CN112143701A - Method and reagent for inhibiting choroidal neovascularization based on RNA (ribonucleic acid) site-specific editing - Google Patents

Abstract

The invention provides a method and a reagent for inhibiting choroidal neovascularization based on RNA (ribonucleic acid) site-specific editing. In the invention, the adeno-associated virus for delivering CasRx and gRNA aiming at vascular endothelial growth factor A (Vegfa) is constructed, so that the aims of efficiently and accurately knocking down Vegfa mRNA and inhibiting the formation and development of pathogenic Choroidal Neovascularization (CNV) are realized by utilizing the targeting inhibition of the CasRx and the gRNA. The virus obtained by the invention can continuously and effectively realize the down regulation of Vegfa mRNA, and has long action time and good stability.

Description

Method and reagent for inhibiting choroidal neovascularization based on RNA (ribonucleic acid) site-specific editing

Technical Field

The invention belongs to the technical field of gene modification, and particularly relates to a method and a reagent for inhibiting choroidal neovascularization based on an RNA (ribonucleic acid) fixed-point editing technology.

Background

Age-related macular degeneration (AMD), characterized by the development of Choroidal Neovascularization (CNV), is the leading cause of visual deterioration in adults over the Age of 50. In clinical manifestations, vision can be normal or severely reduced, chief complaints are often reading difficulty, and the reading is assisted by increasing the light intensity; the fundus is manifested as drusen, focal pigment hyperplasia, macular depigmentation, geographic atrophy, etc.

Angiogenic growth factor Vascular Endothelial Growth Factor A (VEGFA) plays a critical role therein. anti-VEGFA therapy with humanized antibodies has been used clinically to treat AMD by periodic injection of the antibody to maintain therapeutic effect. However, a disadvantage of such antibodies is also found clinically in that they are susceptible to degradation in vivo, resulting in a short period of effective action, requiring relatively frequent administration, e.g., once in 1 to several months depending on the condition. Frequent administration increases the cost of hospitalization on the one hand and also leads to reduced patient compliance on the other, which is known as a bottleneck limiting the widespread use of such drugs.

To alter this situation, attempts have also been made to develop more desirable drugs by targeting VEGFA as a regulatory target, regulating at the gene or protein level. However, drug research is more difficult given that choroidal neovascularization occurs in the eye, an organ that is highly susceptible to side effects or uncertain risk.

In conclusion, there is a need in the art for further development and research to obtain more effective drugs targeting VEGFA or its encoding genes.

Disclosure of Invention

The invention aims to provide an RNA targeting tool based on a CRISPR system, which can efficiently and specifically target VEGFA gene, realize the inhibition of choroidal neovascularization and achieve the purpose of preventing and treating macular degeneration.

In a first aspect of the present invention, there is provided a method for targeted inhibition of vascular endothelial growth factor a in a cell, comprising: and delivering CasRx and gRNA aiming at the vascular endothelial growth factor A into the cells by the adeno-associated virus so as to inhibit the vascular endothelial growth factor A in the cells in a targeted way.

In a preferred embodiment, the expression cassette of CasRx further comprises a nuclear localization signal sequence at both ends of the CasRx-encoding gene.

In another preferred example, the expression cassette of CasRx uses EFS, CMV, CAG, CBH or EF1a as a promoter to drive the expression of CasRx; preferably, EFS is used as the promoter.

In another preferred embodiment, the expression cassette of CasRx comprises the following operably linked sequence elements: a promoter sequence, a nuclear localization signal 1 sequence, a CasRx-encoding nucleic acid sequence, a nuclear localization signal 2 sequence; preferably, the promoter sequence also comprises a 5 'terminal inverted repeat sequence at the 5' end; preferably, 3' of the nuclear localization signal 2 sequence, the PolyA sequence is also included.

In another preferred example, U6 is used as a promoter in an expression cassette for grnas of vascular endothelial growth factor a to drive expression of the grnas.

In another preferred example, the expression cassette for gRNA against vascular endothelial growth factor a includes the following operably linked sequence elements: the U6 promoter, gRNA for vascular endothelial growth factor a; preferably, a3 'terminal inverted repeat sequence is also included at the 3' end of the gRNA.

In another preferred embodiment, the CasRx has a polypeptide sequence (including its functionally equivalent variants or fragments) encoded by the nucleotide sequence 1699-4596 of SEQ ID NO. 1 or a degenerate sequence thereof.

In another preferred example, the gRNA for VEGF A targets a segment of the sequence shown in SEQ ID NO 9(AGACCCTGGTGGACATCTTCCAGGAGTACC) or SEQ ID NO 10(CACATAGGAGAGATGAGCTTCCTACAGCAC) of VEGF A.

In another preferred embodiment, the coding sequence for CasRx and the gRNA for vascular endothelial growth factor a are assembled in one adeno-associated viral vector.

In another preferred embodiment, the vector of the adeno-associated virus comprises the nucleotide sequence shown in SEQ ID NO. 4.

In another preferred embodiment, the expression cassette of CasRx includes the nucleotide sequence shown in SEQ ID NO. 1.

In another preferred example, the expression cassette of the gRNA includes the nucleotide sequence shown by SEQ ID NO. 2 and/or the nucleotide sequence shown by SEQ ID NO. 2.

In another preferred embodiment, the method for targeted inhibition of vascular endothelial growth factor a expression in a cell is a non-therapeutic method.

In another aspect of the present invention, there is provided a recombinant vector expressing CasRx and a gRNA for vascular endothelial growth factor a, the recombinant vector being an adeno-associated viral vector comprising an expression cassette for CasRx and an expression cassette for a gRNA for vascular endothelial growth factor a.

In a preferred embodiment, the expression cassette of CasRx further comprises a nuclear localization signal sequence at both ends of the CasRx encoding gene; and/or EFS, CMV, CAG, CBH or EF1a as promoters to drive the expression of CasRx; more preferably, the expression cassette comprises the following operably linked sequence elements: a promoter sequence, a nuclear localization signal 1 sequence, a CasRx-encoding nucleic acid sequence, a nuclear localization signal 2 sequence; preferably, the promoter sequence also comprises a 5 'terminal inverted repeat sequence at the 5' end; preferably, 3' of the nuclear localization signal 2 sequence, the PolyA sequence is also included.

In another preferred example, in the expression cassette of the gRNA aiming at the vascular endothelial growth factor A, U6 is used as a promoter to drive the expression of the gRNA; more preferably, the expression cassette comprises the following operably linked sequence elements: the U6 promoter, gRNA for vascular endothelial growth factor a; preferably, a3 'terminal inverted repeat sequence is also included at the 3' end of the gRNA.

In another preferred embodiment, the CasRx has a polypeptide sequence (including its functionally equivalent variants or fragments) encoded by the nucleotide sequence 1699-4596 of SEQ ID NO. 1 or a degenerate sequence thereof.

In another preferred example, the gRNA for VEGF A targets a segment of the sequence shown as SEQ ID NO 9 or SEQ ID NO 10 in VEGF A.

In another preferred example, the coding sequence for CasRx and the gRNA for vascular endothelial growth factor a are assembled in one adeno-associated viral vector; more preferably, the vector of the adeno-associated virus comprises the nucleotide sequence shown in SEQ ID NO. 4.

In another aspect of the present invention, there is provided a use of the recombinant vector of any one of the preceding claims for packaging a recombinant virus, which is a recombinant adeno-associated virus.

In another aspect of the present invention, there is provided a recombinant virus, wherein the virus is an adeno-associated virus, and is packaged by the recombinant vector.

In a preferred embodiment, the recombinant virus is used for preparing an agent for targeted inhibition of intracellular vascular endothelial growth factor A.

In another preferred embodiment, the recombinant virus is used for preparing a medicament or a composition for inhibiting choroidal neovascularization.

In another preferred embodiment, the recombinant virus is used for preparing a medicament or composition for relieving or treating macular degeneration (such as age-related macular degeneration).

In another aspect of the invention, there is provided a kit or kit comprising: said recombinant virus or said recombinant vector.

Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.

Drawings

Fig. 1, using CasRx to knock down Vegfa.

(a) Schematic representation of the site of interest. The CasRx targeting site is conserved in the human and mouse Vegfa genes.

(b, c) transient transfection of AAV vectors can effectively knock down Vegfa (N-3 repeats, p-0.012, T-4.389) in human 293T (N-6 repeats, p <0.001, T-6.396) and mouse N2a cells.

(d) VEGFA protein levels in cells were detected by ELISA assay (n ═ 6 replicates, p <0.001, t ═ 9.675).

All values are expressed as mean ± s.e.m; p <0.05, p <0.01, p <0.001, unpaired t-test.

Figure 2, AAV-mediated CasRx delivery, reduced the area of CNV in AMD mouse models.

(a) Schematic representation of the integration of AAV vectors and experimental procedures. AAV-CasRx-Vegfa was injected intravitreally into one eye and PBS was injected into the other eye as a control 21 days prior to laser burns. Transcription levels of Vegfa mRNA were analyzed 3 weeks after AAV infection in the absence of laser burns. VEGFA protein levels were quantified by ELISA 3 days after laser burns. CasRx and Vegfa mRNA levels jm and CNV area were measured 7 days after laser burns.

(b) Vegfa mRNA levels without laser burns 21 days after AAV injection (n-6 mice, p-0.002, t-4.059).

(c, d) CasRx and Vegfa mRNA levels 7 days after laser burn (CasRx mRNA: n-3 mice; Vegfa mRNA: n-3 mice, p-0.002, t-7.583).

(e) VEGFA protein levels 3 days after CNV induction (n-5 mice, p-0.019, t-2.928).

(f) Representative CNV images injected 7 days after laser burn with PBS or AAV-CasRx-Vegfa. The area of the CNV is indicated by the yellow line. Scale bar: 200 μm.

(g) A CNV region. The data points represent laser burns, and a total of 4 laser burns were induced in each eye. (180mW, n ═ 6 mice, p ═ 0.004, t ═ 3.079; 240mW, n ═ 4 mice, p ═ 0.002, t ═ 3.39).

All values are expressed as mean ± s.e.m; p <0.05, p <0.01, p <0.001, unpaired t-test.

Detailed Description

Through intensive research, the inventor constructs adeno-associated virus for delivering CasRx and gRNA aiming at vascular endothelial growth factor A (Vegfa), realizes the efficient and accurate knockdown of Vegfa mRNA and the inhibition of the formation and the development of pathogenic Choroidal Neovascularization (CNV) by utilizing the targeting inhibition of the CasRx and the gRNA. The virus obtained by the invention can continuously and effectively realize the down regulation of Vegfa mRNA, and has long action time and good stability.

As used herein, the term "element" refers to a series of functional nucleic acid sequences useful for the expression of a protein, and in the present invention, is systematically constructed to form an expression construct. The sequence of the "element" may be those provided in the present invention, and also includes variants thereof, as long as the variants substantially retain the function of the "element", which are obtained by inserting or deleting some bases (e.g., 1 to 50 bp; preferably 1 to 30bp, more preferably 1 to 20bp, still more preferably 1 to 10bp), or by random or site-directed mutagenesis, or the like.

As used herein, the term "operably linked" or "operably linked" refers to a functional spatial arrangement of two or more nucleic acid regions or nucleic acid sequences. For example: the promoter region is placed in a specific position relative to the nucleic acid sequence of the gene of interest such that transcription of the nucleic acid sequence is directed by the promoter region, whereby the promoter region is "operably linked" to the nucleic acid sequence.

As used herein, the term "expression cassette" refers to a gene expression system comprising all the necessary elements required for expression of a gene of interest, typically comprising the following elements: promoter, target gene sequence, terminator; in addition, a signal peptide coding sequence and the like can be optionally included. These elements are operatively connected.

As used herein, the term "construct" refers to a single-or double-stranded DNA molecule that has been artificially manipulated to contain DNA segments combined and arranged according to sequences not found in nature. The "construct" includes an expression vector; alternatively, the "construct" is included in an expression vector as part of the expression vector.

As used herein, the "gRNA target" refers to a region of interest in the Vegfa mRNA of interest in the present invention that is suitable for gene editing operations.

The present inventors have focused on studies on inhibition of choroidal neovascularization, and in the course of earlier studies, it was considered that in an AMD animal model, permanent Vegfa gene disruption was induced by editing, e.g. spCas 9; however, since this editing is targeted at the DNA level, the risks associated with permanent DNA modification, including unwanted off-target and targeting effects, cannot be avoided; furthermore, the inventors have found that Cas9 is difficult to package into AAV viruses and the editing efficiency is not ideal. After extensive and intensive research, the inventor improves the previous scheme, uses AAV to deliver CasRx and gRNA aiming at Vegfa, can efficiently and accurately knock down Vegfa mRNA and inhibit the formation and development of pathogenic Choroidal Neovascularization (CNV). One of the differences between the present solution and other gene editing solutions is that the present invention addresses the mRNA inhibition of Vegfa, rather than DNA or protein, which avoids the risks associated with permanent DNA modification.

Adeno-associated virus (AAV) is a virus that is incapable of self-replication and has low immunogenicity. However, AAV viral vector loading capacity is limited, which limits its use. There are relatively few examples in the art that can be successfully transfected with AAV viruses.

AAV vector is one kind of artificially transgenic AAV produced through gene engineering with some naturally occurring adeno-associated virus characteristics. In a preferred embodiment of the invention, the AAV vector is optimally constructed.

According to the invention, a gRNA target point suitable for targeted operation is provided for Vegfa gene, so that the efficient and accurate targeted inhibition effect on Vegfa can be realized, and no off-target effect or other adverse side effects exist.

As a preferred embodiment of the present invention, there is provided an expression cassette for expressing CasRx comprising the following operably linked sequence elements: a promoter, a nuclear localization signal 1 sequence, a CasRx-encoding nucleic acid sequence, a nuclear localization signal 2 sequence; preferably, the promoter sequence also comprises a 5 'terminal inverted repeat sequence at the 5' end; preferably, 3' of the nuclear localization signal 2 sequence, the PolyA sequence is also included. The promoter may be CMV, CAG, CBH, EF1a, EFS, etc. In a more preferred embodiment, the promoter is an EFS promoter, and the present inventors have found that when it is used in the present invention, it is preferable not only for the sequence to be short but also for the activity to drive gene expression, and it is also possible to selectively drive CasRx expression.

As a preferred embodiment of the present invention, there is provided an expression cassette for expression of gRNA for Vegfa comprising the following operably linked sequence elements: a promoter, a gRNA for vascular endothelial growth factor A; preferably, a3 'terminal inverted repeat sequence is also included at the 3' end of the gRNA. In a preferred mode, the promoter is a U6 promoter.

As a preferred mode of the invention, after the simplified SV40PolyA is connected with the expression frame, the target packaging system can be ensured to be reduced to the minimum range, the packaging difficulty of the virus is effectively reduced, and the packaging efficiency of AAV is improved.

In a preferred embodiment of the present invention, the use of a series of guide-1 and guide-2 is effective in improving the editing efficiency.

In a preferred embodiment of the invention, the expression cassette for CasRx expression and the expression cassette for gRNA against Vegfa are placed in the same AAV expression vector for viral packaging. The optimized design of the inventor overcomes the problem of low AAV packaging capacity, successfully and organically integrates two groups of expression cassettes into one expression vector, is favorable for simplifying subsequent operation flow, and has simple and easy-to-operate administration scheme.

Variations of the above elements that have been suitably varied in accordance with the information provided for the various elements of the invention, while still retaining their original function, are also encompassed by the invention. For example, a sequence variant that hybridizes under stringent conditions to a sequence defined in the present invention and has the same function. As used herein, the term "stringent conditions" refers to: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2 XSSC, 0.1% SDS, 60 ℃; or (2) adding denaturant during hybridization, such as 50% (v/v) formamide, 0.1% calf serum/0.1% Ficoll, 42 deg.C, etc.; or (3) hybridization occurs only when the homology between two sequences is at least 70% or more, more preferably 75% or more, 80% or more, 85% or more, or 90% or more, and more preferably 95% or more. For example, the sequence may also be the complement of these defined sequences.

The full-length nucleotide sequence of the gene to which each element of the present invention is directed or a fragment thereof can be obtained by a PCR amplification method, a recombinant method or an artificial synthesis method. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and the sequences can be amplified using commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art as templates.

The vector may also include restriction sites at positions upstream and downstream of the elements, to facilitate organic ligation of the elements.

Methods well known to those skilled in the art can be used to construct the expression vectors required by the present invention. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. Furthermore, the expression vector preferably comprises one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells.

Vectors comprising the appropriate polynucleotide sequences described above, together with appropriate promoter or control sequences, may be used to package viruses.

In the specific embodiment of the invention, the packaged AAV expressing CasRx and gRNA is injected into animal model eyes intravitreally, so that the area of CNV is successfully reduced in the animal eyes, and the effect is particularly obvious and serious.

The invention also provides a composition (e.g., a pharmaceutical composition) comprising an effective amount (e.g., 0.000001-50 wt%, preferably 0.00001-20 wt%, more preferably 0.0001-10 wt%) of the adeno-associated virus packaged according to the invention, and a pharmaceutically acceptable carrier.

As used herein, the term "effective amount" or "effective dose" refers to an amount that produces a function or activity in a human and/or animal and is acceptable to the human and/or animal as used herein. As used herein, a "pharmaceutically acceptable" component is one that is suitable for use in humans and/or mammals without undue adverse side effects (such as toxicity, irritation, and allergic response), i.e., at a reasonable benefit/risk ratio. The term "pharmaceutically acceptable carrier" refers to a carrier for administration of a therapeutic agent, including various excipients and diluents.

Typically, the adenovirus will be formulated in a non-toxic, inert and pharmaceutically acceptable aqueous carrier medium, typically having a pH of about 5 to about 8, preferably a pH of about 6 to about 8.

The pharmaceutical composition of the present invention can be prepared in the form of an injection, for example, by a conventional method using physiological saline or an aqueous solution containing glucose and other adjuvants. The amount of active ingredient (adenovirus) administered is a therapeutically effective amount and is within the skill of the skilled practitioner.

In use, the adeno-associated virus can be administered systemically, or locally. In the present invention, topical administration, in particular intravitreal injection, is preferred.

The invention also provides an expression vector containing the expression cassette for expressing CasRx and the expression cassette for expressing gRNA aiming at Vegfa or a kit/medicine box of virus packaged by the vector.

Other reagents commonly used for viral packaging, transfection, injection, etc. may also be included in the kit/kit for ease of use by those skilled in the art. In addition, the kit may further comprise instructions for use to instruct a person skilled in the art to perform the method.

The technical scheme of the invention proves the feasibility of the RNA targeting CRISPR system for in vivo gene therapy, and provides an effective and accurate novel therapeutic tool for choroidal neovascularization and macular degeneration (such as age-related macular degeneration) caused by high VEGFA expression clinically.

The current therapeutic scheme for choroidal neovascularization is treatment by monoclonal antibodies or inhibitors and the like, and has the characteristic of short duration. In the invention, AAV is used for carrying a high-efficiency and accurate RNA editing tool for targeting VEGFA for the first time, and the therapeutic effect can be achieved for years.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not noted in the following examples, are generally performed according to conventional conditions such as those described in J. SammBruk et al, molecular cloning protocols, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.

Materials and methods

Moral compliance

Animal use and care were in accordance with the guidelines of the ethical committee on biomedical research at the neuroscience research institute of the chinese academy of sciences.

gRNA sequence:

gRNA-1：5’-gtgctgtaggaagctctctctcctatgtg-3’；

gRNA-2：5’-ggtactcctggaagatgtccaccagggtct-3’。

plasmid construction

(1) Construction of CasRx plasmid

pcDNA3.1 is used as a skeleton plasmid, a multiple cloning site and a CAG promoter are added into the skeleton plasmid to obtain a pCAG-EGFP plasmid, and then SV40NLS1, CasRx, SV40NLS2, P2A, GFP, WPRE and BGH PolyA elements are cloned into the pCAG-SV40NLS1-CasRx-SV40NLS2-P2A-GFP-WPRE-PolyA plasmid. The sequence was optimized by codon, and was subjected to gene synthesis by Wajin organism Co.Ltd.

The coding sequence of each element is:

1 st to 1648 th sites in SEQ ID NO. 1 are pCAG promoter sequences;

SV40NLS 1: the 1669-1689 bit sequence in SEQ ID NO: 1;

CasRx: 1, sequences 1699-4596 in SEQ ID NO;

SV40NLS 2: the 4612 th to 4632 th bit sequences in SEQ ID NO 1;

P2A: the 4639 th to 4695 th bit sequences in SEQ ID NO 1;

GFP: sequence 4702-5421 of SEQ ID NO. 1;

WPRE: sequence 5433-6021 in SEQ ID NO: 1;

PolyA: the 6042-6249 bit sequence of SEQ ID NO. 1.

The nucleotide sequence of pCAG-SV40NLS1-CasRx-SV40NLS2-P2A-GFP-WPRE-PolyA is shown in SEQ ID NO: 1.

(2) Construction of gRNA-1 plasmid

A U6-gRNA plasmid is obtained through gene synthesis, and sequentially comprises U6, DR1, guide1, DR2, a CMV promoter (pCMV), mCherry, WPRE and polyA elements, so that the U6-DR1-guide1-DR2-pCMV-mCherry-WPRE-polyA plasmid is obtained. The coding sequence of each element is:

u6: the 1 st to 241 st bit sequence of SEQ ID NO 2;

DR 1: sequence 257-282 of SEQ ID NO 2;

guide 1: sequence 287-316 of SEQ ID NO 2;

DR 2: sequence 323-359 of SEQ ID NO 2;

pCMV: the 365 th-872 th bit sequence of SEQ ID NO 2;

mCherry: the 906 th to 1616 th bit sequences in SEQ ID NO 2;

WPRE: the 1617 th-2204 th bit sequence in SEQ ID NO 2;

PolyA: sequence 2246-2471 of SEQ ID NO. 2.

The nucleotide sequence of U6-DR1-guide1-DR2-pCMV-mCherry-WPRE-polyA is shown in SEQ ID NO. 2. Among them, DR1, DR2 serve as a guide CasRx to target the target RNA.

(3) Construction of gRNA-2 plasmid

A U6-gRNA plasmid is obtained through gene synthesis, and sequentially comprises U6, DR1, guide2, DR2, a CMV promoter (pCMV), mCherry, WPRE and polyA elements, so that the U6-DR1-guide2-DR2-pCMV-mCherry-WPRE-polyA plasmid is obtained. The coding sequence of each element is:

u6: the 1 st to 241 st bit sequence of SEQ ID NO. 3;

DR 1: sequence 257-282 of SEQ ID NO 3;

guide 2: sequence 287-316 of SEQ ID NO 3;

DR 2: sequence 323-359 of SEQ ID NO 3;

pCMV: 3, sequence 365-872 of SEQ ID NO;

mCherry: the 906 th to 1616 th bit sequences in SEQ ID NO 3;

WPRE: the 1617 th-2204 th bit sequence in SEQ ID NO. 3;

PolyA: sequence 2246-2471 of SEQ ID NO 3.

The nucleotide sequence of the U6-DR1-guide2-DR2-pCMV-mCherry-WPRE-polyA plasmid is shown in SEQ ID NO. 3. Among them, DR1, DR2 serve as a guide CasRx to target the target RNA.

(4) Construction of U6-gRNA-pCMV-mCherry-PolyA plasmid

The elements of DR1-guide2-DR2 were obtained from the aforementioned U6-DR1-guide2-DR 2-pCMV-mChery-WPRE-polyA plasmid, and inserted before the pCMV elements of U6-DR1-guide1-DR 2-pCMV-mChery-WPRE-polyA plasmid to obtain U6-gRNA-pCMV-mChery-polyA plasmid.

(5) Construction of AAV-CasRx-Vegfa plasmid

ITR-EFS-SV40NLS1-CasRx-HA-SV40NLS2-SV40PolyA-U6-DR1-guide1-DR2-guide2-DR3-ITR plasmid was obtained by cloning ITR, EFS, SV40NLS1, CasRx, HA, SV40NLS2, SV40PolyA, U6, DR1, guide1, DR2, guide2, DR3, ITR elements in this order using AAV plasmid (#60231) purchased from Addgene. The coding sequence of each element is:

ITR: the sequence 1 to 130 of SEQ ID NO 4;

EFS: the sequence of 143 to 398 bits of SEQ ID NO 4;

SV40NLS 1: the 414 th to 434 th bit sequences in SEQ ID NO 4;

CasRx: the 444 th to 3341 th bit sequences in SEQ ID NO 4;

HA: sequence 3351 to 3377 of SEQ ID NO. 4;

SV40NLS 2: sequence 3378-3398 of SEQ ID NO. 4;

SV40 PolyA: sequence 3414 to 3548 of SEQ ID NO. 4;

u6: the 3555-3795 bit sequence of SEQ ID NO. 4;

DR 1: 4, sequences 3805-3834 in SEQ ID NO;

guide 1: the 3835-3864 bit sequence in SEQ ID NO 4;

DR 2: the 3865-3900 bit sequence in SEQ ID NO. 4;

guide 2: the 3901 st to 3930 th bit sequences in SEQ ID NO. 4;

DR 3: the 3931-3973 sequence of SEQ ID NO. 4;

ITR: the sequence 3998-4138 of SEQ ID NO. 4.

The nucleotide sequence of ITR-EFS-SV40NLS1-CasRx-HA-SV40NLS2-SV40PolyA-U6-DR1-guide1-DR2-guide2-DR3-ITR plasmid is shown in SEQ ID NO. 4.

Transient transfection and qPCR

Transient transfection of plasmids was performed. 293T and N2a cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM) containing 10% Fetal Bovine Serum (FBS) and penicillin/streptomycin and maintained at 37 ℃ with 5% CO 2. Cells were seeded in 6-well plates and transfected with 4 μ g/well vector expressing CasRx and gRNA (CasRx: gRNA-1: gRNA-2: 1: 1, see supplementary sequences) using Lipofectamine 3000 reagent (Thermo Fisher Scientific).

Control groups were transfected with 2. mu.g/well vector containing CasRx only. GFP + mCherry + cells (GFP + cells of control group) were isolated 3 days post transfection using flow cytometry. Total RNA was first purified using trizol (ambion) and then transcribed into complementary DNA (HiScript Q RT SuperMix for qPCR, Vazyme, Biotech). The qPCR reaction was followed by a SYBR Green probe (AceQ qPCR SYBR Green Master Mix, Vazyme, Biotech).

VEGFA qPCR primers:

forward direction: 5'-GGTGGACATCTTCCAGGAGT-3' (SEQ ID NO: 5);

and (3) reversing: 5'-TGATCTGCATGGTAGATGTTG-3' (SEQ ID NO: 6).

CasRx qPCR primers:

forward direction: 5'-CCCTGGTGTCCGGCTCTAA-3' (SEQ ID NO: 7);

and (3) reversing: 5'-GGACTCGCCGAAGTACCTCT-3' (SEQ ID NO: 8).

AAV production and intravitreal injection

AAV-CasRx-Vegfa (AAV-PHP. eb capsid) [ Chan, K.Y.et al.Engineered AAVs for infection non-toxic gene delivery to the central and peripheral nervous systems 20, 1172. sup. 1179, doi:10.1038/nn.4593(2017) was packaged by transfecting HEK293T cells with Polyethyleneimine (PEI) (50. mu.g/ml)]. The virus was harvested, purified and concentrated 3-7 days after three transfections. Mice 6-8 weeks old (C57BL/6) were anesthetized for intravitreal injection. In an Olympus displayAAV-CasRx-Vegfa (7.5X 10 in 1. mu.l) was injected intravitreally using a Hamilton syringe with a 34G needle under a micromirror (Olympus, Tokyo, Japan)⁹Individual viral genomes) or PBS intravitreal injection. Mice with retinal hemorrhages were excluded.

Laser-induced CNV model and CNV staining

Mice were used for Laser burns 2-3 weeks after AAV injection, inducing the CNV Model [ Gong, Y.et al. optimization of an Image-Guided Laser-Induced Choroidal neovacuation Model in Mice. Ploss One 10, doi: ARTN e013264310.1371/journal. po. 0132643(2015) ]. Briefly, mice were anesthetized and pupils were dilated with dilating eye drops to dilate pupil size. Laser photocoagulation was performed using NOVUS Spectra (LUMENIS). The laser parameters used in the present invention are: 532nm wavelength, 70ms exposure time, 180mW or 240mW power and 50 μm spot size. 4 laser burns around the optic disc were induced (30 laser burns for ELISA). Mice with vitreous hemorrhage were excluded from the study. After 3 days of laser induction, mice were perfused with saline and RPE complexes dissociated for ELISA analysis (qPCR 7 days after laser burn). CNV analysis was performed 7 days after laser burn. Mice were perfused with PFA and eyes were then fixed with PFA for 2 hours. The retina was removed from the eye and the RPE/choroid/sclera complex was stained with isolectin-B4 (IB4, 10 μ g/ml, I21413, Life Technologies) alone overnight. The RPE complexes were laid flat and observed with a confocal microscope (VS120 Olympus). Only eyes with successful AAV-CasRx-Vegfa infection were included for quantification. After obtaining the CNV image, DNA was extracted from the RPE complex and the copy number of CasRx was evaluated by qPCR. The area of CNV was quantified by blind observers using ImageJ software.

ELISA

RPE complexes were collected for ELISA. To perform VEGFA ELISA, 30 laser burns were induced in each eye 3 weeks after AAV injection. Eyes were enucleated 3 days after induction, RPE complexes were dissociated from retinas and lysed with RPA. VEGFA protein levels were determined using Quantikine ELISA kit (MMV00, R & D SYSTEMS) according to standard protocols.

Statistical analysis

All values are expressed as mean ± s.e.m. Statistical significance (p <0.05) was determined by unpaired two-tailed student t-test.

Example 1 Targeted Down-Regulation of VEGFA sites and Effect

Through selection and testing, CasRx targeting sites suitable for targeting manipulations of the present invention are identified. And, the targeting site is a CasRx targeting site conserved in human and mouse Vegfa genes. The present inventors designed two guide RNAs (guide RNA, gRNA) for these two sites, respectively (fig. 1a), to achieve effective Vegfa mRNA knockdown.

The effectiveness of the targeting procedure of the present invention was investigated with human 293T cells and mouse N2a cells. First, mRNA level was investigated, and pCAG-SV40NLS1-CasRx-SV40NLS2-P2A-GFP-WPRE-PolyA plasmid and U6-gRNA-pCMV-mCherry-PolyA plasmid constructed as described above were cotransfected transiently into human 293T cells or mouse N2a cells.

As a result, the present inventors found that transient transfection of vectors expressing CasRx and gRNA resulted in a significant reduction in Vegfa mRNA levels in cultured human 293T cells (36 +/-4%, sem) and mouse N2a cells (31 +/-9%, sem) compared to cells transfected with control vectors (FIG. 1b, c).

Protein level studies were performed and showed that VEGFA protein levels were also significantly reduced in mouse N2a cells (fig. 1 d).

Example 2 adeno-associated Virus (AAV) -mediated CasRx delivery reduces the area of CNV

To investigate the knockdown efficiency of CasRx in normal mouse retinas, the inventors injected AAV encoding CasRx and a double gRNA array targeting Vegfa (called AAV-CasRx-Vegfa) intravitreally in the mouse eyes and observed its effect on CNV area. The AAV-CasRx-Vegfa recombinant plasmid is constructed as shown in the left panel of FIG. 2a, and the injection and detection procedures are shown in the right panel of FIG. 2 a.

At 3 weeks post-injection, choroidal-Retinal Pigment Epithelium (RPE) tissue complexes were isolated for qPCR analysis (fig. 2 a). The inventors found that Vegfa transcripts were effectively inhibited in the treated eyes compared to the contralateral eyes injected with PBS (figure 2 b).

The inventors next created AMD mice by inducing CNV in both eyes by laser irradiation. To investigate the potential use of mRNA knock-down approach to AMD treatment, we injected AAV-CasRx-Vegfa into one eye of mice and PBS in the other eye as a control (fig. 2 a). CNV induction was performed in both eyes after 3 weeks. After laser burns, the inventors demonstrated successful infection of AAV-CasRx-Vegfa (FIG. 2 c). Furthermore, the inventors found that the levels of Vegfa mRNA and Vegfa protein in eyes injected with AAV were significantly lower than those in eyes injected with contralateral PBS (mRNA, 22.7 +/-1.8% sem, p ═ 0.002; protein, 68.2 +/-8.7%, sem, p ═ 0.019; unpaired t-test) (fig. 2 d-e). Thus, intravitreal injection of Vegfa mRNA targeting AAV is effective for Vegfa expression in the injected eye.

The therapeutic effect of the CasRx method was evaluated by quantifying the CNV area 7 days after laser treatment. The results of the present inventors show that Vegfa-targeted AAV significantly reduced the CNV area for two different laser irradiation levels compared to control eyes injected with PBS. Under the condition that the laser parameter is 180mW power, the area of CNV of the CasRx group is 66+/-7.8 percent of that of the CNV of the PBS group, sem, n is 6 mice, and p is 0.004; in the case of laser parameters of 240mW power, the CasRx group was only 36.5 +/-6.9% of CNV area of the PBS group, sem, n-4 mice, p-0.002 (unpaired t-test).

Meanwhile, the inventor carries out stage observation aiming at the transfected animal model, and does not observe side effects caused by off-target effect and other visible side effects.

In summary, the present inventors' results indicate that AAV-mediated CasRx delivery can efficiently and accurately knock down Vegfa mRNA and inhibit pathogenic CNV development in AMD mouse models, supporting the idea that RNA-targeting CRISPR systems can be used for therapeutic purposes. CasRx is suitable for containing multiple grnas in a single AAV vector for in vivo delivery.

AAV-provided CasRx has the potential to have a sustained corrective effect on protein expression for up to 2 years in a single injection. This allows the risk associated with mRNA editing to be significantly lower than that of DNA editing because of the large number of transcripts, many of which may maintain normal function.

Therefore, the CasRx knockdown approach can complement existing therapeutic strategies such as monoclonal antibodies, antisense oligonucleotides and DNA nuclease editing.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Shanghai Life science research institute of Chinese academy of sciences

<120> method and agent for inhibiting choroidal neovascularization based on RNA site-directed editing

<130> 193861

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 6249

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(6249)

<223> CasRx plasmid pCAG-SV40 NLS-CasRx-SV40 NLS-P2A-GFP-WPRE-PolyA

<400> 1

ataacttacg gtaaatggcc cgcctggctg accgcccaac gacccccgcc cattgacgtc 60

aataatgacg tatgttccca tagtaacgcc aatagggact ttccattgac gtcaatgggt 120

ggagtattta cggtaaactg cccacttggc agtacatcaa gtgtatcata tgccaagtac 180

gccccctatt gacgtcaatg acggtaaatg gcccgcctgg cattatgccc agtacatgac 240

cttatgggac tttcctactt ggcagtacat ctacgtatta gtcatcgcta ttaccatggt 300

cgaggtgagc cccacgttct gcttcactct ccccatctcc cccccctccc cacccccaat 360

tttgtattta tttatttttt aattattttg tgcagcgatg ggggcggggg gggggggggg 420

gcgcgcgcca ggcggggcgg ggcggggcga ggggcggggc ggggcgaggc ggagaggtgc 480

ggcggcagcc aatcagagcg gcgcgctccg aaagtttcct tttatggcga ggcggcggcg 540

gcggcggccc tataaaaagc gaagcgcgcg gcgggcgggg agtcgctgcg acgctgcctt 600

cgccccgtgc cccgctccgc cgccgcctcg cgccgcccgc cccggctctg actgaccgcg 660

ttactcccac aggtgagcgg gcgggacggc ccttctcctc cgggctgtaa ttagcgcttg 720

gtttaatgac ggcttgtttc ttttctgtgg ctgcgtgaaa gccttgaggg gctccgggag 780

ggccctttgt gcggggggag cggctcgggg ggtgcgtgcg tgtgtgtgtg cgtggggagc 840

gccgcgtgcg gctccgcgct gcccggcggc tgtgagcgct gcgggcgcgg cgcggggctt 900

tgtgcgctcc gcagtgtgcg cgaggggagc gcggccgggg gcggtgcccc gcggtgcggg 960

gggggctgcg aggggaacaa aggctgcgtg cggggtgtgt gcgtgggggg gtgagcaggg 1020

ggtgtgggcg cgtcggtcgg gctgcaaccc cccctgcacc cccctccccg agttgctgag 1080

cacggcccgg cttcgggtgc ggggctccgt acggggcgtg gcgcggggct cgccgtgccg 1140

ggcggggggt ggcggcaggt gggggtgccg ggcggggcgg ggccgcctcg ggccggggag 1200

ggctcggggg aggggcgcgg cggcccccgg agcgccggcg gctgtcgagg cgcggcgagc 1260

cgcagccatt gccttttatg gtaatcgtgc gagagggcgc agggacttcc tttgtcccaa 1320

atctgtgcgg agccgaaatc tgggaggcgc cgccgcaccc cctctagcgg gcgcggggcg 1380

aagcggtgcg gcgccggcag gaaggaaatg ggcggggagg gccttcgtgc gtcgccgcgc 1440

cgccgtcccc ttctccctct ccagcctcgg ggctgtccgc ggggggacgg ctgccttcgg 1500

gggggacggg gcagggcggg gttcggcttc tggcgtgtga ccggcggctc tagagcctct 1560

gctaaccatg ttcatgcctt cttctttttc ctacagctcc tgggcaacgt gctggttatt 1620

gtgctgtctc atcattttgg caaagaattg gaattcgccg ccaccatgcc taaaaagaaa 1680

agaaaggtgg gttctggtat cgagaagaag aagagcttcg ccaagggcat gggagtgaag 1740

agcaccctgg tgtccggctc taaggtgtac atgaccacat ttgctgaggg aagcgacgcc 1800

aggctggaga agatcgtgga gggcgatagc atcagatccg tgaacgaggg agaggctttc 1860

agcgccgaga tggctgacaa gaacgctggc tacaagatcg gaaacgccaa gttttcccac 1920

ccaaagggct acgccgtggt ggctaacaac ccactgtaca ccggaccagt gcagcaggac 1980

atgctgggac tgaaggagac actggagaag aggtacttcg gcgagtccgc cgacggaaac 2040

gataacatct gcatccaggt catccacaac atcctggata tcgagaagat cctggctgag 2100

tacatcacaa acgccgctta cgccgtgaac aacatctccg gcctggacaa ggatatcatc 2160

ggcttcggaa agttttctac cgtgtacaca tacgacgagt tcaaggatcc agagcaccac 2220

cgggccgctt ttaacaacaa cgacaagctg atcaacgcca tcaaggctca gtacgacgag 2280

ttcgataact ttctggataa ccccaggctg ggctacttcg gacaggcttt cttttctaag 2340

gagggcagaa actacatcat caactacgga aacgagtgtt acgacatcct ggccctgctg 2400

agcggactga ggcactgggt ggtgcacaac aacgaggagg agtctcggat cagccgcacc 2460

tggctgtaca acctggacaa gaacctggat aacgagtaca tctccacact gaactacctg 2520

tacgacagga tcaccaacga gctgacaaac agcttctcca agaactctgc cgctaacgtg 2580

aactacatcg ctgagaccct gggcatcaac ccagctgagt tcgctgagca gtacttcaga 2640

ttttccatca tgaaggagca gaagaacctg ggcttcaaca tcacaaagct gagagaagtg 2700

atgctggaca gaaaggatat gtccgagatc aggaagaacc acaaggtgtt cgattctatc 2760

agaaccaagg tgtacacaat gatggacttt gtgatctaca ggtactacat cgaggaggat 2820

gccaaggtgg ccgctgccaa caagagcctg cccgacaacg agaagtctct gagcgagaag 2880

gatatcttcg tgatcaacct gagaggctcc tttaacgacg atcagaagga cgctctgtac 2940

tacgatgagg ccaacaggat ctggagaaag ctggagaaca tcatgcacaa catcaaggag 3000

ttccggggaa acaagacccg cgagtacaag aagaaggacg ctccaaggct gcctaggatc 3060

ctgcctgctg gaagggacgt gagcgccttc agcaagctga tgtacgccct gacaatgttt 3120

ctggacggaa aggagatcaa cgatctgctg accacactga tcaacaagtt cgacaacatc 3180

cagtcttttc tgaaagtgat gcctctgatc ggcgtgaacg ctaagttcgt ggaggagtac 3240

gccttcttta aggacagcgc caagatcgct gatgagctgc ggctgatcaa gtcctttgcc 3300

aggatgggag agccaatcgc tgacgctagg agagctatgt acatcgatgc catccggatc 3360

ctgggaacca acctgtctta cgacgagctg aaggctctgg ccgacacctt cagcctggat 3420

gagaacggca acaagctgaa gaagggcaag cacggaatgc gcaacttcat catcaacaac 3480

gtgatcagca acaagcggtt tcactacctg atcagatacg gcgacccagc tcacctgcac 3540

gagatcgcta agaacgaggc cgtggtgaag ttcgtgctgg gacggatcgc cgatatccag 3600

aagaagcagg gccagaacgg aaagaaccag atcgaccgct actacgagac ctgcatcggc 3660

aaggataagg gaaagtccgt gtctgagaag gtggacgctc tgaccaagat catcacaggc 3720

atgaactacg accagttcga taagaagaga tctgtgatcg aggacaccgg aagggagaac 3780

gccgagagag agaagtttaa gaagatcatc agcctgtacc tgacagtgat ctaccacatc 3840

ctgaagaaca tcgtgaacat caacgctaga tacgtgatcg gcttccactg cgtggagcgc 3900

gatgcccagc tgtacaagga gaagggatac gacatcaacc tgaagaagct ggaggagaag 3960

ggctttagct ccgtgaccaa gctgtgcgct ggaatcgacg agacagcccc cgacaagagg 4020

aaggatgtgg agaaggagat ggccgagaga gctaaggaga gcatcgactc cctggagtct 4080

gctaacccta agctgtacgc caactacatc aagtactccg atgagaagaa ggccgaggag 4140

ttcaccaggc agatcaacag agagaaggcc aagaccgctc tgaacgccta cctgaggaac 4200

acaaagtgga acgtgatcat ccgggaggac ctgctgcgca tcgataacaa gacctgtaca 4260

ctgttccgga acaaggctgt gcacctggag gtggctcgct acgtgcacgc ctacatcaac 4320

gacatcgccg aggtgaactc ctactttcag ctgtaccact acatcatgca gaggatcatc 4380

atgaacgaga gatacgagaa gtctagcggc aaggtgtctg agtacttcga cgccgtgaac 4440

gatgagaaga agtacaacga tagactgctg aagctgctgt gcgtgccttt cggatactgt 4500

atcccacggt ttaagaacct gagcatcgag gccctgttcg accgcaacga ggctgccaag 4560

tttgataagg agaagaagaa ggtgagcggc aactccggtt ctggtctcga gcccaagaag 4620

aagaggaaag tcctcgaggc tactaacttc agcctgctga agcaggctgg agacgtggag 4680

gagaaccctg gacctatgca tatggtgagc aagggcgagg agctgttcac cggggtggtg 4740

cccatcctgg tcgagctgga cggcgacgta aacggccaca agttcagcgt gtccggcgag 4800

ggcgagggcg atgccaccta cggcaagctg accctgaagt tcatctgcac caccggcaag 4860

ctgcccgtgc cctggcccac cctcgtgacc accctgacct acggcgtgca gtgcttcagc 4920

cgctaccccg accacatgaa gcagcacgac ttcttcaagt ccgccatgcc cgaaggctac 4980

gtccaggagc gcaccatctt cttcaaggac gacggcaact acaagacccg cgccgaggtg 5040

aagttcgagg gcgacaccct ggtgaaccgc atcgagctga agggcatcga cttcaaggag 5100

gacggcaaca tcctggggca caagctggag tacaactaca acagccacaa cgtctatatc 5160

atggccgaca agcagaagaa cggcatcaag gtgaacttca agatccgcca caacatcgag 5220

gacggcagcg tgcagctcgc cgaccactac cagcagaaca cccccatcgg cgacggcccc 5280

gtgctgctgc ccgacaacca ctacctgagc acccagtccg ccctgagcaa agaccccaac 5340

gagaagcgcg atcacatggt cctgctggag ttcgtgaccg ccgccgggat cactctcggc 5400

atggacgagc tgtacaagta aacgctagct agaatcaacc tctggattac aaaatttgtg 5460

aaagattgac tggtattctt aactatgttg ctccttttac gctatgtgga tacgctgctt 5520

taatgccttt gtatcatgct attgcttccc gtatggcttt cattttctcc tccttgtata 5580

aatcctggtt gctgtctctt tatgaggagt tgtggcccgt tgtcaggcaa cgtggcgtgg 5640

tgtgcactgt gtttgctgac gcaaccccca ctggttgggg cattgccacc acctgtcagc 5700

tcctttccgg gactttcgct ttccccctcc ctattgccac ggcggaactc atcgccgcct 5760

gccttgcccg ctgctggaca ggggctcggc tgttgggcac tgacaattcc gtggtgttgt 5820

cggggaaatc atcgtccttt ccttggctgc tcgcctgtgt tgccacctgg attctgcgcg 5880

ggacgtcctt ctgctacgtc ccttcggccc tcaatccagc ggaccttcct tcccgcggcc 5940

tgctgccggc tctgcggcct cttccgcgtc ttcgccttcg ccctcagacg agtcggatct 6000

ccctttgggc cgcctccccg catcgatacc gtcgacctcg actgtgcctt ctagttgcca 6060

gccatctgtt gtttgcccct cccccgtgcc ttccttgacc ctggaaggtg ccactcccac 6120

tgtcctttcc taataaaatg aggaaattgc atcgcattgt ctgagtaggt gtcattctat 6180

tctggggggt ggggtggggc aggacagcaa gggggaggat tgggaagaca atagcaggca 6240

tgctgggga 6249

<210> 2

<211> 2471

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(2471)

<223> gRNA-1 plasmid U6-DR-guide 1-DR-pCMV-mCherry-WPRE-PolyA

<400> 2

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg caagtaaacc cctaccaact ggtcggggtt tgaaacggta ctcctggaag 300

atgtccacca gggtctcaag taaaccccta ccaactggtc ggggtttgaa actttttttg 360

tccgcgttac ataacttacg gtaaatggcc cgcctggctg accgcccaac gacccccgcc 420

cattgacgtc aataatgacg tatgttccca tagtaacgcc aatagggact ttccattgac 480

gtcaatgggt ggagtattta cggtaaactg cccacttggc agtacatcaa gtgtatcata 540

tgccaagtcc gccccctatt gacgtcaatg acggtaaatg gcccgcctgg cattatgccc 600

agtacatgac cttacgggac tttcctactt ggcagtacat ctacgtatta gtcatcgcta 660

ttaccatggt gatgcggttt tggcagtaca ccaatgggcg tggatagcgg tttgactcac 720

ggggatttcc aagtctccac cccattgacg tcaatgggag tttgttttgg caccaaaatc 780

aacgggactt tccaaaatgt cgtaataacc ccgccccgtt gacgcaaatg ggcggtaggc 840

gtgtacggtg ggaggtctat ataagcagag gtcgtttagt gaaccgtcag atcacgcgtg 900

ccaccatggt gagcaagggc gaggaggata acatggccat catcaaggag ttcatgcgct 960

tcaaggtgca catggagggc tccgtgaacg gccacgagtt cgagatcgag ggcgagggcg 1020

agggccgccc ctacgagggc acccagaccg ccaagctgaa ggtgaccaag ggtggccccc 1080

tgcccttcgc ctgggacatc ctgtcccctc agttcatgta cggctccaag gcctacgtga 1140

agcaccccgc cgacatcccc gactacttga agctgtcctt ccccgagggc ttcaagtggg 1200

agcgcgtgat gaacttcgag gacggcggcg tggtgaccgt gacccaggac tcctccctgc 1260

aggacggcga gttcatctac aaggtgaagc tgcgcggcac caacttcccc tccgacggcc 1320

ccgtaatgca gaagaagacc atgggctggg aggcctcctc cgagcggatg taccccgagg 1380

acggcgccct gaagggcgag atcaagcaga ggctgaagct gaaggacggc ggccactacg 1440

acgctgaggt caagaccacc tacaaggcca agaagcccgt gcagctgccc ggcgcctaca 1500

acgtcaacat caagttggac atcacctccc acaacgagga ctacaccatc gtggaacagt 1560

acgaacgcgc cgagggccgc cactccaccg gcggcatgga cgagctgtac aagtaaaatc 1620

aacctctgga ttacaaaatt tgtgaaagat tgactggtat tcttaactat gttgctcctt 1680

ttacgctatg tggatacgct gctttaatgc ctttgtatca tgctattgct tcccgtatgg 1740

ctttcatttt ctcctccttg tataaatcct ggttgctgtc tctttatgag gagttgtggc 1800

ccgttgtcag gcaacgtggc gtggtgtgca ctgtgtttgc tgacgcaacc cccactggtt 1860

ggggcattgc caccacctgt cagctccttt ccgggacttt cgctttcccc ctccctattg 1920

ccacggcgga actcatcgcc gcctgccttg cccgctgctg gacaggggct cggctgttgg 1980

gcactgacaa ttccgtggtg ttgtcgggga agctgacgtc ctttccatgg ctgctcgcct 2040

gtgttgccac ctggattctg cgcgggacgt ccttctgcta cgtcccttcg gccctcaatc 2100

cagcggacct tccttcccgc ggcctgctgc cggctctgcg gcctcttccg cgtctccgcc 2160

ttcgccctca gacgagtcgg atctcccttt ggccgcctcc ccgccaccgg ttaggggccc 2220

gtttaaaccc gctgatcagc ctcgactgtg ccttctagtt gccagccatc tgttgtttgc 2280

ccctcccccg tgccttcctt gaccctggaa ggtgccactc ccactgtcct ttcctaataa 2340

aatgaggaaa ttgcatcgca ttgtctgagt aggtgtcatt ctattctggg gggtggggtg 2400

gggcaggaca gcaaggggga ggattgggaa gacaatagca ggcatgctgg ggatgcggtg 2460

ggctctatgg c 2471

<210> 3

<211> 2471

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(2471)

<223> gRNA-2 plasmid U6-DR-guide 2-DR-pCMV-mCherry-WPRE-PolyA

<400> 3

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg caagtaaacc cctaccaact ggtcggggtt tgaaacggta ctcctggaag 300

atgtccacca gggtctcaag taaaccccta ccaactggtc ggggtttgaa actttttttg 360

tccgcgttac ataacttacg gtaaatggcc cgcctggctg accgcccaac gacccccgcc 420

cattgacgtc aataatgacg tatgttccca tagtaacgcc aatagggact ttccattgac 480

gtcaatgggt ggagtattta cggtaaactg cccacttggc agtacatcaa gtgtatcata 540

tgccaagtcc gccccctatt gacgtcaatg acggtaaatg gcccgcctgg cattatgccc 600

agtacatgac cttacgggac tttcctactt ggcagtacat ctacgtatta gtcatcgcta 660

ttaccatggt gatgcggttt tggcagtaca ccaatgggcg tggatagcgg tttgactcac 720

ggggatttcc aagtctccac cccattgacg tcaatgggag tttgttttgg caccaaaatc 780

aacgggactt tccaaaatgt cgtaataacc ccgccccgtt gacgcaaatg ggcggtaggc 840

gtgtacggtg ggaggtctat ataagcagag gtcgtttagt gaaccgtcag atcacgcgtg 900

ccaccatggt gagcaagggc gaggaggata acatggccat catcaaggag ttcatgcgct 960

tcaaggtgca catggagggc tccgtgaacg gccacgagtt cgagatcgag ggcgagggcg 1020

agggccgccc ctacgagggc acccagaccg ccaagctgaa ggtgaccaag ggtggccccc 1080

tgcccttcgc ctgggacatc ctgtcccctc agttcatgta cggctccaag gcctacgtga 1140

agcaccccgc cgacatcccc gactacttga agctgtcctt ccccgagggc ttcaagtggg 1200

agcgcgtgat gaacttcgag gacggcggcg tggtgaccgt gacccaggac tcctccctgc 1260

aggacggcga gttcatctac aaggtgaagc tgcgcggcac caacttcccc tccgacggcc 1320

ccgtaatgca gaagaagacc atgggctggg aggcctcctc cgagcggatg taccccgagg 1380

acggcgccct gaagggcgag atcaagcaga ggctgaagct gaaggacggc ggccactacg 1440

acgctgaggt caagaccacc tacaaggcca agaagcccgt gcagctgccc ggcgcctaca 1500

acgtcaacat caagttggac atcacctccc acaacgagga ctacaccatc gtggaacagt 1560

acgaacgcgc cgagggccgc cactccaccg gcggcatgga cgagctgtac aagtaaaatc 1620

aacctctgga ttacaaaatt tgtgaaagat tgactggtat tcttaactat gttgctcctt 1680

ttacgctatg tggatacgct gctttaatgc ctttgtatca tgctattgct tcccgtatgg 1740

ctttcatttt ctcctccttg tataaatcct ggttgctgtc tctttatgag gagttgtggc 1800

ccgttgtcag gcaacgtggc gtggtgtgca ctgtgtttgc tgacgcaacc cccactggtt 1860

ggggcattgc caccacctgt cagctccttt ccgggacttt cgctttcccc ctccctattg 1920

ccacggcgga actcatcgcc gcctgccttg cccgctgctg gacaggggct cggctgttgg 1980

gcactgacaa ttccgtggtg ttgtcgggga agctgacgtc ctttccatgg ctgctcgcct 2040

gtgttgccac ctggattctg cgcgggacgt ccttctgcta cgtcccttcg gccctcaatc 2100

cagcggacct tccttcccgc ggcctgctgc cggctctgcg gcctcttccg cgtctccgcc 2160

ttcgccctca gacgagtcgg atctcccttt ggccgcctcc ccgccaccgg ttaggggccc 2220

gtttaaaccc gctgatcagc ctcgactgtg ccttctagtt gccagccatc tgttgtttgc 2280

ccctcccccg tgccttcctt gaccctggaa ggtgccactc ccactgtcct ttcctaataa 2340

aatgaggaaa ttgcatcgca ttgtctgagt aggtgtcatt ctattctggg gggtggggtg 2400

gggcaggaca gcaaggggga ggattgggaa gacaatagca ggcatgctgg ggatgcggtg 2460

ggctctatgg c 2471

<210> 4

<211> 4138

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(4138)

<223> AAV-CasRx-Vegfa plasmid ITR-EFS-SV40 NLS-CasRx-HA-SV40 NLS-SV40 PolyA-U6-DR-guide1-DR-guide 2-DR-ITR

<400> 4

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60

ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120

aggggttcct gcggcctcta gataggtctt gaaaggagtg ggaattggct ccggtgcccg 180

tcagtgggca gagcgcacat cgcccacagt ccccgagaag ttggggggag gggtcggcaa 240

ttgatccggt gcctagagaa ggtggcgcgg ggtaaactgg gaaagtgatg tcgtgtactg 300

gctccgcctt tttcccgagg gtgggggaga accgtatata agtgcagtag tcgccgtgaa 360

cgttcttttt cgcaacgggt ttgccgccag aacacaggac cggtgccacc atgcctaaaa 420

agaaaagaaa ggtgggttct ggtatcgaga agaagaagag cttcgccaag ggcatgggag 480

tgaagagcac cctggtgtcc ggctctaagg tgtacatgac cacatttgct gagggaagcg 540

acgccaggct ggagaagatc gtggagggcg atagcatcag atccgtgaac gagggagagg 600

ctttcagcgc cgagatggct gacaagaacg ctggctacaa gatcggaaac gccaagtttt 660

cccacccaaa gggctacgcc gtggtggcta acaacccact gtacaccgga ccagtgcagc 720

aggacatgct gggactgaag gagacactgg agaagaggta cttcggcgag tccgccgacg 780

gaaacgataa catctgcatc caggtcatcc acaacatcct ggatatcgag aagatcctgg 840

ctgagtacat cacaaacgcc gcttacgccg tgaacaacat ctccggcctg gacaaggata 900

tcatcggctt cggaaagttt tctaccgtgt acacatacga cgagttcaag gatccagagc 960

accaccgggc cgcttttaac aacaacgaca agctgatcaa cgccatcaag gctcagtacg 1020

acgagttcga taactttctg gataacccca ggctgggcta cttcggacag gctttctttt 1080

ctaaggaggg cagaaactac atcatcaact acggaaacga gtgttacgac atcctggccc 1140

tgctgagcgg actgaggcac tgggtggtgc acaacaacga ggaggagtct cggatcagcc 1200

gcacctggct gtacaacctg gacaagaacc tggataacga gtacatctcc acactgaact 1260

acctgtacga caggatcacc aacgagctga caaacagctt ctccaagaac tctgccgcta 1320

acgtgaacta catcgctgag accctgggca tcaacccagc tgagttcgct gagcagtact 1380

tcagattttc catcatgaag gagcagaaga acctgggctt caacatcaca aagctgagag 1440

aagtgatgct ggacagaaag gatatgtccg agatcaggaa gaaccacaag gtgttcgatt 1500

ctatcagaac caaggtgtac acaatgatgg actttgtgat ctacaggtac tacatcgagg 1560

aggatgccaa ggtggccgct gccaacaaga gcctgcccga caacgagaag tctctgagcg 1620

agaaggatat cttcgtgatc aacctgagag gctcctttaa cgacgatcag aaggacgctc 1680

tgtactacga tgaggccaac aggatctgga gaaagctgga gaacatcatg cacaacatca 1740

aggagttccg gggaaacaag acccgcgagt acaagaagaa ggacgctcca aggctgccta 1800

ggatcctgcc tgctggaagg gacgtgagcg ccttcagcaa gctgatgtac gccctgacaa 1860

tgtttctgga cggaaaggag atcaacgatc tgctgaccac actgatcaac aagttcgaca 1920

acatccagtc ttttctgaaa gtgatgcctc tgatcggcgt gaacgctaag ttcgtggagg 1980

agtacgcctt ctttaaggac agcgccaaga tcgctgatga gctgcggctg atcaagtcct 2040

ttgccaggat gggagagcca atcgctgacg ctaggagagc tatgtacatc gatgccatcc 2100

ggatcctggg aaccaacctg tcttacgacg agctgaaggc tctggccgac accttcagcc 2160

tggatgagaa cggcaacaag ctgaagaagg gcaagcacgg aatgcgcaac ttcatcatca 2220

acaacgtgat cagcaacaag cggtttcact acctgatcag atacggcgac ccagctcacc 2280

tgcacgagat cgctaagaac gaggccgtgg tgaagttcgt gctgggacgg atcgccgata 2340

tccagaagaa gcagggccag aacggaaaga accagatcga ccgctactac gagacctgca 2400

tcggcaagga taagggaaag tccgtgtctg agaaggtgga cgctctgacc aagatcatca 2460

caggcatgaa ctacgaccag ttcgataaga agagatctgt gatcgaggac accggaaggg 2520

agaacgccga gagagagaag tttaagaaga tcatcagcct gtacctgaca gtgatctacc 2580

acatcctgaa gaacatcgtg aacatcaacg ctagatacgt gatcggcttc cactgcgtgg 2640

agcgcgatgc ccagctgtac aaggagaagg gatacgacat caacctgaag aagctggagg 2700

agaagggctt tagctccgtg accaagctgt gcgctggaat cgacgagaca gcccccgaca 2760

agaggaagga tgtggagaag gagatggccg agagagctaa ggagagcatc gactccctgg 2820

agtctgctaa ccctaagctg tacgccaact acatcaagta ctccgatgag aagaaggccg 2880

aggagttcac caggcagatc aacagagaga aggccaagac cgctctgaac gcctacctga 2940

ggaacacaaa gtggaacgtg atcatccggg aggacctgct gcgcatcgat aacaagacct 3000

gtacactgtt ccggaacaag gctgtgcacc tggaggtggc tcgctacgtg cacgcctaca 3060

tcaacgacat cgccgaggtg aactcctact ttcagctgta ccactacatc atgcagagga 3120

tcatcatgaa cgagagatac gagaagtcta gcggcaaggt gtctgagtac ttcgacgccg 3180

tgaacgatga gaagaagtac aacgatagac tgctgaagct gctgtgcgtg cctttcggat 3240

actgtatccc acggtttaag aacctgagca tcgaggccct gttcgaccgc aacgaggctg 3300

ccaagtttga taaggagaag aagaaggtga gcggcaactc cggttctggt tacccatacg 3360

acgtaccaga ttacgctccc aagaagaagc gcaaggtggg ataaagatcc taaaacttgt 3420

ttattgcagc ttataatggt tacaaataaa gcaatagcat cacaaatttc acaaataaag 3480

catttttttc actgcattct agttgtggtt tgtccaaact catcaatgta tcttatcatg 3540

tctggatcgc ggccgagggc ctatttccca tgattccttc atatttgcat atacgataca 3600

aggctgttag agagataatt ggaattaatt tgactgtaaa cacaaagata ttagtacaaa 3660

atacgtgacg tagaaagtaa taatttcttg ggtagtttgc agttttaaaa ttatgtttta 3720

aaatggacta tcatatgctt accgtaactt gaaagtattt cgatttcttg gctttatata 3780

tcttgtggaa aggacgaaac accgaacccc taccaactgg tcggggtttg aaacggtact 3840

cctggaagat gtccaccagg gtctcaagta aacccctacc aactggtcgg ggtttgaaac 3900

gtgctgtagg aagctcatct ctcctatgtg caagtaaacc cctaccaact ggtcggggtt 3960

tgaaactttt tttgaattct gatgcggtgg cggccgcagg aacccctagt gatggagttg 4020

gccactccct ctctgcgcgc tcgctcgctc actgaggccg ggcgaccaaa ggtcgcccga 4080

cgcccgggct ttgcccgggc ggcctcagtg agcgagcgag cgcgcagctg cctgcagg 4138

<210> 5

<211> 20

<212> DNA

<213> primers (Primer)

<400> 5

ggtggacatc ttccaggagt 20

<210> 6

<211> 21

<212> DNA

<213> primers (Primer)

<400> 6

tgatctgcat ggtagatgtt g 21

<210> 7

<211> 19

<212> DNA

<213> primers (Primer)

<400> 7

ccctggtgtc cggctctaa 19

<210> 8

<211> 20

<212> DNA

<213> primers (Primer)

<400> 8

ggactcgccg aagtacctct 20

<210> 9

<211> 30

<212> DNA

<213> Polynucleotide (nucleotide)

<400> 9

agaccctggt ggacatcttc caggagtacc 30

<210> 10

<211> 30

<212> DNA

<213> Polynucleotide (nucleotide)

<400> 10

cacataggag agatgagctt cctacagcac 30

Claims (16)

1. A method for targeted inhibition of vascular endothelial growth factor a in a cell, comprising: and delivering CasRx and gRNA aiming at the vascular endothelial growth factor A into the cells by the adeno-associated virus so as to inhibit the vascular endothelial growth factor A in the cells in a targeted way.

2. The method according to claim 1, wherein the expression cassette for CasRx further comprises a nuclear localization signal sequence at both ends of the CasRx-encoding gene; or

In the expression cassette of CasRx, EFS, CMV, CAG, CBH or EF1a is used as a promoter to drive the expression of CasRx; preferably, EFS is used as the promoter.

3. The method of claim 2, comprising the following operatively linked sequence elements: a promoter sequence, a nuclear localization signal 1 sequence, a CasRx-encoding nucleic acid sequence, a nuclear localization signal 2 sequence; preferably, the promoter sequence also comprises a 5 'terminal inverted repeat sequence at the 5' end; preferably, 3' of the nuclear localization signal 2 sequence, the PolyA sequence is also included.

4. The method of claim 1, wherein an expression cassette for gRNA of vascular endothelial growth factor A drives expression of gRNA using U6 as a promoter.

5. The method of claim 4, wherein the expression cassette for a gRNA for vascular endothelial growth factor A includes the following operably linked sequence elements: the U6 promoter, gRNA for vascular endothelial growth factor a; preferably, a3 'terminal inverted repeat sequence is also included at the 3' end of the gRNA.

6. The method of any one of claims 1 to 5, wherein the CasRx has a polypeptide sequence encoded by the nucleotide sequence 1699 to 4596 of SEQ ID NO. 1 or a degenerate sequence thereof.

7. The method of any one of claims 1-5, wherein the gRNA for VEGF A targets a segment of the sequence set forth as SEQ ID NO 9 or SEQ ID NO 10 of VEGF A.

8. The method of any one of claims 1 to 5, wherein the coding sequence for CasRx and the gRNA for vascular endothelial growth factor A are assembled in an adeno-associated viral vector; preferably, the vector of the adeno-associated virus comprises the nucleotide sequence shown in SEQ ID NO. 4.

9. The recombinant vector for expressing CasRx and gRNA aiming at vascular endothelial growth factor A is characterized in that the recombinant vector is an adeno-associated virus vector and comprises an expression cassette of CasRx and an expression cassette of gRNA of vascular endothelial growth factor A.

10. The recombinant vector according to claim 9, wherein the expression cassette for CasRx further comprises a nuclear localization signal sequence at each end of the CasRx-encoding gene; and/or EFS, CMV, CAG, CBH or EF1a as promoters to drive the expression of CasRx; more preferably, the expression cassette comprises the following operably linked sequence elements: a promoter sequence, a nuclear localization signal 1 sequence, a CasRx-encoding nucleic acid sequence, a nuclear localization signal 2 sequence; preferably, the promoter sequence also comprises a 5 'terminal inverted repeat sequence at the 5' end; preferably, 3' of the nuclear localization signal 2 sequence, the PolyA sequence is also included.

11. The recombinant vector according to claim 9, wherein the expression cassette for gRNA of vascular endothelial growth factor a has U6 as promoter to drive the expression of gRNA; more preferably, the expression cassette comprises the following operably linked sequence elements: the U6 promoter, gRNA for vascular endothelial growth factor a; preferably, a3 'terminal inverted repeat sequence is also included at the 3' end of the gRNA.

12. The recombinant vector according to any one of claims 9 to 11, wherein the CasRx has a polypeptide sequence encoded by the nucleotide sequence of positions 1699 to 4596 of SEQ ID NO. 1 or a degenerate sequence thereof; or

The gRNA aiming at the vascular endothelial growth factor A targets a segment of a sequence shown by SEQ ID NO 9 or SEQ ID NO 10 in the vascular endothelial growth factor A; or

The coding sequence of CasRx and gRNA for vascular endothelial growth factor a are assembled in an adeno-associated viral vector; more preferably, the vector of the adeno-associated virus comprises the nucleotide sequence shown in SEQ ID NO. 4.

13. Use of the recombinant vector of any one of claims 9 to 12 for packaging a recombinant virus, said recombinant virus being a recombinant adeno-associated virus.

14. A recombinant virus which is an adeno-associated virus and which is packaged with the recombinant vector according to any one of claims 9 to 12.

15. Use of the recombinant virus of claim 14 for:

preparing a reagent for targeted inhibition of the intracellular vascular endothelial growth factor A; and/or

Preparing a medicament or composition for inhibiting choroidal neovascularization; and/or

Preparing a medicament or composition for relieving or treating macular degeneration.

16. A kit or kit comprising: the recombinant virus of claim 14; or 9 to 12 of the recombinant vector.

Images