CN111500641A - Preparation method of pig with human nerve growth factor gene - Google Patents
Preparation method of pig with human nerve growth factor gene Download PDFInfo
- Publication number
- CN111500641A CN111500641A CN202010402846.3A CN202010402846A CN111500641A CN 111500641 A CN111500641 A CN 111500641A CN 202010402846 A CN202010402846 A CN 202010402846A CN 111500641 A CN111500641 A CN 111500641A
- Authority
- CN
- China
- Prior art keywords
- pig
- gene
- hngf
- seq
- crispr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
- A01K67/027—New breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
- A01K67/0278—Humanized animals, e.g. knockin
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/475—Growth factors; Growth regulators
- C07K14/48—Nerve growth factor [NGF]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/873—Techniques for producing new embryos, e.g. nuclear transfer, manipulation of totipotent cells or production of chimeric embryos
- C12N15/877—Techniques for producing new mammalian cloned embryos
- C12N15/8778—Swine embryos
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/072—Animals genetically altered by homologous recombination maintaining or altering function, i.e. knock in
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/108—Swine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/01—Animal expressing industrially exogenous proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
Abstract
The invention discloses a preparation method of a pig with a human nerve growth factor gene. The method comprises the following steps: a. constructing a CRISPR/Cas9 system expression vector targeting a pNGF gene exon; b. constructing a homologous recombination vector for providing the hNGF gene; c. co-transfecting a CRISPR/Cas9 system expression vector and a homologous recombination vector of hNGF genes into pig ear fibroblasts; d. after the transfected pig ear fibroblasts are screened, a positive cell line is obtained, and a transgenic pig with the human nerve growth factor is obtained through somatic cell cloning. According to the invention, the hNGF gene is inserted into the pig pNGF gene locus in a site-specific gene recombination manner, so that the obtained human nerve growth factor-transgenic pig can express the human nerve growth factor but not express the pig nerve growth factor, the current situation that the pig-derived NGF is mixed when the human NGF is collected in pig saliva is avoided, the immunogenicity problem when the human NGF is used for drug therapy is also avoided, and the pig nerve growth factor-transgenic pig is safer and more effective.
Description
Technical Field
The invention relates to an animal obtained by a transgenic method and a preparation method thereof, in particular to a preparation method of a transgenic pig for transforming human nerve growth factors.
Background
Nerve Growth Factor (NGF) is a neurotrophin that has the functions of maintaining the survival of neuronal cells, promoting their growth and differentiation, and plays an important role in the development of animals and various physiological processes in adult animals. In addition, NGF plays an important auxiliary role in the growth and activity maintenance of non-nerve cells such as immune cells, fibroblasts, pancreatic cells and cardiac muscle cells and the repair of tissue damage. NGF therefore has a good clinical or potential therapeutic effect on a number of neurological and non-neurological diseases and injuries.
Currently marketed NGF drugs are mainly extracted from mouse submandibular gland, i.e. murine NGF (mouse NGF, mnngf). Because the homology between mNGF and humanized NGF (human NGF, hNGF) is high, the medicine has good curative effect on treating various neurodegenerative diseases and nerve injury diseases, and China approves the production and marketing of the medicine for clinical treatment in 2003. At present, the medicine has large demand, but the collection cost is high, so the price is always high, and the market price per milligram is as high as 1 ten thousand yuan. In addition, murine NGF, as a human protein, is inevitably associated with immunogenicity problems, which may lead to adverse reactions such as allergy. In addition, the biological activity of human NGF is also higher. Therefore, there is a need to develop new technical methods to increase the NGF production and develop more efficient and safer hNGF drugs.
Various methods have been studied to obtain hNGF, such as animal cells cultured in vitro, transgenic E.coli and yeast, but these methods have not been implemented in production applications due to low production efficiency or failure to obtain correct post-translational modifications of proteins. In another study, the use of transgenic animal mammary gland bioreactor to prepare hNGF improves the yield of hNGF, but still has the following defects: mammary bioreactors are subject to animal gender (female) and physiological cycle (postpartum lactation); the kind and amount of protein contained in the breast milk are large, which is not beneficial to the subsequent purification and extraction of hNGF. The salivary gland of the pig secretes 10-15 liters of saliva per day, and contains less protein than milk, so that the preparation of hNGF by using the transgenic salivary gland of the pig as a bioreactor can solve the defects.
Patent No. 201811571140.9 discloses that PiggyBac transposition system is used to transfer hNGF expressed gene fragment into pig fetal fibroblast genome by random integration, and nuclear transfer and embryo transfer are performed on the selected successfully integrated unicellular clone group, so as to successfully clone transgenic pig capable of efficiently expressing and secreting high-activity hNGF in salivary gland. However, because the endogenous NGF gene of the pig is not knocked out, the pig saliva still contains pig-derived NGF (pig NGF, pNGF), and the physical and chemical properties of pNGF and hNGF are similar, so that the separation difficulty of the pNGF and the hNGF is high.
Disclosure of Invention
The invention aims to provide a preparation method of a pig with a human nerve growth factor gene so as to solve the problems.
According to one aspect of the invention, a preparation method of a pig with a human nerve growth factor gene is provided, which comprises the following steps: a. constructing a CRISPR/Cas9 system expression vector targeting a pNGF gene exon; b. constructing a homologous recombination vector for providing the hNGF gene; c. co-transfecting the CRISPR/Cas9 system expression vector and a homologous recombination vector of hNGF genes into pig ear fibroblasts; d. after the transfected pig ear fibroblasts are screened, a positive cell line is obtained, and a human nerve growth factor gene-transferred pig is obtained through somatic cell cloning.
In certain embodiments, the porcine ear fibroblasts in step c are porcine ear fibroblasts of a primary hNGF gene-transfected pig. Therefore, a plurality of sites can express the human nerve growth factor, and the obtained hNGF yield is higher.
In certain embodiments, the sgRNA 5 nucleotide sequence of the CRISPR/Cas9 system expression vector in step a comprises other nucleotide sequences having NO less than 80% homology as shown in SEQ ID NOs 5 and 6. Therefore, the efficiency of fixed-point integration can be greatly improved.
In certain embodiments, the sgRNA 5 nucleotide sequence of the CRISPR/Cas9 system expression vector in step a comprises the nucleotide sequences shown as SEQ ID NOs 5 and 6. Therefore, the efficiency of fixed-point integration can be greatly improved.
In certain embodiments, the nucleotide sequence of the sgRNA RT3 of the CRISPR/Cas9 system expression vector in step a comprises other nucleotide sequences with homology of not less than 80% as shown in SEQ ID NOs 7 and 8. Therefore, the efficiency of fixed-point integration can be greatly improved.
In certain embodiments, the nucleotide sequence of the sgRNA RT3 of the CRISPR/Cas9 system expression vector in step a comprises the nucleotide sequences shown as SEQ ID NOs 7 and 8. Therefore, the efficiency of fixed-point integration can be greatly improved.
In certain embodiments, the co-transfection method in step c transfects 5 μ g each of the sgRNA 5-guided CRISPR/Cas9 system expression vector plasmid, the sgRNA RT 3-guided CRISPR/Cas9 system expression vector plasmid, and the hNGF gene homologous recombination vector into 100 μ l cell resuspension. Thus, the effect of co-transfection can be improved.
In some embodiments, the hNGF gene homologous recombination vector nucleotide sequence includes the nucleotide sequence shown in SEQ ID NO. 10. Thus, the efficiency of site-directed integration by homologous recombination is higher.
In certain embodiments, the hNGF gene nucleotide sequence comprises the nucleotide sequence set forth as SEQ ID No. 1. Thus, the efficiency of site-directed integration by homologous recombination is higher.
The invention has the beneficial effects that: the hNGF gene is inserted into the pig endogenous pNGF gene locus in a homologous recombination site-specific integration mode, so that the obtained human nerve growth factor transgenic pig can express the human nerve growth factor but not express the pig nerve growth factor, the current situation that the human NGF is mixed in pig saliva when the human NGF is collected is avoided, the immunogenicity problem when the human NGF is used for drug treatment is also avoided, and the method is safer and more effective.
Drawings
Fig. 1 is a CRISPR/Cas9 system expression vector plasmid diagram: wherein Cas9 is a Cas9 protein gene, CMV is a eukaryotic gene promoter for starting Cas9 protein expression, AmpR is an ampicillin resistance gene, and hU6 is a human U6 promoter;
FIG. 2 is a plasmid map of homologous recombinant vector providing hNGF gene: wherein hNGF is a human nerve growth factor protein coding gene, mCherry is a red fluorescent protein coding gene, and AmpR is an ampicillin resistance gene;
FIG. 3 is a process diagram of 2 sgRNA-guided CRISPR/Cas9 expression vector cleaving homologous recombination of pNGF gene and hNGF gene vector;
FIG. 4 is a photograph of a red fluorescence photograph of a part of the cell mass when the cell mass is selected after transfection, wherein D125, D162 and D176 represent the cell mass;
FIG. 5 shows the PCR results of the primarily screened fluorescence-expressing cell masses (product length 3309bp), 5k M indicating 5kMarker labeling, D82, D105, D125, D141, D162 and D176 indicating cell masses;
FIG. 6 shows the alignment of the sequencing results of the cell mass PCR products with the theoretical sequence, and there are 3 cell masses aligned in agreement.
Detailed Description
The gene sequence of SEQ ID NO. 2 related in the invention is from GenBank access number NM-002506.2; the SEQ ID NO 3 gene sequence is derived from GenBank access number NM-002506.2; the SEQ ID NO. 4 gene sequence is derived from GenBank access number X01697.1.
1. Construction of CRISPR/Cas9 system expression vector targeting pNGF gene exon
Selecting a CRISPR/Cas9 system expression vector plasmid pX330-U6-Chimeric-BB-CBh-hSpCas9 (hereinafter referred to as pX330 plasmid), and respectively connecting the linearized pX330 plasmid vector with the annealed sgRNA 5 and sgRNA RT3 to respectively construct a CRISPR/Cas9 system expression vector (shown in figure 1) of the targeted pNGF gene exon guided by the sgRNA 5 and the sgRNA RT 3.
2. Construction of homologous recombination vector providing hNGF Gene
The 54bp long signal peptide sequence (SEQ ID NO:3) in the 726bp long hNGF gene original sequence (SEQ ID NO:2) was replaced with 60bp long porcine PSP signal peptide sequence (SEQ ID NO:4), and the 732bp long hNGF coding sequence (SEQ ID NO:1) was artificially synthesized, the gene sequence L A-hNGF-CMV-Neo-mCherry-RA (SEQ ID NO:9) was synthesized, including the reverse complement of the sgRNA (sgRNA RT3 and sgRNA 5, see Table 3) at both ends, the homologous sequence at both ends of the porcine NGF gene (NCBI Genbank ID:100738968), the L A of 586bp and the 643bp, the previously described 732bp long hNGF coding gene sequence (SEQ ID NO:1) after recombination, the CMV promoter sequence, the NEO-2A-hermCRYC fusion gene sequence, the gene sequence L A-hNGF-Neo-mCRYNC-HrXb-encoding gene sequence (SEQ ID NO: 82) was cloned into the homologous vector (SEQ ID NO: 3610, and the homologous vector shown in the attached figure).
3. Preparation of pNGF-knocked-out hNGF-transgenic pig
The pig ear fibroblasts of primary hNGF-transgenic pigs (hNGF-transgenic pig ear fibroblasts obtained by the method disclosed in the patent No. 201811571140.9) were co-transfected with the sgRNA 5-guided CRISPR/Cas9 system expression vector plasmid, the sgRNA RT 3-guided CRISPR/Cas9 system expression vector plasmid, and the hNGF gene homologous recombination vector described above (see FIG. 3 for the cleavage and homologous recombination process). The transfection method was as follows, in which cells were resuspended in Opti-MEM medium to a cell density of about 1 × 106M L, L ipofectamine TM3000 Transfection Reagent kit (brand: ThermoFisher, cat # L3000015) was used to transfect, 5 μ g each of the above-mentioned sgRNA 5-guided CRISPR/Cas9 system expression vector plasmid, sgRNA RT 3-guided CRISPR/Cas9 system expression vector plasmid, hNGF gene homologous recombination vector was used to transfect 100 μ l cell resuspension, cells after Transfection were spread evenly in a petri dish and cultured at a density of 1-2 cells in a microscope 40-fold visual field, when cell clusters grow to a diameter of about 5mm, cell clusters expressing red fluorescence were picked up with cell cloning loops (see FIG. 4), cell mass was individually cultured and amplified, a part of cells were extracted from each cell cluster, primers (F: 5'-AGTTTTGCGACTATAGGCCCTT-3'; R:5'-TATCCTCCTCGCCCTTGCTCA-3') were used for PCR identification (FIG. 5), and PCR products with clear bands near the 3309bp position were identified, sequencing results were aligned with theoretical sequences and selected target cell clusters (FIG. 6).
And (3) taking the target cell mass as a nuclear donor to clone somatic cells to obtain the hNGF-knocked-out transgenic cloned pig.
What has been described above are merely some embodiments of the present invention. It will be apparent to those skilled in the art that various changes and modifications can be made without departing from the inventive concept herein, and it is intended to cover all such modifications and variations as fall within the scope of the invention.
Sequence listing
<110> southern China university of agriculture
Preparation method of <120> pig with human nerve growth factor gene
<130>2020.5.13
<160>10
<170>SIPOSequenceListing 1.0
<210>1
<211>732
<212>DNA
<213> Artificial Synthesis ()
<400>1
agcgtaatgt ccatgttgtt ctacactctg atcacagctc ttctgatcgg cgtacaggca 60
gaaccacact cagagagcaa tgtccctgca ggacacacca tcccccaagc ccactggact 120
aaacttcagc attcccttga cactgccctt cgcagagccc gcagcgcccc ggcagcggcg 180
atagctgcac gcgtggcggggcagacccgc aacattactg tggaccccag gctgtttaaa 240
aagcggcgac tccgttcacc ccgtgtgctg tttagcaccc agcctccccg tgaagctgca 300
gacactcagg atctggactt cgaggtcggt ggtgctgccc ccttcaacag gactcacagg 360
agcaagcggt catcatccca tcccatcttc cacaggggcg aattctcggt gtgtgacagt 420
gtcagcgtgt gggttgggga taagaccacc gccacagaca tcaagggcaa ggaggtgatg 480
gtgttgggag aggtgaacat taacaacagt gtattcaaac agtacttttt tgagaccaag 540
tgccgggacc caaatcccgt tgacagcggg tgccggggca ttgactcaaa gcactggaac 600
tcatattgta ccacgactca cacctttgtc aaggcgctga ccatggatgg caagcaggct 660
gcctggcggt ttatccggat agatacggcc tgtgtgtgtg tgctcagcag gaaggctgtg 720
agaagagcct ga 732
<210>2
<211>726
<212>DNA
<213> Artificial Synthesis ()
<400>2
atgtccatgt tgttctacac tctgatcaca gcttttctga tcggcataca ggcggaacca 60
cactcagaga gcaatgtccc tgcaggacac accatccccc aagcccactg gactaaactt 120
cagcattccc ttgacactgc ccttcgcaga gcccgcagcg ccccggcagc ggcgatagct 180
gcacgcgtgg cggggcagac ccgcaacatt actgtggacc ccaggctgtt taaaaagcgg 240
cgactccgtt caccccgtgt gctgtttagc acccagcctc cccgtgaagc tgcagacact 300
caggatctgg acttcgaggt cggtggtgct gcccccttca acaggactca caggagcaag 360
cggtcatcat cccatcccat cttccacaggggcgaattct cggtgtgtga cagtgtcagc 420
gtgtgggttg gggataagac caccgccaca gacatcaagg gcaaggaggt gatggtgttg 480
ggagaggtga acattaacaa cagtgtattc aaacagtact tttttgagac caagtgccgg 540
gacccaaatc ccgttgacag cgggtgccgg ggcattgact caaagcactg gaactcatat 600
tgtaccacga ctcacacctt tgtcaaggcg ctgaccatgg atggcaagca ggctgcctgg 660
cggtttatcc ggatagatac ggcctgtgtg tgtgtgctca gcaggaaggc tgtgagaaga 720
gcctga 726
<210>3
<211>54
<212>DNA
<213> Artificial Synthesis ()
<400>3
atgtccatgt tgttctacac tctgatcaca gcttttctga tcggcataca ggcg 54
<210>4
<211>60
<212>DNA
<213> Artificial Synthesis ()
<400>4
agcgtaatgt ccatgttgtt ctacactctg atcacagctc ttctgatcgg cgtacaggca 60
<210>5
<211>24
<212>DNA
<213> Artificial Synthesis ()
<400>5
caccgcggtt tatccgaatc gaca 24
<210>6
<211>24
<212>DNA
<213> Artificial Synthesis ()
<400>6
aaactgtcga ttcggataaa ccgc 24
<210>7
<211>24
<212>DNA
<213> Artificial Synthesis ()
<400>7
caccgcagac ccgcaacatc actg 24
<210>8
<211>24
<212>DNA
<213> Artificial Synthesis ()
<400>8
aaaccagtga tgttgcgggt ctgc 24
<210>9
<211>4402
<212>DNA
<213> Artificial Synthesis ()
<400>9
tttgtggatt ttcagtcacc agatctcaga gctggcccag tgctgctgtc tgaagagggt 60
gttttcagtg ctgaggcttc aagacaagtc cccagcagcc tgccctctcc cttcccaagc 120
tgttgggcag gacactgctg ggaggtatca aactgccctc cagccagccc ggtgcacact 180
tgtgcacact tatcacctga ccacggctgc cttgctggca ggtagagaac acaaggggtt 240
ctgtaaacag cactgctgaa ctcataccac actatggggc agaatttcag gggctctgtc 300
ccttcccgga aaggcccacc ccctatatgg agtctgagcc cggacaaaca ggttgtctga 360
gccagcccta tttaagcctg gtgtcccagt gcaactgttg tagcagtacc tttcactctc 420
agaagtgtcc tggtttgaat ggtcaattcc cggtcccctt gcccttcacc accaggagaa 480
gcctcctcgt catcctcttg ggagggcaac tccgaggaac ccagaaacta cctctgccca 540
acctgcagcg ctccatggaa taaccctcat ttctgtgtca ttccaggtgc atagcgtaat 600
gtccatgttg ttctacactc tgatcacagc tcttctgatc ggcgtacagg cagaaccaca 660
ctcagagagc aatgtccctg caggacacac catcccccaa gcccactgga ctaaacttca 720
gcattccctt gacactgccc ttcgcagagc ccgcagcgcc ccggcagcgg cgatagctgc 780
acgcgtggcg gggcagaccc gcaacattac tgtggacccc aggctgttta aaaagcggcg 840
actccgttca ccccgtgtgc tgtttagcac ccagcctccc cgtgaagctg cagacactca 900
ggatctggac ttcgaggtcg gtggtgctgc ccccttcaac aggactcaca ggagcaagcg 960
gtcatcatcc catcccatct tccacagggg cgaattctcg gtgtgtgaca gtgtcagcgt 1020
gtgggttggg gataagacca ccgccacaga catcaagggc aaggaggtga tggtgttggg 1080
agaggtgaac attaacaaca gtgtattcaa acagtacttt tttgagacca agtgccggga 1140
cccaaatccc gttgacagcg ggtgccgggg cattgactca aagcactgga actcatattg 1200
taccacgact cacacctttg tcaaggcgct gaccatggat ggcaagcagg ctgcctggcg 1260
gtttatccgg atagatacgg cctgtgtgtg tgtgctcagc aggaaggctg tgagaagagc 1320
ctgacctgca agccagcccc cacctccccc agctccccac ccacactctc ctgcgcccct 1380
ccctacctca gcctgtaaat tattttaaat tataaggact gcatggtaat ttatagttta 1440
tacagtttta aaaatcatta tttattaaat ttttggaagc aataacttcg tatagcatac 1500
attatacgaa gttatgacat tgattattga ctagttatta atagtaatca attacggggt1560
cattagttca tagcccatat atggagttcc gcgttacata acttacggta aatggcccgc 1620
ctggctgacc gcccaacgac ccccgcccat tgacgtcaat aatgacgtat gttcccatag 1680
taacgccaat agggactttc cattgacgtc aatgggtgga gtatttacgg taaactgccc 1740
acttggcagt acatcaagtg tatcatatgc caagtacgcc ccctattgac gtcaatgacg 1800
gtaaatggcc cgcctggcat tatgcccagt acatgacctt atgggacttt cctacttggc 1860
agtacatcta cgtattagtc atcgctatta ccatggtgat gcggttttgg cagtacatca 1920
atgggcgtgg atagcggttt gactcacggg gatttccaag tctccacccc attgacgtca 1980
atgggagttt gttttggcac caaaatcaac gggactttcc aaaatgtcgt aacaactccg 2040
ccccattgac gcaaatgggc ggtaggcgtg tacggtggga ggtctatata agcagagctc 2100
tctggctaac tagagaaccc actgcttact ggcttatcga aattaatacg actcactata 2160
ggatgattga acaagatgga ttgcacgcag gttctccggc cgcttgggtg gagaggctat 2220
tcggctatga ctgggcacaa cagacaatcg gctgctctga tgccgccgtg ttccggctgt 2280
cagcgcaggg gcgcccggtt ctttttgtca agaccgacct gtccggtgcc ctgaatgaac 2340
tgcaggacga ggcagcgcgg ctatcgtggc tggccacgac gggcgttcct tgcgcagctg 2400
tgctcgacgt tgtcactgaa gcgggaaggg actggctgct attgggcgaa gtgccggggc 2460
aggatctcct gtcatctcac cttgctcctg ccgagaaagt atccatcatg gctgatgcaa 2520
tgcggcggct gcatacgctt gatccggcta cctgcccatt cgaccaccaa gcgaaacatc 2580
gcatcgagcg agcacgtact cggatggaag ccggtcttgt cgatcaggat gatctggacg 2640
aagagcatca ggggctcgcg ccagccgaac tgttcgccag gctcaaggcg cgcatgcccg 2700
acggcgagga tctcgtcgtg acccatggcg atgcctgctt gccgaatatc atggtggaaa 2760
atggccgctt ttctggattc atcgactgtg gccggctggg tgtggcggac cgctatcagg 2820
acatagcgtt ggctacccgt gatattgctg aagagcttgg cggcgaatgg gctgaccgct 2880
tcctcgtgct ttacggtatc gccgctcccg attcgcagcg catcgccttc tatcgccttc 2940
ttgacgagtt cttcgagggc agaggaagtc tgctaacatg cggtgacgtg gaggagaatc 3000
ccggccctgc tagcatggtg agcaagggcg aggaggataa catggccatc atcaaggagt 3060
tcatgcgctt caaggtgcac atggagggct ccgtgaacgg ccacgagttc gagatcgagg 3120
gcgagggcga gggccgcccc tacgagggca cccagaccgc caagctgaag gtgaccaagg 3180
gtggccccct gcccttcgcc tgggacatcc tgtcccctca gttcatgtac ggctccaagg 3240
cctacgtgaa gcaccccgcc gacatccccg actacttgaa gctgtccttc cccgagggct 3300
tcaagtggga gcgcgtgatg aacttcgagg acggcggcgt ggtgaccgtg acccaggact 3360
cctccctgca ggacggcgag ttcatctaca aggtgaagct gcgcggcacc aacttcccct 3420
cagacggccc cgtaatgcag aagaaaacca tgggctggga ggcctcctcc gagcggatgt 3480
accccgagga cggcgccctg aagggcgaga tcaagcagag gctgaagctg aaggacggcg 3540
gccactacga cgctgaggtc aagaccacct acaaggccaa gaagcccgtg cagctgcccg 3600
gcgcctacaa cgtcaacatc aagttggaca tcacctccca caacgaggac tacaccatcg 3660
tggaacagta cgaacgcgcc gagggccgcc actccaccgg cggcatggac gagctgtaca 3720
agtaaataac ttcgtatagc atacattata cgaagttatg cctgtgtgcc agccctccct 3780
cattttgccc agcatgacca tctgccagtc ttgggacgga agctgcaggg agacgggtcc 3840
acagcaggcc cggctccctc tcaggccctc ctggagccct caccctcccg gcgcccgcag 3900
ccagccctgc cacttcaggg aaggctaacc aggctccgat attagcctaa gcccggcgtg 3960
attaggaagg gaagggaagt ctgtgggact gcaactttgc tccgcattcc agagccaaag 4020
ctacctaatc cttggattac ctgccccaca gcctagattc ttcagccttg attgcctcac 4080
tggggaagtt tgtggagctt catcagaagg cagatccctg ctgggcacag ggctgccccc 4140
aacctcagag aagcccaggc tgggtcctat ctatccggct cactagatag acaggaggag 4200
actcgcactg aagacctgtg aggctggctc gctttttagg gggaggtctg cttttggctg 4260
aaaagcgctc tgcaagagtt gtaacaaaat catctcatgg ggcctgtcac ggtagatctg 4320
atttcatgta aagactgcct tagctctaat ggctggcctc gatttatccc ctggcggctt 4380
cctgcagaag gactccatta cc 4402
<210>10
<211>7118
<212>DNA
<213> Artificial Synthesis ()
<400>10
tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60
cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120
ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180
accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240
attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300
tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360
tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cgagctcggt acctcgcgaa 420
tgcatctaga ccacagtgat gttgcgggtc tgctttgtgg attttcagtc accagatctc 480
agagctggcc cagtgctgct gtctgaagag ggtgttttca gtgctgaggc ttcaagacaa 540
gtccccagca gcctgccctc tcccttccca agctgttggg caggacactg ctgggaggta 600
tcaaactgcc ctccagccag cccggtgcac acttgtgcac acttatcacc tgaccacggc 660
tgccttgctg gcaggtagag aacacaaggg gttctgtaaa cagcactgct gaactcatac 720
cacactatgg ggcagaattt caggggctct gtcccttccc ggaaaggccc accccctata 780
tggagtctga gcccggacaa acaggttgtc tgagccagcc ctatttaagc ctggtgtccc 840
agtgcaactg ttgtagcagt acctttcact ctcagaagtg tcctggtttg aatggtcaat 900
tcccggtccc cttgcccttc accaccagga gaagcctcct cgtcatcctc ttgggagggc 960
aactccgagg aacccagaaa ctacctctgc ccaacctgca gcgctccatg gaataaccct 1020
catttctgtg tcattccagg tgcatagcgt aatgtccatg ttgttctaca ctctgatcac 1080
agctcttctg atcggcgtac aggcagaacc acactcagag agcaatgtcc ctgcaggaca 1140
caccatcccc caagcccact ggactaaact tcagcattcc cttgacactg cccttcgcag 1200
agcccgcagc gccccggcag cggcgatagc tgcacgcgtg gcggggcaga cccgcaacat 1260
tactgtggac cccaggctgt ttaaaaagcg gcgactccgt tcaccccgtg tgctgtttag 1320
cacccagcct ccccgtgaag ctgcagacac tcaggatctg gacttcgagg tcggtggtgc 1380
tgcccccttc aacaggactc acaggagcaa gcggtcatca tcccatccca tcttccacag 1440
gggcgaattc tcggtgtgtg acagtgtcag cgtgtgggtt ggggataaga ccaccgccac 1500
agacatcaag ggcaaggagg tgatggtgtt gggagaggtg aacattaaca acagtgtatt 1560
caaacagtac ttttttgaga ccaagtgccg ggacccaaat cccgttgaca gcgggtgccg 1620
gggcattgac tcaaagcact ggaactcata ttgtaccacg actcacacct ttgtcaaggc 1680
gctgaccatg gatggcaagc aggctgcctg gcggtttatc cggatagata cggcctgtgt 1740
gtgtgtgctc agcaggaagg ctgtgagaag agcctgacct gcaagccagc ccccacctcc 1800
cccagctccc cacccacact ctcctgcgcc cctccctacc tcagcctgta aattatttta 1860
aattataagg actgcatggt aatttatagt ttatacagtt ttaaaaatca ttatttatta 1920
aatttttgga agcaataact tcgtatagca tacattatac gaagttatga cattgattat 1980
tgactagtta ttaatagtaa tcaattacgg ggtcattagt tcatagccca tatatggagt 2040
tccgcgttac ataacttacg gtaaatggcc cgcctggctg accgcccaac gacccccgcc 2100
cattgacgtc aataatgacg tatgttccca tagtaacgcc aatagggact ttccattgac 2160
gtcaatgggt ggagtattta cggtaaactg cccacttggc agtacatcaa gtgtatcata 2220
tgccaagtac gccccctatt gacgtcaatg acggtaaatg gcccgcctgg cattatgccc 2280
agtacatgac cttatgggac tttcctactt ggcagtacat ctacgtatta gtcatcgcta 2340
ttaccatggt gatgcggttt tggcagtaca tcaatgggcg tggatagcgg tttgactcac 2400
ggggatttcc aagtctccac cccattgacg tcaatgggag tttgttttgg caccaaaatc 2460
aacgggactt tccaaaatgt cgtaacaact ccgccccatt gacgcaaatg ggcggtaggc 2520
gtgtacggtg ggaggtctat ataagcagag ctctctggct aactagagaa cccactgctt 2580
actggcttat cgaaattaat acgactcact ataggatgat tgaacaagat ggattgcacg 2640
caggttctcc ggccgcttgg gtggagaggc tattcggcta tgactgggca caacagacaa 2700
tcggctgctc tgatgccgcc gtgttccggc tgtcagcgca ggggcgcccg gttctttttg 2760
tcaagaccga cctgtccggt gccctgaatg aactgcagga cgaggcagcg cggctatcgt 2820
ggctggccac gacgggcgtt ccttgcgcag ctgtgctcga cgttgtcact gaagcgggaa 2880
gggactggct gctattgggc gaagtgccgg ggcaggatct cctgtcatct caccttgctc 2940
ctgccgagaa agtatccatc atggctgatg caatgcggcg gctgcatacg cttgatccgg 3000
ctacctgccc attcgaccac caagcgaaac atcgcatcga gcgagcacgt actcggatgg 3060
aagccggtct tgtcgatcag gatgatctgg acgaagagca tcaggggctc gcgccagccg 3120
aactgttcgc caggctcaag gcgcgcatgc ccgacggcga ggatctcgtc gtgacccatg 3180
gcgatgcctg cttgccgaat atcatggtgg aaaatggccg cttttctgga ttcatcgact 3240
gtggccggct gggtgtggcg gaccgctatc aggacatagc gttggctacc cgtgatattg 3300
ctgaagagct tggcggcgaa tgggctgacc gcttcctcgt gctttacggt atcgccgctc 3360
ccgattcgca gcgcatcgcc ttctatcgcc ttcttgacga gttcttcgag ggcagaggaa 3420
gtctgctaac atgcggtgac gtggaggaga atcccggccc tgctagcatg gtgagcaagg 3480
gcgaggagga taacatggcc atcatcaagg agttcatgcg cttcaaggtg cacatggagg 3540
gctccgtgaa cggccacgag ttcgagatcg agggcgaggg cgagggccgc ccctacgagg 3600
gcacccagac cgccaagctg aaggtgacca agggtggccc cctgcccttc gcctgggaca 3660
tcctgtcccc tcagttcatg tacggctcca aggcctacgt gaagcacccc gccgacatcc 3720
ccgactactt gaagctgtcc ttccccgagg gcttcaagtg ggagcgcgtg atgaacttcg 3780
aggacggcgg cgtggtgacc gtgacccagg actcctccct gcaggacggc gagttcatct 3840
acaaggtgaa gctgcgcggc accaacttcc cctcagacgg ccccgtaatg cagaagaaaa 3900
ccatgggctg ggaggcctcc tccgagcgga tgtaccccga ggacggcgcc ctgaagggcg 3960
agatcaagca gaggctgaag ctgaaggacg gcggccacta cgacgctgag gtcaagacca 4020
cctacaaggc caagaagccc gtgcagctgc ccggcgccta caacgtcaac atcaagttgg 4080
acatcacctc ccacaacgag gactacacca tcgtggaaca gtacgaacgc gccgagggcc 4140
gccactccac cggcggcatg gacgagctgt acaagtaaat aacttcgtat agcatacatt 4200
atacgaagtt atgcctgtgt gccagccctc cctcattttg cccagcatga ccatctgcca 4260
gtcttgggac ggaagctgca gggagacggg tccacagcag gcccggctcc ctctcaggcc 4320
ctcctggagc cctcaccctc ccggcgcccg cagccagccc tgccacttca gggaaggcta 4380
accaggctcc gatattagcc taagcccggc gtgattagga agggaaggga agtctgtggg 4440
actgcaactt tgctccgcat tccagagcca aagctaccta atccttggat tacctgcccc 4500
acagcctaga ttcttcagcc ttgattgcct cactggggaa gtttgtggag cttcatcaga 4560
aggcagatcc ctgctgggca cagggctgcc cccaacctca gagaagccca ggctgggtcc 4620
tatctatccg gctcactaga tagacaggag gagactcgca ctgaagacct gtgaggctgg 4680
ctcgcttttt agggggaggt ctgcttttgg ctgaaaagcg ctctgcaaga gttgtaacaa 4740
aatcatctca tggggcctgt cacggtagat ctgatttcat gtaaagactg ccttagctct 4800
aatggctggc ctcgatttat cccctggcgg cttcctgcag aaggactcca ttaccgcggt 4860
ttatccgaat cgacacggaa gcttggcgta atcatggtca tagctgtttc ctgtgtgaaa 4920
ttgttatccg ctcacaattc cacacaacat acgagccgga agcataaagt gtaaagcctg 4980
gggtgcctaa tgagtgagct aactcacatt aattgcgttg cgctcactgc ccgctttcca 5040
gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc caacgcgcgg ggagaggcgg 5100
tttgcgtatt gggcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg 5160
gctgcggcga gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg 5220
ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa 5280
ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg 5340
acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc 5400
tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc 5460
ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc 5520
ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg 5580
ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc 5640
actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga 5700
gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg gtatctgcgc 5760
tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 5820
caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg 5880
atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc 5940
acgttaaggg attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa 6000
ttaaaaatga agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta 6060
ccaatgctta atcagtgagg cacctatctc agcgatctgt ctatttcgtt catccatagt 6120
tgcctgactc cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag 6180
tgctgcaatg ataccgcgag acccacgctc accggctcca gatttatcag caataaacca 6240
gccagccgga agggccgagc gcagaagtgg tcctgcaact ttatccgcct ccatccagtc 6300
tattaattgt tgccgggaag ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt 6360
tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag 6420
ctccggttcc caacgatcaa ggcgagttac atgatccccc atgttgtgca aaaaagcggt 6480
tagctccttc ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt tatcactcat 6540
ggttatggca gcactgcata attctcttac tgtcatgcca tccgtaagat gcttttctgt 6600
gactggtgag tactcaacca agtcattctg agaatagtgt atgcggcgac cgagttgctc 6660
ttgcccggcg tcaatacggg ataataccgc gccacatagc agaactttaa aagtgctcat 6720
cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag 6780
ttcgatgtaa cccactcgtg cacccaactg atcttcagca tcttttactt tcaccagcgt 6840
ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg 6900
gaaatgttga atactcatac tcttcctttt tcaatattat tgaagcattt atcagggtta 6960
ttgtctcatg agcggataca tatttgaatg tatttagaaa aataaacaaa taggggttcc 7020
gcgcacattt ccccgaaaag tgccacctga cgtctaagaa accattatta tcatgacatt 7080
aacctataaa aataggcgta tcacgaggcc ctttcgtc 7118
Claims (9)
1. The preparation method of the pig with the human nerve growth factor gene is characterized by comprising the following steps:
a. constructing a CRISPR/Cas9 system expression vector targeting a pNGF gene exon;
b. constructing a homologous recombination vector for providing the hNGF gene;
c. co-transfecting the CRISPR/Cas9 system expression vector and a homologous recombination vector of hNGF genes into pig ear fibroblasts;
d. after the transfected pig ear fibroblasts are screened, a positive cell line is obtained, and a human nerve growth factor gene-transferred pig is obtained through somatic cell cloning.
2. The method according to claim 1, wherein the porcine ear fibroblasts of step c are porcine ear fibroblasts of primary hNGF-transgenic pigs.
3. The preparation method of claim 1, wherein the sgRNA 5 nucleotide sequence of the CRISPR/Cas9 system expression vector in step a comprises other nucleotide sequences with homology of not less than 80% as shown in SEQ ID NO 5 and SEQ ID NO 6.
4. The preparation method of claim 1, wherein the sgRNA 5 nucleotide sequence of the CRISPR/Cas9 system expression vector in step a comprises the nucleotide sequences shown as SEQ ID NO. 5 and SEQ ID NO. 6.
5. The preparation method of claim 1, wherein the nucleotide sequence of the sgRNA RT3 of the CRISPR/Cas9 system expression vector in the step a comprises other nucleotide sequences with homology of not less than 80% as shown in SEQ ID NO 7 and SEQ ID NO 8.
6. The preparation method of claim 1, wherein the nucleotide sequence of sgRNA RT3 of the CRISPR/Cas9 system expression vector in the step a comprises the nucleotide sequences shown as SEQ ID NO 7 and SEQ ID NO 8.
7. The method for preparing the recombinant human antibody of claim 1, wherein the cotransfection method in step c transfects 5 μ g of each of sgRNA 5-guided CRISPR/Cas9 system expression vector plasmid, sgRNA RT 3-guided CRISPR/Cas9 system expression vector plasmid and hNGF gene homologous recombination vector into 100 μ l of cell resuspension.
8. The method according to claim 7, wherein the nucleotide sequence of hNGF gene homologous recombination vector comprises the nucleotide sequence shown in SEQ ID NO. 10.
9. The method according to claim 8, wherein the hNGF gene nucleotide sequence comprises the nucleotide sequence shown in SEQ ID NO. 1.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010402846.3A CN111500641A (en) | 2020-05-13 | 2020-05-13 | Preparation method of pig with human nerve growth factor gene |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010402846.3A CN111500641A (en) | 2020-05-13 | 2020-05-13 | Preparation method of pig with human nerve growth factor gene |
Publications (1)
Publication Number | Publication Date |
---|---|
CN111500641A true CN111500641A (en) | 2020-08-07 |
Family
ID=71868470
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202010402846.3A Pending CN111500641A (en) | 2020-05-13 | 2020-05-13 | Preparation method of pig with human nerve growth factor gene |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN111500641A (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114958759A (en) * | 2021-02-23 | 2022-08-30 | 南京启真基因工程有限公司 | Construction method and application of amyotrophic lateral sclerosis model pig |
WO2023284254A1 (en) * | 2021-07-16 | 2023-01-19 | 北京复昇生物科技有限公司 | Construction method for and application of hace2 humanized transgenic pig |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5272063A (en) * | 1988-11-22 | 1993-12-21 | Syntex (U.S.A.) Inc. | Process of making human nerve growth factor |
CN105671079A (en) * | 2016-02-26 | 2016-06-15 | 华南农业大学 | Mouse with human nerve growth factor transgenes as well as preparation method and application of mouse |
CN109628487A (en) * | 2018-12-21 | 2019-04-16 | 华南农业大学 | A method of growth factor of human nerve is prepared using transgene pig salivary gland |
-
2020
- 2020-05-13 CN CN202010402846.3A patent/CN111500641A/en active Pending
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5272063A (en) * | 1988-11-22 | 1993-12-21 | Syntex (U.S.A.) Inc. | Process of making human nerve growth factor |
CN105671079A (en) * | 2016-02-26 | 2016-06-15 | 华南农业大学 | Mouse with human nerve growth factor transgenes as well as preparation method and application of mouse |
CN109628487A (en) * | 2018-12-21 | 2019-04-16 | 华南农业大学 | A method of growth factor of human nerve is prepared using transgene pig salivary gland |
Non-Patent Citations (3)
Title |
---|
FANG ZENG ET AL.: "Production of functional human nerve growth factor from the saliva of transgenic mice by using salivary glands as bioreactors", 《SCIENTIFIC REPORTS》 * |
JIN PENG ET AL.: "Production of Human Albumin in Pigs Through CRISPR/Cas9-Mediated Knockin of Human cDNA into Swine Albumin Locus in the Zygotes", 《SCIENTIFIC REPORTS》 * |
李国玲等: "转基因和基因编辑猪的研究进展", 《华南农业大学学报》 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114958759A (en) * | 2021-02-23 | 2022-08-30 | 南京启真基因工程有限公司 | Construction method and application of amyotrophic lateral sclerosis model pig |
WO2023284254A1 (en) * | 2021-07-16 | 2023-01-19 | 北京复昇生物科技有限公司 | Construction method for and application of hace2 humanized transgenic pig |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN109312360B (en) | Transposon-based transfection system for primary cells | |
CN109706185B (en) | Method for realizing gene knockout based on base editing system mutation initiation codon and application | |
CN107557388B (en) | Lentiviral vector for CAR-T preparation and construction method and application thereof | |
KR101522217B1 (en) | Fsh producing cell clone | |
CN108410787A (en) | A kind of recombined bacillus subtilis of synthesis new tetroses of lactoyl-N- and its construction method and application | |
CN108949693A (en) | A kind of pair of T cell immune detection point access carries out the method and application of gene knockout | |
CN114702597B (en) | Construction and application of engineering bacteria for expressing plant antibacterial peptide Ct-AMP1 | |
CN111500641A (en) | Preparation method of pig with human nerve growth factor gene | |
CN110938651A (en) | Targeting vector, method for constructing BAC clone by targeting and integrating exogenous gene to mouse F4/80 exon 22 site and application | |
CN114196705A (en) | Recombinant adeno-associated virus packaging plasmid, recombinant adeno-associated virus and application thereof | |
CN114736308B (en) | Preparation and application of coccidian antigen peptide/IL 5 fusion protein gene engineering bacteria | |
CN114853901B (en) | Construction and application of engineering bacteria for expressing antibacterial peptide AFP1 fusion protein | |
CN107287201B (en) | Strong broad-spectrum promoter and application thereof | |
KR101535070B1 (en) | Recomnication expression vector of vascular growth factor and the vascular growth factor expressing stem cell line thereof | |
CN114410559B (en) | Heavy metal-passivated geobacillus engineering strain and construction method thereof | |
WO2000058483A9 (en) | Protozoan expression system | |
CN101899465A (en) | Recombinant J subgroup avian leucosis virus infective cloned plasmids and preparation method and application thereof | |
CN111100841B (en) | Establishment and application of genetic engineering cell strain and high-throughput drug screening model of anti-obesity drug target UCP1 | |
KR20170017115A (en) | Method of testing genotype and phenotype for simultaneously predicting drug resistance against protease inhibitor, reverse transcriptase inhibitor and integrase inhibitor | |
CN109852589A (en) | A kind of clone of cymbidium mosaic virus strain and its transcription vector building | |
CN107751545A (en) | Use of colicin or microorganism capable of expressing colicin for preparing meat enhancing agent | |
CN114181939B (en) | Recombinant coccidium vector expressing NA4 protein and fluorescent tag and detection method thereof | |
CN108977523A (en) | For detecting primer pair, probe and the kit of SLCO1B1 521T > C gene pleiomorphism | |
CN113846116B (en) | Method for improving anthocyanin synthesis efficiency in saccharomyces cerevisiae | |
CN112852651B (en) | Method for increasing yield of hydrocortisone produced by saccharomyces cerevisiae biotransformation |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200807 |