CN112662674B - gRNA for targeted editing of VEGFA gene exon region and application thereof - Google Patents
gRNA for targeted editing of VEGFA gene exon region and application thereof Download PDFInfo
- Publication number
- CN112662674B CN112662674B CN202110037499.3A CN202110037499A CN112662674B CN 112662674 B CN112662674 B CN 112662674B CN 202110037499 A CN202110037499 A CN 202110037499A CN 112662674 B CN112662674 B CN 112662674B
- Authority
- CN
- China
- Prior art keywords
- grna
- artificial sequence
- sequence
- vegfa
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to a gRNA for targeted editing of a VEGFA gene exon region and application thereof, belonging to the technical field of gene editing. The gRNA sequence is targeted to destroy an exon region of a VEGFA gene, and a targeting structure domain sequence of the gRNA sequence is selected from a basic sequence shown in any one of SEQ ID NO 5-21, SEQ ID NO 25-53, or an extended sequence with similarity more than or equal to 90% with the basic sequence. By adopting the gRNA sequence, the VEGFA gene promoter region is specifically targeted and destroyed, so that the VEGFA mRNA level is effectively reduced. Thereby treating related diseases such as cancer, age-related macular degeneration, diabetic nephropathy, rheumatoid arthritis, psoriatic skin, ovarian hyperstimulation syndrome, and the like.
Description
Technical Field
The invention relates to the technical field of gene editing, in particular to a gRNA for targeted editing of a VEGFA gene exon region and application thereof.
Background
The angiogenesis signal pathway involved in Vascular Endothelial Growth Factor A (VEGFA) regulates various biological physiological processes and disease-related signal pathways, such as angiogenesis process from embryo development to various organs and tissues. When a specific tissue or organ is in a hypoxia state, VEGFA in cells is activated and expressed up-regulated by a Hypoxia Inducible Factor (HIF) transcription factor, and the up-regulated VEGFA is bound to a receptor thereof to activate a new blood vessel signaling pathway and provide nutrients for the body. In various cancers and other diseases, tissues are in a hypoxic state, VEGFA is significantly up-regulated and expressed, and a new vascular pathway is activated. Researches show that VEGFA related new vessel signaling pathway can be up-regulated in various pathological processes, such as various cancer courses of lung cancer, breast cancer, liver cancer, glioblastoma and the like, and VEGF is obviously up-regulated and expressed in various diseases of diabetic nephropathy, rheumatoid arthritis, psoriatic skin, ovarian hyperstimulation syndrome and the like.
The VEGF antibody Abametpu and the medicine RGX-314 which over-expresses anti-VEGF and is clinically tested are used for treating Diabetic Macular Edema (DME), macular Edema after Retinal Vein Occlusion (RVO), diabetic Retinopathy (DR) and the like, and the effect is better. The testing of anti-VEGF Abirascipt (Aflibercept) from Bayer for colorectal cancer is already in clinical stage three, while the testing for non-small cell lung cancer is also in clinical stage three. Anti-VEGF Bevacizumab (Bevacizumab) from Gene tag corporation is used for the treatment of colon cancer, lung cancer, breast cancer, glioblastoma, kidney cancer, etc., and clinical trials for the treatment of colon cancer and breast cancer have entered the third phase. However, frequent intravitreal injection of antibody drugs seriously affects the quality of life of patients, and therefore, the development of a drug which permanently down-regulates VEGFA is highly necessary and urgent for human health.
Age-related macular degeneration (AMD) has become the leading cause of blindness in the elderly over the age of 50 worldwide, causing irreversible vision loss. AMD is classified as dry or atrophic and neovascular or wet. Of these, 10-15% are neovascular age-related macular degeneration (nAMD), one of the leading causes of vision loss. Clinical symptoms of nAMD patients are gradual or sudden development of severe visual impairment, fundus hemorrhage, exudation with choroidal neovascularization and discoid scarring in the macular region. Neovascular age-related macular degeneration begins at age 50 with a prevalence of up to 13% in the elderly population over age 60. Research has now demonstrated that the key molecular mechanism of nAMD is that retinal pigment epithelial cells (RPE) stimulate over-expression of Vascular Endothelial Growth Factor (VEGFA) due to genetic or external pressure, thereby activating the signal path of neovascularization, causing retinal blood leakage and severely damaging vision. Thus, ocular intravitreal injection of VEGF antibody drugs can effectively inhibit retinal and choroidal neovascularization and deterioration of central vision impairment.
The intravitreal injection of a VEGF antibody drug is a treatment scheme which has a good effect on treating nAMD and has the largest market share at present. However, all VEGF antibody drugs need to be injected intravitreally every 1-3 months, and the frequent intravitreal injections and the high cost bring difficult postoperative life and economic pressure for the elderly.
CRISPR/Cas (clustered regulated short linked polypeptides/CRISPR-associated proteins) system is the most widely used gene editing technology at present. In the prior art, a CRISPR-Cas gene editing system for carrying out gene editing on VEGFA genes appears, gRNAs comprising multiple Cas nucleases and targeting different sites are tried, and a lot of efforts are made, but the problem of low editing efficiency generally exists at present, and a good treatment effect is difficult to achieve; furthermore, editing the VEGFA gene may also result in unpredictable toxicity.
Disclosure of Invention
In view of the above, there is a need to provide a gRNA for targeted editing of VEGFA gene exon regions, with which gRNA sequences can be used to specifically target disruption of VEGFA gene exon regions and effectively reduce VEGFA mRNA levels.
The invention provides a gRNA which is a single-molecule gRNA (sgRNA) and can be used for targeted disruption of an exon region of a VEGFA gene, wherein a targeting structure domain sequence of the gRNA is selected from a basic sequence shown in SEQ ID NO. 5-21, SEQ ID NO. 25-53, or an extension sequence with similarity more than or equal to 90% with the basic sequence.
It is understood that the extension sequence preferably has a sequence similarity of 95% or more, 96% or more, 97% or more, or 98% or more to the base sequence described above.
It will be appreciated that the gRNA comprises a targeting domain identical to the target sequence, and a fixed sequence domain (backbone sequence), as shown in fig. 1, wherein the fixed sequence domain is designed in a conventional manner.
The grnas of the invention are sufficient to allow targeting of the Cas9 nuclease molecule to the VEGFA gene through the targeting domain and the backbone sequence. The core of the gRNA invention provided by the inventors lies in the targeting domain, and those skilled in the art can know that a single-molecule gRNA formed by connecting the gRNA targeting domain of the invention with any suitable framework sequence can achieve the function of targeting Cas9 to VEGFA, thereby achieving the technical effect of the invention.
The inventor finds that, in earlier researches, a gRNA (ribonucleic acid) containing multiple Cas nucleases and targeting different sites has been tried in a CRISPR-Cas gene editing system for carrying out gene editing on a VEGFA gene in the prior art, and a lot of efforts are made, but the current results are not obvious, and the problem of low editing efficiency exists. On the basis, the inventor searches and screens through a large number of experiments, so that the editing efficiency of the obtained gRNA is remarkably improved, the expression level of VEGFA is effectively reduced, a better effect can be achieved when the gRNA is used for treating diseases, and the gRNA also has higher safety.
In some of these embodiments, the base sequence is selected from the group consisting of SEQ ID NO. The sequence is used as a targeting structure domain sequence of the gRNA, and has better editing efficiency.
In some of these embodiments, the base sequence is selected from the group consisting of SEQ ID NOS 5-21, SEQ ID NOS. The sequence is used as a targeting domain sequence of the gRNA, and has the best editing efficiency.
In some embodiments, the gRNA uses a gRNA backbone sequence that is common to the SaCas9 or SpCas9 systems.
In some embodiments, the gRNA backbone sequences use gRNA backbone sequences that are common to the SaCas9 system.
In some embodiments, the gRNA framework sequence common to the SaCas9 system is 5' (SEQ ID NO: 57).
In some embodiments, the gRNA framework sequence uses a gRNA framework sequence that is common to the SpCas9 system.
In some embodiments, the gRNA backbone sequence common to the SpCas9 system is 5-.
The invention also discloses a gRNA expression vector for editing the exon region of the targeted VEGFA gene, which comprises a nucleotide sequence for coding the gRNA.
The expression vector can express gRNA for targeted editing of VEGFA gene, and it is understood that those skilled in the art can construct the vector by conventional techniques.
The invention also discloses a composition for targeted editing of an exon region of a VEGFA gene, which comprises a gRNA system and a Cas9 enzyme system, wherein the gRNA system directly or indirectly comprises the gRNA, and the Cas9 enzyme system directly or indirectly comprises a Cas9 enzyme.
It is understood that the above description of directly containing a gRNA refers to formulation directly using a gRNA (including but not limited to a chemically synthesized gRNA), and indirectly containing a gRNA refers to production of a gRNA by conventional means such as transcription through genetic engineering; likewise, for directly containing Cas9 enzyme means directly formulated using purified Cas9 protein, and indirectly containing Cas9 enzyme means indirectly producing Cas9 enzyme by means of genetic engineering.
In some of these embodiments, the grnas are at least 2. Cas9 enzyme was used in combination with at least 2 of the grnas for gene editing, or their encoding nucleic acids were used. Further, in some of these embodiments, the Cas9 enzyme is SaCas9 or SpCas9.
The invention also discloses a cell with modified VEGFA gene, which is obtained by contacting the cell with the composition containing the gRNA system and the Cas9 enzyme system to realize the modification of the VEGFA gene.
The invention also discloses a delivery system for delivering the composition, which comprises the gRNA system and the Cas9 enzyme system, and the delivery system adopts at least one of RNP delivery, liposome delivery, nanoparticle delivery and virus delivery.
In some of these embodiments, the delivery system employs viral delivery. Further, in some of these embodiments, the delivery system employs AAV (adeno-associated virus) delivery.
The invention also discloses application of the gRNA, the gRNA expression vector, the composition, the cell and the delivery system in preparation of a medicament for treating diseases with the advantage of reducing VEGFA. For example, for the preparation of a medicament for the treatment of a disease associated with VEGFA overexpression.
In some of these embodiments, the disease in which down-regulation of VEGFA is beneficial comprises: cancer, age-related macular degeneration, diabetic nephropathy, rheumatoid arthritis, psoriasis, ovarian hyperstimulation syndrome. Age-related macular degeneration (AMD) is preferred.
Compared with the prior art, the invention has the following beneficial effects:
1. the gRNA of the VEGFA gene exon region targeted editing is based on a CRISPR/Cas system, provides a plurality of new gRNA sequences of the VEGFA gene exon region targeted, and can directly damage the VEGFA gene exon after being delivered to cells by using a vector, so that the VEGFA transcription level is reduced. Can be used for treating diseases related to VEGFA overexpression, or diseases including cancer, age-related macular degeneration, diabetic nephropathy, rheumatoid arthritis, psoriatic skin, ovarian hyperstimulation syndrome, etc. by down-regulating conventional VEGFA mRNA level.
2. Compared with the editing system of the targeting VEGFA gene in the prior art, the editing efficiency of the gRNA is obviously improved, the expression level of the VEGFA is more effectively reduced, and a better effect can be achieved when the gRNA is used for treating diseases.
3. Further, in particular, the partial grnas of the present invention achieve unexpected technical effects compared to grnas targeting proximal sites.
4. Experiments show that part of gRNA of the invention has higher safety.
Drawings
FIG. 1 is a schematic diagram of a target DNA-Cas9-gRNA system;
FIG. 2 is a first schematic diagram showing the targeting positions of a part of gRNAs on the human VEGFA gene in the example;
FIG. 3 is a schematic diagram of the targeting position of a portion of gRNA on the human VEGFA gene in example II;
FIG. 4 is a schematic diagram of the targeting position of a portion of gRNA on the human VEGFA gene in example III;
FIG. 5 is a fourth schematic representation of the targeting positions of a portion of gRNAs in the examples on the human VEGFA gene;
FIG. 6 is a diagram schematically showing a peak of DNA sequencing by Sanger of a part of the recombinant plasmid in example 1;
wherein: a is a peak diagram of sequencing DNA of Sanger of gRNA #5-2 recombinant plasmid, and B is a peak diagram of sequencing DNA of Sanger of gRNA #7-2 recombinant plasmid;
FIG. 7 is a graph showing the in vivo editing efficiency of mice in the groups gRNA # 1, gRNA # 2, and gRNA # 5-2;
FIG. 8 is a graph showing the expression levels of Vegfa protein in mice in groups of gRNA # 1, gRNA # 2, and gRNA # 5-2;
FIG. 9 is a graph showing the areas of CNV in mice in groups of gRNA # 1, gRNA # 2, and gRNA # 5-2;
FIG. 10 is an in vivo off-target efficiency assay for gRNA # 1;
FIG. 11 is a gRNA # 2 in vivo off-target efficiency assay;
FIG. 12 is an in vivo off-target efficiency assay for gRNA # 5-2;
FIG. 13 shows the results of in vivo toxicity tests of mice in the groups gRNA # 1, gRNA # 2, and gRNA # 5-2;
wherein: FIGS. 13A and 13B show the results of tests 7 days and 6 weeks after AAV injection.
Detailed Description
In order that the invention may be more fully understood, reference will now be made to the following description. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.
Defining:
the "Cas9" described in the present invention includes, but is not limited to, spCas9, saCas9, nme2Cas9, nme3Cas9, cjCas9, nmCas9, st1Cas9, fnCas9, tdCas9, st3Cas9, geoCas9, blatCas9, scCas9 and SmacCas9, fusion proteins thereof, or mutants thereof.
Reagents and materials used in the present example are all commercially available unless otherwise specified; unless otherwise specified, all the experimental methods are routine in the art.
Example 1
And (3) a CRISPR gene editing method is used for breaking the VEGFA gene exon experiment.
Restriction enzymes involved in this example were purchased from NEB, a small plasmid DNA extraction kit and 2 × Accurate Taq master Mix, a genomic DNA extraction kit from Accurate Biotech, inc., of Akeby, hunan, OPTI-MEM, T4 DNA ligase and Lipofectamine 2000 transfection reagent from Thermo. Stbl3 competent bacteria were purchased from Shenzhen kang Life technologies, inc. The primers used for gRNA, PCR and sequencing were all synthesized by conventional methods.
1. Construction of recombinant plasmid
gRNA design.
Firstly, a gRNA targeting structure domain, namely a region targeting VEGFA gene, and exon 1 and 3 regions of the targeting VEGFA gene are determined, then, a gRNA with the length of the targeting structure domain of 17-24nt is designed according to a human VEGFA gene sequence, as shown in the following table 1, and part of the gRNAs are selected for experiment, as shown in the following table 2 specifically, and a SaCas9-gRNA sequence of the targeting bacterial LacZ gene is used as a negative control, as shown in the following table 3.
TABLE 1 targeting Domain sequences of gRNAs
TABLE 2 targeting Domain sequences of gRNAs
TABLE 3 negative control sequences
2. A plasmid was constructed.
All the gRNA recombinant plasmids are obtained by cutting pX552 through enzyme and connecting with a gRNA targeting sequence and a specific framework corresponding to each Cas nuclease. gRNA framework sequences corresponding to CjCas9, spCas9 and SaCas9 are as follows in sequence:
GUUUUAGUCCCUGAAGGGACUAAAAUAAAGAGUUUGCGGGACUCUGCGGGGUUACAAUCCCCUAAAACCGC(SEQ ID NO:55)、
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC(SEQ ID NO:56)、
GUUUUAGUACUCUGGAAACAGAAUCUACUAAAACAAGGCAAAAUGCCGUGUUUAUCUCGUCAACUUGUUGGCGAGAUUUUU(SEQ ID NO:57)。
wherein the pAAV-U6-gRNA # 1 is constructed by connecting a gRNA # 1 targeting domain sequence with a tracrRNA (trans-activating crRNA) sequence and a pre-crRNA (precursor CRISPR RNA) sequence corresponding to the cjCas9 through a GAAA or TGAA joint. The gRNA # 2 targeting domain sequence and the gRNA backbone corresponding to SpCas9 were constructed as pAAV-U6-gRNA # 2. And the gRNA #3-gRNA # 16 and gRNA # LacZ are respectively connected with gRNA frameworks corresponding to the SacAS9 for construction, and a DNA sequence sense strand and an antisense strand (the 5' -end of the sense strand is added with caccg, the 5' -end of the antisense strand is added with aaac, and the 3' -end of the antisense strand is added with C) corresponding to a gRNA target sequence are synthesized by a conventional method.
pX551-CMV-CjCas9 (Addgene, 107035) was purchased from Addgene; the original pMecp2 promoter of the SpCas9 in the pX551 (Addgene, 60975) is replaced by the pAAV-CMV-SpCas9 through modification to be a CMV promoter; pAAV-CMV-SacaS9 was derived from pX601 (Addgene, 61591) with the U6-gRNA fragment removed. Because the SacAS9 is partially overlapped with PAM sequences ('NGG') and ('NNGRRT') of the SpCas9, a part of gRNA sequences are commonly used for the two nucleases, and the part of the pAAV-U6-gRNA recombinant plasmid gRNA corresponding to the SpCas9 is constructed by the method, and the corresponding gRNA targeting sequence and the gRNA framework sequence corresponding to the SpCas9 are connected in the modified pX552 plasmid.
Mu.l of each of the sense and antisense strands of the DNA sequence corresponding to the above gRNA target sequence was mixed, 2. Mu.l of NEB 10x cuttermarst buffer and 14. Mu.l of H2O were added thereto, and the mixture was incubated at 95 ℃ for 5 minutes in a PCR apparatus, immediately taken out and incubated on ice for 5 minutes, and annealed to form double-stranded DNA having a cohesive end according to the following reaction system.
TABLE 4 reaction System
| Total volume of reaction | 20μl |
| Oligo-F(100μM) | 2μl |
| Oligo-R(100μM) | 2μl |
| 10×NEB Cutter smart buffer | 2μl |
| Deionized water | 14μl |
Therefore, the digested plasmid and the annealing primer, and the DNA Ligation Kit Ver.2.1 (TAKARA, 6022Q) were added in sequence according to the following reaction system and incubated for 1 hour at 16 ℃ in a PCR instrument, so that the annealing product was connected to the linearized backbone, and different pAAV-U6-gRNAs plasmids were obtained.
TABLE 5 reaction System
| Total volume of reaction | 6μl |
| 2x SolutionⅠ | 3μl |
| annealed primers | 2μl |
| digested plasmid | 1μl |
3. Plasmid transformation
In a clean bench, all T4-linked reaction products were quickly added to 1 tube (50. Mu.l) of E.coli Stbl3 competent cells (Kangsheng, KTSM 110L), which were then incubated on ice for 30 min. The competent cells were immersed in a 42 ℃ water bath for 90 seconds and incubated on ice for 2 minutes. In a clean bench, 400. Mu.L of LB medium without antibiotics was added, and then the broth was put into a bacterial shaker and incubated at 37 ℃ and 200rpm for 45 minutes for recovery. During the recovery period, the biochemical incubator was opened, and an LB agar plate containing an appropriate amount of ampicillin was placed in and dried. The pellet was centrifuged at 12000rpm for 1 minute at room temperature, the majority of the supernatant was aspirated and retained at about 50. Mu.L before being resuspended thoroughly. The bacterial droplets were pipetted onto the edge of an ampicillin-containing LB agar plate and streaked onto the plate using a pipette tip. The plate was then placed upside down in the biochemical incubator and incubation continued for 16 hours.
4. And (5) identifying positive clones.
In the super clean bench, 7 monoclonals are picked up into 50 mul LB culture medium containing ampicillin by using 1-10 mul pipette tips, and the bacteria and the LB culture medium are mixed uniformly by blowing and beating for several times. 2 mul of the bacterial liquid was aspirated and added to the colony PCR reaction solution (shown in the following table), and after mixing well, the mixture was instantaneously centrifuged to collect the liquid at the bottom of the tube, followed by PCR. And placing the residual bacterial liquid in a biochemical incubator for continuous culture.
TABLE 6 reaction System
| Total volume of reaction | 30μl |
| 2X Accurate Taq Master Mix(Accurate Biotech，AG11019) | 15μl |
| gRNA-F (each gRNA specific forward primer) | 1μl |
| Reverse primer of modified pX552 vector | 1μl |
| template | 1μl |
| Deionized water | 12μl |
* Each gRNA specific forward primer: a forward primer used in primer annealing for constructing pAAV-U6-gRNAs vector.
And carrying out agarose gel electrophoresis after PCR amplification, and selecting the clone with correct and single electrophoresis band and normal brightness as a positive clone. 10 μ l of the resulting suspension was subjected to Sanger sequencing. The remaining strain was used for plasmid extraction, according to the protocol of the Accurate plasmid extraction kit (Accurate Biotech, AG 21001), and finally eluted with 50. Mu.l of Elution Buffer. The concentration was determined using the Qubit dsDNA BR Assay Kit (Invitrogen, Q32853) as per the protocol of the Qubit4 Fluorometer. One positive clone was selected for each plasmid, 5-10. Mu.l was provided for Sanger sequencing, and universal U6-Promoter-F (ACGATACAAGGCTGTTAGAG) was used as the sequencing primer. The recombinant plasmid is successfully constructed. FIG. 6 schematically shows a partial sequencing result.
2. Detecting editing efficiency
1. And (5) detecting editing efficiency.
HEK293T cells were transfected following strictly the procedures used by the Life Tech company Lipofectamine 2000 (Thermo Fisher 11668019) reagent. The day before transfection, well-conditioned HEK293T cells were seeded at 1 × 105/well into 24-well plates. On the day of transfection, 500ng of each recombinant gRNA plasmid was added to 50. Mu.l of OPTI-MEM (Thermo, 212078 88), 1. Mu.l of Lipofactamine2000 was added to 50. Mu.l of OPTI-MEM medium, and the mixture was allowed to stand at room temperature for 5mins, after which the diluted plasmid DNA was mixed with Lipofactamine2000 and allowed to stand at room temperature for 15mins, then 100. Mu.l of plasmid DNA complex was added to each well of 24-well plate, and the plate was gently shaken and mixed. Incubated at 37 ℃ for 72h.
Cells were harvested 72h after transfection and genomic DNA was extracted according to the standard method of the Accurate Universal genomic DNA extraction kit (Accurate, AG 21009). A sequence of about 800bp upstream and downstream of the gRNA binding site was amplified with specific primers. Different gRNA corresponds to different primers. The sequence is as follows:
TABLE 7 amplification primers for each gRNA
The PCR reaction system was prepared as follows, with a total volume of 50. Mu.l:
TABLE 8 PCR reaction System
| Total volume of reaction | 50μl |
| 2x taq master mix | 25μl |
| VEGFA-PCR-F1 | 1μl |
| VEGFA-PCR-R1 | 1μl |
| template | 1μl |
| Deionized water | 22μl |
The PCR products were detected by 1% agarose electrophoresis and were subjected to Sanger sequencing. The sequencing result is imported into a TIDE analysis website (https:// ice. All recombinant plasmid transfection HEK293T cell experiments, repeated three times. The average edit efficiency was finally obtained, see table 9.
TABLE 9 Gene editing efficiency of each group
As can be seen from the above table, the VEGFA gene was partially edited in the grnas designed according to the present invention, and the editing efficiency of the grnas according to the present invention was significantly improved as compared with the control gRNA # 1 group and gRNA # 2 group. Among them, the highest editing efficiency was the gRNA # 5 series, gRNA # 6 series, gRNA #7 series, gRNA #9 series, gRNA #15 series, and the next was gRNA # 10 series, gRNA #11 series, gRNA # 12 series, gRNA # 13 series.
Example 2
VEGFA-Cas9-gRNA system regulates and controls VEGFA gene transcription level experiment in HEK293T cells.
Nucleic acid purification kit, reverse transcription kit, and 2X according to the present example
Green Pro Taq HS Premix was purchased from Accurate Biotech, inc. of Akrey, hunan, OPTI-MEM and Lipofectamine 2000 transfection reagents were purchased from Thermo. Primers and related RNAs used for PCR and sequencing were synthesized by a reagent company.
1. And (4) cell transfection.
Referring to the procedure for plasmid transfection of cells in example 1, HEK293T cells were transfected with recombinant plasmids (including control plasmids). The day before transfection, HEK293T cells in good condition were treated at 1X 10 5 Perwell into 24-well plates. On the day of transfection, 500ng of recombinant gRNA plasmid was added to 50. Mu.l of OPTI-MEM (Thermo, 212078), 1. Mu.l of Lipofactamine2000 (Thermo Fisher 11668019) was added to 50. Mu.l of OPTI-MEM medium, and after mixing, the mixture was left to stand at room temperature for 5mins, and then the diluted plasmid DNA was mixed with Lipofactamine2000, and then left to stand at room temperature for 15mins, and then 100. Mu.l of plasmid DNA complex was added to each well of 24-well plate, and the plate was gently shaken and mixed. After 72h of culture, the cells were harvested and RNA was extracted.
2. Detecting changes in transcription levels
1. Total RNA was extracted and inverted to cDNA.
After all high editing efficiency recombinant plasmids were selected to transfect HEK293T cells for 72h, the cells were harvested and RNA was extracted using the Steadypure Universal RNA Extraction Kit (Accurate Biotech, AG 21017). Using a Qubit TM RNA BR Assay Kit(Thermo Fisher, Q10210) Kit, followed by removal of genomic gDNA and reverse transcription reaction using Evo M-MLV RT Kit with gDNA Clean for qPCR II (Accurate Biotech, AG 11711), cDNA synthesis.
qPCR detects the transcriptional level of the SaCas9-gRNA and SpCas9-gRNA regulated VEGFA gene.
Relative real-time quantitative qPCR was used to detect relative changes in expression of VEGFA mRNA with GAPDH as an internal control, using Accurate SYBR Green Pro Taq HS (Accurate Biotech, AG 11701). The primer sequences are shown in the following table. Specific primers are designed aiming at gRNA of each exon region, only wild type sequences can be amplified, and edited mRNA cannot be amplified. LacZ group changes in the relative expression of VEGFA mRNA were detected by qPCR with all gRNA-specific primers and served as negative controls.
TABLE 10 primers for relative expression Change of VEGFA mRNA
TABLE 11.QPCR reaction System
| Total volume of reaction | 10μl |
| SYBR Green Pro Taq HS | 5μl |
| forward primer/10μM | 0.2μl |
| reverse primer/10μM | 0.2μl |
| cDNA diluted 3-fold | 3μl |
| Deionized water | 1.2μl |
The recombinant plasmid transfects cells, extracts RNA, reversely synthesizes cDNA and qPCR all need independent 3 times biological repeated experiments, and the result is obtained by 2 times -ΔΔCT The calculation method yielded three average results, the results of which are shown in the following table.
TABLE 12 efficiency of gene editing and mRNA alteration in each group
By combining the editing efficiency data in table 9 above and the analysis of the transcription validation data in table 12, the gRNA of the present invention leads to a significant decrease in the transcription level of VEGFA gene in cells and significantly improves the editing efficiency, compared to the control gRNA # 1 group and gRNA # 2 group. The most effective in editing VEGFA gene is gRNA # 5, gRNA # 6, gRNA #7, gRNA #9, and gRNA #15, preferably gRNA # 10, gRNA #11, gRNA # 12, and gRNA # 13.
The present inventors have found, upon data analysis, that the VEGFA gene editing effect of the gRNA # 16 series is not good, but surprisingly, the targeted positions of grnas # 5 to #6 and #12 to #13 on the genome are close to the targeted position of gRNA #16 (as shown in fig. 2), but have a significantly enhanced editing effect. Including greatly improved editing efficiency, and greatly reduced post-editing mRNA levels. When combined with Cas9 for gene editing, gRNA #5-gRNA # 6 also had a significantly enhanced editing effect compared to gRNA # 2.
A similar situation also occurs in the gRNA #7 series. The targeting positions of the gRNA #7 series and the gRNA #8 series are close (as shown in FIG. 3), but the editing effect of the gRNA #7 series is obviously better.
Similarly, grnas #9-1, grnas #9-2, and grnas #9-3 had significantly enhanced editing effects compared to gRNA # 3 targeted to a proximal genomic position (as shown in fig. 4).
Similar events occur with gRNA #11-1, gRNA #11-2, gRNA #11-3, gRNA #15-1, gRNA #15-2, and gRNA #15-3, which also have significantly enhanced editing effects as compared to gRNA # 14 targeted to a proximal genomic position (as shown in FIG. 5).
The above experiment also confirmed that for some gRNAs targeting cleavage of a specific site, the length of the targeting domain sequence is not much influenced by the editing effect when the length is varied within the range of 17-24 nt.
Example 3
Editing efficiency and safety in mice were tested.
1. AAV vector construction and AAV virus packaging and purification.
Packaging AAV: HEK293T cells were co-transfected with AAV8 capsid plasmids, pHelper plasmids and specific plasmids pX551-CMV-CjCas9 (Addgene, 107035), pAAV-U6-gRNA # 1, pAAV-CMV-SpCas9, pAAV-U6-gRNA # 2, pAAV-CMV-SacAS9, pAAV-U6-gRNA #5-2 or pAAV-U6-gRNA # LacZ by the calcium phosphate method. After standing at room temperature for 20min by mixing at a molar ratio of 1,
purification Kit Maxi) were isolated and purified. The number of viral vector genomes was quantified by qPCR with ITR primers (5 '-ggaacccctagtgatgatggagtt (SEQ ID NO: 94) and 5' -cggccctagtgagcga (SEQ ID NO: 95)).
2. Fundus injection and laser-induced retinal neovascularization in mice.
All animal management, use and handling used in this study were conducted under the guidance provided by the animal care and use committee of the biotechnology limited, guangzhou regeng, ophthalmology and strict protocols of safety studies. In this study, specific male 8-week-old C57BL/6J mice were used. The mice were maintained in a 12 hour light/dark cycle.
Mice were injected in the sub-retinal space. 5% chloral hydrate (100 mu L/10g body weight) is injected into the middle abdominal cavity of a mouse with the age of 8 weeks for anesthesia, after the mouse is completely anesthetized, the beautiful compound tropicamide eye drops and the Alcon proparacaine hydrochloride eye drops are sequentially used for mydriasis and local anesthesia, and the Yishukang sodium hyaluronate is coated around the eyeball of the mouse to improve the visualization of the interior of the eyeball. A30G tip needle (Hamilton, 7803-01) was used to puncture a hole 1mm from the edge of the mouse cornea, and then 1. Mu.L (9X 10. Mu.L) each of AAV8-CMV-CjCas9 and AAV8-gRNA # 1 subretinal space was injected under a surgical microscope (Leica Microsystems Ltd.) using a Hamilton 10. Mu.L microsyringe (Hamilton, 7653-01) to which a Hamilton 33G flat needle (Hamilton, 7803-05) had been attached 9 Individual viral genome) to experimental mouse groups # 1, AAV8-CMV-SpCas9 and AAV8-gRNA # 2 each at 1. Mu.L (9X 10) 9 Individual viral genome) to experimental mouse group # 2, AAV8-CMV-SacAS9 and AAV8-gRNA #5-2 each 1. Mu.L (9X 10) 9 Individual viral genome) to experimental mouse group # 3, AAV8-CMV-SacAS9 and AAV8-gRNA # LacZ each 1. Mu.L (9X 10) 9 Individual viral genomes) to experimental mouse group #4 (as a negative control group). Subretinal space injection was divided into two experiments, with the first dose administered 6 weeks prior to laser modeling and the second dose administered 7 days prior to laser modeling.
Laser-induced choroidal neovascularization. Two batches of mice were dosed with laser light and laser modeled 7 days or 6 weeks after the mice subretinal injection. Mice were anesthetized and mydriasis performed as above. The French light TeVitra fundus laser therapeutic instrument is used, and the laser parameters are 532nm wavelength, 100 micron spot size, 250mW power and 100ms exposure time. Laser burns are induced in the vicinity of the optic nerve in 3-4 spots. Only burns that did not have retinal hemorrhages and produced blebs were used for the study.
Quantitative and qualitative analysis of retinal vascular rupture. After 1 week of laser molding, the eyeball was fixed with 4% paraformaldehyde at room temperature for 1 hour, the lens, cornea, retina, etc. were carefully detached and removed, the choroid was retained and choroid/RPE patches were made. RPE (RPE/choroid/sclera) was immunostained overnight at 4 ℃ using either isolectin-B4 (Thermo Fisher Scientific, I21413,1, 100) or anti-opsin antisense (Millipore, AB5405,1,000. The RPE/choroid were plated and visualized using a fluorescence microscope (Eclipse 90i, nikon) at 100 Xmagnification. CNV sites were detected using Image J software (1.47v, NIH). The mean of 3-4 CNV sites per eyeball was analyzed. Each group consists of 9-10 eyeballs.
And (5) detecting the in vivo editing efficiency. One week after molding, the mouse eyeballs were taken and the tissue samples were washed with PBS. Retinal epithelial (RPE) cells were separated from the choroid/sclera by vortexing in lysis buffer (NucleoSpin Tissue, macherey-Nagel) for 30 seconds. Genomic DNA was extracted from a portion of RPE tissue for analysis of editing efficiency and in vivo off-target efficiency. Meanwhile, part of the sample tissue was lysed in 120. Mu.L of cell lysis buffer (CST # 9803), and the amount of Vegfa protein was measured using a mouse VEGF Quantikine ELISA kit (MMV 00, R & D Systems).
And (4) detecting the in vivo off-target effect. After injecting AAV into the mouse subretinal space for 6 weeks, the eyeball is separated, the cornea, the crystalline lens and the retina are removed, only RPE and choroid tissues are reserved, and the genome DNA is extracted. By predicting off target sites through CRISPOR software, we select sites of top12, take RPE genomic DNA as a template, specifically target deep sequencing, and analyze the off-target rate of each site.
And (6) analyzing the data. One-way ANOVA and Tukey post hoc tests were used.
3. And (5) detecting the in vivo editing efficiency.
In order to test the editing efficiency in mouse tissue retinal epithelial cells (RPEs), after three groups of mice (10 mice each and 20 eyes) injected with 3 AAV viruses in the sub-retinal space are cultured for 6 weeks, the eyes of each group of mice are taken, the RPE cells are stripped respectively, and genomic DNA is extracted to test the editing efficiency, and the results are shown in fig. 7, wherein the editing efficiency in the RPEs of CjCas9+ gRNA # 1, spCas9+ gRNA # 2 and SaCas9+ gRNA #5-2 groups is sequentially: 19%, 18% and 38%. Meanwhile, the result of measuring the amount of the Vegfa protein by ELISA is shown in FIG. 8, and it can be seen from the figure that the expression level of the Vegfa protein is reduced more obviously and is reduced by 40% after 6 weeks of mice injected with SacAS9+ gRNA #5-2 compared with cjCas9+ gRNA # 1 and SpCas9+ gRNA # 2 with low editing efficiency in vivo;
AAV of different combinations is injected into mouse eyeballs, laser treatment is carried out 6 weeks or 7 days later to induce a choroid neovascularization model, and then the CNV area is detected one week after laser treatment. Choroidal slides were prepared from four experimental mouse groups one week after molding, and after Isolectin-B4 staining, the CNV area was quantitatively counted, and the results are shown in fig. 9, in which the results show that three mice groups administered with the drug were reduced by 20%, 19%, and 39%, respectively, compared to the negative control.
4. And detecting the in vivo off-target effect.
The CRISPR/Cas9 gene editing system is used as a pharmaceutical tool, and the first problems to be solved urgently are off-target efficiency and in-vivo safety. We used techniques to detect off-target effects at the cellular level and the results showed that none of the three dosing groups CjCas9+ gRNA #1 (fig. 10), spCas9+ gRNA #2 (fig. 11) and SaCas9+ gRNA #5-2 (fig. 12) detected Cas 9-induced insertion deletions with a frequency greater than 0.1%, indicating that off-target mutations were not induced beyond the sequencing error rate. The mutation frequencies at each off-target site are shown in FIGS. 10-12.
5. Long-term safety testing in mice
Studies have shown that conditional knockdown of the Vegfa gene in RPE cells leads to cone dysfunction in the retina, and the present invention focuses on detecting the cause of toxic side effects in RPE cells caused by AAV-induced gene knockdown. We examined subretinal space at two time points 7 days and 6 weeks after AAV virus injection, dissected retina tissue and frozen sections were made, stained with opsin antibody, and the size of the opsin positive sites in the retina was measured microscopically. The results are shown in fig. 13A, and indicate that, 7 days after AAV injection, cjCas9-gRNA # 1 caused a certain reduction in the mouse retinal opsin region compared to the negative control, with the remaining two groups being less different from the control group.
However, after 6 weeks of AAV injection in mice, the opsin region size was reduced by 31% and 18% in CjCas9+ gRNA # 1 and SpCas9+ gRNA # 2 treated retinas compared to negative controls, respectively, as shown in fig. 13B. However, in the present invention, saCas9+ gRNA #5-2 did not induce cone dysfunction.
The results show that the SaCas9+ gRNA #5-2 has higher effectiveness and safety in mice.
According to the toxicity results of CjCas9+ gRNA # 1 and SpCas9+ gRNA # 2 after long-term expression in vivo, it is speculated that after the VEGFA gene is cleaved by induction of gRNA # 1, a new initiation site may be generated, so that the initiation site is translated into a new protein, and after long-term expression in vivo, normal dysfunction of retina is caused.
After VEGFA is cleaved by gRNA # 2 and gRNA #5-2, new amino acid chains of different lengths and different sequences may eventually be generated due to differences in cleavage pattern and cleavage sites. After gRNA # 2 edited the VEGFA gene in vivo, it is likely that a new mutant amino acid chain was generated in vivo, which affects the normal function and structure of the retina.
The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that various changes and modifications can be made by those skilled in the art without departing from the spirit of the invention, and these changes and modifications are all within the scope of the invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
Sequence listing
<110> Guangzhou Ruifeng Biotechnology, inc
<120> gRNA for targeted editing of VEGFA gene exon region and application thereof
<160> 93
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
agucgcgcug acggacagac ag 22
<210> 2
<211> 20
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 20
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
<210> 4
<211> 20
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
<210> 5
<211> 17
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
uccuggaaga uguccac 17
<210> 6
<211> 18
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
cuccuggaag auguccac 18
<210> 7
<211> 19
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
acuccuggaa gauguccac 19
<210> 8
<211> 20
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
<210> 9
<211> 21
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
guacuccugg aagaugucca c 21
<210> 10
<211> 22
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
gguacuccug gaagaugucc ac 22
<210> 11
<211> 23
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
ggguacuccu ggaagauguc cac 23
<210> 12
<211> 24
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
aggguacucc uggaagaugu ccac 24
<210> 13
<211> 20
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
<210> 14
<211> 17
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
ggaagccggg cucaugg 17
<210> 15
<211> 18
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
cggaagccgg gcucaugg 18
<210> 16
<211> 19
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
ucggaagccg ggcucaugg 19
<210> 17
<211> 20
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
<210> 18
<211> 21
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
gcucggaagc cgggcucaug g 21
<210> 19
<211> 22
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
cgcucggaag ccgggcucau gg 22
<210> 20
<211> 23
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
gcgcucggaa gccgggcuca ugg 23
<210> 21
<211> 24
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
ggcgcucgga agccgggcuc augg 24
<210> 22
<211> 17
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
agcccggcuu ccgagcg 17
<210> 23
<211> 20
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
<210> 24
<211> 24
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
guccaugagc ccggcuuccg agcg 24
<210> 25
<211> 17
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
gagcccgcgc ccggagg 17
<210> 26
<211> 18
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
ggagcccgcg cccggagg 18
<210> 27
<211> 19
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
cggagcccgc gcccggagg 19
<210> 28
<211> 20
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
<210> 29
<211> 21
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
gccggagccc gcgcccggag g 21
<210> 30
<211> 22
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
ggccggagcc cgcgcccgga gg 22
<210> 31
<211> 23
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 31
gggccggagc ccgcgcccgg agg 23
<210> 32
<211> 24
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 32
ggggccggag cccgcgcccg gagg 24
<210> 33
<211> 20
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 33
<210> 34
<211> 17
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 34
cugcaaugac gagggcc 17
<210> 35
<211> 18
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 35
gcugcaauga cgagggcc 18
<210> 36
<211> 19
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 36
ugcugcaaug acgagggcc 19
<210> 37
<211> 20
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 37
<210> 38
<211> 21
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 38
gcugcugcaa ugacgagggc c 21
<210> 39
<211> 22
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 39
ggcugcugca augacgaggg cc 22
<210> 40
<211> 23
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 40
gggcugcugc aaugacgagg gcc 23
<210> 41
<211> 24
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 41
ggggcugcug caaugacgag ggcc 24
<210> 42
<211> 20
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 42
<210> 43
<211> 20
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 43
<210> 44
<211> 20
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 44
<210> 45
<211> 17
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 45
ggagugugug cccacug 17
<210> 46
<211> 18
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 46
uggagugugu gcccacug 18
<210> 47
<211> 19
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 47
cuggagugug ugcccacug 19
<210> 48
<211> 20
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 48
<210> 49
<211> 21
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 49
gccuggagug ugugcccacu g 21
<210> 50
<211> 22
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 50
ggccuggagu gugugcccac ug 22
<210> 51
<211> 23
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 51
gggccuggag ugugugccca cug 23
<210> 52
<211> 24
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 52
agggccugga gugugugccc acug 24
<210> 53
<211> 23
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 53
cuuccaggag uacccugaug aga 23
<210> 54
<211> 20
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 54
<210> 55
<211> 71
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 55
guuuuagucc cugaagggac uaaaauaaag aguuugcggg acucugcggg guuacaaucc 60
ccuaaaaccg c 71
<210> 56
<211> 76
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 56
guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc cguuaucaac uugaaaaagu 60
ggcaccgagu cggugc 76
<210> 57
<211> 81
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 57
guuuuaguac ucuggaaaca gaaucuacua aaacaaggca aaaugccgug uuuaucucgu 60
caacuuguug gcgagauuuu u 81
<210> 58
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 58
<210> 59
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 59
<210> 60
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 60
<210> 61
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 61
<210> 62
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 62
<210> 63
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 63
<210> 64
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 64
<210> 65
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 65
<210> 66
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 66
<210> 67
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 67
<210> 68
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 68
<210> 69
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 69
<210> 70
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 70
<210> 71
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 71
<210> 72
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 72
<210> 73
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 73
<210> 74
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 74
<210> 75
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 75
<210> 76
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 76
<210> 77
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 77
ggcgagctac tcttcctccc c 21
<210> 78
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 78
<210> 79
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 79
<210> 80
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 80
<210> 81
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 81
<210> 82
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 82
<210> 83
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 83
<210> 84
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 84
<210> 85
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 85
agcagccccc gcatcgcatc 20
<210> 86
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 86
<210> 87
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 87
<210> 88
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 88
<210> 89
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 89
<210> 90
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 90
<210> 91
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 91
<210> 92
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 92
<210> 93
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 93
Claims (6)
1. A gRNA for targeted editing of an exon region of a VEGFA gene is characterized in that a gRNA sequence is targeted to destroy the exon region of the VEGFA gene, and a targeting structure domain sequence of the gRNA is a sequence shown in SEQ ID NO. 8.
2. A gRNA expression vector for targeted editing of an exon region of the VEGFA gene, comprising a nucleotide sequence encoding the gRNA of claim 1.
3. A composition for targeted editing of exon regions of the VEGFA gene, comprising: comprising a gRNA system comprising the gRNA of claim 1 and a Cas9 enzyme system comprising a Cas9 enzyme.
4. A cell modified with VEGFA gene, comprising contacting the cell with a composition according to claim 3 to modify the VEGFA gene.
5. A delivery system for delivering the composition of claim 3, said delivery system employing an AVV8 delivery system.
6. Use of a gRNA according to claim 1, a gRNA expression vector according to claim 2, a composition according to claim 3, a cell according to claim 4, a delivery system according to claim 5 in the manufacture of a medicament for the treatment of age-related macular degeneration disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110037499.3A CN112662674B (en) | 2021-01-12 | 2021-01-12 | gRNA for targeted editing of VEGFA gene exon region and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110037499.3A CN112662674B (en) | 2021-01-12 | 2021-01-12 | gRNA for targeted editing of VEGFA gene exon region and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112662674A CN112662674A (en) | 2021-04-16 |
| CN112662674B true CN112662674B (en) | 2023-04-11 |
Family
ID=75414395
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110037499.3A Active CN112662674B (en) | 2021-01-12 | 2021-01-12 | gRNA for targeted editing of VEGFA gene exon region and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112662674B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113583999A (en) * | 2021-07-06 | 2021-11-02 | 复旦大学 | Cas9 protein, gene editing system containing Cas9 protein and application |
| CN113862304B (en) * | 2021-09-09 | 2023-08-22 | 中国科学院海洋研究所 | CRISPR/Cas9 gene editing method for haliotis discus |
| CN115820728A (en) * | 2022-07-11 | 2023-03-21 | 上海贝斯昂科生物科技有限公司 | Gene editing method and application |
| WO2024088175A1 (en) * | 2022-10-26 | 2024-05-02 | 广州瑞风生物科技有限公司 | Gene editing system and use thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108351350A (en) * | 2015-08-25 | 2018-07-31 | 杜克大学 | The composition and method of type endonuclease improvement genome project specificity are instructed using RNA |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009045356A2 (en) * | 2007-09-28 | 2009-04-09 | Yale University | Microrna compositions in the treatment of vegf-mediated disorders |
| KR20230136697A (en) * | 2013-06-05 | 2023-09-26 | 듀크 유니버시티 | Rna-guided gene editing and gene regulation |
| KR101961332B1 (en) * | 2016-07-28 | 2019-03-22 | 기초과학연구원 | Pharmaceutical Composition for Treating or Preventing Eye Disease Comprising Cas9 Protein and Guide RNA |
| EP4012032A1 (en) * | 2016-08-19 | 2022-06-15 | Toolgen Incorporated | Artificially engineered angiogenesis regulatory system |
| CN106755049B (en) * | 2016-11-14 | 2020-04-21 | 西北农林科技大学 | Visual cell repair efficiency report system based on artificial nuclease and establishment method thereof |
| CN107245493B (en) * | 2017-03-24 | 2021-02-19 | 陕西师范大学 | Vector for expressing aptamer ribozyme modified sgRNA regulated and controlled by theophylline and application |
| CN112143701A (en) * | 2019-06-26 | 2020-12-29 | 中国科学院脑科学与智能技术卓越创新中心 | Method and reagent for inhibiting choroidal neovascularization based on RNA (ribonucleic acid) site-specific editing |
-
2021
- 2021-01-12 CN CN202110037499.3A patent/CN112662674B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108351350A (en) * | 2015-08-25 | 2018-07-31 | 杜克大学 | The composition and method of type endonuclease improvement genome project specificity are instructed using RNA |
Non-Patent Citations (1)
| Title |
|---|
| 遗传性红细胞增多症相关HIF2α基因点突变对人CD34+造血干祖细胞体外红系分化的影响;赵慧娟等;《中国细胞生物学学报》;20180824(第09期);第1479–1485页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112662674A (en) | 2021-04-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112662674B (en) | gRNA for targeted editing of VEGFA gene exon region and application thereof | |
| US20220135970A1 (en) | Crispr/cas-related methods and compositions for treating usher syndrome and retinitis pigmentosa | |
| EP4086346A1 (en) | Method for treating usher syndrome and composition thereof | |
| AU2017305404A1 (en) | Compositions and methods for treating CEP290 associated disease | |
| CN114846139A (en) | Method and composition for treating MPS IH based on LEAPER technology | |
| CN109844123A (en) | Through manned angiogenesis regulator control system | |
| US20230075045A1 (en) | Engineered crispr/cas13 system and uses thereof | |
| US20230038993A1 (en) | Compositions and methods for treating cep290-associated disease | |
| JP2024504608A (en) | Editing targeting RNA by leveraging endogenous ADAR using genetically engineered RNA | |
| CN115896107A (en) | Small interfering RNA for treating neovascular retinal disease and DNA tetrahedral complex thereof | |
| KR20040018356A (en) | Gene therapy with chimeric oligonucleotides delivered by a method comprising a step of iontophoresis | |
| WO2022062440A1 (en) | Grna targeting ctgf gene and use thereof | |
| US20230383275A1 (en) | Sgrna targeting aqp1 rna, and vector and use thereof | |
| US20200248204A1 (en) | Methods of treating genetic hearing loss | |
| JP2023527464A (en) | Biallelic k-gene knockout of SARM1 | |
| US20240024368A1 (en) | Compositions and methods for neuroprotection and/or neuroregeneration | |
| US11807850B2 (en) | Compositions and methods for modulating gene expression | |
| JP2022524434A (en) | Non-viral DNA vector and its use for expressing FVIII therapeutic agents | |
| JP2020528735A (en) | Genome editing system for repetitive elongation mutations | |
| CN113122580A (en) | Method and composition for treating MPS IH based on LEAPER technology | |
| WO2024088175A1 (en) | Gene editing system and use thereof | |
| WO2022052909A1 (en) | Methods for editing bcl11a gene in hematopoietic stem/progenitor cells | |
| WO2022166771A1 (en) | 3'utr construction method and application | |
| KR20240034143A (en) | Novel genomic safe harbor and the use thereof | |
| WO2023230167A1 (en) | Methods of treating, ameliorating and/or preventing polycystic kidney disease and polycystic liver disease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |