CN109706185B - Method for realizing gene knockout based on base editing system mutation initiation codon and application - Google Patents

Abstract

A method for realizing gene knockout based on base editing system mutation initiation codon and application thereof. The gene knockout method is based on an accurate single base editing technology, and carries out mutation aiming at an encoding gene initiation codon ATG, so that the translation initiation function can not be normally exerted, and the goal of knocking out a target gene is achieved. The method specifically comprises the following steps: selecting a target sequence which is located in a translation initiation region of a gene to be knocked out and is 20bp-NGG or CCN-20bp, and enabling the target sequence to comprise a complete initiation codon ATG; and (3) positioning ABE or BE4 to a target sequence by using the sgRNA sequence, carrying out A-to-G, T-C or G-to-A mutation on a target single base in the ATG of the initiation codon of the target gene, and destroying the initiation codon so as to realize gene knockout. The knockout method is more efficient, more accurate and less in off-target effect, and realizes knockout of genes which cannot be knocked out by a part of conventional methods.

Description

Method for realizing gene knockout based on base editing system mutation initiation codon and application

Technical Field

The invention relates to a gene knockout strategy, in particular to a gene knockout method based on initiation codon base editing and application thereof.

Background

Gene knockout is the loss or inactivation of a gene of an organism by various molecular manipulations using molecular genetic techniques, and further, the inability to function normally.

In the conventional gene knock-out, it is mainly performed by a homologous recombination method. The method begins with the construction of a DNA vector containing the desired mutation, which contains at least 2kb of homology with the target sequence (Hall et al, 2009). Constructs can be delivered to stem cells by electrotransfection or microinjection. The DNA construct is then recombined into the cellular DNA in time by virtue of the cell's own repair. However, this is a inefficient process, since intracellular homologous recombination accounts for only 10 of DNA recombination^-2To 10^-3(Hall et al.,2009)。

Subsequently, editing techniques based on site-specific nucleases were developed. Currently, Zinc Finger Nucleases (ZFNs) (Santiago et al, 2008), Transcription activator-like effector nucleases (TALENs) (joint and Sander,2012), and aggregation regularly spaced short palindromic repeats (CRISPRs) (Gaj et al, 2013) are included. These three methods involve the precise targeting of DNA sequences to introduce double-stranded DNA breaks (DSBs) and then attempt to repair the double-stranded breaks using cellular repair mechanisms, usually by non-homologous end joining (NHEJ). This repair may result in insertion or deletion of base pairs, which in turn causes a frameshift mutation. Such mutations can disable the gene for knock-out purposes (Gaj et al, 2013) of a particular gene. In addition, CRISPR achieves knock-in (knock-in) by homologous recombination for repair in the presence of a template. Compared with homologous recombination, the process is more efficient, and then allele knockout can be realized more easily.

The CRISPR/Cas9 system is the technology with the fastest development and the widest application in the field of gene editing due to the characteristics of simplicity, high efficiency, low cost and the like, and the revolution of the field of gene editing is initiated. Currently, the CRISPR/Cas9 system has been successfully used for studies on DNA knock-out, knock-in, substitution, modification, labeling, RNA modification, and gene transcription regulation (Hsu et al, 2014; Komor et al, 2017 a). And has been successfully applied to gene editing in a number of species (Barrangou and Doudna, 2016; Komor et al, 2017 a). However, due to the low HDR efficiency (integration rarely occurs) and the easy generation of random insertions and deletions (indels) by the non-homologous end joining mechanism, new bases may be randomly introduced near the breakpoint, resulting in inaccurate gene editing. In addition, CRISPR/Cas 9-mediated gene editing has some off-target effects (Gorski et al, 2017).

Disclosure of Invention

One of the purposes of the invention is to provide a high-efficiency and accurate gene knockout strategy.

The base editing technology is a novel gene editing tool constructed based on CRISPR/Cas9 technology. There are currently Cytosine Base Editors (CBEs) and guanine base editors (ABEs). The cytosine base editor is the fusion of dCas9 or Cas9 nickase with rat cytidine deaminase APOBEC1, which converts cytosine (C) to uracil (U) by deamination, after which uracil (U) is converted to thymine (T) by DNA replication or repair. Similarly, it can also convert guanine (G) to adenine (A). It is capable of introducing point mutations in a target gene accurately and efficiently without the need for double-stranded DNA breaks or any donor template, exhibiting great gene editing potential (Komor et al, 2016). The cytosine base editor does not need to cut DNA to cause DSB, the formed indel is lower than 1 percent, and the realized gene editing is more accurate (Komor et al, 2016); moreover, this approach reduces off-target efficiency to 10-fold below natural background, achieving safer gene editing (Nishida et al, 2016). The most commonly used at present is BE3(Komor et al, 2016), more efficient BE4(Komor et al, 2017 b).

The adenine base editor induces nucleotide changes at a wide range of target genomic loci in human cells (gaudell et al, 2017). In the ABE system, TadA: the TadA heterodimer is directed to the target site by the Cas9 n/single guide rna (sgrna) complex, and the engineered TadA converts adenine (a) to inosine (I) in single stranded genomic DNA as an active tRNA adenosine deaminase, subsequently leading to a guanine (G) mutation in the genome during DNA repair or DNA replication (gaudell et al, 2017). Similarly, it can also convert thymine (T) to cytosine (C). To this end, the BE and ABE systems, which can programmably introduce all four transitions (C to T, G to A, A to G and T to C) on a target gene of a genome, greatly expand the base editing function.

Based on the accurate and specific single base editing mediated by the CBEs or ABEs system, the inventor skillfully designs a gene knockout strategy: mutating the ATG of the target gene initiation codon into ATA by G-to-A mutation by utilizing a BE4 system; or ATG to ACG by T to C mutation or ATG to GTG by A to G mutation using the ABE system. The translation initiation of the gene is prevented by mutating the initiation codon, thereby realizing the purpose of gene silencing and knockout.

According to a first aspect of the present invention, there is provided a gene knockout method comprising:

determining an initiation codon of a gene to be knocked out, and searching and designing a 20bp-NGG target sequence (PAM sequence) to enable the PAM sequence to comprise a complete initiation codon ATG; and positioning the ABE to a target sequence by utilizing the sgRNA sequence to change a target single base A in the initiation codon into G, so that the initiation codon ATG is mutated into GTG to realize the gene knockout purpose.

Alternatively, determining the initiation codon of the gene to be knocked out, and searching and designing a CCN-20bp target sequence (PAM sequence) to enable the target sequence to contain a complete initiation codon ATG; and positioning ABE and BE4 to a target sequence by using the sgRNA sequence to change a target single base T in an initiation codon into C or G into A, so that the initiation codon ATG is mutated into ACG or ATA to realize the gene knockout purpose.

The target single base A or T is preferably located at positions 4-7 of the target sequence if ABE is used, and the target single base G is preferably located at positions 4-8 of the target sequence if BE4 is used;

the sgRNA sequence is a 20bp sequence which is complementary and corresponds to a target sequence.

According to the invention, ABE can be selected from pCMV-ABEmax SEQ ID NO.1

BE4 is selected from: pCMV-AncBE4max SEQ ID NO. 2; pCMV-BE4max SEQ ID NO.3

The method according to the invention can be used to knock out the following eleven target genes: human APOE, PD1, LAG3, TIGIT, VISTA, CD224, CD160, SOX9, HDAC1, and mouse TIM3 and LAG3, the sgRNA sequences corresponding thereto are complementary to the target gene sequences shown in sequences one to ten, respectively.

According to a second aspect of the invention, there is provided the use of the above method for knock-out of a human APOE, PD1, LAG3, TIGIT, VISTA, CD224, CD160, SOX9, HDAC1 gene in the cell line HEK 293T.

According to a third aspect of the invention, there is provided the use of the above method for knock-out of a human APOE, PD1, LAG3, TIGIT, VISTA, CD224, CD160, SOX9, HDAC1 gene in a human T cell.

According to a fourth aspect of the present invention there is provided an isolated T cell or cell line or subculture thereof obtained according to the above use.

According to a fifth aspect of the present invention, there is provided a kit for gene knockout, comprising the sgRNA, ABE, BE3, BE4 described above (corresponding to a gene to BE knocked out) and a corresponding amplification reagent.

The invention utilizes the base editing technology developed on the basis of CRISPR/Cas9, and changes and destroys the ATG of the initiation codon through the accurate single base mutation from A to G, T to C or from G to A, thereby establishing a gene knockout strategy which is more efficient, more accurate and less in off-target effect than CRISPR/Cas 9.

Reference to the literature

Barrangou,R.,Doudna,J.A.,2016.Applications of CRISPR technologies in research and beyond.Nature Biotechnology 34,933.

Gaj,T.,Gersbach,C.A.,Barbas,C.F.,2013.ZFN,TALEN,and CRISPR/Cas-based methods for genome engineering.Trends in Biotechnology 31,397-405.

Gaudelli,N.M.,Komor,A.C.,Rees,H.A.,Packer,M.S.,Badran,A.H.,Bryson,D.I.,Liu,D.R.,2017.Programmable base editing of A·T to G·C in genomic DNA without DNA cleavage.Nature551,464.

Gorski,S.A.,Vogel,J.,Doudna,J.A.,2017.RNA-based recognition and targeting:sowing the seeds of specificity.Nature Reviews Molecular Cell Biology 18,215.

Hall,B.,Limaye,A.,Kulkarni,A.B.,2009.Overview:generation of gene knockout mice.Curr Protoc Cell Biol Chapter 19,Unit 19 12 19 12 11-17.

Hsu,Patrick D.,Lander,Eric S.,Zhang,F.,2014.Development and Applications of CRISPR-Cas9for Genome Engineering.Cell 157,1262-1278.

Joung,J.K.,Sander,J.D.,2012.TALENs:a widely applicable technology for targeted genome editing.Nature Reviews Molecular Cell Biology 14,49.

Komor,A.C.,Badran,A.H.,Liu,D.R.,2017a.CRISPR-Based Technologies for the Manipulation of Eukaryotic Genomes.Cell 168,20-36.

Komor,A.C.,Kim,Y.B.,Packer,M.S.,Zuris,J.A.,Liu,D.R.,2016.Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage.Nature 533,420.

Komor,A.C.,Zhao,K.T.,Packer,M.S.,Gaudelli,N.M.,Waterbury,A.L.,Koblan,L.W.,Kim,Y.B.,Badran,A.H.,Liu,D.R.,2017b.Improved base excision repair inhibition and bacteriophage Mu Gam protein yields C:G-to-T:A base editors with higher efficiency and product purity.Sci Adv 3,eaao4774.

Nishida,K.,Arazoe,T.,Yachie,N.,Banno,S.,Kakimoto,M.,Tabata,M.,Mochizuki,M.,Miyabe,A.,Araki,M.,Hara,K.Y.,Shimatani,Z.,Kondo,A.,2016.Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems.Science 353.

Ren,B.,Yan,F.,Kuang,Y.,Li,N.,Zhang,D.,Zhou,X.,Lin,H.,Zhou,H.,2018.Improved Base Editor for Efficiently Inducing Genetic Variations in Rice with CRISPR/Cas9-Guided Hyperactive hAID Mutant.Molecular Plant 11,623-626.

Santiago,Y.,Chan,E.,Liu,P.-Q.,Orlando,S.,Zhang,L.,Urnov,F.D.,Holmes,M.C.,Guschin,D.,Waite,A.,Miller,J.C.,Rebar,E.J.,Gregory,P.D.,Klug,A.,Collingwood,T.N.,2008.

Targeted gene knockout in mammalian cells by using engineered zinc-finger nucleases.Proceedings of the National Academy of Sciences 105,5809-5814.

Drawings

FIG. 1 is a schematic diagram of the realization of targeted gene knockout using ATG mutation according to the present invention;

FIG. 2 is a schematic structural diagram of pCMV-AncBE4max used in the present invention;

FIG. 3 is a schematic structural view of pCMV-BE4max used in the present invention;

FIG. 4 is a schematic diagram of the structure of pCMV-ABEmax used in the present invention;

FIG. 5 shows an example of flow cytometry detection of GFP positivity by transfecting sgRNA and ABE or BE4 plasmids of the present invention;

FIG. 6 is a diagram showing the gene editing efficiency and editing site analysis of the present invention, taking HDAC1 gene as an example;

FIG. 7 is a diagram showing the gene editing efficiency and editing site analysis in the present invention, taking the SOX9 gene as an example;

FIG. 8 shows the editing efficiency and editing site analysis of monoclonal cells obtained by sorting the ATG (initiation codon of the target gene) according to the present invention, taking the HDAC1 gene as an example;

FIG. 9 shows the editing efficiency and editing site analysis of the monoclonal cell obtained by sorting the ATG editing start codon of the target gene according to the present invention, taking the SOX9 gene as an example;

FIG. 10 shows Western blot analysis of target genes of monoclonal cells edited by ATG, the initiation codon of the target gene obtained by sorting, using HDAC1 gene as an example.

Detailed Description

The embodiments of the present invention will now be described in detail and fully with reference to the accompanying examples, which are provided for illustration of the embodiments of the present invention and are not to be construed as limiting the scope of the invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used are not indicated to the manufacturer, and are considered to be conventional products available through commercial purchase.

The above description is only exemplary of the invention and should not be taken as limiting the invention, as any modification, equivalent replacement, or improvement made within the spirit and principle of the invention should be included in the protection scope of the invention.

Base site directed editing is the use of sgrnas to target ABE or BE4 to or to specific target sites, and the selection and design of the target gene specific sgrnas is the key to the present invention. The sgRNA is selected and designed as follows:

a20 bp-NGG or CCN-20bp target sequence (PAM sequence) containing the initiation codon ATG of the gene is selected, and the target single base A or T is preferably located at the 4 th to 7 th positions of the target sequence by ABE, and the target single base G is preferably located at the 4 th to 8 th positions of the target sequence by BE4 (FIG. 1-FIG. 4).

A 20bp sgRNA sequence complementary to the target sequence was prepared.

For eleven target genes, human APOE, PD1, LAG3, TIGIT, VISTA, CD224, CD160, SOX9, HDAC1 and mouse TIM3 and LAG3, the following target gene sequences were selected to design the corresponding sgRNAs (PAM in bold; candidate mutation codes in italic underlined):

hAPOE

ABE T to C

Sg-1:

SEQ ID NO.4

ABE A to G

Sg-2:

SEQ ID NO.5

hPD1

ABE A to G

Sg-1:

SEQ ID NO.6

hLAG3

BE4 G to A

Sg-1:

SEQ ID NO.7

ABE T to C

Sg-2:

SEQ ID NO.8

hTIGIIT

ABE T to C

Sg-1:

SEQ ID NO.9

BE4 G to A

Sg-2:

SEQ ID NO.10

hVISTA

ABE A to G

Sg-1:

SEQ ID NO.11

hCD224

ABE A to G

Sg-1:

SEQ ID NO.12

Seven, hCD160

ABE A to G

Sg-1:

SEQ ID NO.13

Eight hSOX9

BE4 G to A

Sg-1:

SEQ ID NO.14

Nine mTIM3

BE4 G to A

Sg-1:

SEQ ID NO.15

ABE T to C

Sg-2:

SEQ ID NO.16

Ten mLAG3

BE4G to A

Sg-1:

SEQ ID NO.17

ABE T to C

Sg-2:

SEQ ID NO.18

Eleven HDAC1

ABE A to G

Sg-1:

SEQ ID NO.19

Aiming at the selected target gene sequences, human APOE (item 2), PD1, LAG3 (item 2), TIGIT (item 2), VISTA, CD224, CD160, SOX9, HDAC1, mouse TIM3 (item 2) and LAG3 (item 2), corresponding sgRNA expression vectors are constructed, and different sgRNAs are respectively introduced into pGL3-U6-sgRNA vectors and SEQ ID NO. 20.

Example 1

ABE or BE4 mediated base editing is carried out on the cell strain, and the initiation codon is mutated to realize gene knockout.

The invention carries out the culture and transfection of eukaryotic cells and carries out the gene knockout of cell strains (through electrotransformation or lipofection). The following examples are the methods of lipofection of HEK293T cells into human APOE, PD1, LAG3, TIGIT, VISTA, CD224, CD160, SOX9, HDAC1 and other genes.

(1) HEK293T cells were seeded in DMEM medium containing 10% FBS (HyClone, SH30022.01B) containing penicillin (100U/ml) and streptomycin (100. mu.g/ml).

(2) Cells were plated in 6-well plates the day before transfection. The next day, transfection was performed when the density reached 70% -80%.

(3) According to Lipofectamine^TM2000Transfection Reagent (Invitrogen,11668-019), 2. mu.g of ABE or BE4 plasmid was mixed with 2. mu.g of the corresponding pGL3-U6-sgRNA plasmid, co-transfected into cells, the solution was changed after 6 to 8 hours, the cells were harvested after 72 hours, and the Transfection efficiency of the cells was determined by a flow analyzer (FIG. 5).

(4) Genotyping analysis

A. A portion of the cells was lysed in a lysis buffer (10. mu.M Tris-HCl,0.4M NaCl, 2. mu.M EDTA, 1% SDS) with 100. mu.g/ml proteinase K, extracted with phenol-chloroform and solubilized to 50. mu.l ddH₂And (4) in O.

B. PCR amplification is carried out by using a pair of primers N-For and N-Rev, PCR recovery products are obtained by AxyPrep PCR clean purification, 200ng is uniformly diluted to 20 mu l For denaturation and annealing, and the procedures are as follows: 95 ℃ for 5 min; 95-85 ℃ at-2 ℃/s; at-0.1 ℃/s at 85-25 ℃; hold at 4 ℃.

C. The PCR product was recovered and subjected to A-addition reaction using rTaq. The reaction system of adding A is as follows:

700-800ng PCR recovery product

5μl 10X Buffer(Mg2+PLUS)

4μl dNTP

0.5μl rTaq(TAKARA,R001AM)

Water was added to the reaction system to 50. mu.l.

After incubation at 37 ℃ for 30 min, 1. mu.l of the product was ligated with pMD19-T vector (TAKARA,3271) and DH5 competent cells (TransGen, CD201) were transformed.

D. The single clone is picked, the universal primer M13-F is used for sequencing each target gene mutation, and the sequencing result is as follows (the bold represents PAM; the italic represents the mutant code, and the italic underline represents the mutant base):

1.hAPOE

Sg-1:

Mut:

Sg-2:

Mut:

2.hPD1

Sg-1:

Mut:

3.hLAG3

Sg-1:

Mut:

Sg-2:

Mut:

4.hTIGIT

Sg-1:

Mut:

Sg-2:

Mut:

5.hVISTA

Sg-1:

Mut:

6.hCD224

Sg-1:

Mut:

hCD160 (FIGS. 6 and 8)

Sg-1:

Mut:

8.hSOX9

Sg-1:

Mut:

HDAC1 (FIG. 7, FIG. 9)

Sg-1:

Mut:

(5) Western blot detection knockout effect

Furthermore, when we performed western blot detection on the selected monoclonal cells of HDAC1, the protein of HDAC1 was not detected (fig. 10), and it is shown from the protein level that ATG mutation can successfully achieve target gene knockout.

The results show that: the initiation codon of the target gene is subjected to sgRNA targeted base mutation, so that the target gene cannot play a translation initiation role, and the successful knockout of human APOE, PD1, LAG3, TIGIT, VISTA, CD224, CD160, SOX9 and HDAC1 genes is realized.

Example 2

ABE or BE4 mediated base editing is carried out on primary cells, and the initiation codon is mutated to realize gene knockout.

As a general rule, human T cells are knocked out into primary cells (by electrotransfection or lipofection), as exemplified by electrotransfection.

(1) Separation and purification of PBMC cells:

A. collecting peripheral blood by using an anticoagulation tube, and shaking the collected peripheral blood and the anticoagulant while collecting;

B. mixing peripheral blood cells and lymphocyte separation liquid in equal volume, centrifuging, and sucking centrifuged leucocyte layer cells;

C. and mixing the obtained leucocyte layer cells with a serum-free cell culture medium 1640, centrifuging, and collecting precipitated cells, namely the PBMC cells.

The above separation process was repeated three times.

(2) Enrichment of CD 3-positive cells

A. Adjusting PBMC cell concentration to 50X10⁶cell/ml。

B. 50. mu.l of CD3+ engineered antibodies cocktail was added to 1ml of the solution, mixed well and allowed to stand at room temperature for 5 minutes.

C. Adding 150 mul of magnet into each 1ml of the mixture, uniformly mixing the mixture, standing the mixture for 10 minutes at room temperature,

D. the centrifuge tube was placed on a magnetic rack and allowed to stand for 5 minutes, and the upper cell suspension was aspirated into a new 15ml centrifuge tube.

E. This operation was repeated once.

F. Cells were collected by centrifugation at 300g for 10 min at room temperature.

G. And (6) counting the cells.

(3) Electrotransfer of CD3 positive cells

A. Dispose the electrical swivel system

Add 8. mu.g BE3, BE4 or ABE plasmid and 8. mu.g corresponding pGL3-U6-sgRNA plasmid into 1.5ml centrifuge tube, and add 82. mu.l electrotransfer buffer and 18. mu.l supplement1 according to the instruction of Lonza Amaxa electrotransfer kit, mix well.

B. Harvesting 20X10⁶The cells were placed in a 15ml centrifuge tube, centrifuged at 300g for 10 minutes and the supernatant discarded.

C. The cells were resuspended in the plasmid electrotransfer buffer mixture prepared in A and transferred to an electrotransfer cuvette.

D. The instrument was used for electrotransformation with the Lonza 2B, U-014 program.

E. The cells after electroporation were rapidly transferred to a pre-warmed AIM-V medium supplemented with 10% FBS and cultured in a 37 ℃ 5% carbon dioxide incubator for 2 hours.

F. Cell total fluid after electrotransformation, 1X10⁶Cells were resuspended at density of one/ml and cultured overnight.

(4) Activated culture of T cells

A. After 24 hours of electroporation, 100U/ml IL-2 was added to the medium and CD3/CD28dynabeads were added at a ratio of 1:1 to activate T cells.

B. Half-changing the cell liquid every two days, or supplementing IL-2, and keeping the cell density at 1X10⁶One per ml.

C. After 5 days of activation, the T cells were collected in 15ml centrifuge tubes, placed in a magnetic rack, and the supernatant was slowly transferred to another clean 15ml centrifuge tube and the procedure repeated once.

D. Centrifuge 300g at room temperature for 10 min, discard the supernatant, resuspend the cells in 10% FBS,300U/ml IL-2AIM-V medium, density controlled at 1X10⁶One per ml.

E. Half-changing the cells every two days, or supplementing IL-2, and counting, the cells are maintained at 1X10⁶One per ml.

(5) Genotyping analysis

A. The collected cells were lysed in a lysis solution (10. mu.M Tris-HCl,0.4M NaCl, 2. mu.M EDTA, 1% SDS) with 100. mu.g/ml proteinase K, extracted with phenol-chloroform, and then dissolved in 50. mu.l of deionized water.

B. PCR amplification is carried out by using a pair of primers N-For and N-Rev, PCR recovery products are obtained by AxyPrep PCR clean purification, 200ng is uniformly diluted to 20 mu l For denaturation and annealing, and the procedures are as follows: 95 ℃ for 5 min; 95-85 ℃ at-2 ℃/s; at-0.1 ℃/s at 85-25 ℃; hold at 4 ℃.

C. The PCR product was recovered and subjected to A-addition reaction using rTaq. The reaction system of adding A is as follows:

700-800ng PCR recovery product

5μl 10X Buffer(Mg2+PLUS)

4μl dNTP

0.5μl rTaq(TAKARA,R001AM)

Water was added to the reaction system to 50. mu.l.

After incubation at 37 ℃ for 30 min, 1. mu.l of the product was ligated with pMD19-T vector (TAKARA,3271) and DH5 competent cells (TransGen, CD201) were transformed.

D. The single clone is picked, and the mutation of each target gene of the T cell is sequenced by using a universal primer M13-F, and the sequencing result is as follows (the bold represents PAM; the italic represents a candidate mutation code son; the italic represents a mutation base):

1.hAPOE

Sg-1:

Mut:

Sg-2:

Mut:

2.hPD1

Sg-1:

Mut:

3.hLAG3

Sg-1:

Mut:

Sg-2:

Mut:

4.hTIGIT

Sg-1:

Mut:

Sg-2:

Mut:

5.hVISTA

Sg-1:

Mut:

6.hCD224

Sg-1:

Mut:

7.hCD160

Sg-1:

Mut:

8.hSOX9

Sg-1:

Mut:

9.HDAC1

Sg-1:

Mut:

the results show that: the target gene has sgRNA targeted base mutation, and the gene initiation codon ATG introduces mutation, so as to realize successful gene knockout on human APOE, PD1, LAG3, TIGIT, VISTA, CD224, CD160, SOX9, HDAC1 and the like.

Example 3

Construction of ABE or BE 4-mediated knockout mice

The embryo collection, microinjection, embryo culture, embryo transplantation and the like of the mice are carried out according to the conventional operation. For example, TIM3 and LAG3 genes were used to construct knockout mice.

(1) Microinjection: fertilized eggs were injected with mRNA of ABE or BE4 and TIM 3-specific sgRNA (corresponding to the sequence nine above), or mRNA of ABE or BE4 and LAG 3-specific sgRNA (corresponding to the sequence ten above), respectively. Performing embryo transplantation conventionally;

(2) genotype analysis: extracting genome DNA from the tail of a conventional mouse, amplifying coding regions respectively by PCR, and performing Sanger sequencing, wherein the sequencing result is as follows (the bold represents PAM; the italic represents a mutant coder; and the italic represents a mutant base):

10.mTIM3

Sg-1:

Mut:

Sg-2:

Mut:

11.mLAG3

Sg-1:

Mut:

Sg-2:

Mut:

the above results confirm that mutations were introduced at the start codons of TIM3 and LAG3, and that construction of TIM3 and LAG3 knockout mice was successful.

Sequence listing

<110> institute of science and technology of the national institute of health and science and technology

<120> method for realizing gene knockout based on base editing system mutation initiation codon and application

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 8811

<212> DNA

<213> Artificial sequence ()

<400> 1

atatgccaag tacgccccct attgacgtca atgacggtaa atggcccgcc tggcattatg 60

cccagtacat gaccttatgg gactttccta cttggcagta catctacgta ttagtcatcg 120

ctattaccat ggtgatgcgg ttttggcagt acatcaatgg gcgtggatag cggtttgact 180

cacggggatt tccaagtctc caccccattg acgtcaatgg gagtttgttt tggcaccaaa 240

atcaacggga ctttccaaaa tgtcgtaaca actccgcccc attgacgcaa atgggcggta 300

ggcgtgtacg gtgggaggtc tatataagca gagctggttt agtgaaccgt cagatccgct 360

agagatccgc ggccgctaat acgactcact atagggagag ccgccaccat gaaacggaca 420

gccgacggaa gcgagttcga gtcaccaaag aagaagcgga aagtctctga agtcgagttt 480

agccacgagt attggatgag gcacgcactg accctggcaa agcgagcatg ggatgaaaga 540

gaagtccccg tgggcgccgt gctggtgcac aacaatagag tgatcggaga gggatggaac 600

aggccaatcg gccgccacga ccctaccgca cacgcagaga tcatggcact gaggcaggga 660

ggcctggtca tgcagaatta ccgcctgatc gatgccaccc tgtatgtgac actggagcca 720

tgcgtgatgt gcgcaggagc aatgatccac agcaggatcg gaagagtggt gttcggagca 780

cgggacgcca agaccggcgc agcaggctcc ctgatggatg tgctgcacca ccccggcatg 840

aaccaccggg tggagatcac agagggaatc ctggcagacg agtgcgccgc cctgctgagc 900

gatttcttta gaatgcggag acaggagatc aaggcccaga agaaggcaca gagctccacc 960

gactctggag gatctagcgg aggatcctct ggaagcgaga caccaggcac aagcgagtcc 1020

gccacaccag agagctccgg cggctcctcc ggaggatcct ctgaggtgga gttttcccac 1080

gagtactgga tgagacatgc cctgaccctg gccaagaggg cacgcgatga gagggaggtg 1140

cctgtgggag ccgtgctggt gctgaacaat agagtgatcg gcgagggctg gaacagagcc 1200

atcggcctgc acgacccaac agcccatgcc gaaattatgg ccctgagaca gggcggcctg 1260

gtcatgcaga actacagact gattgacgcc accctgtacg tgacattcga gccttgcgtg 1320

atgtgcgccg gcgccatgat ccactctagg atcggccgcg tggtgtttgg cgtgaggaac 1380

gcaaaaaccg gcgccgcagg ctccctgatg gacgtgctgc actaccccgg catgaatcac 1440

cgcgtcgaaa ttaccgaggg aatcctggca gatgaatgtg ccgccctgct gtgctatttc 1500

tttcggatgc ctagacaggt gttcaatgct cagaagaagg cccagagctc caccgactcc 1560

ggaggatcta gcggaggctc ctctggctct gagacacctg gcacaagcga gagcgcaaca 1620

cctgaaagca gcgggggcag cagcgggggg tcagacaaga agtacagcat cggcctggcc 1680

atcggcacca actctgtggg ctgggccgtg atcaccgacg agtacaaggt gcccagcaag 1740

aaattcaagg tgctgggcaa caccgaccgg cacagcatca agaagaacct gatcggagcc 1800

ctgctgttcg acagcggcga aacagccgag gccacccggc tgaagagaac cgccagaaga 1860

agatacacca gacggaagaa ccggatctgc tatctgcaag agatcttcag caacgagatg 1920

gccaaggtgg acgacagctt cttccacaga ctggaagagt ccttcctggt ggaagaggat 1980

aagaagcacg agcggcaccc catcttcggc aacatcgtgg acgaggtggc ctaccacgag 2040

aagtacccca ccatctacca cctgagaaag aaactggtgg acagcaccga caaggccgac 2100

ctgcggctga tctatctggc cctggcccac atgatcaagt tccggggcca cttcctgatc 2160

gagggcgacc tgaaccccga caacagcgac gtggacaagc tgttcatcca gctggtgcag 2220

acctacaacc agctgttcga ggaaaacccc atcaacgcca gcggcgtgga cgccaaggcc 2280

atcctgtctg ccagactgag caagagcaga cggctggaaa atctgatcgc ccagctgccc 2340

ggcgagaaga agaatggcct gttcggaaac ctgattgccc tgagcctggg cctgaccccc 2400

aacttcaaga gcaacttcga cctggccgag gatgccaaac tgcagctgag caaggacacc 2460

tacgacgacg acctggacaa cctgctggcc cagatcggcg accagtacgc cgacctgttt 2520

ctggccgcca agaacctgtc cgacgccatc ctgctgagcg acatcctgag agtgaacacc 2580

gagatcacca aggcccccct gagcgcctct atgatcaaga gatacgacga gcaccaccag 2640

gacctgaccc tgctgaaagc tctcgtgcgg cagcagctgc ctgagaagta caaagagatt 2700

ttcttcgacc agagcaagaa cggctacgcc ggctacattg acggcggagc cagccaggaa 2760

gagttctaca agttcatcaa gcccatcctg gaaaagatgg acggcaccga ggaactgctc 2820

gtgaagctga acagagagga cctgctgcgg aagcagcgga ccttcgacaa cggcagcatc 2880

ccccaccaga tccacctggg agagctgcac gccattctgc ggcggcagga agatttttac 2940

ccattcctga aggacaaccg ggaaaagatc gagaagatcc tgaccttccg catcccctac 3000

tacgtgggcc ctctggccag gggaaacagc agattcgcct ggatgaccag aaagagcgag 3060

gaaaccatca ccccctggaa cttcgaggaa gtggtggaca agggcgcttc cgcccagagc 3120

ttcatcgagc ggatgaccaa cttcgataag aacctgccca acgagaaggt gctgcccaag 3180

cacagcctgc tgtacgagta cttcaccgtg tataacgagc tgaccaaagt gaaatacgtg 3240

accgagggaa tgagaaagcc cgccttcctg agcggcgagc agaaaaaggc catcgtggac 3300

ctgctgttca agaccaaccg gaaagtgacc gtgaagcagc tgaaagagga ctacttcaag 3360

aaaatcgagt gcttcgactc cgtggaaatc tccggcgtgg aagatcggtt caacgcctcc 3420

ctgggcacat accacgatct gctgaaaatt atcaaggaca aggacttcct ggacaatgag 3480

gaaaacgagg acattctgga agatatcgtg ctgaccctga cactgtttga ggacagagag 3540

atgatcgagg aacggctgaa aacctatgcc cacctgttcg acgacaaagt gatgaagcag 3600

ctgaagcggc ggagatacac cggctggggc aggctgagcc ggaagctgat caacggcatc 3660

cgggacaagc agtccggcaa gacaatcctg gatttcctga agtccgacgg cttcgccaac 3720

agaaacttca tgcagctgat ccacgacgac agcctgacct ttaaagagga catccagaaa 3780

gcccaggtgt ccggccaggg cgatagcctg cacgagcaca ttgccaatct ggccggcagc 3840

cccgccatta agaagggcat cctgcagaca gtgaaggtgg tggacgagct cgtgaaagtg 3900

atgggccggc acaagcccga gaacatcgtg atcgaaatgg ccagagagaa ccagaccacc 3960

cagaagggac agaagaacag ccgcgagaga atgaagcgga tcgaagaggg catcaaagag 4020

ctgggcagcc agatcctgaa agaacacccc gtggaaaaca cccagctgca gaacgagaag 4080

ctgtacctgt actacctgca gaatgggcgg gatatgtacg tggaccagga actggacatc 4140

aaccggctgt ccgactacga tgtggaccat atcgtgcctc agagctttct gaaggacgac 4200

tccatcgaca acaaggtgct gaccagaagc gacaagaacc ggggcaagag cgacaacgtg 4260

ccctccgaag aggtcgtgaa gaagatgaag aactactggc ggcagctgct gaacgccaag 4320

ctgattaccc agagaaagtt cgacaatctg accaaggccg agagaggcgg cctgagcgaa 4380

ctggataagg ccggcttcat caagagacag ctggtggaaa cccggcagat cacaaagcac 4440

gtggcacaga tcctggactc ccggatgaac actaagtacg acgagaatga caagctgatc 4500

cgggaagtga aagtgatcac cctgaagtcc aagctggtgt ccgatttccg gaaggatttc 4560

cagttttaca aagtgcgcga gatcaacaac taccaccacg cccacgacgc ctacctgaac 4620

gccgtcgtgg gaaccgccct gatcaaaaag taccctaagc tggaaagcga gttcgtgtac 4680

ggcgactaca aggtgtacga cgtgcggaag atgatcgcca agagcgagca ggaaatcggc 4740

aaggctaccg ccaagtactt cttctacagc aacatcatga actttttcaa gaccgagatt 4800

accctggcca acggcgagat ccggaagcgg cctctgatcg agacaaacgg cgaaaccggg 4860

gagatcgtgt gggataaggg ccgggatttt gccaccgtgc ggaaagtgct gagcatgccc 4920

caagtgaata tcgtgaaaaa gaccgaggtg cagacaggcg gcttcagcaa agagtctatc 4980

ctgcccaaga ggaacagcga taagctgatc gccagaaaga aggactggga ccctaagaag 5040

tacggcggct tcgacagccc caccgtggcc tattctgtgc tggtggtggc caaagtggaa 5100

aagggcaagt ccaagaaact gaagagtgtg aaagagctgc tggggatcac catcatggaa 5160

agaagcagct tcgagaagaa tcccatcgac tttctggaag ccaagggcta caaagaagtg 5220

aaaaaggacc tgatcatcaa gctgcctaag tactccctgt tcgagctgga aaacggccgg 5280

aagagaatgc tggcctctgc cggcgaactg cagaagggaa acgaactggc cctgccctcc 5340

aaatatgtga acttcctgta cctggccagc cactatgaga agctgaaggg ctcccccgag 5400

gataatgagc agaaacagct gtttgtggaa cagcacaagc actacctgga cgagatcatc 5460

gagcagatca gcgagttctc caagagagtg atcctggccg acgctaatct ggacaaagtg 5520

ctgtccgcct acaacaagca ccgggataag cccatcagag agcaggccga gaatatcatc 5580

cacctgttta ccctgaccaa tctgggagcc cctgccgcct tcaagtactt tgacaccacc 5640

atcgaccgga agaggtacac cagcaccaaa gaggtgctgg acgccaccct gatccaccag 5700

agcatcaccg gcctgtacga gacacggatc gacctgtctc agctgggagg tgactctggc 5760

ggctcaaaaa gaaccgccga cggcagcgaa ttcgagccca agaagaagag gaaagtctaa 5820

ccggtcatca tcaccatcac cattgagttt aaacccgctg atcagcctcg actgtgcctt 5880

ctagttgcca gccatctgtt gtttgcccct cccccgtgcc ttccttgacc ctggaaggtg 5940

ccactcccac tgtcctttcc taataaaatg aggaaattgc atcgcattgt ctgagtaggt 6000

gtcattctat tctggggggt ggggtggggc aggacagcaa gggggaggat tgggaagaca 6060

atagcaggca tgctggggat gcggtgggct ctatggcttc tgaggcggaa agaaccagct 6120

ggggctcgat accgtcgacc tctagctaga gcttggcgta atcatggtca tagctgtttc 6180

ctgtgtgaaa ttgttatccg ctcacaattc cacacaacat acgagccgga agcataaagt 6240

gtaaagccta gggtgcctaa tgagtgagct aactcacatt aattgcgttg cgctcactgc 6300

ccgctttcca gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc caacgcgcgg 6360

ggagaggcgg tttgcgtatt gggcgctctt ccgcttcctc gctcactgac tcgctgcgct 6420

cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa ggcggtaata cggttatcca 6480

cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga 6540

accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc 6600

acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg 6660

cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat 6720

acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt 6780

atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc 6840

agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg 6900

acttatcgcc actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg 6960

gtgctacaga gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg 7020

gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg 7080

gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca 7140

gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac actcagtgga 7200

acgaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc ttcacctaga 7260

tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag taaacttggt 7320

ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt ctatttcgtt 7380

catccatagt tgcctgactc cccgtcgtgt agataactac gatacgggag ggcttaccat 7440

ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca gatttatcag 7500

caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact ttatccgcct 7560

ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca gttaatagtt 7620

tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg tttggtatgg 7680

cttcattcag ctccggttcc caacgatcaa ggcgagttac atgatccccc atgttgtgca 7740

aaaaagcggt tagctccttc ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt 7800

tatcactcat ggttatggca gcactgcata attctcttac tgtcatgcca tccgtaagat 7860

gcttttctgt gactggtgag tactcaacca agtcattctg agaatagtgt atgcggcgac 7920

cgagttgctc ttgcccggcg tcaatacggg ataataccgc gccacatagc agaactttaa 7980

aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt 8040

tgagatccag ttcgatgtaa cccactcgtg cacccaactg atcttcagca tcttttactt 8100

tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa 8160

gggcgacacg gaaatgttga atactcatac tcttcctttt tcaatattat tgaagcattt 8220

atcagggtta ttgtctcatg agcggataca tatttgaatg tatttagaaa aataaacaaa 8280

taggggttcc gcgcacattt ccccgaaaag tgccacctga cgtcgacgga tcgggagatc 8340

gatctcccga tcccctaggg tcgactctca gtacaatctg ctctgatgcc gcatagttaa 8400

gccagtatct gctccctgct tgtgtgttgg aggtcgctga gtagtgcgcg agcaaaattt 8460

aagctacaac aaggcaaggc ttgaccgaca attgcatgaa gaatctgctt agggttaggc 8520

gttttgcgct gcttcgcgat gtacgggcca gatatacgcg ttgacattga ttattgacta 8580

gttattaata gtaatcaatt acggggtcat tagttcatag cccatatatg gagttccgcg 8640

ttacataact tacggtaaat ggcccgcctg gctgaccgcc caacgacccc cgcccattga 8700

cgtcaataat gacgtatgtt cccatagtaa cgccaatagg gactttccat tgacgtcaat 8760

gggtggagta tttacggtaa actgcccact tggcagtaca tcaagtgtat c 8811

<210> 2

<211> 8961

<212> DNA

<213> Artificial sequence ()

<400> 2

atatgccaag tacgccccct attgacgtca atgacggtaa atggcccgcc tggcattatg 60

cccagtacat gaccttatgg gactttccta cttggcagta catctacgta ttagtcatcg 120

ctattaccat ggtgatgcgg ttttggcagt acatcaatgg gcgtggatag cggtttgact 180

cacggggatt tccaagtctc caccccattg acgtcaatgg gagtttgttt tggcaccaaa 240

atcaacggga ctttccaaaa tgtcgtaaca actccgcccc attgacgcaa atgggcggta 300

ggcgtgtacg gtgggaggtc tatataagca gagctggttt agtgaaccgt cagatccgct 360

agagatccgc ggccgctaat acgactcact atagggagag ccgccaccat gaaacggaca 420

gccgacggaa gcgagttcga gtcaccaaag aagaagcgga aagtcagcag tgaaaccgga 480

ccagtggcag tggacccaac cctgaggaga cggattgagc cccatgaatt tgaagtgttc 540

tttgacccaa gggagctgag gaaggagaca tgcctgctgt acgagatcaa gtggggcaca 600

agccacaaga tctggcgcca cagctccaag aacaccacaa agcacgtgga agtgaatttc 660

atcgagaagt ttacctccga gcggcacttc tgcccctcta ccagctgttc catcacatgg 720

tttctgtctt ggagcccttg cggcgagtgt tccaaggcca tcaccgagtt cctgtctcag 780

caccctaacg tgaccctggt catctacgtg gcccggctgt atcaccacat ggaccagcag 840

aacaggcagg gcctgcgcga tctggtgaat tctggcgtga ccatccagat catgacagcc 900

ccagagtacg actattgctg gcggaacttc gtgaattatc cacctggcaa ggaggcacac 960

tggccaagat acccacccct gtggatgaag ctgtatgcac tggagctgca cgcaggaatc 1020

ctgggcctgc ctccatgtct gaatatcctg cggagaaagc agccccagct gacatttttc 1080

accattgctc tgcagtcttg tcactatcag cggctgcctc ctcatattct gtgggctaca 1140

ggcctgaagt ctggaggatc tagcggagga tcctctggca gcgagacacc aggaacaagc 1200

gagtcagcaa caccagagag cagtggcggc agcagcggcg gcagcgacaa gaagtacagc 1260

atcggcctgg ccatcggcac caactctgtg ggctgggccg tgatcaccga cgagtacaag 1320

gtgcccagca agaaattcaa ggtgctgggc aacaccgacc ggcacagcat caagaagaac 1380

ctgatcggag ccctgctgtt cgacagcggc gaaacagccg aggccacccg gctgaagaga 1440

accgccagaa gaagatacac cagacggaag aaccggatct gctatctgca agagatcttc 1500

agcaacgaga tggccaaggt ggacgacagc ttcttccaca gactggaaga gtccttcctg 1560

gtggaagagg ataagaagca cgagcggcac cccatcttcg gcaacatcgt ggacgaggtg 1620

gcctaccacg agaagtaccc caccatctac cacctgagaa agaaactggt ggacagcacc 1680

gacaaggccg acctgcggct gatctatctg gccctggccc acatgatcaa gttccggggc 1740

cacttcctga tcgagggcga cctgaacccc gacaacagcg acgtggacaa gctgttcatc 1800

cagctggtgc agacctacaa ccagctgttc gaggaaaacc ccatcaacgc cagcggcgtg 1860

gacgccaagg ccatcctgtc tgccagactg agcaagagca gacggctgga aaatctgatc 1920

gcccagctgc ccggcgagaa gaagaatggc ctgttcggaa acctgattgc cctgagcctg 1980

ggcctgaccc ccaacttcaa gagcaacttc gacctggccg aggatgccaa actgcagctg 2040

agcaaggaca cctacgacga cgacctggac aacctgctgg cccagatcgg cgaccagtac 2100

gccgacctgt ttctggccgc caagaacctg tccgacgcca tcctgctgag cgacatcctg 2160

agagtgaaca ccgagatcac caaggccccc ctgagcgcct ctatgatcaa gagatacgac 2220

gagcaccacc aggacctgac cctgctgaaa gctctcgtgc ggcagcagct gcctgagaag 2280

tacaaagaga ttttcttcga ccagagcaag aacggctacg ccggctacat tgacggcgga 2340

gccagccagg aagagttcta caagttcatc aagcccatcc tggaaaagat ggacggcacc 2400

gaggaactgc tcgtgaagct gaacagagag gacctgctgc ggaagcagcg gaccttcgac 2460

aacggcagca tcccccacca gatccacctg ggagagctgc acgccattct gcggcggcag 2520

gaagattttt acccattcct gaaggacaac cgggaaaaga tcgagaagat cctgaccttc 2580

cgcatcccct actacgtggg ccctctggcc aggggaaaca gcagattcgc ctggatgacc 2640

agaaagagcg aggaaaccat caccccctgg aacttcgagg aagtggtgga caagggcgct 2700

tccgcccaga gcttcatcga gcggatgacc aacttcgata agaacctgcc caacgagaag 2760

gtgctgccca agcacagcct gctgtacgag tacttcaccg tgtataacga gctgaccaaa 2820

gtgaaatacg tgaccgaggg aatgagaaag cccgccttcc tgagcggcga gcagaaaaag 2880

gccatcgtgg acctgctgtt caagaccaac cggaaagtga ccgtgaagca gctgaaagag 2940

gactacttca agaaaatcga gtgcttcgac tccgtggaaa tctccggcgt ggaagatcgg 3000

ttcaacgcct ccctgggcac ataccacgat ctgctgaaaa ttatcaagga caaggacttc 3060

ctggacaatg aggaaaacga ggacattctg gaagatatcg tgctgaccct gacactgttt 3120

gaggacagag agatgatcga ggaacggctg aaaacctatg cccacctgtt cgacgacaaa 3180

gtgatgaagc agctgaagcg gcggagatac accggctggg gcaggctgag ccggaagctg 3240

atcaacggca tccgggacaa gcagtccggc aagacaatcc tggatttcct gaagtccgac 3300

ggcttcgcca acagaaactt catgcagctg atccacgacg acagcctgac ctttaaagag 3360

gacatccaga aagcccaggt gtccggccag ggcgatagcc tgcacgagca cattgccaat 3420

ctggccggca gccccgccat taagaagggc atcctgcaga cagtgaaggt ggtggacgag 3480

ctcgtgaaag tgatgggccg gcacaagccc gagaacatcg tgatcgaaat ggccagagag 3540

aaccagacca cccagaaggg acagaagaac agccgcgaga gaatgaagcg gatcgaagag 3600

ggcatcaaag agctgggcag ccagatcctg aaagaacacc ccgtggaaaa cacccagctg 3660

cagaacgaga agctgtacct gtactacctg cagaatgggc gggatatgta cgtggaccag 3720

gaactggaca tcaaccggct gtccgactac gatgtggacc atatcgtgcc tcagagcttt 3780

ctgaaggacg actccatcga caacaaggtg ctgaccagaa gcgacaagaa ccggggcaag 3840

agcgacaacg tgccctccga agaggtcgtg aagaagatga agaactactg gcggcagctg 3900

ctgaacgcca agctgattac ccagagaaag ttcgacaatc tgaccaaggc cgagagaggc 3960

ggcctgagcg aactggataa ggccggcttc atcaagagac agctggtgga aacccggcag 4020

atcacaaagc acgtggcaca gatcctggac tcccggatga acactaagta cgacgagaat 4080

gacaagctga tccgggaagt gaaagtgatc accctgaagt ccaagctggt gtccgatttc 4140

cggaaggatt tccagtttta caaagtgcgc gagatcaaca actaccacca cgcccacgac 4200

gcctacctaa acgccgtcgt gggaaccgcc ctgatcaaaa agtaccctaa gctggaaagc 4260

gagttcgtgt acggcgacta caaggtgtac gacgtgcgga agatgatcgc caagagcgag 4320

caggaaatcg gcaaggctac cgccaagtac ttcttctaca gcaacatcat gaactttttc 4380

aagaccgaga ttaccctggc caacggcgag atccggaagc ggcctctgat cgagacaaac 4440

ggcgaaaccg gggagatcgt gtgggataag ggccgggatt ttgccaccgt gcggaaagtg 4500

ctgagcatgc cccaagtgaa tatcgtgaaa aagaccgagg tgcagacagg cggcttcagc 4560

aaagagtcta tcctgcccaa gaggaacagc gataagctga tcgccagaaa gaaggactgg 4620

gaccctaaga agtacggcgg cttcgacagc cccaccgtgg cctattctgt gctggtggtg 4680

gccaaagtgg aaaagggcaa gtccaagaaa ctgaagagtg tgaaagagct gctggggatc 4740

accatcatgg aaagaagcag cttcgagaag aatcccatcg actttctgga agccaagggc 4800

tacaaagaag tgaaaaagga cctgatcatc aagctgccta agtactccct gttcgagctg 4860

gaaaacggcc ggaagagaat gctggcctct gccggcgaac tgcagaaggg aaacgaactg 4920

gccctgccct ccaaatatgt gaacttcctg tacctggcca gccactatga gaagctgaag 4980

ggctcccccg aggataatga gcagaaacag ctgtttgtgg aacagcacaa gcactacctg 5040

gacgagatca tcgagcagat cagcgagttc tccaagagag tgatcctggc cgacgctaat 5100

ctggacaaag tgctgtccgc ctacaacaag caccgggata agcccatcag agagcaggcc 5160

gagaatatca tccacctgtt taccctgacc aatctgggag cccctgccgc cttcaagtac 5220

tttgacacca ccatcgaccg gaagaggtac accagcacca aagaggtgct ggacgccacc 5280

ctgatccacc agagcatcac cggcctgtac gagacacgga tcgacctgtc tcagctggga 5340

ggtgacagcg gcgggagcgg cgggagcggg gggagcacta atctgagcga catcattgag 5400

aaggagactg ggaaacagct ggtcattcag gagtccatcc tgatgctgcc tgaggaggtg 5460

gaggaagtga tcggcaacaa gccagagtct gacatcctgg tgcacaccgc ctacgacgag 5520

tccacagatg agaatgtgat gctgctgacc tctgacgccc ccgagtataa gccttgggcc 5580

ctggtcatcc aggattctaa cggcgagaat aagatcaaga tgctgagcgg aggatccgga 5640

ggatctggag gcagcaccaa cctgtctgac atcatcgaga aggagacagg caagcagctg 5700

gtcatccagg agagcatcct gatgctgccc gaagaagtcg aagaagtgat cggaaacaag 5760

cctgagagcg atatcctggt ccataccgcc tacgacgaga gtaccgacga aaatgtgatg 5820

ctgctgacat ccgacgcccc agagtataag ccctgggctc tggtcatcca ggattccaac 5880

ggagagaaca aaatcaaaat gctgtctggc ggctcaaaaa gaaccgccga cggcagcgaa 5940

ttcgagccca agaagaagag gaaagtctaa ccggtcatca tcaccatcac cattgagttt 6000

aaacccgctg atcagcctcg actgtgcctt ctagttgcca gccatctgtt gtttgcccct 6060

cccccgtgcc ttccttgacc ctggaaggtg ccactcccac tgtcctttcc taataaaatg 6120

aggaaattgc atcgcattgt ctgagtaggt gtcattctat tctggggggt ggggtggggc 6180

aggacagcaa gggggaggat tgggaagaca atagcaggca tgctggggat gcggtgggct 6240

ctatggcttc tgaggcggaa agaaccagct ggggctcgat accgtcgacc tctagctaga 6300

gcttggcgta atcatggtca tagctgtttc ctgtgtgaaa ttgttatccg ctcacaattc 6360

cacacaacat acgagccgga agcataaagt gtaaagccta ggatgcctaa tgagtgagct 6420

aactcacatt aattgcgttg cgctcactgc ccgctttcca gtcgggaaac ctgtcgtgcc 6480

agctgcatta atgaatcggc caacgcgcgg gaagaggcgg tttgcgtatt gggcgctctt 6540

ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag 6600

ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgca ggaaagaaca 6660

tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt 6720

tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc 6780

gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct 6840

ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg 6900

tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca 6960

agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact 7020

atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta 7080

acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta 7140

actacggcta cactagaaga acagtatttg gtatctgcgc tctgctgaag ccagttacct 7200

tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt 7260

tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga 7320

tcttttctac ggggtctgac actcagtgga acgaaaactc acgttaaggg attttggtca 7380

tgagattatc aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga agttttaaat 7440

caatctaaag tatatatgag taaacttggt ctgacagtta ccaatgctta atcagtgagg 7500

cacctatctc agcgatctgt ctatttcgtt catccatagt tgcctgactc cccgtcgtgt 7560

agataactac gatacgggag ggcttaccat ctggccccag tgctgcaatg ataccgcgag 7620

acccacgctc accggctcca gatttatcag caataaacca gccagccgga agggccgagc 7680

gcagaagtgg tcctgcaact ttatccgcct ccatccagtc tattaattgt tgccgggaag 7740

ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt gctacaggca 7800

tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag ctccggttcc caacgatcaa 7860

ggcgagttac atgatccccc atgttgtgca aaaaagcggt tagctccttc ggtcctccga 7920

tcgttgtcag aagtaagttg gccgcagtgt tatcactcat ggttatggca gcactgcata 7980

attctcttac tgtcatgcca tccgtaagat gcttttctgt gactggtgag tactcaacca 8040

agtcattctg agaatagtgt atgcggcgac cgagttgctc ttgcccggcg tcaatacggg 8100

ataataccgc gccacatagc agaactttaa aagtgctcat cattggaaaa cgttcttcgg 8160

ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg 8220

cacccaactg atcttcagca tcttttactt tcaccagcgt ttctgggtga gcaaaaacag 8280

gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg gaaatgttga atactcatac 8340

tcttcctttt tcaatattat tgaagcattt atcagggtta ttgtctcatg agcggataca 8400

tatttgaatg tatttagaaa aataaacaaa taggggttcc gcgcacattt ccccgaaaag 8460

tgccacctga cgtcgacgga tcgggagatc gatctcccga tcccctaggg tcgactctca 8520

gtacaatctg ctctgatgcc gcatagttaa gccagtatct gctccctgct tgtgtgttgg 8580

aggtcgctga gtagtgcgcg agcaaaattt aagctacaac aaggcaaggc ttgaccgaca 8640

attgcatgaa gaatctgctt agggttaggc gttttgcgct gcttcgcgat gtacgggcca 8700

gatatacgcg ttgacattga ttattgacta gttattaata gtaatcaatt acggggtcat 8760

tagttcatag cccatatatg gagttccgcg ttacataact tacggtaaat ggcccgcctg 8820

gctgaccgcc caacgacccc cgcccattga cgtcaataat gacgtatgtt cccatagtaa 8880

cgccaatagg gactttccat tgacgtcaat gggtggagta tttacggtaa actgcccact 8940

tggcagtaca tcaagtgtat c 8961

Claims (4)

1. A method of gene knockout comprising:

according to the translation initiation region sequence characteristics of the gene to be knocked out, a 20bp-NGG target sequence is designed to contain a complete initiation codon ATG;

positioning ABE to a target sequence by utilizing a sgRNA sequence to mutate a target single base A in an initiation codon into G, so that the initiation codon loses functions, and a target gene is knocked out;

wherein the target single base A is located at positions 4-7 of the target sequence; the sgRNA sequence is a 20bp sequence which is complementary and corresponds to a target sequence,

wherein ABE is selected from pCMV-ABEmax SEQ ID NO. 1;

wherein the method is used for knocking out a target gene HDAC1, and the sgRNA sequence corresponding to the method is complementary with the following target gene sequences:

Sg-1:AGCAAGATGGCGCAGACGCAGGG。

2. use of the method of claim 1 for performing an HDAC1 gene knockout of the cell line HEK 293T.

3. Isolated cell lines or their subcultures obtained according to the use of claim 2.

4. A kit for HDAC1 gene knock-out comprising the sgRNA, ABE, and amplification reagents of claim 1.

Images