrast to example 2 part 2, this part was supplemented with a control experiment in which only the two reporter plasmids BFP-GCA and BFP-CCA, not referred to in example 2 part 2, were added without any argrnas. And the conditions for MFI exceeding the background value by more than 2 times in the relevant test of fig. 3 were repeated. Meanwhile, in the experiment, the repetition 1 and the repetition 2 correspond to two ADAR2-r16-293T prepared in different batches.

As shown in FIG. 6, the preference of this system for the 5 'adjacent base of the target base in the replicate experiment exhibited a pattern similar to that shown in FIG. 3 for the correlation test of example 2, section 2, all with better editing efficiency when the 5' adjacent base was either G or C, with G being greater than C.

The above results indicate that the technology of the present application can affect the final protein function from the transcriptional level without changing the DNA sequence. Also, the preference of this technique for the 5' neighbor of the target base may be different from both the LERPER and the RESCUE techniques, see table 2 for details. Notably, in the test for BFP-GCA, BFP-TCA, BFP-ACA in this study, the design of the arRNA not only presented one mismatch at the target base, but also presented another mismatch 3' downstream of the arRNA (as shown in FIG. 2). Therefore, it is necessary to further test whether there is a similar pattern of preference for the 5' upstream base when there is no mismatch at these positions.

TABLE 2 comparison of base preferences of three RNA editing techniques target bases

Example 3: testing of the CUSPER editing System without mismatches between the 3 'and 5' adjacent bases

By reading the GFP signal, we can quickly and roughly judge the editing efficiency of different arRNAs, but if further confirmation of editing efficiency is needed, it is finally confirmed by Next Generation Sequencing (NGS) how much proportion of C in mRNA is edited into U. Meanwhile, the editing efficiency of the target base A or C of the RNA single base editing system, whether A to I (Qu et al, 2019) or C to U (Abudayyeh et al, 2019), is greatly influenced. Due to the limitations of BFP to the GFP reporter, if C at position 199 in the DNA sequence of BFP (SEQ ID NO 2) is used as the target base, the corresponding amino acid at position 65 is not affected when C at the 5' adjacent base (position 198) is changed into A, T or G; however, when A of the 3' adjacent base (position 200) is changed to T, C or G, it will result in complete loss of GFP signal. Therefore, the system in which the 3' -adjacent bases are T, C and G cannot be tested by the assay for reading GFP using the reporter system. And if the second-generation sequencing is carried out, the percentage of U in the mRNA after editing to A, U, C and G can be directly read, so that the editing efficiency is high and low under 16 conditions of 4 different 5 'adjacent bases and 4 different 3' adjacent bases.

Referring to the procedure of example 1.2, based on the difference in DNA sequence at positions 198,199, and 200 in the DNA sequence of BFP (SEQ ID NO 2), we constructed 16 different reporter systems, namely ACA, ACT (corresponding mRNA: ACU), ACC, ACG, TCA (corresponding mRNA: UCA), TCT (corresponding mRNA: UCU), TCC (corresponding mRNA: UCC), TCG (corresponding mRNA: UCG), CCA, CCT (corresponding mRNA: CCU), CCC, CCG, GCA, GCT (corresponding mRNA: GCU), GCC, and GCG. And the 293T cells were infected with the lentivirus packaging, infection procedure described in example 1.1, allowing stable integration into 293T cells.

Corresponding to the above 16 different reporter systems, the 3 'and 5' nearest neighbor bases of the target base of the arRNA can be complementarily paired with the 5 'and 3' adjacent bases of the target base in the target RNA by watson crick base pairing principle, on the basis that the target base of the arRNA corresponding to the target base C of the mRNA is U. The sequences of the synthesized arRNAs are shown in Table 3, and the correspondence between the target bases and their 5 'and 3' neighbors in the mRNA and the target bases of the arRNAs and their 5 'and 3' nearest neighbors is shown in FIG. 7.

Corresponding arRNAs were transfected into 16 different reporter cells, and RNA extraction and next-generation sequencing were performed according to the following procedure.

1. Cell culture DMEM (Hyclone SH 30243.01) containing 10% FBS (Vistech SE 100-011) was used. Reporter cells were transferred to 12-well plates at 15000 cells/well. This time was recorded as 0 hour.

2. 24 hours after cell passage, 12.5pmol of arRNA was transferred into each well using RNAi MAX (Invitrogen, 13778150) reagent. The transfection procedure was according to the supplier's instructions.

3. 72 hours after cell passage, whole well cells were digested with pancreatin (Invitrogen 25300054), harvested with 800. Mu.L TRIzol (Invitrogen, 15596018), RNA extracted using the Direct-zol RNA Miniprep kit (Zymo Resaerch, R2052), and 1000ng of total RNA extracted per sample was used

One-Step gDNA Removal and cDNA Synthesis SuperMix kit (gold full-scale, AT 311) is used for reverse transcription to synthesize cDNA, 1 mu L of reverse transcription product is taken, and the sequence of ggagtgatcgggtgtgcctaCGGCAAGCTGACCTGAAGTT (SEQ ID NO: 7) and gag ttggatgctgggatggGT are usedPCR was performed with two primers for AGTTGCCGTCGTCCTTGAAGAAG (SEQ ID NO: 8) and Q5 hot start enzyme (NEB, M0494L). The PCR products were pooled using Hi-TOM kit (Nuozenogen, REF PT 045) and the next generation sequencing and data analysis was performed as follows.

Illumina sequencing

The constructed sequencing library was subjected to high throughput sequencing by means of a NovaSeq6000 platform in PE150 format.

Sequencing data processing

The original data obtained by high-throughput sequencing is subjected to quality control by fastp (v0.19.6), and low-quality sequences with linker sequences and sequences containing polyG and the like are filtered out. Splitting the obtained high-quality sequencing data into each sample according to a corresponding Barcode sequence by using an autonomously developed splitting script, comparing the sample with the amplified target region sequence by using BWA (v0.7.17-r 1188) software, carrying out format conversion by SAMtools (v 1.9) to generate a BAM file, counting comparison information, reordering and establishing an index.

Analysis of editing efficiency

All mRNA target bases were detected using JACUSA (v1.3.0) software using the parameters: call-1-a B, R, D, I, Y, M:4-C ACGT-C2-P1-P UNSTRANDED-R-u Dir Mult-CE. After filtering out high frequency mutations that occurred in both control and treated samples, the part of the target bases with mutation frequencies above the threshold from C to U was taken as the true target C to U frequency, with three times the average mutation frequency outside the C- > U mutation as the threshold.

The results of the second generation sequencing are shown in FIG. 8. It was confirmed by second-generation sequencing that the CUSPER system indeed achieved C to U single base editing of mRNA. As can be seen from comparison with example 2, the editing efficiency is relatively low if both the 5' and 3' nearest neighbor bases of the target base have no mismatch with the target RNA, and the editing efficiency can be improved when the 5' nearest neighbor base of the target base forms a G-G mismatch with the target RNA. Furthermore, when both the 5 'and 3' nearest neighbor bases of the target base are paired with the 3 'and 5' adjacent bases of the target base on Watson-Crick principle, in addition to the C-U mismatch of the target base, higher editing efficiency can be obtained when the target base triplet on mRNA is the following sequence: ACG, ACC, UCC, UCG, CCC, CCG, UCA, UCU.

TABLE 3.3 ARRNA sequences with no mismatches between the 3 'and 5' adjacent bases

/>

Note: the upper and lower case letters are not different, and the capital letters only highlight the difference between sequences. Wherein the arRNA is named after the target base triplet it targets.

Reference to the literature

1.Abudayyeh,O.O.,Gootenberg,J.S.,Franklin,B.,Koob,J.,Kellner,M.J.,Ladha,A.,...&Zhang,F.(2019).A cytosine deaminase for programmable single-base RNA editing.Science,365(6451),382-386.

2.Cox,D.B.,Gootenberg,J.S.,Abudayyeh,O.O.,Franklin,B.,Kellner,M.J.,Joung,J.,&Zhang,F.(2017).RNA editing with CRISPR-Cas13.Science,358(6366),1019-1027.

3.Eckstein,F.(2014).Phosphorothioates,essential components of therapeutic oligonucle otides.Nucleic acid therapeutics,24(6),374-387.

4.Merkle,T.,Merz,S.,Reautschnig,P.,Blaha,A.,Li,Q.,Vogel,P.,...&Stafforst,T.(2019).Precise RNA editing by recruiting endogenous ADARs with antisense oligon ucleotides.Nature biotechnology,37(2),133.

5.Pollard,K.M.,Cauvi,D.M.,Toomey,C.B.,Morris,K.V.,&Kono,D.H.(2013).Interferon-γand systemic autoimmunity.Discovery medicine,16(87),123.

6.Qu,L.,Yi,Z.,Zhu,S.,Wang,C.,Cao,Z.,Zhou,Z.,...&Bao,Y.(2019).Progra mmable RNA editing by recruiting endogenous ADAR using engineered RNAs.Nature biotechnology,37(9),1059-1069.

7.Vu,L.T.,Nguyen,T.T.K.,Md Thoufic,A.A.,Suzuki,H.,&Tsukahara,T.(2016).Chemical RNA editing for genetic restoration:the relationship between the structure and deamination efficiency of carboxyvinyldeoxyuridine oligodeoxynucleotides.Chemical biology&drug design,87(4),583-593.

8.Xu,L.,Wang,J.,Liu,Y.,Xie,L.,Su,B.,Mou,D.,...&Zhao,L.(2019).CRISPR-edited stem cells in a patient with HIV and acute lymphocytic leukemia.New England Journal of Medicine,381(13),1240-1247.

Sequence listing

<110> Boya Yingyin (Beijing) Biotechnology Ltd

<120> a novel method for targeted editing of RNA

<130> PD01322

<150> 201911411077.7

<151> 2019-12-31

<160> 25

<170> PatentIn version 3.5

<210> 1

<211> 2130

<212> DNA

<213> Artificial sequence

<220>

<223> ADAR2-r16 cDNA

<400> 1

atggatatag aagatgaaga aaacatgagt tccagcagca ctgatgtgaa ggaaaaccgc 60

aatctggaca acgtgtcccc caaggatggc agcacacctg ggcctggcga gggctctcag 120

ctctccaatg ggggtggtgg tggccccggc agaaagcggc ccctggagga gggcagcaat 180

ggccactcca agtaccgcct gaagaaaagg aggaaaacac cagggcccgt cctccccaag 240

aacgccctga tgcagctgaa tgagatcaag cctggtttgc agtacacact cctgtcccag 300

actgggcccg tgcacgcgcc tttgtttgtc atgtctgtgg aggtgaatgg ccaggttttt 360

gagggctctg gtcccacaaa gaaaaaggca aaactccatg ctgctgagaa ggccttgagg 420

tctttcgttc agtttcctaa tgcctctgag gcccacctgg ccatggggag gaccctgtct 480

gtcaacacgg acttcacatc tgaccaggcc gacttccctg acacgctctt caatggtttt 540

gaaactcctg acaaggcgga gcctcccttt tacgtgggct ccaatgggga tgactccttc 600

agttccagcg gggacctcag cttgtctgct tccccggtgc ctgccagcct agcccagcct 660

cctctccctg ccttaccacc attcccaccc ccgagtggga agaatcccgt gatgatcttg 720

aacgaactgc gcccaggact caagtatgac ttcctctccg agagcgggga gagccatgcc 780

aagagcttcg tcatgtctgt ggtcgtggat ggtcagttct ttgaaggctc ggggagaaac 840

aagaagcttg ccaaggcccg ggctgcgcag tctgccctgg ccgccatttt taacttgcac 900

ttggatcaga cgccatctcg ccagcctatt cccagtgagg gtcttcagct gcatttaccg 960

caggttttag ctgacgctgt ctcacgcctg gtcataggta agtttggtga cctgaccgac 1020

aacttctcct cccctcacgc tcgcagaata ggtctggctg gagtcgtcat gacaacaggc 1080

acagatgtta aagatgccaa ggtgatatgt gtttctacag gatctaaatg tattaatggt 1140

gaatacctaa gtgatcgtgg ccttgcatta aatgactgcc atgcagaaat agtatctcgg 1200

agatccttgc tcagatttct ttatacacaa cttgagcttt acttaaataa cgaggatgat 1260

caaaaaagat ccatctttca gaaatcagag cgaggggggt ttaggctgaa ggagaatata 1320

cagtttcatc tgtacatcag cacctctccc tgtggagatg ccagaatctt ctcaccacat 1380

gaggcaatcc tggaagaacc agcagataga cacccaaatc gtaaagcaag aggacagcta 1440

cggaccaaaa tagaggctgg tcaggggacg attccagtgc gcaacaatgc gagcatccaa 1500

acgtgggacg gggtgctgca aggggagcgg ctgctcacca tgtcctgcag tgacaagatt 1560

gcacgctgga acgtggtggg catccaggga tcactgctca gcattttcgt ggagcccatt 1620

tacttctcga gcatcatcct gggcagcctt taccacgggg accacctttc cagggccatg 1680

taccagcgga tctccaacat agaggacctg ccacctctct acaccctcaa caagcctttg 1740

ctcacaggca tcagcaatgc agaagcacgg cagccaggga aggcccccat attcagtgtc 1800

aactggacgg taggcgactc cgctattgag gtcatcaacg ccacgactgg gaagggagag 1860

ctgggccgcg cgtcccgcct gtgtaagcac gcgttgtact gtcgctggat gcgtgtgcac 1920

ggcaaggttc cctcccactt actacgctcc aagattacca agcccaacgt gtaccatgag 1980

acaaagctgg cggcaaagga gtaccaggcc gccaaggcgc gtctgttcac agccttcatc 2040

aaggcggggc tgggggcctg ggtggagaag cccaccgagc aggaccagtt ctcactcacg 2100

cccgattaca aggatgacga cgataagtag 2130

<210> 2

<211> 720

<212> DNA

<213> Artificial sequence

<220>

<223> BFP cDNA

<400> 2

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tctggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccctgaccca cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg cgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtga 720

<210> 3

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 3

gcugcuucau guggucgggg uagcggcuga agcacugcac gccguagguc agggugguca 60

cgaggguggg ccagggcacg ggcagcuugc c 91

<210> 4

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 4

gcugcuucau guggucgggg uagcggcuga agcacugcac gccguugguc agggugguca 60

cgaggguggg ccagggcacg ggcagcuugc c 91

<210> 5

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 5

gcugcuucau guggucgggg uagcggcuga agcacugcac gccgucgguc agggugguca 60

cgaggguggg ccagggcacg ggcagcuugc c 91

<210> 6

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 6

gcugcuucau guggucgggg uagcggcuga agcacugcac gccguggguc agggugguca 60

cgaggguggg ccagggcacg ggcagcuugc c 91

<210> 7

<211> 42

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 7

ggagtgagta cggtgtgcct acggcaagct gaccctgaag tt 42

<210> 8

<211> 43

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 8

gagttggatg ctggatgggt agttgccgtc gtccttgaag aag 43

<210> 9

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 9

gcugcuucau guggucgggg uagcggcuga agcacugcac gccguucguc agggugguca 60

cgaggguggg ccagggcacg ggcagcuugc c 91

<210> 10

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 10

gcugcuucau guggucgggg uagcggcuga agcacugcac gccgaucguc agggugguca 60

cgaggguggg ccagggcacg ggcagcuugc c 91

<210> 11

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 11

gcugcuucau guggucgggg uagcggcuga agcacugcac gccggucguc agggugguca 60

cgaggguggg ccagggcacg ggcagcuugc c 91

<210> 12

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 12

gcugcuucau guggucgggg uagcggcuga agcacugcac gccgcucguc agggugguca 60

cgaggguggg ccagggcacg ggcagcuugc c 91

<210> 13

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 13

gcugcuucau guggucgggg uagcggcuga agcacugcac gccguugguc agggugguca 60

cgaggguggg ccagggcacg ggcagcuugc c 91

<210> 14

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 14

gcugcuucau guggucgggg uagcggcuga agcacugcac gccgaugguc agggugguca 60

cgaggguggg ccagggcacg ggcagcuugc c 91

<210> 15

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 15

gcugcuucau guggucgggg uagcggcuga agcacugcac gccggugguc agggugguca 60

cgaggguggg ccagggcacg ggcagcuugc c 91

<210> 16

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 16

gcugcuucau guggucgggg uagcggcuga agcacugcac gccgcugguc agggugguca 60

cgaggguggg ccagggcacg ggcagcuugc c 91

<210> 17

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 17

gcugcuucau guggucgggg uagcggcuga agcacugcac gccguuaguc agggugguca 60

cgaggguggg ccagggcacg ggcagcuugc c 91

<210> 18

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 18

gcugcuucau guggucgggg uagcggcuga agcacugcac gccgauaguc agggugguca 60

cgaggguggg ccagggcacg ggcagcuugc c 91

<210> 19

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 19

gcugcuucau guggucgggg uagcggcuga agcacugcac gccgguaguc agggugguca 60

cgaggguggg ccagggcacg ggcagcuugc c 91

<210> 20

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 20

gcugcuucau guggucgggg uagcggcuga agcacugcac gccgcuaguc agggugguca 60

cgaggguggg ccagggcacg ggcagcuugc c 91

<210> 21

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 21

gcugcuucau guggucgggg uagcggcuga agcacugcac gccguuuguc agggugguca 60

cgaggguggg ccagggcacg ggcagcuugc c 91

<210> 22

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 22

gcugcuucau guggucgggg uagcggcuga agcacugcac gccgauuguc agggugguca 60

cgaggguggg ccagggcacg ggcagcuugc c 91

<210> 23

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 23

gcugcuucau guggucgggg uagcggcuga agcacugcac gccgguuguc agggugguca 60

cgaggguggg ccagggcacg ggcagcuugc c 91

<210> 24

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 24

gcugcuucau guggucgggg uagcggcuga agcacugcac gccgcuuguc agggugguca 60

cgaggguggg ccagggcacg ggcagcuugc c 91

<210> 25

<211> 91

<212> RNA

<213> Artificial sequence

<220>

<223> arRNA

<400> 25

uaauccugaa uaucgcgcaa uuccccagca gagaacaucg cggugugaac gucccuuuau 60

accgggcagg uauagcugaa aucagcgugg c 91

Claims

1. An engineered composition for RNA editing comprising:

1) A modified adenosine deaminase protein or a construct expressing the modified adenosine deaminase protein, wherein the adenosine deaminase protein is modified to have an activity of catalyzing cytidine deamination, and

2) An arRNA that recruits the modified adenosine deaminase protein to a target RNA or a construct comprising the arRNA or a coding sequence thereof;

wherein the arrRNA comprises a complementary RNA sequence that hybridizes to the target RNA, and recruitment of the adenosine deaminase protein to the target RNA by the arrRNA results in deamination of target cytidine in the target RNA, wherein the adenosine deaminase protein is an ADAR2 protein, wherein the modification is: E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T, wherein the modified amino acid numbering is identical to the amino acid numbering in the Ge nBank accession NP-001103.1.

2. The engineered composition of claim 1, wherein the targeting base in the arRNA opposite the target cytidine is U or C when the arRNA is hybridized to the target RNA.

3. The engineered composition of claim 1, wherein:

the arRNA comprises unpaired nucleotides at one or more positions corresponding to upstream, downstream, or upstream and downstream of a target cytidine of the target RNA, to form nucleotide mismatches with one or more positions upstream, downstream, or upstream and downstream of the target cytidine.

4. The engineered composition of claim 3, wherein the 3' nearest neighbor base of the targeting base forms a mismatch with a target RNA.

5. The engineered composition of claim 4, wherein the 3' nearest neighbor base of the targeting base forms a G-G mismatch with the target RNA when the arrRNA is hybridized to the target RNA.

6. The engineered composition of claim 2, wherein the 5' nearest neighbor base of the targeting base does not form a mismatch with the target RNA when the arRNA is hybridized to the target RNA.

7. The engineered composition of claim 6, wherein the 5' nearest neighbor base of the targeting base is U.

8. The engineered composition of claim 5, wherein the bases in the target RNA opposite the 5' nearest neighbor base of the targeting base of the arrRNA are in a preferred order of G or C, U or A from high to low when the arrRNA is hybridized to the target RNA.

9. The engineered composition of claim 1, wherein a target cytidine triplet formed by the target cytidine and its 5 'and 3' adjacent bases forms a mismatch only at the target cytidine when the arRNA is hybridized to the target RNA, wherein the target cytidine triplet is selected from the group consisting of: ACG, ACC, UCC, UCG, CCC, CCG, UCA, UCU.

10. The engineered composition of claim 1, wherein the arRNA is 91nt in length.

11. The engineered composition of claim 2, wherein the targeting bases in the arRNA are equal in length from the 3 'end and the 5' end.

12. The engineered composition of claim 1, wherein the arRNA is chemically modified.

13. The engineered composition of claim 12, wherein the chemical modification comprises a 2 '-O-methyl modification or an internucleotide 3' thio modification.

14. A method for deaminating a target cytidine in a target RNA in a cell for non-diagnostic therapeutic purposes comprising introducing into the cell 1) and 2) as follows:

1) A modified adenosine deaminase protein or a construct expressing said modified adenosine deaminase protein, and

2) An arRNA that recruits the modified adenosine deaminase protein to the target RNA or a construct comprising the same or a coding sequence thereof, wherein the adenosine deaminase protein is modified with activity to catalyze cytidine deamination, the arRNA comprises a complementary RNA sequence that hybridizes to the target RNA, and recruitment of the adenosine deaminase protein to target RN A results in deamination of the target cytidine in the target RNA, wherein the adenosine deaminase protein is an ADAR2 protein and the modification is: E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T, the modified amino acid numbering being consistent with the amino acid numbering in GenBank accession NP-001103.1.

15. The method of claim 14, wherein the construct expressing the modified adenosine deaminase protein and the construct comprising the coding sequence of the arRNA are the same construct or the construct expressing the modified adenosine deaminase protein and the construct comprising the coding sequence of the arRNA are separate constructs introduced into the cell simultaneously or separately.

16. The method of claim 14, wherein the targeting base of the arRNA opposite the target cytidine is U or C when the arRNA is hybridized to the target RNA.

17. The method of claim 14, wherein:

the argrna comprises unpaired nucleotides at one or more positions upstream, downstream, or upstream and downstream of a target cytidine corresponding to the target RNA to form nucleotide mismatches with one or more positions upstream, downstream, or upstream and downstream of the target cytidine.

18. The method of claim 16, wherein the 3' nearest neighbor base of the targeting base forms a mismatch with the target RNA.

19. The method of claim 18, wherein the 3' nearest neighbor of the targeting base forms a G-G mismatch with the target RNA when the arRNA is hybridized to the target RNA.

20. The method of claim 16, wherein the 5' nearest neighbor base of the targeting base does not form a mismatch with the target RNA when the arRNA hybridizes to the target RNA.

21. The method of claim 20, wherein the 5' nearest neighbor base of the targeting base is U.

22. The method of claim 19, wherein when the arRNA hybridizes to a target RNA, the order of preference of the bases in the target RNA opposite the 5' nearest neighbor base of the targeting base is G or C, U or a from high to low.

23. The method of claim 14, wherein a target cytidine triplet formed by the target cytidine and its 5 'and 3' adjacent bases forms a mismatch only at the target cytidine when the arRNA is hybridized to the target RNA, wherein the target cytidine triplet is selected from the group consisting of: ACG, ACC, UCC, UC G, CCC, CCG, UCA, UCU.

24. The method of claim 14, wherein the arRNA is 91nt in length.

25. The method of claim 16, wherein the targeting bases in the arRNA are equal in length from the 3 'end and the 5' end.

26. The method of claim 14, wherein the arRNA is chemically modified.

27. The method of claim 26, wherein the chemical modification comprises a 2 '-O-methyl modification or an internucleotide 3' thio modification.

28. The method of claim 14, wherein the cell is a mammalian cell.

29. Use of the engineered composition of any one of claims 1-13 for the manufacture of a medicament for treating a disease caused by a T to C mutation, the use deaminating a targeted cytidine in a messenger RNA comprising the transcription of the T to C mutation.

30. A modified adenosine deaminase protein for RNA editing, wherein the adenosine deaminase protein is ADAR2, wherein the modification is: E488Q/V351G/S486A/T375S/S370C/P462A/N597I/L332I/I398V/K350I/M383L/D619G/S582T/V440I/S495N/K418E/S661T, the modified amino acid numbering being consistent with the amino acid numbering in GenBank accession NP-001103.1.

31. Use of a modified adenosine deaminase protein according to claim 30, to catalyze the deamination of cytidine to uridine.