CN115820728A

CN115820728A - Gene editing method and application

Info

Publication number: CN115820728A
Application number: CN202210814386.4A
Authority: CN
Inventors: 徐天宏; 周波; 赖祺
Original assignee: Shanghai Best Onco Biotechnology Co ltd
Current assignee: Shanghai Best Onco Biotechnology Co ltd
Priority date: 2022-07-11
Filing date: 2022-07-11
Publication date: 2023-03-21
Also published as: WO2024012300A1

Abstract

The invention relates to the field of biomedicine, in particular to a method and application of gene editing, wherein the method comprises the steps of deaminating target C base and/or target A base on a target polynucleotide by using a base editing system so as to introduce a stop codon or a point mutation start codon into a target gene coding region; the base editing system includes: (a) A fusion protein comprising a Cas9 fragment and a deaminase fragment, or a variant or polynucleotide encoding thereof; (b) A guide nucleotide or a polynucleotide encoding it which targets the fusion protein or variant thereof in a) to the target C base and/or the target A base. The method knocks out a target gene by a safe and efficient base editing technology. The method provided by the invention is expected to be developed into a medicament for treating diseases such as age-related macular degeneration and the like, and has wide clinical application prospect and development value.

Description

Gene editing method and application

Technical Field

The invention relates to the field of biomedicine, in particular to a gene editing method and application.

Background

Gene sequencing technology allows us to read out genomic sequences, while gene editing technology, in particular CRISRP/Cas9 technology, allows us to more easily modify genomic sequences. In 2020, nobel prize of chemistry awarded emmeniel capentey (emmenule charpienter), janniefre dudena (Jennifer a. Doudna), and developed a method for genome editing. Through the development of more than ten years, the gene editing technology has shown great value in the fields of gene function research, genetic disease treatment, tumor treatment and the like.

Age-related macular degeneration (AMD) is a major factor leading to irreversible blindness in the elderly population. It is predicted that by 2040, AMD will affect nearly 3 billion people. AMD is clinically classified as dry (dry) and wet (wet). Clinical progression of wet AMD is manifested by Choroidal Neovascularization (CNV), and the occurrence of CNV is a major cause of rapid blindness in patients. Studies have shown that vascular endothelial growth factor (VPF) plays an important role in CNV processes, and by examination of retinal and choroidal tissues in AMD patients, nozaki et al found that activated complement upregulated VPF expression in local tissues. Targeting VPF has become a method of treating wet AMD. The current VPF targeting drugs include bevacizumab, ranibizumab, aflibercept, and butoxezumab, and all of the drugs are VPF targeting proteins. However, antibody drugs have certain disadvantages, such as frequent injections, which increase the risk of complications, are not friendly to patients, and increase the economic burden of patients. The direct disruption of VPF expression by gene therapy would be a potentially effective therapeutic approach.

The CRISPR/Cas9 gene editing technology cuts a DNA double strand based on the Cas9 protein, and the broken DNA double strand can introduce insertion or deletion mutation during repair, so that a target gene is knocked out. However, studies have shown that this DNA Double Strand Break (DSB) -based genetic manipulation has significant drawbacks, which may result in chromosomal deletions at the megabase level, causing global damage to the human cell genome. In addition, double strand breaks can cause p 53-induced apoptosis, and positively edited cells are more prone to enrich for p53 mutated cells, which undoubtedly increase the risk of carcinogenesis when injected into the body. The base editing technology is characterized in that deaminase is integrated into the CRISPR/Cas technology, and the purpose of base editing is realized in situ by deamination of bases. The editing mode does not need to introduce DNA double-strand break, and is safer in theory. Currently, cytosine Base Editing (CBE) and Adenine Base Editing (ABE) are the most widely used, and C to T conversion or a to G conversion can be achieved respectively. Other types of Base transversion Editors can also effect a C to G (C: G to G: C Base Editors, CGBE) or A to C transversion, which undoubtedly increases the type of Base editing. The proposal of the base editing technology is rapidly becoming a good tool in the field of gene editing. Cytosine base editing can act on a Coding region (CDS) of a gene to be expressed, and the aim of knocking out the gene is achieved by generating a stop codon by targeting CAA, CAG, CGA or TGG. CGBE can generate stop codons by targeting TAC, TCA. In addition, cytosine base editing, adenine base editing and CGBE editors can achieve the purpose of gene knockout by targeting initiation codons ATG or CTG.

Disclosure of Invention

In view of the above-described drawbacks of the prior art, it is an object of the present invention to provide a method and use for editing a VPF gene, which solve the problems of the prior art.

To achieve the above and other related objects, the present invention provides a method for editing a VPF gene, the method comprising deaminating a target C base and/or a target a base on a VPF polynucleotide using a base editing system to introduce a stop codon or a point mutation start codon in a coding region of the VPF gene; the base editing system includes:

(a) A fusion protein comprising a Cas9 fragment and a deaminase fragment, or a variant or polynucleotide encoding thereof;

(b) A guide nucleotide or a polynucleotide encoding it which targets the fusion protein or variant thereof in a) to the target C base and/or the target A base.

The invention also provides a cell obtained by the VPF gene editing method.

The cell is a somatic cell or a germ cell. The cells are for example RPE cells or Muller cells.

The invention also provides application of the cell in preparing a product for preventing or treating diseases related to VPF overexpression.

As described above, the method and use for editing VPF gene of the present invention have the following advantageous effects: by using a base editing technology, the expression of VPF is silenced in a point mutation mode, so that the purpose of treating diseases is achieved, and the harmful influence caused by DNA double chains caused by a CRISPR/Cas technology is overcome. The base editing system preferably used in the invention for chimeric deaminase into the middle of Cas9 protein has no obvious difference in off-target at DNA and RNA level compared with wild type cells, indicating the safety of the method for gene therapy products. The method can provide a new choice for establishing a base editing technology to treat genetic diseases and gene abnormal diseases, can also provide support for the research of new effective gene targets, and simultaneously lays a solid technical foundation for the research of related disease treatment.

Drawings

FIG. 1 shows a pattern of knock-out gene by different base editing systems, (A) induction of stop codon; (B) disruption of the initiation codon.

FIG. 2 shows the results of efficiency measurements of induced stop codon mutations in RPE cell lines.

FIG. 3 shows the results of efficiency measurements of the induced stop codon mutations in Muller cell lines.

FIG. 4 shows the results of efficiency measurements of the initiation codon mutations (14 and 15 positions) in RPE cell lines.

FIG. 5 shows the results of efficiency measurements in RPE cell lines using the adenine base editor mutation initiation codon (16-position).

FIG. 6 shows the results of efficiency measurements of the start codon mutations (14 and 15 positions) in the Muller cell line.

FIG. 7 shows the results of efficiency measurements in Muller cell lines using the adenine base editor mutation start codon (16 site).

FIG. 8 shows VPF expression levels for different types of mutant cell lines.

Figure 9 shows the number of snps detected for different mutant cell lines.

Detailed Description

The present invention provides a method of editing a VPF gene, the method comprising deaminating a target C base and/or a target a base on a VPF polynucleotide using a base editing system to introduce a stop codon or a point mutation start codon in the coding region of the VPF gene; the base editing system includes:

(a) A fusion protein comprising a Cas9 fragment and a deaminase fragment, or a variant thereof, or a polynucleotide encoding the same;

The VPF Gene has the Gene ID of 7422.

The VPF polynucleotide comprises a coding strand and a complementary strand; the polynucleotide encoding the VPF protein comprises a coding region and a non-coding region.

The VPF polynucleotide may be in the form of DNA or RNA. The DNA form is selected from cDNA, genome DNA or artificial synthetic DNA, and can be single-stranded or double-stranded; the DNA may be the coding strand or the non-coding strand.

Deamination of a target C base and/or a target a base on a VPF polynucleotide results in conversion of C to T, or a to G, or C to G in the VPF polynucleotide. In some embodiments, C to T conversion, and/or a to G conversion, and/or C to G conversion occurs in the coding sequence of the VPF polynucleotide. In some embodiments, C to T conversion, and/or a to G conversion, and/or C to G conversion results in a mutation in the VPF protein; mutations in the VPF protein are loss-of-function mutations or non-coding mutations. The loss of function mutation introduces a stop codon in the VPF coding sequence, resulting in the production of a truncated or non-functional VPF protein. The non-coding mutation is by mutating the initiation codon of the VPF coding sequence, which results in abolishing VPF expression. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations are introduced into the VPF polynucleotide.

In some embodiments, the stop codon is TAA, TAG or TGA. For example, the stop codon is generated by conversion from CAA to TAA via deamination of the first C on the coding strand; the stop codon is generated by conversion from CAG to TAG via deamination of the first C on the coding strand; the stop codon is generated from the conversion of CGA to TGA via deamination of the first C on the coding strand; the stop codon is generated from TGG to TGA conversion via deamination of the third C on the complementary strand; the stop codon is generated from conversion of TAC to TAG via deamination of the third C on the complementary strand; the stop codon is generated from the TCA to TGA conversion via deamination of the second C on the complementary strand.

The initiation codon is ATG or CTG. The start codon mutation is generated by conversion from ATG to ATA via deamination of the third C on the complementary strand; the start codon mutation is generated by conversion of ATG to ACG via deamination of the second a on the complementary strand; the start codon mutation is generated by conversion from ATG to GTG via deamination of the first a on the coding strand. The start codon mutation is generated by conversion of ATG to ATC via deamination of the third G on the coding strand.

In certain embodiments of the invention, the fusion protein or variant thereof may be delivered directly into an object to be edited, such as a host cell; or in the form of messenger RNA (mRNA) molecules which are translated into the fusion protein or variant thereof upon delivery into a host cell; or in the form of an expression vector comprising a deoxyribonucleic acid (DNA) sequence encoding one or more genes for expression of the fusion protein or variant thereof.

In some embodiments of the invention, the guide nucleotide may be delivered directly into an object to be edited, such as a host cell.

In some embodiments, the guide nucleotide may be delivered in the form of an expression vector comprising a guide nucleotide encoding one or more copies.

In certain embodiments of the invention, the fusion protein is selected from one or more of a cytosine fusion protein, an adenine fusion protein, or a cytosine transversion fusion protein. Accordingly, the base editing system is a cytosine base editing system, an adenine base editing system, or a CGBE base editing system. The deaminase fragment can be cytosine deaminase or adenine deaminase.

The cytosine deaminase is selected from one or more of the following: APOBEC1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D, APOBEC3F, APOBEC3G, APOBEC3H, APOBEC4, activation-induced deaminase (AID) or pmCDA1.

The adenine deaminase is selected from wild-type tadA, mutant-type tadA, or a compound wttadA-tadA consisting of the wild-type tadA and the mutant-type tadA. In certain preferred embodiments of the invention, the adenine deaminase is wtTadA-TadA.

In certain embodiments of the invention, the Cas9 fragment and the deaminase fragment are linked by a linker peptide.

In certain embodiments of the present invention, the cytosine fusion protein has the structure NH2- [ nuclear localization signal ] - [ first nCas9 fragment ] - [ linker peptide ] - [ cytosine deaminase fragment ] - [ linker peptide ] - [ second nCas9 fragment ] - [ GS peptide segment ] - [ UGI peptide segment ] - [ nuclear localization signal ] -COOH; preferably, the amino acid sequence of the cytosine fusion protein is shown as SEQ ID No. 18.

In certain embodiments of the invention, the adenine fusion protein has the structure NH2- [ nuclear localization signal ] - [ first nCas fragment ] - [ linker peptide ] - [ adenine deaminase fragment ] - [ linker peptide ] - [ second nCas9 fragment ] - [ GS peptide fragment ] - [ nuclear localization signal ] -COOH; preferably, the amino acid sequence of the adenine fusion protein is shown as SEQ ID No. 19.

In certain embodiments of the invention, the cytosine transversion fusion protein comprises, in order from N-terminus to C-terminus, a first Cas9 fragment, a chimeric insert comprising a deaminase fragment and a uracil DNA-binding protein fragment, a second nickase fragment. Preferably, the amino acid sequence of the cytosine transversion fusion protein is shown in SEQ ID No. 20.

In certain embodiments of the invention, the variant of the fusion protein is a fragment, derivative or analog of the fusion protein that may be (i) a protein in which one or more conserved or non-conserved amino acid residues (preferably conserved amino acid residues) are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a protein having a substituent group in one or more amino acid residues, or (iii) a protein in which an additional amino acid sequence is fused to the sequence of the protein (e.g., a leader or secretory sequence or a sequence used to purify the protein or a pro-protein sequence). Such fragments, derivatives and analogs are within the purview of those skilled in the art in view of the present description. In some embodiments, a variant of the fusion protein refers to a protein that has 75% or greater, or 85% or greater, or 90% or greater, or 95% or greater identity to the amino acid sequence of the fusion protein and has the same or similar function as the fusion protein. The above-mentioned identity of 75% or more may be 75%, 80%, 85%, 90% or 95% or more; in particular, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% may be used. The above-mentioned 90% or more identity may be 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The similar function means that 75% or more, or 85% or more, or 90% or more, or 95% or more of the function of the original protein is retained.

In certain embodiments of the invention, the targeting sequence of the guide nucleotide is a sequence within SEQ ID No.21 to SEQ ID No.62 that can utilize a deaminase to form a stop codon or/and disrupt an initiation codon.

In the cytosine base editing system, the target sequence of the guide nucleotide is at least any one of SEQ ID NO.1-SEQ ID NO.10, SEQ ID NO.14 and SEQ ID NO.15. Preferably, the targeting sequences used are SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.7, SEQ ID NO.10, SEQ ID NO.14.

In the adenine base editing system, the target sequences of the guide nucleotides are shown as SEQ ID NO.14, SEQ ID NO.15 and SEQ ID NO.16. Preferably, the targeting sequences used are SEQ ID NO.14, SEQ ID NO.16.

In the CGBE base editing system, the targeting sequence of the guide nucleotide is shown in SEQ ID NO.11-SEQ ID NO.15. Preferably, the targeting sequences used are SEQ ID NO.12, SEQ ID NO.14.

In the method of the invention, the mass ratio of the guide nucleotide sequence to the fusion protein is 1: (2-20); may be 1: (2 to 4), 1: (2 to 6), 1: (2 to 8), 1: (2 to 10), 1: (2 to 12), 1: (2 to 14), 1: (2 to 16), 1: (2 to 18), 1: (2 to 20), (4 to 6), 1: (4 to 8), 1: (4-10), 1: (4 to 12), 1: (4 to 14), 1: (4-16), 1: (4-18), 1: (4-20), 1: (8 to 10), 1: (8 to 12), 1: (8 to 14), 1: (8 to 16), 1: (8 to 18), 1: (8 to 20), 1: (10 to 12), 1: (10 to 14), 1: (10 to 16), 1: (10 to 18), 1: (10-20), 1: (12 to 14), 1: (14 to 16), 1: (16 to 18), 1: (18 to 20); preferably, 1: (2-8).

In the method of the invention, the VPF polynucleotide is contacted with (a) and (b), respectively, or with the RNP complex formed by (a) and (b).

The target of gene editing to which the method of the present invention is applied is not particularly limited, and can be performed in vitro or in vivo.

The step of deaminating a target C base and/or a target A base on a VPF polynucleotide using a base editing system comprises: delivering an expression vector comprising a polynucleotide encoding a fusion protein or variant thereof, an expression vector comprising a polynucleotide encoding a guide nucleotide, into an object to be edited; preferably, the expression vector is delivered to the subject to be edited by one or more of lipofection, electroporation, viral transduction, microinjection, particle bombardment, biolistic transformation.

In some embodiments, the method is performed in cells in culture, i.e., the object to be edited is a cell, which may be a somatic cell or a germ cell, which may be an animal cell or a human cell; further preferably, the cell is an RPE cell or a Muller cell.

In some embodiments, a gene delivery vehicle can be used to deliver a polynucleotide described herein to a cell or tissue. As used herein, "gene delivery," "gene transfer," "transduction," and the like, refer to the introduction of exogenous polynucleotides into a host cell, such as vector-mediated gene transfer (by, for example, viral infection/transfection, or various other protein-based or lipid-based gene delivery complexes) and techniques that facilitate the delivery of "naked" polynucleotides (such as electroporation, "gene gun" delivery, and various other techniques for introducing polynucleotides). The introduced polynucleotide may be stably or transiently maintained in the host cell. Stable maintenance generally requires that the introduced polynucleotide comprise an origin of replication compatible with the host cell or a replicon, such as an extrachromosomal replicon (e.g., plasmid) or nuclear or mitochondrial chromosome, that is incorporated into the host cell. Many "vectors" are known to mediate gene transfer to mammalian cells, as is known in the art and described herein.

The method of the invention is carried out in vivo and may act on somatic or germ cells, preferably, the method is carried out in a mammal; further preferably, the mammal is a rodent; still further preferably, the mammal is a human. Further preferably, the method targets age related macular degeneration disease-associated cells in a mammal.

The invention also provides a cell obtained by the VPF gene editing method.

The VPF overexpression associated disease is for example cancer or an ophthalmic disease. Such as lung cancer, thyroid cancer, breast cancer, hemangioma. The ophthalmic disease is for example macular degeneration. In one embodiment, the macular degeneration is age related macular degeneration.

The present invention also provides a method of preventing or treating a disease associated with VPF overexpression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a base editing system as in the methods described above or a cell as described above.

In the present invention, the base editing system or cell may also be used in combination with other drugs.

In the application provided by the invention, the base editing system can be a single effective component, and can also be combined with other active components to form a combined preparation. The amount of active ingredient in the composition will generally be a safe and effective amount which should be adjusted by the person skilled in the art, for example, the amount of active ingredient administered will generally depend on the weight of the patient, the type of application, the condition and severity of the disease.

The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention.

Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments, and is not intended to limit the scope of the present invention; in the description and claims of the present application, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise.

When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention. Example 1: base editing System mutation VPF Generation stop codon

sgRNA design and vector construction

Design of sgrnas using base editing knock-out genes requires consideration of several factors: firstly, the nucleotides CAA, CAG, CGA, TGG, TCA and TAC which can form a stop codon must be positioned in the same triplet code; secondly, the editing base is positioned in a window of an editing system; thirdly, the Adjacent Motif (PAM) of the nuclease-recognized span sequence is different. Table 1 lists the sequences in which stop codons or/and mutant start codons can be induced, and the subsequent sgRNA design was obtained with reference to these 42 sequences. Only nucleases targeting the PAM sequence to NGG are shown here (FIG. 1). Aiming at a cytosine base editing system, 10 target sites capable of inducing stop codons are provided, and the corresponding sequence numbers are respectively SEQ ID NO.1-SEQ ID NO.10. For CGBE system, there are 3 target sites that can induce stop codon, corresponding sequences, named SEQ ID NO.11-SEQ ID NO.13, respectively. Sgrnas designed for different editing systems knockout VPFs are shown in table 2.

TABLE 1 sequences in which stop codons and/or mutant start codons can be induced

Inducible stop codon and the sequence position (5 '-3') of the initiation codon	Final purpose of	Sequence numbering
			Tcgcactgaaacttttcgtccaacttctgggctgttctcgctt＊	Generation of stop codon	SEQ ID NO.21
ttatgcggatcaaacctcaccaaggccagcacataggagagat	Generation of stop codon	SEQ ID NO.22
			caaagaaagatagagcaagacaagaaaagtaagtggccctgac	Generation of stop codon	SEQ ID NO.23
ttcgaggaaagggaaaggggcaaaaacgaaagcgcaagaaatc	Generation of stop codon	SEQ ID NO.24
			ggagaaagcatttgtttgtacaagatccgcagacgtgtaaatg	Generation of stop codon	SEQ ID NO.25
cagtcgcgctgacggacagacagacagacaccgcccccagccc	Generation of stop codon	SEQ ID NO.26
			acgcggcggcgagccgcgggcaggggccggagcccgcgcccgg	Generation of stop codon	SEQ ID NO.27
gctcgggccgggaggagccgcagccggaggagggggaggagga	Generation of stop codon	SEQ ID NO.28
			aggaagaggagagggggccgcagtggcgactcggcgctcggaa	Generation of stop codon	SEQ ID NO.29
ctccagccgcgcgcgctccccaggccctggcccgggcctcggg	Generation of stop codon	SEQ ID NO.30
			ctttctgtcctcagtggtcccaggctgcacccatggcagaagg	Generation of stop codon	SEQ ID NO.31
ccatggcagaaggaggagggcagaatcatcacgaaggtgagtc	Generation of stop codon	SEQ ID NO.32
			tgaagttcatggatgtctatcagcgcagctactgccatccaat	Generation of stop codon	SEQ ID NO.33
agaccctggtggacatcttccaggagtaccctgatgagatcga	Generation of stop codon	SEQ ID NO.34
			aggagtccaacatcaccatgcaggtgggcatctttgggaagtg	Generation of stop codon	SEQ ID NO.35
ggatcaaacctcaccaaggccagcacataggagagatgagctt	Generation of stop codon	SEQ ID NO.36
			taggagagatgagcttcctacagcacaacaaatgtgaatgcag	Generation of stop codon	SEQ ID NO.37
atttgtttgtacaagatccgcagacgtgtaaatgttcctgcaa	Generation of stop codon	SEQ ID NO.38
			actcgcgttgcaaggcgaggcagcttgagttaaacgaacgtac	Generation of stop codon	SEQ ID NO.39
aggagagggggccgcagtggcgactcggcgctcggaagccggg	Generation of stop codon	SEQ ID NO.40
			ggggaggaagagtagctcgccgaggcgccgaggagagcgggcc	Generation of stop codon	SEQ ID NO.41
catcctgtgtgcccctgatgcgatgcgggggctgctgcaatga	Generation of stop codon	SEQ ID NO.42
			gacaagaaaaaaaatcagttcgaggaaagggaaaggggcaaaa	Generation of stop codon	SEQ ID NO.43
gaaagggaaaggggcaaaaacgaaagcgcaagaaatcccggta	Generation of stop codon	SEQ ID NO.44
			aagaggagagggggccgcagtggcgactcggcgctcggaagcc	Generation of stop codon	SEQ ID NO.45
gcgctcggaagccgggctcatggacgggtgaggcggcggtgtg	Generation of stop codon	SEQ ID NO.46
			ccatgaactttctgctgtcttgggtgcattggagccttgcctt	Generation of stop codon	SEQ ID NO.47
ttctgctgtcttgggtgcattggagccttgccttgctgctcta	Generation of stop codon	SEQ ID NO.48
			tgctctctttctgtcctcagtggtcccaggctgcacccatggc	Generation of stop codon	SEQ ID NO.49
agaaatcccggtataagtcctggagcgtgtacgttggtgcccg	Generation of stop codon	SEQ ID NO.50
			cccgctgctgtctaatgccctggagcctccctggcccccagta	Generation of stop codon	SEQ ID NO.51
tcggcgctcggaagccgggctcatggacgggtgaggcggcggt	Generation of stop codon	SEQ ID NO.52
			tttttttattttccagaaaatcagttcgaggaaagggaaaggg	Generation of stop codon	SEQ ID NO.53
gcagtccctgtgggccttgctcagagcggagaaagcatttgtt	Generation of stop codon	SEQ ID NO.54
			acaccgcccccagccccagctaccacctcctccccggccggcg	Generation of stop codon	SEQ ID NO.55
ggagccttgccttgctgctctacctccaccatgccaaggtaag	Generation of stop codon	SEQ ID NO.56
			tggatgtctatcagcgcagctactgccatccaatcgagaccct	Generation of stop codon	SEQ ID NO.57
tggtggacatcttccaggagtaccctgatgagatcgagtacat	Generation of stop codon	SEQ ID NO.58
			agtaccctgatgagatcgagtacatcttcaagccatcctgtgt	Generation of stop codon	SEQ ID NO.59
Ggtataagtcctggagcgtgtacgttggtgcccgctgctgtct	Generation of stop codon	SEQ ID NO.60
			Cccgcagctgaccagtcgcgctgacggacagacagacagacac	Disruption of the initiation codon	SEQ ID NO.61
ccggtcgggcctccgaaaccatgaactttctgctgtcttgggt	Disruption of the initiation codon	SEQ ID NO.62

Note: underlined in Table 1 represents triplet codons or start codons that can form stop codons

Table 2 knock-out sgrnas designed for VPF gene using different base editing systems

The corresponding oligo sequence was synthesized for the designed target site, and the upstream and downstream sequences were annealed by the program (95 ℃ C., 5min 95-85 ℃ at-2 ℃/s;85 ℃ C. -25 ℃ at-0.1 ℃/s; hold at 4 ℃) and ligated to PGL3-U6-sgRNA-GFP vector linearized with BsaI (NEB: R0539L). The linking system is as follows: t4 ligation buffer (NEB: M0202L) 1. Mu.L, linearized vector 20ng, annealed oligo fragment (10. Mu.M) 5. Mu.L, T4 ligase (NEB: M0202L) 0.5. Mu.L, ddH ₂ The amount of O was made up to 10. Mu.L. Ligation was carried out overnight at 16 ℃. The connected vector is transformed, selected, identified, and identified by the primer U6 vector as the upstream sequence: 5-. The concentration of the shake bacteria extraction plasmid (Axygene: AP-MN-P-250G) of the positive clone is determined for later use.

Culture and transfection of RPE cell lines or Muller cell lines

Commercial RPE cells (ARPE-19) were seeded and cultured with Muller cells (MIO-M1) in DMEM high-sugar medium (HyClone, SH30022.01B) supplemented with 10% FBS, which contained penicillin (100U/M1) and streptomycin (100. Mu.g/ml). Pre-transfection fractionAnd (4) transferring the mixture into a 6-well plate, and performing transfection when the density reaches 70% -80%. The medium was changed to antibiotic-free medium two hours before transfection. Transfection Lipofectamine is exemplified by lipofection, as per Lipofectamine ^TM The instruction manual of 2000Transfection Reagent (Invitrogen, 11668-019) mixes 2. Mu.g of base editing protein plasmid (i.e. cytosine fusion protein plasmid or CGBE fusion protein plasmid) and 1. Mu.g of pGL3-U6-sgRNA-GFP plasmid, co-transfects to each well of cells, changes the solution after 6-8 hours, and sorts positive cells by flow after 72 hours. Two bases editors were selected for each type, one was conventionally designed cytosine fusion protein plasmid A3A-BE4max (adddge: # 157943), and one was conventionally designed CGBE fusion protein plasmid CGBE-A3A (SEQ ID NO.18 of the sequence reference 202210415558.0 patent); another option, which can significantly reduce off-target, is an editor that chimes deaminase to the middle position of Cas9, the cytosine fusion protein plasmid is: CE-A3A-BE4max (amino acid sequence shown in SEQ ID No. 18), CGBE fusion protein plasmid CE-CGBE-A3A (amino acid sequence shown in SEQ ID No. 20).

3. Measurement of editing efficiency

The collected cells were genotyped by lysis with a composition of 50mM KCl,1.5mM MgCl ₂ 1.0 mM Tris pH 8.0,0.5% Nonidet P-40,0.5% Tween 20, 100. Mu.g/ml protease K. The fragments containing the target site were amplified by PCR and then deeply sequenced.

Through sequencing data analysis, it is found that for 13 sites that can be induced into stop codons in the RPE cell line, editing can be effectively realized by using both types of cytosine base editors. Meanwhile, the editing efficiency of 5 sites, i.e., VPF _1, VPF _3, VPF _7, VPF _10and VPF _12, was found to be more than 50% (FIG. 2).

In Muller cell lines, editing was also efficiently achieved using both types of cytosine base editors for the 13 sites that could be induced into the stop codon. The editing efficiency was reduced in the Muller cell line compared to the RPE cell line, and the efficiencies of the 5 sites VPF _1, VPF _3, VPF _7, VPF _10, VPF _12were relatively high.

Example 2: base editing System mutations VPF disruption initiation codon

sgRNA design and vector construction

The position of an initiation codon is fixed, the number of designed sgRNAs is limited, wherein the sgRNAs are named as VPF _14 and VPF _15 suitable for a pyrimidine base editing system, an adenine base editing system and a CGBE base editing system, and the corresponding sequences are SEQ ID NO.14-SEQ ID NO.15. VPF-16 is only suitable for the adenine base editing system and has the sequence of SEQ ID NO.16. A schematic diagram of the different editing systems for knocking out VPFA gene is shown in FIG. 1.

The corresponding oligo sequence was synthesized for the designed target site, and the upstream and downstream sequences were annealed by the program (95 ℃ C., 5min 95-85 ℃ at-2 ℃/s;85 ℃ C. -25 ℃ at-0.1 ℃/s; hold at 4 ℃) and ligated to PGL3-U6-sgRN-GFP vector linearized with BsaI (NEB: R0539L). The linking system is as follows: t4 ligation buffer (NEB: M0202L) 1. Mu.L, linearized vector 20ng, annealed oligo fragment (10. Mu.M) 5. Mu.L, T4 ligase (NEB: M0202L) 0.5. Mu.L, ddH ₂ The amount of O was made up to 10. Mu.L. Ligation was carried out overnight at 16 ℃. The connected vector is transformed, selected, identified, and identified by the primer U6 vector as the upstream sequence: 5 'TTTCCCATGATTCCTTCAT-3' (SEQ ID NO. 17), the downstream sequence is that of the corresponding oligo. The concentration of the shake bacteria extraction plasmid (Axygene: AP-MN-P-250G) for positive clone is determined for later use.

Culture and transfection of RPE cell lines or Muller cell lines

Commercial RPE cells (ARPE-19) and Muller cells (MIO-M1) were inoculated and cultured in DMEM high-sugar medium (HyClone, SH30022.01B) supplemented with 10% FBS, which contained penicilin (100U/ml) and streptomycin (100. Mu.g/ml). The cells are divided into 6-well plates before transfection, and transfection is carried out when the density reaches 70% -80%. The medium was changed to antibiotic-free medium two hours before transfection, which was exemplified by lipofection. According to Lipofectamine ^TM 2000 The manual of Transfection Reagent (Invitrogen, 11668-019) is prepared by mixing 2 μ g base editing protein plasmid (cytosine fusion protein plasmid, adenine fusion protein plasmid or CGBE fusion protein plasmid) and 1 μ g pGL3-U6-sgRNA-GFP plasmid, co-transfecting into each well of cells, changing the solution after 6-8 hr, and flow-sorting positive cells after 72 hr. Each type of base editor selects a conventional design and can significantly reduce off-target, three of the conventional designs being: A3A-BE4max (addge: # 157943), ABEmax (addge: # 164415), CGBE-A3A (SEQ ID NO.18 of the sequence reference 202210415558.0 patent). Another editor that can significantly reduce off-target, chimeric deaminase to Cas9 middle position, is: CE-A3A-BE4max (amino acid sequence shown in SEQ ID NO. 18), CE-ABE (amino acid sequence shown in SEQ ID NO. 19), and CE-CGBE-A3A (amino acid sequence shown in SEQ ID NO. 20).

3. Measurement of editing efficiency

The collected cells were genotyped by lysis with a composition of 50mM KCl,1.5mM MgCl ₂ 1.0 mM Tris pH 8.0,0.5% Nonidet P-40,0.5% Tween 20, 100. Mu.g/ml protease K. PCR amplifies the fragment containing the target site, and then carries out deep sequencing.

Analysis of the sequencing data revealed that both VPF _14 and VPF _15, which could be targeted against the 3 base editing system, could be efficiently edited in the RPE cell line, with the editing efficiency of VPF _14 site being higher than that of VPF _15 (shown in fig. 4). For the VPF-16 site, both types of adenine base editors efficiently achieved editing (FIG. 5).

In Muller cell lines, both VPF _14 and VPF _15 could be efficiently edited for sites that could be targeted by all 3 systems, with the editing efficiency of VPF _14 site being higher than VPF _15 (shown in fig. 6). For the VPF-16 site, both types of adenine base editors efficiently achieved editing (FIG. 7).

Example 3: detection of VPF expression level after mutation by enzyme-linked immunosorbent assay

1. Screening of monoclonal cells

As described in examples 1 and 2, transfected RPE cells were flow sorted for positive cells, single cells were plated in 96-well plates, and two weeks later, a portion of the cells were genotyped by lysis, with the lysate composition 50mM KCl,1.5mM MgCl ₂ 1.0 mM Tris pH 8.0,0.5% Nonidet P-40,0.5% Tween 20, 100. Mu.g/ml protease K. Selecting the homozygous mutant cell strain for expanding culture. Against induction intoTwo sites of the termination codon, VPF-7 and VPF _12, were selected. For the mutant start codon, the VPF 16 site was chosen.

2. Enzyme-linked immunosorbent assay VPF expression

And carrying out amplification culture on the selected homozygous knockout RPE cell strain. Expression of VPF was determined using an enzyme-linked immunosorbent assay (ELISA). The brief steps are as follows: the panels required for the test were removed from the sealed bag which had equilibrated to room temperature, the unused panels and desiccant were returned to the aluminum foil bag to compact the self-sealing strips, the bag was sealed, and the bag was returned to 4 ℃. And adding standard substance and general specimen diluent into blank holes, adding samples or standard substances with different concentrations (100 ul/hole) into the other corresponding holes, sealing the reaction holes by using sealing plate adhesive paper, and incubating for 90 minutes in a constant temperature box at 37 ℃ in a dark place. Biotinylated antibody working solutions were prepared 20 minutes earlier. The plate was washed 5 times. The biotinylated antibody diluent was added to the blank wells and the biotinylated antibody working solution (100 ul/well) was added to the remaining wells. The reaction wells were sealed with new sealing plate gummed paper and incubated at 37 ℃ in a thermostated container for 60 minutes in the absence of light. Enzyme conjugate working solutions were prepared 20 minutes earlier. Placed in the dark at room temperature (22-25 ℃). The plate was washed 5 times. The blank wells were filled with enzyme conjugate diluent and the remaining wells were filled with enzyme conjugate working solution (100 ul/well). The reaction wells were sealed with new sealing plate gummed paper, incubated at 37 ℃ in a thermostated container for 30 minutes in the absence of light. And (4) turning on a power supply of the microplate reader, preheating the instrument, and setting a detection program. The plate was washed 5 times. 100ul of chromogenic substrate (TMB) per well was added, and incubated at 37 ℃ in a thermostat for 15 minutes in the absence of light. 100 ul/well of the reaction termination solution was added, and the OD450 value was measured immediately after mixing (within 3 minutes). The reading result is stored in the instrument and a paper result is printed. And after the experiment is finished, putting the unused reagent back to the refrigerator according to the specified preservation temperature and preserving until the expiration date is finished. It is recommended to preserve the microplate frame for the next or future test.

By analyzing the data, different types of base editing cell lines could achieve the knockout of the VPF protein (shown in fig. 8).

Example 4: safety analysis of base-edited VPF Gene

For the cell line obtained in example 3, the genomic DNA of the homozygous mutant cell line was extracted by using a Tiangen blood/cell/tissue genomic DNA extraction kit (DP 304), and then sent to Beijing AnnuoYou for whole genome sequencing, wherein the sequencing depth was 25-30x. The sequenced raw data were aligned to the human reference genome (GRCh 38/hg 38) by BWAv0.7.16. SNP sites were analyzed by the GATK HaplotpypeCaller software.

By analyzing the sequencing data, it was found that the SNP generated using the chimeric cytosine base editor (CE-A3A-BE 4max, CE-CGBE-A3A) was close to the wild type and much lower than the conventional type base editor (A3A-BE 4max, CGBE-A3A). The use of the chimeric editor is suggested to be of greater value for subsequent clinical applications. For the adenine base editor, both types of editors produced a much lower number of SNPs than the cytosine base editor, which correlates with the adenine base editor being less off-target at the DNA level (shown in fig. 9).

In summary, it can be seen that: according to the method, the sgRNA/BE protein complex (RNP) is introduced into an RPE cell line or a Muller cell line in a lipofection or electroporation transfection mode by utilizing guide nucleotides (sgRNA) and base editing proteins, so that the VPF gene can BE efficiently knocked out, and meanwhile, no obvious off-target is detected at the DNA and RNA levels by utilizing a chimeric base editor, so that the purpose of knocking out can BE safely realized. Therefore, the VPF gene is knocked out by using the base editing technology, and safe and effective treatment means is provided for AMD diseases or is expected to be developed into a safe and effective anti-tumor biological preparation by combining the modes of viral vectors, injection and the like, so that the VPF gene knock-out method has obvious application prospect and clinical application value.

The above examples are intended to illustrate the disclosed embodiments of the invention and are not to be construed as limiting the invention. In addition, various modifications of the invention set forth herein, as well as variations of the methods of the invention, will be apparent to persons skilled in the art without departing from the scope and spirit of the invention. While the invention has been specifically described in connection with various specific preferred embodiments thereof, it should be understood that the invention should not be unduly limited to such specific embodiments. Indeed, various modifications of the above-described embodiments which are obvious to those skilled in the art to which the invention pertains are intended to be covered by the scope of the present invention.

Claims

1. A method of editing a VPF gene, comprising deaminating a target C base and/or a target a base on a VPF polynucleotide using a base editing system to introduce a stop codon or a point mutation start codon in the coding region of the VPF gene; the base editing system includes:

2. The method of claim 1, wherein the stop codon introduced is TAA, TAG or TGA; and/or, the initiation codon is ATG or CTG.

3. The method according to claim 1, wherein the fusion protein is selected from one or more of a cytosine fusion protein, an adenine fusion protein or a cytosine transversion fusion protein; the base editing system corresponding to each fusion protein is a cytosine base editing system, an adenine base editing system or a CGBE base editing system.

4. The method of claim 1, wherein the deaminase fragment is a cytosine deaminase or an adenine deaminase; preferably, the cytosine deaminase is selected from one or more of the following: APOBEC1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D, APOBEC3F, APOBEC3G, APOBEC3H, APOBEC4, activation-induced deaminase or pmCDA1;

and/or the adenine deaminase is selected from wild-type tadA, mutant tadA, or a complex wtTadA-tadA consisting of the two.

5. The method of claim 1, wherein the Cas9 fragment and the deaminase fragment are linked by a linker peptide.

6. The method of claim 3, further comprising any one or more of:

1) The structure of the cytosine fusion protein is NH2- [ nuclear localization signal ] - [ first nCas9 fragment ] - [ catenin ] - [ cytosine deaminase fragment ] - [ catenin ] - [ second nCas9 fragment ] - [ GS peptide segment ] - [ UGI peptide segment ] - [ nuclear localization signal ] -COOH; preferably, the amino acid sequence of the cytosine fusion protein is shown as SEQ ID No. 18;

2) The adenine fusion protein has a structure of NH2- [ nuclear localization signal ] - [ first nCas fragment ] - [ linker peptide ] - [ adenine deaminase fragment ] - [ linker peptide ] - [ second nCas9 fragment ] - [ GS peptide segment ] - [ nuclear localization signal ] -COOH; preferably, the amino acid sequence of the adenine fusion protein is shown as SEQ ID No. 19;

3) The cytosine transversion fusion protein sequentially comprises a first Cas9 fragment, a chimeric insertion fragment and a second nickase fragment from an N end to a C end, wherein the chimeric insertion fragment comprises a deaminase fragment and a uracil DNA binding protein fragment; preferably, the amino acid sequence of the cytosine transversion fusion protein is shown in SEQ ID No. 20.

7. The method of claim 1, wherein the targeting sequence of the guide nucleotide is selected from the group consisting of SEQ ID No.21 to SEQ ID No.62.

8. The method of claim 3, further comprising any one or more of:

1) In the cytosine base editing system, the target sequence of the guide nucleotide is at least any one of SEQ ID NO.1-SEQ ID NO.10, SEQ ID NO.14 and SEQ ID NO. 15;

2) In the adenine base editing system, the target sequence of the guide nucleotide is shown as SEQ ID NO.14, SEQ ID NO.15 and SEQ ID NO. 16;

3) In the CGBE base editing system, the targeting sequence of the guide nucleotide is shown as SEQ ID NO.11-SEQ ID NO.15.

9. The method of claim 1, wherein the step of deaminating the target C and/or A base on the VPF polynucleotide using a base editing system comprises: delivering an expression vector comprising a polynucleotide encoding a fusion protein or variant thereof, an expression vector comprising a polynucleotide encoding a guide nucleotide, into an object to be edited; preferably, the expression vector is delivered into the subject to be edited by one or more of lipofection, electroporation, viral transduction, microinjection, particle bombardment, biolistic transformation.

10. The method of claim 1, wherein the method is performed in vitro; and/or the object to be edited is a cultured cell; preferably, the cells are RPE cells or Muller cells.

11. A cell obtained by a method of editing a VPF gene according to any one of claims 1 to 10.

12. Use of the cell of claim 11 for the preparation of a product for the prevention or treatment of a disease associated with VPF overexpression.

13. The use according to claim 12, wherein the disease associated with VPF overexpression is cancer or an ophthalmic disease; preferably, the ophthalmic disease is macular degeneration; more preferably, the macular degeneration is age-related macular degeneration.