WO2021243105A1 - Composition and method for treating retinal vascular disease with vegf gene disruption - Google Patents

Abstract

Provided herein is a gene editing system that targets VEGF protein that can be combined with a nanoparticle for efficient and safe use. Also provided are methods that use the system or nanoparticle to reduce VEGF expression and treat diseases or states associated with pathological expression.

Description

COMPOSITION AND METHOD FOR TREATING RETINAL VASCULAR DISEASE WITH VEGF GENE DISRUPTION

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Application Serial No. 63/031,500, filed May 28, 2020, the contents of which are hereby incorporated by reference into the present disclosure.

SEQUENCE LISTING

[0001.1] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on May 27, 2021, is named 064189-9360_SL.txt and is 4,317 bytes in size.

BACKGROUND

[0002] Vascular endothelial growth factor A (VEGF-A), with its potent vasopermeability and vasoproliferative effects, is an important mediator in retinal vascular diseases. The VEGF-A gene, located on chromosome 6 (6p21.1), is a member of the PDGF/VEGF growth factor family. Alternative splicing results in multiple isoforms of which VEGF¹⁶⁵ is the most abundant isoform found in the eye.

[0003] Intravitreal injection of anti-VEGF medications is commonly used to temporarily decrease intraocular VEGF levels in treatment of macular edema and retinal or choroidal neovascularization associated with common eye diseases such as age-related macular degeneration (AMD), diabetic retinopathy, retinal vein occlusion (RVO), and many less common retinal vascular diseases. Current anti-VEGF medications include bevacizumab, ranibizumab, aflibercept, and brolucizumab all of which bind to and block actions of VEGF - A.

[0004] Although these medications have tremendously improved visual outcomes for patients with retinal vascular diseases, frequent intraocular injections are often needed, and in some patients injections may reach frequencies of up to every four weeks indefinitely. Frequent intravitreal injections increase the risk of complications such as endophthalmitis, are inconvenient to patients, and place a significant financial burden on healthcare systems in the US and throughout the world. Developing slow release formulations and devices as well as longer lasting medications are among some of approaches taken to address these problems. However, there has not been any indication that any of these methods would lead to a permanent treatment.

[0005] What remains needed is an efficient, easy to-practice, cost-effective, fast and safe way to treat diseases and conditions mediated by VEGF-A. This disclosure satisfies this need and provides related advantages as well.

SUMMARY OF THE DISCLOSURE

[0006] Gene therapy has the potential to permanently reduce VEGF-A levels and eliminate the need for frequent intravitreal injections. Both gene augmentation and gene silencing methods have been used to reduce VEGF-A levels. Gene silencing has not yet reached human clinical trials, but in vitro and in vivo studies using microRNA and shRNA have demonstrated some success in VEGF reduction. In recent years, CRISPR-Cas9 [Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR-associated protein 9 (Cas9)] has been used to disrupt VEGF-A gene in retinal pigment epithelial (RPE) cells and in mouse retina. Within the retina, VEGF is constitutively expressed in Muller cells, RPE cells, ganglion cells, and retinal and choroidal vasculature; this expression in significantly increased in pathologic angiogenic states.

[0007] Provided herein is a CRISPR gene editing system comprising a ribonucleotide protein or polypeptide or mRNA encoding same, e.g., a Cas polypeptide or protein or mRNA encoding the Cas polypeptide or protein, and at least one guide RNA (sgRNA or gRNA herein) that targets and cleaves a VEGF polynucleotide or protein. In one aspect, the VEGF gene is selected from VEGF-A, VEFG-165 or an isoform of each thereof. In a further aspect, the CRISPR gene editing system further comprises a detectable or purification label on any element of the CRISPR gene editing system, e.g., ribonucleotide protein or polypeptide, e.g. a Cas polypeptide or protein, a Cas mRNA encoding same, protein, primers or sgRNA. A non limited example of the sgRNA comprises, or consists essentially, of essentially of, the sgRNA of SEQ ID NO 2 or an equivalent thereof. However, within the scope of this disclosure, sgRNA can be designed and prepared using methods known in the art. In aspect, the Cas ribonucleotide protein or polypeptide is selected from Cas9 or Cas Cpfl protein, polypeptide or an equivalent of each thereof, or an mRNA encoding same.

[0008] In a further aspect, the target sequence comprises a photospacer (e.g., 3’- cctccttctcatcgagcggc-5’ or an equivalent thereof). In a yet further aspect, the CRISPR gene editing system further comprises a forward primer and a reverse primer for the VEGF polynucleotide or gene. Exemplary forward and reverse primers are provided in SEQ ID NOs 3 and 4, respectively or an equivalent of each thereof. In one aspect, the gRNA comprises, or consists essentially thereof or consist essentially of, 5’- GGAGGAAGAGTAGCTCGCCG-3 ’ with a PAM sequence of 5’-AGG-3’ on exon 1, encoding for amino acids 146 to 152.

[0009] In one aspect, the CRISPR gene editing system as described herein targets one or more of: a) one or more exons of the VEGF gene; b) exon 1 of the VEGF gene; and/or c) the target sequence of SEQ ID NO 6 or an equivalent thereof.

[0010] Also provided is a nanoparticle comprising the CRISPR gene editing system as described herein, e.g., a lipid nanoparticle. In one aspect, also provided is a plurality of the nanoparticles, wherein the nanoparticles are the same or different from each other with respect to one or more of the CRISPR system, the diameter of the nanoparticle, and/or the composition of the nanoparticle.

[0011] Yet further provided is a composition comprising the CRISPR gene editing system and/or the nanoparticle as described herein or the plurality of nanoparticles, and a carrier.

The composition can further comprise a preservative and/or stabilizer. In one aspect, composition is frozen or lyophilized.

[0012] In one embodiment, provided herein is a cell comprising the CRISPR gene editing system or the nanoparticle as described herein. The cell can be prokaryotic or eukaryotic, and of any species expressing VEGF. In a further aspect, the cell expresses VEGF protein that optionally is VEGF-A, VEFG-165 or an isoform of each thereof. In a yet further aspect, the cell is selected from a Muller cell, a retinal pigment epithelial (RPE) cell, or a ganglion cell that is optionally a mammalian cell, e.g., a mammalian cell selected from the group of: a canine cell, a feline cell, a rat cell, a murine cell, a simian cell or a human cell.

[0013] Further provided is a method to edit or reduce expression of a VEGF gene in a cell that expresses VEGF protein or polypeptide comprising contacting the cell with the CRISPR gene editing system, the composition or the nanoparticle as described herein. The contacting can be in vitro or in vivo. In one aspect, the cell is a mammalian cell, e.g., a mammalian cell selected from the group of: a canine cell, a feline cell, a rat cell, a murine cell, a simian cell or a human cell. In a further aspect, the cell expresses VEGF protein that optionally is VEGF- A, VEFG-165 or an isoform of each thereof. In a yet further aspect, the cell is selected from a Muller cell, a retinal pigment epithelial (RPE) cell, or a ganglion cell.

|0014| Also provided is a method to treat a condition mediated by VEGF gene expression or pathologic angiogenic states in a subject in need thereof, comprising administering to the subject the system, composition or nanoparticle as described herein. Non-limiting examples of conditions include age-related macular degeneration (AMD), diabetic retinopathy, retinal vein occlusion (RVO), or a retinal vascular disease.

[0015] In one aspect, the subject is a mammal, e.g., a canine, a feline, a rat, a murine, a simian or a human.

[0016] Administration can be by any appropriate method, e.g., by intravitreal injection, suprachoroidal, intraocular injection, topical, or subretinal injection.

[00 I7J Further provided is a kit comprising any of the components, systems, compositions, or nanoparticles as described herein, optionally with instructions for use.

BRIEF DESCRIPTION OF THE DRAWINGS

[0018] FIGS. 1A - 1C: LCM mediated transfection and VEGF-A gene disruption following CRISPR-Cas9 RNP treatment in RPE cells. (FIG. 1A) LCM mediated transfection of RPE cells. 48 hours after transfection RPE cells treated with GFP mRNA combined with LCM show green fluorescence; no fluorescence is seen in untreated cells (control) and in cells treated with GFP mRNA alone. (FIG. IB) Representative agarose gel in genomic cleavage detection assay using transfected RPE cells. The CRISPR-Cas9 treated (T) and untreated (U) cells as well as the manufacturer control (MC) were PCR amplified using the same set of primers flanking the region of interest. Note the presence of the parental band (top band) in all groups; however, only CRISPR-Cas9 treated cells (T) show the two cleaved bands (asterisks) at the expected locations (408 and 79) along the length of the gel. Other bands, which correspond in both groups, are likely artifactual. (FIG. 1C) Diagram of representative colonies showing indels at the predicted cut site detected by Sanger sequencing. The guide sequence, PAM and adjacent nucleotides of the normal VEGF -A gene are shown as a reference. The border of nucleotides adjacent to the predicted cut site is shown in gray. In eight colonies (not shown here) large deletions involved other areas in addition to the guide sequence.

[0019] FIGS. 2A - 2B: VEGF-A expression following VEGF-A gene disruption in RPE and Muller cells. CRISPR-Cas9 treated cells were compared with untreated cells. Data are deesented as mean + SEM. * p < 0.0001. (FIG. 2A) VEGF-A mRNA measured using quantitative RT-PCR showing lower expression in CRISPR-Cas9 treated cells in both RPE and Muller cells; however, it is only statistically significant for Muller cells. Results comprised of 15 independent experiments for RPE and nine independent experiments for Muller cells, with three replicate samples for each experiment. (FIG. 2B) VEGF-A protein level in cell culture medium measured using ELISA showing lower expression in CRISPR- Cas9 treated cells in both RPE and Muller cells. Results composed of nine independent experiments for both RPE and Muller cells, with two replicate samples for each.

[0020] FIG. 3A - 3B: Cell count results comparing CRISPR-Cas9 treated and untreated cells shows no statically significant change in either RPE or Muller cells. Data are presented as mean + SEM. Results composed of 12 independent experiments for RPE and nine independent experiments for Muller cells. FIG. 3A shows RPE cells and FIG. 3B shows Muller cells.

[0021] FIG. 4: A diagram presumptively comparing the effects of CRISPR-Cas9 RNP gene editing (grey arrow) with intravitreal anti-VEGF injections (light grey and dark grey arrows). The threshold above which pathological effects of VEGF appear varies in different diseases and among different individuals; in addition, the speed of VEGF rise may depend on disease severity. Because of these, patients require anti-VEGF injection at different frequencies (light grey and darker grey lines represent VEGF levels in 2 different individuals with different needs for anti-VEGF injections). CRISPR-Cas9 RNP gene editing can potentially reduce the VEGF level which might be mediated by the VEGF threshold. While in some patients a single treatment may be all that they need, others may still require anti-VEGF injection but at a lower frequency.

ED I TA 11 FI) DESCRIPTION

Definitions

[0022] Throughout this disclosure, various publications, patents and published patent specifications are referenced by an identifying citation or an Arabic number, the full citation for each of which is found immediately preceding the claims. The disclosures of the references cited therein, and the various publications, patents and published patent specifications disclosed herein are hereby incorporated by reference into the present disclosure in their entirety to more fully describe the state of the art to which this invention pertains. [0023] The practice of the present technology will employ, unless otherwise indicated, conventional techniques of organic chemistry, pharmacology, immunology, molecular biology, microbiology, cell biology and recombinant DNA, which are within the skill of the art. See, e.g ., Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual, 2^nd edition (1989); Current Protocols In Molecular Biology (F. M. Ausubel, et al. eds., (1987)); the series Methods in Enzymology (Academic Press, hbbb Inc.): PCR 2: A Practical Approach (M.J. MacPherson, B.D. Hames and G.R. Taylor eds. (1995)), Harlow and Lane, eds. (1988) Antibodies, a Laboratory Manual, and Animal Cell Culture (R.I. Freshney, ed. (1987)).

[0024] As used in the specification and claims, the singular form “a,” “an” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a cell” includes a plurality of cells, including mixtures thereof.

[0025] As used herein, the term “comprising” is intended to mean that the compounds, compositions and methods include the recited elements, but not exclude others. “Consisting essentially of’ when used to define compounds, compositions and methods, shall mean excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants, e.g., from the isolation and purification method and pharmaceutically acceptable carriers, preservatives, and the like. “Consisting of’ shall mean excluding more than trace elements of other ingredients. Embodiments defined by each of these transition terms are within the scope of this technology.

[0026] All numerical designations, e.g., pH, temperature, time, concentration, and molecular weight, including ranges, are approximations which are varied ( + ) or ( - ) by increments of 1.0, 0.7, 0.5, 0.3, 0.1, or 0.01, as appropriate, or alternatively by a variation of +/- 15 %, or alternatively 10%, or alternatively 5%, or alternatively 2%. It is to be understood, although not always explicitly stated, that all numerical designations are preceded by the term “about” and the appropriate range is included within the use of the term. The term “about,” as used herein when referring to a measurable value such as an amount or concentration and the like, is meant to encompass variations of 20%, 15%, 10%, 7%, 5%, 3%, 1 %, 0.5%, 0.1% or even 0.01 % of the specified amount. It also is to be understood, although not always explicitly stated, that the reagents described herein are merely exemplary and that equivalents of such are known in the art. [0027] The terms "oligonucleotide" or "polynucleotide" or "portion," or "segment" thereof refer to a stretch of polynucleotide residues which is long enough to use in PCR or various hybridization procedures to identify or amplify identical or related parts of mRNA or DNA molecules. The polynucleotide compositions of this invention include RNA, cDNA, genomic DNA, synthetic forms, and mixed polymers, both sense and antisense strands, and may be chemically or biochemically modified or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralen, etc.), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids, etc.). Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen bonding and other chemical interactions. Such molecules are known in the art and include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone of the molecule.

[0028] The terms “polynucleotide” and “oligonucleotide” are used interchangeably and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides or analogs thereof. Polynucleotides can have any three-dimensional structure and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: a gene or gene fragment (for example, a probe, primer, EST or SAGE tag), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, RNAi, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers. A polynucleotide can comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure can be imparted before or after assembly of the polynucleotide. The sequence of nucleotides can be interrupted by non-nucleotide components. A polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component. The term also refers to both double-and single-stranded molecules. Unless otherwise specified or required, any embodiment of this invention that is a polynucleotide encompasses both the double-stranded form and each of two complementary single-stranded forms known or predicted to make up the double-stranded form.

[0029] A polynucleotide is composed of a specific sequence of four nucleotide bases: adenine (A); cytosine (C); guanine (G); thymine (T); and uracil (U) for thymine when the polynucleotide is RNA. In some embodiments, the polynucleotide may comprise one or more other nucleotide bases, such as inosine (I), a nucleoside formed when hypoxanthine is attached to ribofuranose via a P-N9-glycosidic bond, resulting in the chemical structure:

Inosine is read by the translation machinery as guanine (G).

[0030] The term “polynucleotide sequence” is the alphabetical representation of a polynucleotide molecule. This alphabetical representation can be input into databases in a computer having a central processing unit and used for bioinformatics applications such as functional genomics and homology searching.

[0031] As used herein, “expression” refers to the process by which polynucleotides are transcribed into mRNA and/or the process by which the transcribed mRNA is subsequently being translated into peptides, polypeptides, or proteins. If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.

[0032] The term “encode” as it is applied to polynucleotides refers to a polynucleotide which is said to “encode” a polypeptide if, in its native state or when manipulated by methods well known to those skilled in the art, it can be transcribed and/or translated to produce the mRNA for the polypeptide and/or a fragment thereof. The antisense strand is the complement of such a nucleic acid, and the encoding sequence can be deduced therefrom.

[0033] The compositions for the administration of the CRISPR vectors and systems can be conveniently presented in dosage unit form and can be prepared by any of the methods well known in the art. [0034] “Messenger RNA” or “mRNA” is a nucleic acid molecule that is transcribed from DNA and then processed to remove non-coding sections known as introns. The resulting mRNA is exported from the nucleus (or another locus where the DNA is present) and translated into a protein. The term “pre-mRNA” refers to the strand prior to processing to remove non-coding sections.

[0035] The terms “hairpin,” “hairpin loop,” “stem loop,” and/or “loop” used alone or in combination with “motif’ is used in context of an oligonucleotide to refer to a structure formed in single stranded oligonucleotide when sequences within the single strand which are complementary when read in opposite directions base pair to form a region whose conformation resembles a hairpin or loop.

[0036] As used herein, the term “domain” refers to a particular region of a protein or polypeptide and is associated with a particular function. For example, “a domain which associates with an RNA hairpin motif’ refers to the domain of a protein that binds one or more RNA hairpin. This binding may optionally be specific to a particular hairpin.

[0037] It is to be inferred without explicit recitation and unless otherwise intended, that when the present disclosure relates to a polypeptide, protein, polynucleotide or antibody, an equivalent or a biologically equivalent of such is intended within the scope of this disclosure. As used herein, the term “biological equivalent thereof’ is intended to be synonymous with “equivalent thereof’ when referring to a reference protein, antibody, polypeptide or nucleic acid, intends those having minimal homology while still maintaining desired structure or functionality. Unless specifically recited herein, it is contemplated that any polynucleotide, polypeptide or protein mentioned herein also includes equivalents thereof. For example, an equivalent intends at least about 70% homology or identity, or at least 80% homology or identity and alternatively, or at least about 85 %, or alternatively at least about 90%, or alternatively at least about 95%, or alternatively 98% percent homology or identity and exhibits substantially equivalent biological activity to the reference protein, polypeptide or nucleic acid. Alternatively, when referring to polynucleotides, an equivalent thereof is a polynucleotide that hybridizes under stringent conditions to the reference polynucleotide or its complement.

[0038] A polynucleotide or polynucleotide region (or a polypeptide or polypeptide region) having a certain percentage (for example, 80%, 85%, 90%, or 95%) of “sequence identity” to another sequence means that, when aligned, that percentage of bases (or amino acids) are the same in comparing the two sequences. The alignment and the percent homology or sequence identity can be determined using software programs known in the art, for example those described in Current Protocols in Molecular Biology (Ausubel et al., eds. 1987) Supplement 30, section 7.7.18, Table 7.7.1. Preferably, default parameters are used for alignment. A preferred alignment program is BLAST, using default parameters. In particular, preferred programs are BLASTN and BLASTP, using the following default parameters: Genetic code = standard; filter = none; strand = both; cutoff = 60; expect = 10; Matrix = BLOSUM62; Descriptions = 50 sequences; sort by = HIGH SCORE; Databases = non-redundant, GenBank + EMBL + DDBJ + PDB + GenBank CDS translations + SwissProtein + SPupdate + PIR. Details of these programs can be found at the following Internet address: ncbi.nlm.nih.gov/cgi-bin/BLAST. In some embodiments, Clustal Omega (accessible at www.ebi.ac.uk/Tools/msa/clustalo/) is used to generate the alignment and identity percentage. In further embodiments, default setting is applied.

[0039] The terms or “acceptable,” “effective,” or “sufficient” when used to describe the selection of any components, ranges, dose forms, etc. disclosed herein intend that said component, range, dose form, etc. is suitable for the disclosed purpose.

[0040] As will be understood by one skilled in the art, for any and all purposes, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof. Furthermore, as will be understood by one skilled in the art, a range includes each individual member.

[0041] As used herein, “and/or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (“or”).

[0042] Applicants have provided herein the polypeptide and/or polynucleotide sequences for use in gene and protein editing techniques described below. It should be understood, although not always explicitly stated that the sequences provided herein can be used to provide the expression product as well as substantially identical sequences that produce a protein that has the same biological properties. These “biologically equivalent” or “biologically active” polypeptides are encoded by equivalent polynucleotides as described herein. They may possess at least 60%, or alternatively, at least 65%, or alternatively, at least 70%, or alternatively, at least 75%, or alternatively, at least 80%, or alternatively at least 85%, or alternatively at least 90%, or alternatively at least 95% or alternatively at least 98%, identical primary amino acid sequence to the reference polypeptide when compared using sequence identity methods run under default conditions. Specific polypeptide sequences are provided as examples of particular embodiments. Modifications to the sequences to amino acids with alternate amino acids that have similar charge. Additionally, an equivalent polynucleotide is one that hybridizes under stringent conditions to the reference polynucleotide or its complement or in reference to a polypeptide, a polypeptide encoded by a polynucleotide that hybridizes to the reference encoding polynucleotide under stringent conditions or its complementary strand. Alternatively, an equivalent polypeptide or protein is one that is expressed from an equivalent polynucleotide.

[0043] “Hybridization” refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson-Crick base pairing, Hoogstein binding, or in any other sequence-specific manner. The complex may comprise two strands forming a duplex structure, three or more strands forming a multi-stranded complex, a single self-hybridizing strand, or any combination of these. A hybridization reaction may constitute a step in a more extensive process, such as the initiation of a PC reaction, or the enzymatic cleavage of a polynucleotide by a ribozyme.

[0044] Examples of stringent hybridization conditions include: incubation temperatures of about 25°C to about 37°C; hybridization buffer concentrations of about 6x SSC to about lOx SSC; formamide concentrations of about 0% to about 25%; and wash solutions from about 4x SSC to about 8x SSC. Examples of moderate hybridization conditions include: incubation temperatures of about 40°C to about 50°C; buffer concentrations of about 9x SSC to about 2x SSC; formamide concentrations of about 30% to about 50%; and wash solutions of about 5x SSC to about 2x SSC. Examples of high stringency conditions include: incubation temperatures of about 55°C to about 68°C; buffer concentrations of about lx SSC to about O.lx SSC; formamide concentrations of about 55% to about 75%; and wash solutions of about lx SSC, 0. lx SSC, or deionized water. In general, hybridization incubation times are from 5 minutes to 24 hours, with 1, 2, or more washing steps, and wash incubation times are about 1, 2, or 15 minutes. SSC is 0.15 M NaCl and 15 mM citrate buffer. It is understood that equivalents of SSC using other buffer systems can be employed.

[0045] “Homology” or “identity” or “similarity” refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence that can be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An “unrelated” or “non-homologous” sequence shares less than 40% identity, or alternatively less than 25% identity, with one of the sequences of the present invention.

[0046] As used herein, the term “recombinant expression system” refers to a genetic construct or constructs for the expression of certain genetic material formed by recombination.

[0047] A “vector” is defined as any molecule that can carry inserted polynucleotides into a host cell. Examples of vectors are liposomes, micelles biocompatible polymers, including natural polymers and synthetic polymers; lipoproteins; polypeptides; polysaccharides; lipopolysaccharides; artificial viral envelopes; metal particles; and bacteria, or viruses, such as baculovirus, adenovirus and retrovirus, bacteriophage, cosmid, plasmid, fungal vectors and other recombination vehicles typically used in the art which have been described for expression in a variety of eukaryotic and prokaryotic hosts, and may be used for gene therapy as well as for simple protein expression.

[0048] A polynucleotide disclosed herein can be delivered to a cell or tissue using a gene delivery vehicle. “Gene delivery,” “gene transfer,” “transducing,” and the like as used herein, are terms referring to the introduction of an exogenous polynucleotide (sometimes referred to as a “transgene”) into a host cell, irrespective of the method used for the introduction. Such methods include a variety of well-known techniques such as vector- mediated gene transfer (by, e.g., viral infection/transfection, or various other protein-based or lipid-based gene delivery complexes) as well as techniques facilitating the delivery of “naked” polynucleotides (such as electroporation, “gene gun” delivery and various other techniques used for the introduction of polynucleotides). The introduced polynucleotide may be stably or transiently maintained in the host cell. Stable maintenance typically requires that the introduced polynucleotide either contains an origin of replication compatible with the host cell or integrates into a replicon of the host cell such as an extrachromosomal replicon (e.g., a plasmid) or a nuclear or mitochondrial chromosome. A number of vectors are known to be capable of mediating transfer of genes to mammalian cells, as is known in the art and described herein. [0049] As used herein, the terms “nucleic acid sequence” and “polynucleotide” are used interchangeably to refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, this term includes, but is not limited to, single-, double-, or multi -stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases.

[0050] As used herein, a “contiguous” polynucleotide refers to nucleic acid sequence conjugated with each other directly or indirectly.

[0051] A “plasmid” is an extra-chromosomal DNA molecule separate from the chromosomal DNA which is capable of replicating independently of the chromosomal DNA. In many cases, it is circular and double-stranded. Plasmids provide a mechanism for horizontal gene transfer within a population of microbes and typically provide a selective advantage under a given environmental state. Plasmids may carry genes that provide resistance to naturally occurring antibiotics in a competitive environmental niche, or alternatively the proteins produced may act as toxins under similar circumstances.

[0052] “Plasmids” used in genetic engineering are called “plasmid vectors”. Many plasmids are commercially available for such uses. The gene to be replicated is inserted into copies of a plasmid containing genes that make cells resistant to particular antibiotics and a multiple cloning site (MCS, or polylinker), which is a short region containing several commonly used restriction sites allowing the easy insertion of DNA fragments at this location. Another major use of plasmids is to make large amounts of proteins. In this case, researchers grow bacteria containing a plasmid harboring the gene of interest. Just as the bacterium produces proteins to confer its antibiotic resistance, it can also be induced to produce large amounts of proteins from the inserted gene.

[0053] A “yeast artificial chromosome” or “YAC” refers to a vector used to clone large DNA fragments (larger than 100 kb and up to 3000 kb). It is an artificially constructed chromosome and contains the telomeric, centromeric, and replication origin sequences needed for replication and preservation in yeast cells. Built using an initial circular plasmid, they are linearized by using restriction enzymes, and then DNA ligase can add a sequence or gene of interest within the linear molecule by the use of cohesive ends. Yeast expression vectors, such as YACs, Yips (yeast integrating plasmid), and YEps (yeast episomal plasmid), are extremely useful as one can get eukaryotic protein products with posttranslational modifications as yeasts are themselves eukaryotic cells, however YACs have been found to be more unstable than BACs, producing chimeric effects.

[0054] A “viral vector” is defined as a recombinantly produced virus or viral particle that comprises a polynucleotide to be delivered into a host cell, either in vivo, ex vivo or in vitro.

[0055] Examples of viral vectors include retroviral vectors, adenovirus vectors, adeno- associated virus vectors, alphavirus vectors and the like. Infectious tobacco mosaic virus (TMV)-based vectors can be used to manufacturer proteins and have been reported to express Griffithsin in tobacco leaves (O'Keefe et al. (2009) Proc. Nat. Acad. Sci. USA 106(15):6099- 6104). Alphavirus vectors, such as Semliki Forest virus-based vectors and Sindbis virus- based vectors, have also been developed for use in gene therapy and immunotherapy. See, Schlesinger & Dubensky (1999) Curr. Opin. Biotechnol. 5:434-439 and Ying et al. (1999) Nat. Med. 5(7):823-827. In aspects where gene transfer is mediated by a retroviral vector, a vector construct refers to the polynucleotide comprising the retroviral genome or part thereof, and a therapeutic gene. Further details as to modem methods of vectors for use in gene transfer may be found in, for example, Kotterman et al. (2015) Viral Vectors for Gene Therapy: Translational and Clinical Outlook Annual Review of Biomedical Engineering 17.

[0056] As used herein, “retroviral mediated gene transfer” or “retroviral transduction” carries the same meaning and refers to the process by which a gene or nucleic acid sequences are stably transferred into the host cell by virtue of the vims entering the cell and integrating its genome into the host cell genome. The vims can enter the host cell via its normal mechanism of infection or be modified such that it binds to a different host cell surface receptor or ligand to enter the cell. As used herein, retroviral vector refers to a viral particle capable of introducing exogenous nucleic acid into a cell through a viral or viral-like entry mechanism.

[0057] Retrovimses carry their genetic information in the form of RNA; however, once the vims infects a cell, the RNA is reverse-transcribed into the DNA form which integrates into the genomic DNA of the infected cell. The integrated DNA form is called a provims.

[0058] In aspects where gene transfer is mediated by a DNA viral vector, such as an adenovims (Ad) or adeno-associated vims (AAV), a vector constmct refers to the polynucleotide comprising the viral genome or part thereof, and a transgene. Adenovimses (Ads) are a relatively well characterized, homogenous group of vimses, including over 50 serotypes. Ads do not require integration into the host cell genome. Recombinant Ad derived vectors, particularly those that reduce the potential for recombination and generation of wild-type virus, have also been constructed. Such vectors are commercially available from sources such as Takara Bio USA (Mountain View, CA), Vector Biolabs (Philadelphia, PA), and Creative Biogene (Shirley, NY). Wild-type AAV has high infectivity and specificity integrating into the host cell's genome. See, Wold and Toth (2013) Curr. Gene. Ther. 13(6):421-433, Hermonat & Muzyczka (1984) Proc. Natl. Acad. Sci. USA 81:6466-6470, and Lebkowski et al. (1988) Mol. Cell. Biol. 8:3988-3996.

[0059] Vectors that contain both a promoter and a cloning site into which a polynucleotide can be operatively linked are well known in the art. Such vectors are capable of transcribing RNA in vitro or in vivo, and are commercially available from sources such as Agilent Technologies (Santa Clara, Calif.) and Promega Biotech (Madison, Wis.). In order to optimize expression and/or in vitro transcription, it may be necessary to remove, add or alter 5' and/or 3' untranslated portions of the clones to eliminate extra, potential inappropriate alternative translation initiation codons or other sequences that may interfere with or reduce expression, either at the level of transcription or translation. Alternatively, consensus ribosome binding sites can be inserted immediately 5' of the start codon to enhance expression.

[0060] Gene delivery vehicles also include DNA/liposome complexes, micelles and targeted viral protein-DNA complexes. Liposomes that also comprise a targeting antibody or fragment thereof can be used in the methods disclosed herein. In addition to the delivery of polynucleotides to a cell or cell population, direct introduction of the proteins described herein to the cell or cell population can be done by the non-limiting technique of protein transfection, alternatively culturing conditions that can enhance the expression and/or promote the activity of the proteins disclosed herein are other non-limiting techniques.

[0061] As used herein, the term “helper” in reference to a virus or plasmid refers to a virus or plasmid used to provide the additional components necessary for replication and packaging of a viral particle or recombinant viral particle. The components encoded by a helper virus may include any genes required for virion assembly, encapsidation, genome replication, and/or packaging. For example, the helper virus may encode necessary enzymes for the replication of the viral genome. Non-limiting examples of helper viruses and plasmids suitable for use with AAV constructs include pHELP (plasmid), adenovirus (virus), or herpesvirus (virus).

[0062] As used herein, the term “AAV” is a standard abbreviation for adeno-associated virus. Adeno-associated virus is a single-stranded DNA parvovirus that grows only in cells in which certain functions are provided by a co-infecting helper virus. General information and reviews of AAV can be found in, for example, Carter, 1989, Handbook of Parvoviruses, Vol. 1, pp. 169- 228, and Berns, 1990, Virology, pp. 1743-1764, Raven Press, (New York). It is fully expected that the same principles described in these reviews will be applicable to additional AAV serotypes characterized after the publication dates of the reviews because it is well known that the various serotypes are quite closely related, both structurally and functionally, even at the genetic level. (See, for example, Blacklowe, 1988, pp. 165-174 of Parvoviruses and Human Disease, J. R. Pattison, ed.; and Rose, Comprehensive Virology 3: 1-61 (1974)). For example, all AAV serotypes apparently exhibit very similar replication properties mediated by homologous rep genes; and all bear three related capsid proteins such as those expressed in AAV2. The degree of relatedness is further suggested by heteroduplex analysis which reveals extensive cross -hybridization between serotypes along the length of the genome; and the presence of analogous self-annealing segments at the termini that correspond to "inverted terminal repeat sequences" (ITRs). The similar infectivity patterns also suggest that the replication functions in each serotype are under similar regulatory control.

[0063] An “AAV vector” as used herein refers to a vector comprising one or more polynucleotides of interest (or transgenes) that are flanked by AAV terminal repeat sequences (ITRs). Such AAV vectors can be replicated and packaged into infectious viral particles when present in a host cell that has been transfected with a vector encoding and expressing rep and cap gene products.

[0064] Adeno-associated virus (AAV) is a replication-deficient parvovirus, the single- stranded DNA genome of which is about 4.7 kb in length including two 145 nucleotide inverted terminal repeat (ITRs). There are multiple serotypes of AAV. The nucleotide sequences of the genomes of the AAV serotypes are known. For example, the complete genome of AAV-1 is provided in GenBank Accession No. NC_002077; the complete genome of AAV-2 is provided in GenBank Accession No. NC_001401 and Srivastava et ah, J. Virol., 45: 555-564 (1983); the complete genome of AAV-3 is provided in GenBank Accession No. NC_1829; the complete genome of AAV-4 is provided in GenBank Accession No. NC_001829; the AAV-5 genome is provided in GenBank Accession No. AF085716; the complete genome of AAV-6 is provided in GenBank Accession No. NC_00 1862; at least portions of AAV-7 and AAV-8 genomes are provided in GenBank Accession Nos.

AX753246 and AX753249, respectively; the AAV-9 genome is provided in Gao et ah, J. Virol., 78: 6381-6388 (2004); the AAV-10 genome is provided in Mol. Then, 13(1): 67-76 (2006); and the AAV-11 genome is provided in Virology, 330(2): 375-383 (2004). The sequence of the AAV rh.74 genome is provided in U.S. Patent 9,434,928, incorporated herein by reference. Cis-acting sequences directing viral DNA replication (rep), encapsidation/packaging and host cell chromosome integration are contained within the AAV ITRs. Three AAV promoters (named p5, pl9, and p40 for their relative map locations) drive the expression of the two AAV internal open reading frames encoding rep and cap genes. The two rep promoters (p5 and pi 9), coupled with the differential splicing of the single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep 78, rep 68, rep 52, and rep 40) from the rep gene. Rep proteins possess multiple enzymatic properties that are ultimately responsible for replicating the viral genome. The cap gene is expressed from the p40 promoter and it encodes the three capsid proteins VP1, VP2, and VP3. Alternative splicing and non-consensus translational start sites are responsible for the production of the three related capsid proteins. A single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158: 97-129 (1992).

[0065] AAV possesses unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cells in culture is noncytopathic, and natural infection of humans and other animals is silent and asymptomatic. Moreover, AAV infects many mammalian cells allowing the possibility of targeting many different tissues in vivo. Moreover, AAV transduces slowly dividing and non-dividing cells, and can persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is inserted as cloned DNA in plasmids, which makes construction of recombinant genomes feasible. Furthermore, because the signals directing AAV replication and genome encapsidation are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding replication and structural capsid proteins, rep-cap) may be replaced with foreign DNA. To generate AAV vectors, the rep and cap proteins may be provided in trans. Another significant feature of AAV is that it is an extremely stable and hearty virus. It easily withstands the conditions used to inactivate adenovirus (56° to 65°C for several hours), making cold preservation of AAV less critical. AAV may even be lyophilized. Finally, AAV- infected cells are not resistant to superinfection. Recombinant AAV genomes may be from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV- 9, AAV- 10, AAV-11, AAV- 12, AAV-13 and AAV rh74. Production of pseudotyped rAAV is disclosed in, for example, WO 01/83692. Other types of rAAV variants, for example rAAV with capsid mutations, are also contemplated. See, for example, Marsic et al., Molecular Therapy, 22(11): 1900-1909 (2014). The nucleotide sequences of the genomes of various AAV serotypes are known in the art.

|0066| In some embodiments, the term “CRISPR” refers to a technique of sequence specific genetic manipulation relying on the clustered regularly interspaced short palindromic repeats pathway, which unlike RNA interference regulates gene expression at a transcriptional level. The term “guide” as used herein refers to the guide polynucleotide sequences used to target specific genes employing the CRISPR technique. In some embodiments, the guide is a guide RNA (gRNA or sgRNA). Techniques of designing gRNAs and donor therapeutic polynucleotides for target specificity are well known in the art. See, e.g., Doench et al. (2014) Nature Biotechnol. 32(12): 1262-7 and Graham et al. (2015) Genome Biol. 16: 260, incorporated by reference herein.

10067] With respect to the endonuclease enzyme protein of the CRISPR-based technology, the term “ribonucleotide” refers to any suitable endonuclease enzyme protein or a variant thereof or mRNA thereof that will be specifically directed by the selected guide polynucleotide to enzymatically knock-out the target sequence of the guide polynucleotide.

As used herein, the term “variant thereof,” as used with respect to an ribonucleotide refers to the referenced endonuclease in its enzymatically functional form expressed in any suitable host organism or expression system and/or including any modifications to enhance the enzymatic activity.

[0068) As used herein, with respect to the CRISPR-based technology, the term “guide polynucleotide” refers to a polynucleotide having a “synthetic sequence” capable of binding the corresponding ribonuclease enzyme protein (e.g., Cas9) and a variable target sequence capable of binding the genomic target (e.g., a nucleotide sequence found in an exon of a target gene). In some embodiments of the present disclosure, a guide polynucleotide is a guide ribonucleic acid (gRNA or sgRNA). In some embodiments, the variable target sequence of the guide polynucleotide is any sequence within the target that is unique with respect to the rest of the genome and is immediately adjacent to a Protospacer Adjacent Motif (PAM). The exact sequence of the PAM sequence may vary as different endonucleases require different PAM sequences. gRNAs typically comprises a gRNA scaffold and a target specific sequence for example complementary to the target sequence). In some embodiments, a scaffold sequence refers to the sequence within the gRNA that is responsible for ribonucleotide or Cas enzyme binding, it does not include the 20 bp spacer/targeting sequence that is used to guide the enzyme to target polynucleotide. In further embodiments, a scaffold sequence comprises, or consists essentially of, or yet further consists of a direct repeat. More than one gRNA may be present in a construct, i.e., multiple spacers may be used to ensure gene targeting. The target specific sequences may be experimentally determined or found on one of many publicly available databases, such as Addgene (www.addgene.org).

[0069] The protospacer adjacent motif (or PAM for short) is a short DNA sequence (usually 2-6 base pairs in length) that follows the DNA region targeted for cleavage by the CRISPR system, such as CRISPR-Cas9. The PAM is required for a Cas nuclease to cut and is generally found 3-4 nucleotides downstream from the cut site.

[0070] In one aspect, the enzyme system uses a Cas9 CRISPR associated endonuclease or ribonucleotide protein but equivalents or alternatives are within the scope of this disclosure several of which are disclosed herein. Non-limiting exemplary Cas9s are provided herein, e.g. the Cas9 provided for in UniProtKB G3ECR1 (CAS9 STRTR) or the Staphylococcus aureus Cas9, as well as the nuclease dead Cas9, orthologs and biological equivalents each thereof. Orthologs include but are not limited to Streptococcus pyogenes Cas9 (“spCas9”); Cas 9 from Streptococcus thermophiles, Legionella pneumophilia, Neisseria lactamica, Neisseria meningitides, Francisella novicida; and Cpfl (which performs cutting functions analogous to Cas9) from various bacterial species including Acidaminococcus spp. and Francisella novicida U112. While the invention of this disclosure is exemplified using a Cas9 system, it is within the scope of this disclosure and invention that can be used in lieu of Cas9. Non-limiting examples include other enzymes such as Cpfl, C2cl, C2c2, C2c3, group 29, group 30 protein, Cas 13 a, Cas 13b, Casl3c or Casl3. In some embodiments of the present disclosure, a suitable endonuclease includes a CRISPR-associated sequence 9 (Cas9) endonuclease or a variant thereof, a CRISPR-associated sequence 13 (Casl 3) endonuclease or a variant thereof, CRISPR-associated sequence 6 (Cas6) endonuclease or a variant thereof, a CRISPR from Prevotella and Francisella 1 (Cpfl) endonuclease or a variant thereof, or a CRISPR from Microgenomates and Smithella 1 (Cmsl) endonuclease or a variant thereof. In some embodiments of the present disclosure, a suitable endonuclease includes a Streptococcus pyogenes Cas9 (SpCas9), a Staphylococcus aureus Cas9 (SaCas9), a Francisella novicida Cas9 (FnCas9), or a variant thereof. Variants may include a protospacer adjacent motif (PAM) SpCas9 (xCas9), high fidelity SpCas9 (SpCas9-FIFl), a high fidelity SaCas9, or a high fidelity FnCas9. In other embodiments of the present disclosure, the endonuclease comprises a Cas fusion nuclease comprising a Cas9 protein or a variant thereof fused with a Fokl nuclease or variant thereof. Variants of the Cas9 protein of this fusion nuclease include a catalytically inactive Cas9 (e.g., dead Cas9). In some embodiments of the present disclosure, the endonuclease may be a Cas9, Casl 3, Cas6, Cpfl, CMS1 protein, or any variant thereof that is derived or expressed from Methanococcus maripaludis C7, Corynebacterium diphtheria, Corynebacterium efficiens YS-314, Cory neb acterium glutamicum (ATCC 13032), Corynebacterium glutamicum (ATCC 13032), Corynebacterium glutamicum R, Corynebacterium kroppenstedtii (DSM 44385), Mycobacterium abscessus (ATCC 19977), Nocardia farcinica IFM1 0 152, Rhodococcus erythropolis PR4, Rhodococcus jostii RFIAl , Rhodococcus opacus B4 (uid36573), Acidothermus cellulolyticus 1 IB, Arthrobacter chlorophenolicus A6, Kribbella flavida (DSM 17836, uid43465), Thermomonospora curvata (DSM431 83), Bifidobacterium dentium Bdl, Bifidobacterium longum DJO10A, Slackia heliotrinireducens (DSM 20476), Persephonella marina EX HI, Bacteroides fragilis NCTC 9434, Capnocytophaga ochracea (DSM 7271 ), Flavobacterium psychrophilum JIP02 86, Akkermansia muciniphila (ATCC BAA 835), Roseiflexus castenholzii (DSM 13941 ), Roseiflexus RSI, Synechocystis PCC6803, Elusimicrobium minutum Peil 9 1, uncultured Termite group 1 bacterium phylotype Rs D 17, Fibrobacter succinogenes S85, Bacillus cereus (ATCC 10987), Listeria innocua, Lactobacillus casei, Lactobacillus rhamnosus GG, Lactobacillus salivarius UCC1 18, Streptococcus agalactiae-5-A909, Streptococcus agalactiae NEM316, Streptococcus agalactiae 2603, Streptococcus dysgalactiae equisimilis GGS 124, Streptococcus equi zooepidemicus MGCS1 0565, Streptococcus gallolyticus UCN34 (uid46061 ), Streptococcus gordonii Challis subst CHI, Streptococcus mutans NN2025 (uid46353), Streptococcus mutans, Streptococcus pyogenes M 1 GAS, Streptococcus pyogenes MGAS5005, Streptococcus pyogenes MGAS2096, Streptococcus pyogenes MGAS9429, Streptococcus pyogenes MGAS 10270, Streptococcus pyogenes MGAS61 80, Streptococcus pyogenes MGAS31 5, Streptococcus pyogenes SSI-1, Streptococcus pyogenes MGAS 1 0750, Streptococcus pyogenes NZ 1 3 1, Streptococcus therm ophiles CNRZ1 066, Streptococcus thermophiles LMD-9, Streptococcus therm ophiles LMG 1831 1, Clostridium botulinum A3 Loch Maree, Clostridium botulinum B Eklund 17B, Clostridium botulinum Ba4 657, Clostridium botulinum F Langeland, Clostridium cellulolyticum H 10, Finegoldia magna (ATCC 29328), Eubacterium rectale (ATCC 33656), Mycoplasma gallisepticum,

Mycoplasma mobile 163K, Mycoplasma penetrans, Mycoplasma synoviae 53,

Streptobacillus moniliformis (DSM 121 12), Bradyrhizobium BTAil , Nitrobacter hamburgensis X14, Rhodopseudomonas palustris BisBl 8, Rhodopseudomonas palustris BisB5, Parvibaculum lavamentivorans DS-1, Dinoroseobacter shibae DFL 12, Gluconacetobacter diazotrophicus Pal 5 FAPERJ, Gluconacetobacter diazotrophicus Pal 5 JGI, Azospirillum B51 0 (uid46085), Rhodospirillum rubrum (ATCC 11170), Diaphorobacter TPSY (uid29975), Verminephrobacter eiseniae EF01-2, Neisseria meningitides 053442, Neisseria meningitides alphal4, Neisseria meningitides Z2491, Desulfovibrio salexigens DSM 2638, Campylobacter jejuni doylei 269 97, Campylobacter jejuni 8 1116, Campylobacter jejuni, Campylobacter lari RM21 00, Helicobacter hepaticus, Wolinella succinogenes, Tolumonas auensis DSM 9 187, Pseudoalteromonas atlantica T6c, Shewanella pealeana (ATCC 700345), Legionella pneumophila Paris, Actinobacillus succinogenes 130Z, Pasteurella multocida, Francisella tularensis novicida U112, Francisella tularensis holarctica, Francisella tularensis FSC 198, Francisella tularensis, Francisella tularensis WY96- 3418, or Treponema denticola (ATCC 35405).

[0071] The term “Casl3” refers to one of a family of novel type of RNA targeting enzymes. The diverse Casl3 family contains at least four known subtypes, including Casl3a (formerly C2c2), Casl3b, Casl3c, and Casl3d. Casl3’s function similarly to Cas9, using a ~64-nt guide RNA to encode target specificity. The Casl3 protein complexes with the guide RNA via recognition of a short hairpin in the crRNA, and target specificity is encoded by a 28 - 30-nt spacer that is complementary to the target region. In addition to programmable RNase activity, all Casl3s exhibit collateral activity after recognition and cleavage of a target transcript, leading to non-specific degradation of any nearby transcripts regardless of complementarity to the spacer. Wessels, H.-H. et al. Nature Biotechnol. doi.org/10.1038/s41587-020-0456-9 (Published March 16, 2020). In one aspect, the term also includes optimized versions of Cas9, Casl3d and Casl3d orthologs.

[0072] The term “CRISPR-Cas9 RNP” intends the combination of Cas9 protein and guide RNA for rapid and efficient genome editing. These systems are known in the art and commercially available, see e.g., polyplus-transfection.com/blog/jetcrispr-mp-transfection/, last accessed on May 27, 2020 and Qiao, I, et al. (2019) Co-expression of Cas9 and single- guided RNAs in Escherichia coii streamlines production of Cas9 ribonucleoproteins. Comrnun Biol 2, 161 (2019).

[0073] The term “cell” as used herein may refer to either a prokaryotic or eukaryotic cell, optionally obtained from a subject or a commercially available source. In one embodiment, the cell is an insect cell.

[0074] “Eukaryotic cells” comprise all of the life kingdoms except monera. They can be easily distinguished through a membrane-bound nucleus. Animals, plants, fungi, and protists are eukaryotes or organisms whose cells are organized into complex structures by internal membranes and a cytoskeleton. The most characteristic membrane-bound structure is the nucleus. Unless specifically recited, the term “host” includes a eukaryotic host, including, for example, yeast, higher plant, insect and mammalian cells. Non-limiting examples of eukaryotic cells or hosts include simian, bovine, porcine, murine, rat, avian, reptilian and human, e.g., HEK293 cells, Chinese Hamster Ovary (CHO) cells and 293T cells, Muller cells, RPE or other specific cell types, as disclosed herein.

[0075] “Prokaryotic cells” that usually lack a nucleus or any other membrane-bound organelles and are divided into two domains, bacteria and archaea. In addition to chromosomal DNA, these cells can also contain genetic information in a circular loop called an episome. Bacterial cells are very small, roughly the size of an animal mitochondrion (about 1-2 pm in diameter and 10 pm long). Prokaryotic cells feature three major shapes: rod shaped, spherical, and spiral. Instead of going through elaborate replication processes like eukaryotes, bacterial cells divide by binary fission. Examples include but are not limited to Bacillus bacteria, E. coli bacterium, and Salmonella bacterium.

[0076] In one embodiment, the guide polynucleotide is a gRNA or sgRNA. The term “gRNA” or “guide RNA” as used herein refers to the guide RNA sequences used to target specific genes for correction employing the CRISPR technique. Techniques of designing gRNAs and donor therapeutic polynucleotides for target specificity are well known in the art. For example, Doench, T, et al. Nature biotechnology 2014; 32(12): 1262-7, Mohr, S. et al. (2016) FEBS Journal 283: 3232-38, and Graham, D., et al. Genome Biol. 2015; 16: 260. gRNA comprises or alternatively consists essentially of, or yet further consists of a fusion polynucleotide comprising CRISPR RNA (crRNA) and trans-activating CRISPR RNA (tracrRNA); or a polynucleotide comprising CRISPR RNA (crRNA) and trans-activating CRISPR RNA (tracrRNA). In some aspects, a gRNA is synthetic (Kelley, M. et al. (2016) J of Biotechnology 233 (2016) 74-83). As used herein, a biological equivalent of a gRNA includes but is not limited to polynucleotides or targeting molecules that can guide a Cas9 or an equivalent thereof to a specific nucleotide sequence such as a specific region of a cell’s genome. SEQ ID NO 2 is an example of a gRNA.

[0077] The term “protein,” “peptide,” and “polypeptide” are used interchangeably and in their broadest sense to refer to a compound of two or more subunit amino acids, amino acid analogs or peptidomimetics. The subunits may be linked by peptide bonds. In another embodiment, the subunit may be linked by other bonds, e.g., ester, ether, etc. A protein or peptide must contain at least two amino acids and no limitation is placed on the maximum number of amino acids that can comprise a protein’s or peptide's sequence. As used herein the term “amino acid” refers to natural and/or unnatural or synthetic amino acids, including glycine and both the D and L optical isomers, amino acid analogs and peptidomimetics.

[0078] The term “isolated” as used herein refers to molecules or biologicals or cellular materials being substantially free from other materials.

[0079] As used herein, the term “detectable marker” refers to at least one marker capable of directly or indirectly, producing a detectable signal. A non-exhaustive list of this marker includes enzymes which produce a detectable signal, for example by colorimetry, fluorescence, luminescence, such as horseradish peroxidase, alkaline phosphatase, b- galactosidase, glucose 6-phosphate dehydrogenase, chromophores such as fluorescent, luminescent dyes, groups with electron density detected by electron microscopy or by their electrical property such as conductivity, amperometry, voltammetry, impedance, detectable groups, for example whose molecules are of sufficient size to induce detectable modifications in their physical and/or chemical properties, such detection may be accomplished by optical methods such as diffraction, surface plasmon resonance, surface variation , the contact angle change or physical methods such as atomic force spectroscopy, tunnel effect, or radioactive molecules such as ³² P, ³⁵ S or ¹²⁵1.

[0080] As used herein, the term “purification marker” or “selectable marker” refers to at least one marker useful for purification or identification. A non-exhaustive list of this marker includes His, lacZ, GST, maltose-binding protein, NusA, BCCP, c-myc, CaM, FLAG, GFP, YFP, cherry, thioredoxin, poly(NANP), V5, Snap, HA, chitin-binding protein, Softag 1, Softag 3, Strep, or S-protein. Suitable direct or indirect fluorescence marker comprise FLAG, GFP, YFP, RFP, dTomato, cherry, Cy3, Cy 5, Cy 5.5, Cy 7, DNP, AMCA, Biotin, Digoxigenin, Tamra, Texas Red, rhodamine, Alexa fluors, FITC, TRITC or any other fluorescent dye or hapten.

[0081] As used herein, the term “nuclear localization signal” or “NLS” refers to an amino acid sequence that 'tags' a protein for import into the cell nucleus by nuclear transport. Typically, this signal consists of one or more short sequences of positively charged lysines or arginines exposed on the protein surface. Different nuclear localized proteins may share the same NLS. An NLS has the opposite function of a nuclear export signal (NES), which targets proteins out of the nucleus.

[0082] As used herein, the term “regulatory sequence” or “expression control sequence” or the like refers to a segment of a nucleic acid molecule which is capable of increasing or decreasing the expression of specific genes within an organism. Expression control or regulatory sequences may include, e.g., include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (poly A) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. A promoter may be selected from amongst a constitutive promoter, a tissue- specific promoter, a cell-specific promoter, a promoter responsive to physiologic cues, or an inducible promoter.

[0083] Inducible promoters may be suitable for use in the disclosed invention, for example including promoters responsive to exogenous agents (e.g., pharmacological agents) or to physiological cues (such as temperature). These response elements include, but are not limited to a hypoxia response element (HRE) that binds HIF-Ia and b, a metal-ion response element such as described by Mayo et al. (1982, Cell 29:99-108); Brinster et al. (1982,

Nature 296:39-42) and Searle et al. (1985, Mol. Cell. Biol. 5:1480-1489); or a heat shock response element such as described by Nouer et al. (in: Heat Shock Response, ed. Nouer, L., CRC, Boca Raton, Fla., ppI67-220, 1991). In one embodiment, a regulatable promoter that provides tight control over the transcription of the polynucleotide, e.g., via a pharmacological agent, or transcription factors activated by a pharmacological agent or in alternative embodiments, physiological cues. Promoter systems that are non-leaky and that can be tightly controlled are preferred. Examples of regulatable promoters which are ligand-dependent transcription factor complexes that may be used in the invention include, without limitation, members of the nuclear receptor superfamily activated by their respective ligands (e.g., glucocorticoid, estrogen, progestin, retinoid, ecdysone, and analogs and mimetics thereof) and rTTA activated by tetracycline. In one aspect of the invention, the gene switch is an EcR- based gene switch. Examples of such systems include, without limitation, the systems described in U.S. Pat. Nos. 6,258,603, 7,045,315, U.S. Published Patent Application Nos. 2006/0014711, 2007/0161086, and International Published Application No. WO 01/70816. Examples of chimeric ecdysone receptor systems are described in U.S. Pat. No. 7,091,038, U.S. Published Patent Application Nos. 2002/0110861, 2004/0033600, 2004/0096942, 2005/0266457, and 2006/0100416, and International Published Application Nos. WO 01/70816, WO 02/066612, WO 02/066613, WO 02/066614, WO 02/066615, WO 02/29075, and WO 2005/108617, each of which is incorporated by reference in its entirety. An example of a non-steroidal ecdysone agonist-regulated system is the RheoSwitch® Mammalian Inducible Expression System (New England Biolabs, Ipswich, Mass.).

[0084] Still other promoter systems may include response elements including but not limited to a tetracycline (tet) response element (such as described by Gossen & Bujard (1992) Proc. Natl. Acad. Sci. USA 89:5547-551); or a hormone response element such as described by Lee et al. (1981) Nature 294:228-232); Hynes et al. (1981) Proc. Natl. Acad. Sci. USA 78:2038- 2042); Klock et al. (1987) Nature 329:734-736); and Israel & Kaufman (1989) Nucl. Acids Res. 17:2589-2604) and other inducible promoters known in the art. Using such promoters, expression of the neutralizing antibody construct can be controlled, for example, by the Tet- on/off system (Gossen et al. (1995) Science 268:1766-9; Gossen et al. (1992) Proc. Natl. Acad. Sci. USA., 89(12):5547-51); the TetR-KRAB system (Urrutia R. (2003) Genome Biol., 4(10):231; Deuschle U et al. (1995) Mol Cell Biol. (4): 1907-14); the mifepristone (RU486) regulatable system (Geneswitch; Wang Y et al. (1994) Proc. Natl. Acad. Sci. USA., 91(17):8180-4; Schillinger et al., (2005) Proc. Natl. Acad. Sci. USA. 102(39): 13789-94); the humanized tamoxifen-dep regulatable system (Roscilli et al. (2002), Mol. Ther. 6(5):653-63).

[0085] VEGF (Vascular endothelial growth factor) is a signal protein that is known to stimulate vasculogenesis and angiogenesis. It is part of the system that restores the oxygen supply to tissues when blood circulation is inadequate. VEGF also contributes to and creates new blood vessels during embryonic development. A protein having VEGF biological activity is a protein having one or more of the biological activities of VEGF as known in the art. Seq. ID NO.: 1 is an example of a polynucleotide encoding a VEGF protein. Additional examples include the sequences available at GenBank X62568.1 and GenBank AY04758 and described in Ito et al., (2001) Cell Sign. 13(11):849-854. SEQ ID NO: 1

SEQ ID NO: 1

4974 GAATTCG 4981 CCCTTCCTGA GATCACCGGT AGGAGGGCCA TCATGAACTT TCTGCTGTCT TGGGTGCATT 5041 GGAGCCTTGC CTTGCTGCTC TACCTCCACC ATGCCAAGTG GTCCCAGGCT GCACCCATGG 5101 CAGAAGGAGG AGGGCAGAAT CATCACGAAG TGGTGAAGTT CATGGATGTC TATCAGCGCA 5161 GCTACTGCCA TCCAATCGAG ACCCTGGTGG ACATCTTCCA GGAGTACCCT GATGAGATCG 5221 AGTACATCTT CAAGCCATCC TGTGTGCCCC TGATGCGATG CGGGGGCTGC TGCAATGACG 5281 AGGGCCTGGA GTGTGTGCCC ACTGAGGAGT CCAACATCAC CATGCAGATT ATGCGGATCA 5341 AACCTCACCA AGGCCAGCAC ATAGGAGAGA TGAGCTTCCT ACAGCACAAC AAATGTGAAT 5401 GCAGACCAAA GAAAGATAGA GCAAGACAAG AAAATCCCTG TGGGCCTTGC TCAGAGCGGA 5461 GAAAGCATTT GTTTGTACAA GATCCGCAGA CGTGTAAATG TTCCTGCAAA AACACAGACT 5521 CGCGTTGCAA GGCGAGGCAG CTTGAGTTAA ACGAACGTAC TTGCAGATGT GACAAGCCGA 5581 GGCGGTGAAA GGGCGAATTC

[0086] VEGF-A intends Vascular endothelial growth factor A, a human protein. The sequence of the protein is known and is available at https://www.uniprot.Org/uniprot/P15692#function, last accessed on May 27, 2020, incorporated by reference.

[0087] A “nanoparticle” intends a drug-carrying and/or compound-carrying particulate or granular material within the particular size range recited. As used herein, a nanoparticle consisting of particles 50 millimeters or less in diameter, and 1 micron or more (e.g., 1 to 100 or alternatively, or alternatively, 1 to 75 microns, or alternatively 1 to 50, or alternatively 1 to 25, or alternatively 1 to 10 microns) in diameter. Non-limiting examples of such include hollow microspheres, e.g., lipid nanoparticles, that can contain the CRISPR gene editing systems and components as described herein and microparticles, which are used as a generic term for any particles in the recited size range, whether spherical or not, as those terms are typically used in the art. In one aspect, the nanoparticles are "biocompatible", it is meant that the components of the delivery system will not cause tissue injury or injury to the human biological system. To impart biocompatibility, polymers and excipients that have had history of safe use in humans or with GRAS (Generally Accepted As Safe) status, are preferentially used. By biocompatibility, it is meant that the ingredients and excipients used in the composition will ultimately be "bioabsorbed" or cleared by the body with no adverse effects to the body. For a composition to be biocompatible, and be regarded as non-toxic, it must not cause toxicity to cells. Similarly, the term “bioabsorbable” refers to microspheres made from materials which undergo bioabsorption in vivo over a period of time such that long term accumulation of the material in the patient is avoided. The biocompatible nanoparticle is bioabsorbed over a period of less than 2 years, preferably less than 1 year and even more preferably less than 6 months. The rate of bioabsorption is related to the size of the particle, the material used, and other factor well recognized by the skilled artisan. A mixture of bioabsorbable, biocompatible materials can be used to form the nanoparticles used in this invention. See, for example Wei et al. (2020) Nature Communications 11, 3232 //doi.org/10.1038/s41467-020-17029-3 (last accessed on May 24, 2021) and Agharmiri et al. (2020) J. Drug Delivery Science and Technology, Vo!. 56A: 101533, doi.org/10.1016/j.jddst.2020.101533 (last accessed on May 24, 2021) for examples of nanoparticle delivery systems for CRISPR/Cas9 delivery. Qui et al. (2021) PNAS March 9, 2021 111(10) e2020401118; doi.org/10.1073/pnas.202040t 118 (last accessed on May 24, 2021) for a general description and methods for lipid nanoparticle delivery of Cas9 mRNA and sgRNA for gene editing technologies.

[0088] Lipofectamine intends a transfection reagent that is commercially available from Invitrogen. It is used to increase transfection efficiency of polynucleotides by lipofection. Lipofectamine contains lipid subunits that can form liposomes in an aqueous environment, which entrap the transfection product.

[0089] CRISPRMAX (LCM) intends is a lipid nanoparticle transfection reagent for CRISPR- Cas9 protein delivery _. It is commercially available from ThermoFisher Scientific.

[0090] A “subject” of diagnosis or treatment is a prokaryotic or a eukaryotic cell, a tissue culture, a tissue or an animal, e.g., a mammal, including a human. Non-human animals subject to diagnosis or treatment include, for example, a human patient, a simian, a murine, a canine, a leporid, such as a rabbit, livestock, sport animals, and pets.

[0091] A “composition” as used herein, refers to an active agent, such as an agent as disclosed herein and a carrier, inert or active. The carrier can be, without limitation, solid such as a bead or resin, or liquid, such as phosphate buffered saline. [0092] The term “carrier” as used herein refers to a usually inactive substance that acts as a vehicle for an active substance. The terms “excipient”, “vehicle”, or “carrier” refer to substances that facilitate the use of, but do not deleteriously react with, the active compound(s) when mixed with it. The term “active” refers to the ingredient, component or constituent of the compositions of the present invention responsible for the intended therapeutic effect. Carriers must be of sufficiently high purity and of sufficiently low toxicity to render them suitable for administration to the subject being treated. The carrier can be inert, or it can possess pharmaceutical benefits. The term “pharmaceutically acceptable carrier” as used herein refers to any substantially non-toxic carrier conventionally useful for administration of pharmaceuticals in which the active component will remain stable and bioavailable. The pharmaceutical compositions within the described invention contain a therapeutically effective amount of included in a pharmaceutically-acceptable carrier. The term “pharmaceutically-acceptable carrier” as used herein refers to one or more compatible solid or liquid filler, diluents or encapsulating substances which are suitable for administration to a human or other vertebrate animal. The term “carrier” as used herein refers to an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. The components of the pharmaceutical compositions also are capable of being commingled in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficiency.

[0093] A “pharmaceutical composition” is intended to include the combination of an active agent with a carrier, inert or active, in a sterile composition suitable for diagnostic or therapeutic use in vitro , in vivo or ex vivo. In one aspect, the pharmaceutical composition is substantially free of endotoxins or is non-toxic to recipients at the dosage or concentration employed.

[0094] “Administration,” “administering” and the like intends by any appropriate means, e.g., intravenously, intravitreal injection, intraocularly, transdermally, orally, by suppository, inhalation, or other, an agent, composition or combination as described herein.

[0095] Administration or treatment in “combination” refers to administering two agents such that their pharmacological effects are manifest at the same time. Combination does not require administration at the same time or substantially the same time, although combination can include such administrations. [0096] An “effective amount” is an amount sufficient to effect beneficial or desired results. An effective amount can be administered in one or more administrations, applications or dosages. Such delivery is dependent on a number of variables including the time period for which the individual dosage unit is to be used, the bioavailability of the therapeutic agent, the route of administration, etc. It is understood, however, that specific dose levels of the therapeutic agents disclosed herein for any particular subject depends upon a variety of factors including the activity of the specific compound employed, bioavailability of the compound, the route of administration, the age of the animal and its body weight, general health, sex, the diet of the animal, the time of administration, the rate of excretion, the drug combination, and the severity of the particular disorder being treated and form of administration. In general, one will desire to administer an amount of the compound that is effective to achieve a serum level commensurate with the concentrations found to be effective in vivo. These considerations, as well as effective formulations and administration procedures are well known in the art and are described in standard textbooks. Consistent with this definition and as used herein, the term “therapeutically effective amount” is an amount sufficient to treat a specified disorder or disease or alternatively to obtain a pharmacological response.

[0097] As used herein, “treating” or “treatment” of a disease in a patient refers to (1) preventing the symptoms or disease from occurring in an animal, subject or patient that is predisposed or does not yet display symptoms of the disease; (2) inhibiting the disease or arresting its development; or (3) ameliorating or causing regression of the disease or the symptoms of the disease. As understood in the art, “treatment” is an approach for obtaining beneficial or desired results, including clinical results. For the purposes of this technology, beneficial or desired results can include one or more, but are not limited to, alleviation or amelioration of one or more symptoms, diminishment of extent of a condition (including a disease), stabilized (i.e., not worsening) state of a condition (including disease), delay or slowing of condition (including disease), progression, amelioration or palliation of the condition (including disease), states and remission (whether partial or total), whether detectable or undetectable. In one aspect, the term treatment excludes prevention or prophylaxis.

Modes for Carrying Out the Disclosure

[0098] The examples are provided to demonstrate some embodiments of the disclosure. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

[0099] Applicant describes herein the effects of VEGF-A gene disruption in Muller cells as well as in RPE cells, both of which are major VEGF producers in the eye. In one aspect, CRISPR-Cas9 ribonucleoprotein (or alternatively an alternative ribonucleoprotein known in the art and briefly described herein or mRNA encoding same) is delivered via a nanoparticle such as lipid nanoparticle such as lipofectamine CRISPRMAX (LCM).

[0100] Thus, in one aspect, this disclosure provides methods and compositions for gene editing to reduce production of VEGF in the cells such as the eye. Clustered regularly interspaced short palindromic repeats associated protein-9 nuclease (CRISPR-Cas9 or an equivalent thereof, or mRNA encoding same) can be used to silence VEGF gene by producing double stranded cuts in DNA at one or more locations in the cell, e.g. exon 1.

[0101] There are two major ways that gene silencing could be achieved: 1) CRISPR can be designed for a particular part of the VEGF gene. Then CRISPR and Cas9 or equivalent system can be delivered into cells to make precise double stranded cut in the DNA at the desired position. CRISPR-Cas9 delivery into cells could be achieved using nanoparticles such as lipid nanoparticles, Lipofectamine CRISPRMAX nanoparticle, or more vectors. Any of the first 5 exons of VEGF-A can be targeted but in one aspect, exon 1 is targeted because of its high on and off target scores. In another approach, instead of delivering CRISPR-Cas9 into cells, CRISPR and Cas9 genes could be inserted into the DNA using viral vectors using methods known in the art. Provided herein are non-limiting examples of vectors for such delivery. In this approach CRISPR and Cas9 produced by cells create precise double stranded cut in the DNA at desired position of the VEGF gene. CRISPR and Cas9 genes could be introduced to cells using viral vectors, particularly adeno associated virus 2 (AAV2).

[0102] Retinal pigment epithelial (RPE) cells, Muller cells, ganglion cells and endothelial cells are major producers of VEGF in the eye and the main targets of gene editing in this method. CRISPR ribonucleotide protein (e.g., Cas9) or mRNA encoding same, or a nanoparticle complex or CRISPR-Cas9 gene-vector complex delivery can be done through intravitreal injection. The likelihood of delivery of CRISPR-Cas9 or their genes into cells is likely higher for more superficial cells than RPE. Instead of CRISPR-Cas9, CRISPR-Cpfl can also be used, or the Cas9 can be streptococcal (spCas9) or staphylococcal (saCas9). The vectors for delivery can be viral or non viral. The CRISPR-Cas9 could target VEGF, VEGF- A, or any isomer of VEGF-A such as VEGF-165.

[0103] Thus, in one aspect, provided herein is a gene editing system comprising a CRISPR gene editing system comprising a CRISPR ribonucleotide protein or polypeptide (e.g., Cas9) or CRISPR-Cpfl protein or mRNA encoding the protein or polypeptide and a guide RNA (sgRNA) that targets and/or cleaves VEGF protein, e.g., VEGF-A, VEGF-165 or an any isoform of each thereof. In one aspect, the gene editing system further comprises a detectable or purification label. In a further aspect, the system comprises an engineered nucleoprotein complex that comprises: (a) a CRISPR ribonucleotide protein (e.g., Cas9) or polypeptide, mRNA or an equivalent encoding the protein or polypeptide, e.g., a CRISPR- Cpfl polypeptide, and (b) one or more recombinant or synthetic single guide RNA (gRNA or sgRNA) which is engineered or designed to comprise on its 5’ end, an RNA sequence that recognizes by hybridization (that hybridizes to or binds to) a VEGF target RNA (e.g., and on its 3’ end (i) an RNA sequence capable of binding to or associating with the CRISPR ribonucleotide protein (e.g., Cas polypeptide (e.g., a Cas9 or Cpfl polypeptide-binding “scaffold sequence”)), or (ii) a linker that binds or covalently or non-covalently links the 5’ RNA-hybridizing or binding end of the sgRNA with the CRISPR ribonucleotide protein (e.g., Cas polypeptide), wherein the nucleoprotein complex does or does not comprise a PAMmer oligonucleotide. In one aspect, the Cas polypeptide or mRNA is truncated or mutated from wild-type, as is known in the art. In a further aspect, the nucleoprotein complex of the gene editing system further comprises a 5’ RNA- hybridizing or binding end of the sgRNA that is between about 15 to 25, or 20, 21, 22 nucleotides in length, and the RNA sequence capable of binding to or associating with the CRISPR ribonucleotide protein (e.g., Cas9 protein) is between about 85 and 100, or 90, 91, 92, 93, 94 or 95 nucleotides in length, and optionally the CRISPR ribonucleotide protein (e.g., Cas9 or Cas polypeptide) is adapted to be associated with, fused with, or that binds to or is covalently or non-covalently linked to, an effector polypeptide, a targeting agent, an enzyme, and/or a detectable moiety, wherein optionally the effector polypeptide comprises an RNA modifying polypeptide. In a further aspect, the nucleoprotein complex of the gene editing system comprises a CRISPR ribonucleotide protein (e.g., Cas polypeptide or mRNA) that is fused to or covalently linked to said effector polypeptide and/or targeting agent and/or a detectable agent. In one aspect, the target is within exon 1 of the VEGF encoding sequence, e.g., VEFG-A, VEGF-165 or an isoform thereof. [0104] In another aspect, the editing system comprises the sgRNA or gRNA of SEQ ID NO 2 or an equivalent thereof. In another aspect, the system binds to the target sequence of SEQ ID NO 6) or a fragment or equivalent thereof. In a yet further aspect, the target sequence comprises a photospacer, e.g., the photospacer having the sequence identified in the Brief Description of the Sequences, or an equivalent thereof. In one aspect, the gRNA comprises, or consists essentially thereof or consist essentially of, 5’-

GGAGGAAGAGTAGCTCGCCG-3 ’ with a PAM sequence of 5’-AGG-3’ on exon 1, encoding for amino acids 146 to 152.

[0105] The gene editing system can further comprise a forward primer and a reverse primer for the VEGF protein. In one aspect, the primers are SEQ ID NOs 3 and 4, respectively and equivalents of each thereof.

[0106] Also provided are polynucleotides encoding the above components, wherein the polynucleotide is DNA or RNA. They can be inserted into a vector for replication or expression or incorporated into nanoparticle for delivery.

[0021] In addition, one or more of the gene editing system, polynucleotides or a vector comprising them, can be combined with a carrier, such as a pharmaceutically acceptable carrier.

[0108] In another aspect, nanoparticle, e.g., a nanoparticle, such as a lipid nanoparticle, e.g., lipofectamine nanoparticle comprises, or consists essentially of, or yet further consists of, the gene editing system as described herein.

[0109] Also provided herein is a cell comprising the gene editing system or the nanoparticle as described herein. The cell can be a prokaryotic or eukaryotic cell. In one aspect, the cell expresses or comprises VEGF, e.g., VEGF-A. Non-limiting examples of such cells include a Muller cell, a retinal pigment epithelial (RPE) cell, or a ganglion cell. The cells can be of any species, e.g., a mammalian cell such as a canine, feline, simian, rat, murine or a human cell. The cells can be from a subject or patient biopsy or a cultured cell line that is created or purchased from a vendor such as the American Type Culture Collection (ATCC).

[0110] The gene editing system, nanoparticles and/or compositions as provided herein are useful to edit a VEGF gene in a cell that expresses VEGF, the method comprising, or consisting essentially of, or yet further consisting of contacting the cell with the gene editing system, the nanoparticle or compositions as described herein. In one aspect, the VEGF target is within exon 1 of the VEGF encoding sequence, e.g., VEFG-A, VEGF-165 or an isoform thereof.

[0111] In a further aspect, a different therapeutic agent is contacted with the cell. Various amounts can be contacted depending on the purpose, e.g., an effective amount to edit VEGF, suboptimal amounts or a therapeutically effective amount. The contacting can be performed in vitro or in vivo. When performed in vitro, the method provides an assay for personalized medicine or an assay to test for combination therapies. When performed in a non-human mammal, the method provides an animal model to test for new therapies or combination therapies. When performed in a mammal or a human, the method provides a therapeutic benefit, alone or in combination with other therapies. In one embodiment, the cell is a mammalian cell, such as for example, a canine cell, a feline cell, a rat cell, a murine cell, a simian cell or a human cell.

[0112] Also provided is a method to treat a condition mediated by VEGF gene expression or pathologic angiogenic states in a subject in need thereof, comprising administering to the subject the gene editing system and/or a nanoparticle and/or a composition as described herein. In one aspect, the VEGF target is within exon 1 of the VEGF encoding sequence, e.g., VEFG-A, VEGF-165 or an isoform thereof.

[0113] Other therapeutic agents can be combined with the disclosed systems for use in the method. Various amounts can be administered depending on the purpose, e.g., an effective amount to edit VEGF -A in the subject, suboptimal amounts to determine safety, toxicity or efficacy, or a therapeutically effective amount for treatment or prevention.

[0114] Non-limiting examples of conditions or states include for example, age-related macular degeneration (AMD), diabetic retinopathy, retinal vein occlusion (RVO), or a retinal vascular disease. In one aspect the subject is a mammal, e.g., a canine, a feline, a rat, a murine, a simian or a human. The method is performed to reduce VEGF expression and minimize symptoms of the disease or condition. The effects can be clinical or sub-clinical. In one aspect, the method treats the disease or condition. In another aspect it can prevent the disease or condition. In one aspect, treatment excludes prevention. Methods to monitor VEGF expression and clinical symptoms are known in the art.

[0115] Any appropriate mode of administration can be used, such as for example, suprachoroidal, intravitreal injection, intraocular injection, topical or subretinal injection. [0116] Further provided are compositions and/or kits comprising the gene editing system and/or the nanoparticle, and/or the composition as described herein, and instructions for use. In one aspect the composition comprises a carrier that optionally comprises a preservative or a stabilizer. The compositions can be frozen or lyophilized for storage and subsequent use.

Brief Description of the Sequences

[0117] SEQ ID NO 1 is a polynucleotide sequence of a VEGF-A protein or polypeptide.

[0118] SEQ ID NO 2 is the polynucleotide sequence of the gRNA. The 20-nt guide segment of the sgRNA is 5’- GGAGGAAGAGTAGCTCGCCG-3. ’ A PAM sequence of 5’-AGG-3’ on exon 1, encoding for amino acids 146 to 152 is provided herein as an example of the PAM.

[0119] SEQ ID NO 3 is the polynucleotide sequence of the forward primer.

[0120] SEQ ID NO 4 is the polynucleotide sequence of the reverse primer.

[0121] SEQ ID NO 5 is the polynucleotide sequence of the non-target strand of the VEGF-A polynucleotide.

[0122] SEQ ID NO 6 is the polynucleotide sequence of the target strand of the VEGF-A polynucleotide. The 20-nt photospacer is 3’ -cctccttctcatcgagcggc-5 ’ .

[0123] SEQ ID NOs 7 to 10 are mutations outside the guide area detected by Sanger sequencing. Insertion deletions respectively are indicated in the sequence listing. With one exception in SEQ ID 8, all mutations were single nucleotide substitution. Some colonies had up to three mutations.

[0124]( SEQ ID NO 7 shows the mutations for CRISPR-Cas9 treated RPE cells.

[0125] SEQ ID NO 8 shows the mutations for CRISPR-Cas9 treated Muller cells.

[0126] SEQ ID NO 9 shows the mutations for untreated RPE cells (control).

[0127] SEQ ID NO 10 shows the mutations for untreated Muller cells (control).

Experiment No. 1 Materials and Methods

Cell Culture and Transfection Using LCM Nanopartide.

[0128] Retinal pigment epithelial (RPE) cells (ARPE-19, ATCC CRL-2302, Manassas, VA) were grown in T75 flasks using Dulbecco's Modified Eagle's Medium (DMEM): F-12 (ATCC 30-2006) with 10% Fetal Bovine Serum (FBS) (ATCC 30-2020). Muller cells (MIO- Ml) were purchased from XIP (London, United Kingdom). DMEM (ATCC 30-2002) with 10% FBS (ATCC 30-2020) was used to grow Muller cells in T75 flasks. Primary Human Retinal Microvascular Endothelial Cells (HRME) (ACBRI 181) purchased from Cell Systems (Kirkland, WA) were grown in T75 flasks using Complete Classic Medium with Serum and CultureBoost (4Z0-500, Cell Systems, Kirkland, WA).

[0129] For transfection with LCM, the manufacturer’s protocol (Invitrogen TrueGuide Synthetic gRNA - Thermo Fisher Scientific, Waltham, MA) was followed. The cells were seeded into a 6-well plate the day before transfection so that they reached 30-70% confluence at the time of transfection. On the day of transfection, 125 μL of Opti-MEM I Medium (Gibco, Thermo Fisher Scientific, Waltham, MA), 37.5 pmol of TrueCut™ Cas9 Protein v2 (Invitrogen by Thermo Fisher Scientific, Waltham, MA), 37.5 pmol of sgRNA and 12.5 μL of Lipofectamine Cas9 Plus Reagent (Invitrogen by Thermo Fisher Scientific, Waltham,

MA), were added to a 1.7 mL sterile microcentrifuge tube (Tube 1). Meanwhile, 125 pL of Opti-MEM I Medium and 7.5 pL of LCM Transfection Reagent (Invitrogen by Thermo Fisher Scientific, Waltham, MA), were added to another sterile tube (Tube 2). Tube 2 was incubated for 1 minute at room temperature, then mixed well into Tube 1 by frequent pipetting. The mixture was incubated for 15 minutes at room temperature to allow the formation of CRISPR-Cas9 RNPs. 250 pL of the transfection complex was added to each of the wells, after which the cells were incubated at 37°C in the presence of 5% C02. The cells were analyzed 48 hours post-transfection.

Designing a Specific Single-guide RNA (sgRNA) Targeting the Human VEGF-A Gene.

[0130] Guide RNA (gRNA) was designed using Benchling CRISPR gRNA design software (Benchling, San Francisco, CA). A protospacer adjacent motif (PAM) sequence of 5’-NGG- 3’ for streptococcus pyogenes Cas9 (spCas9) and a guide sequence length of 20 nucleotides were selected.

[0131] The analysis showed the guide sequence of 5’-GGAGGAAGAGTAGCTCGCCG-3’ (SEQ ID NO: 2) with the PAM sequence of 5’-AGG-3’ on exon 1, encoding for amino acids 146 to 152, to have the best on-target and off-target scores of 74.3 and 85.1, respectively. Search of the entire VEGF-A gene revealed that this same area on exon 1 had the best overall on-target and off-target scores. In Vitro CRISPR-Cas9-Mediated Cleavage of DNA Oligonucleotide Duplex.

[0132] The target DNA duplex and the single guide RNA (sgRNA)s are exemplary and disclosed in the Sequence Listing. Sequences can be obtained commercially from Integrated DNA Technology (Skokie, IL) and Invitrogen by Thermo Fisher Scientific (Waltham, MA), respectively. DNA cleavage was monitored with 5’ ³²P-labels at both strands of the DNA duplex following a previously reported protocol ¹⁵. A typical 10 pL ³²P-labeling reaction contained 10 mM double-stranded DNA, 8 pL ³²P g-ATR (MP Biomedicals, 6000 Ci/mmol), 10 units T4 polynucleotide kinase (PNK, New England Biolabs #M0201), and IX PNK Buffer (New England Biolabs, 70 mM Tris-HCl, 10 mM MgCh, 5 mM DTT, pH 7.6). The reaction mixture was incubated at 37°C for 30 minutes, then the T4 PNK was deactivated by heating at 65°C for 20 minutes. The cleavage reaction was carried out at single-turnover condition: ³²P-labeled DNA duplex (1 nM) was subjected to cleavage by a pre-formed Cas9/sgRNA effector complex, with the concentration of the complex at least 10 times higher than that of the DNA. To pre-form the effector complex, appropriate amount of RNA (Invitrogen) was first heated at 95°C for 1 minutes, then incubated in a reaction buffer (20 mM Tris pH 7.5, 100 mM KC1, 5 mM MgCh, 5% (v/v) glycerol, and 0.5 mM TCEP) for 10 minutes. Then desired amount of Cas9 (Invitrogen) was added to obtain a final ratio of RNA/Cas9 approximately 1.5: 1. The Cas9/RNA mixture was incubated at room temperature for 15 minutes, then appropriate amount of DNA substrate was added, and the mixture was incubated at 37°C for 30 minutes. To terminate the reaction, equal amount of denaturing solution (8M urea, 20 mM EDTA, 20% glycerol, 0.1% bromophenol blue, 0.1% xylene cyanol) was added and the mixture was heated at 95°C for 1 minute to deactivate the Cas9 enzyme. The cleavage reaction was resolved by 20% denaturing PAGE, and DNA species were visualized by autoradiography using a Personal Molecular Imager (Bio-Rad, Hercules, CA).

[0133] To quantify the reaction, the signal of the individual precursor and product band was corrected for background according to: I = Io - So^xabg, where Io is the raw measured signal, So is area of the band, and abg is the average intensity per unit area obtained from multiple sections of the gel between the precursor and product bands. The reaction product was then computed as:

[0134] %Product= [Iproduct/ (Iprecursor + Iproduct)] x 100, where Iprecursor is the intensity of DNA precursor signal and Iproduct is the sum of products signal. Genomic Cleavage Assay.

[0135] The genome editing efficiency was determined by the GeneArt Genomic Cleavage Detection Kit (Life Technologies, Thermo Fisher Scientific, Waltham, MA). The sgRNA targeting sequence 5’- GGAGGAAGAGTAGCTCGCCG -3’ (SEQ ID NO: 2) was used to edit the VEGF-A gene. At 48 hours post-transfection, the culture medium was removed and the cells were rinsed twice with 500 pL PBS. The cells were detached by adding 500 pL of Trypsin/EDTA to the selected well of a 6-well plate. Transfected cells were spun down at 200g for 5 minutes at 4°C. The supernatant was carefully removed, after which cell lysis proceeded. 50 pL of Cell Lysis Buffer and 2 pL of Protein Degrader were mixed in a microcentrifuge tube and 50 pL of Cell Lysis Buffer/Protein Degrader mixture was added to the cell pellet. The pellet was resuspended by frequent pipetting and transferred to a PCR tube. The PCR program was set to 68°C for 15 minutes and 95°C for 10 minutes. The cell lysate was vortexed briefly and the following components were added to a PCR tube: Sample Tube containing 2 pL of Cell Lysate, 1 pL of each forward and reverse Primers, 25 pL of AmpliTaq Gold 360 Master Mix and 21 pL of Water. For best results, 5 pL of 360 GC Enhancer per 50 pL PCR reaction was added to the sample tube. For the VEGF-A gene target, a forward primer, 5’-TGTGCGCAGACAGTGCTCCA-3’ (SEQ ID NO: 3), and a reverse primer, 5’-CCAGATCGTACGTGCGGTGACT-3’ (SEQ ID NO: 4), were used. The second PCR reaction was run with the following conditions: 95°C for 10 minutes for one cycle, then 95°C for 30 seconds, 55°C for 30 seconds and 72°C for 30 seconds for a total of 40 cycles. The final extension was set at 72°C for 7 minutes for one cycle. Three pL of the resulting PCR product were mixed with 1 pL of 10X Detection Reaction Buffer and 5 pL water, then subjected to denaturing and re-annealing at 95°C for 5 minutes, 95°C to 85°C (2°C/sec) and 85°C to 25°C (0.1°C/sec). Finally, 1 pL of Detection Enzyme was added to the test sample and then incubated at 37°C for 1 hour. The digested product was analyzed with a 2% E-Gel EX agarose gel on E-Gel iBase Power System (Thermo Fisher Scientific,

Waltham, MA). The following equation was used to calculate the genomic cleavage efficiency:

[0136] Cleavage Efficiency = 1- [(1-fraction cleaved)l/2], Fraction Cleaved= sum of cleaved band intensities/ (sum of the cleaved and parental band intensities) DNA Sequencing.

[0137] To assess the effects of the CRISPR-Cas9 gene editing on the DNA sequence, a Sanger sequencing assay of a 284 base pair (bp) amplicon flanking the target area on the VEGF-A gene was performed by Genewiz (South Plainfield, NJ). The assay included TA cloning and DNA amplification. The traces were compared to the reference wild type sequence to detect any insertion, deletion or substitution.

ELISA.

[0138] The Human VEGF ELISA Kit (abeam, Cambridge, MA) was used to measure VEGF- A protein. Cell culture medium was centrifuged at 2,000g for 10 minutes. The top portion of the supernatant was collected and the remainder was discarded. Standard solutions were prepared according to the protocol and serial standard dilutions were made. Samples and antibody cocktail were prepared using appropriate diluents. Samples and standards were loaded on a coated microplate and antibody cocktail was added. After following other steps, including incubation on a plate shaker the samples were read using SpectraMax iD3 (Molecular Devices, San Jose, CA) and the protein concentration was calculated based on the standard curve.

Quantitative RT-PCR Assay.

[0139] Purelink RNA Mini Kit (ThermoFisher Scientific, Waltham, MA) was used and the manufacturer’s protocol was followed to extract total RNA from cell culture. Reverse transcription was performed using 1 pg of total RNA per 50 pL of reaction volume of TaqMan Reverse Transcription Reagents (ThermoFisher Scientific, Waltham, MA). cDNA was obtained by incubating the reaction in thermal cycler (Veriti, Applied Biosystem, ThermoFisher Scientific, Waltham, MA). Real-time quantitative (qPCR) was performed using TaqMan Fast Advanced Master Mix solution (ThermoFisher Scientific, Waltham, MA) and amplification was achieved using QuantStudio 6. GAPDH expression was used as an internal control. The probes included Hs00900055_ml (ThermoFisher Scientific, Waltham, MA) for VEGF-A and Hs02758991_gl (ThermoFisher Scientific, Waltham, MA) for GAPDH.

Statistical Analysis.

[0140] Data are presented as mean + standard error of means (SEM). Two-tailed Student’s t- Test for independent samples was used for VEGF-A mRNA and protein analysis. Results

In Vitro Cleavage of Synthetic VEGF-A DNA Oligonucleotide Duplex by CRISPR-Cas9 RNP Complex is Highly Efficient.

[0141] In vitro cleavage studies were carried out with catalytically active Cas9 using a synthetic DNA duplex (designated as “VEGF”) mimicking a segment of the VEGF-A gene. When the Cas9 effector was assembled using an sgRNA containing the correct guide segment, both the target and non-target strands were cleaved to near completion with 88+2% of products observed. Based on marker DNA strands with known length, the target strand was cleaved at the 23rd nucleotide from the 5’ terminus, while the non-target strand was cleaved at the 37th nucleotide from the 5’ terminus. Both were consistent with the expected Cas9 cleavage sites. In addition, control experiments showed no VEGF DNA cleavage if only Cas9 was presented or if Cas9 was assembled with a sgRNA whose 20-nt guide did not matched the VEGF DNA protospacer. Overall, the data demonstrated successful in vitro cleavage of VEGF DNA by Cas9 with high efficiency.

CRISPR-Cas9 RNP Complex Delivered via LCM Can Target and Disrupt the VEGF-A Gene In Vitro in RPE and Muller Cells.

[0142] First, to demonstrate the ability of LCM in transfecting target cells, we used GFP mRNA (TriLink, San Diego, CA) and performed fluorescent microscopy. When GFP mRNA was combined with LCM, it produced green fluorescence whereas no fluorescence was noted in the absence of LCM (FIG. 1 A).

[0143] In order to evaluate efficiency of CRISPR-Cas9 RNP in VEGF-A gene editing via LCM, cleavage detection assay was performed on RPE and Muller cells subjected to CRISPR-Cas9 RNP. Selecting an amplicon length of 487 bp for the genomic cleavage assay, two bands of 408 bp and 79 bp were detected on the agarose gel (FIG. IB). The presence of the 2 expected bands confirmed that the VEGF-A gene was successfully disrupted at the desired region. The genomic cleavage efficiency was quantified using E-Gel GelQuant Express Analysis Software (Therm oFisher), which estimated a cleavage rate of 40% (n=8) for RPE cells and 32% (n=9) for Muller cells.

[0144] Sanger sequencing showed complex mixture of insertion and deletion events at the predicted site in both RPE (FIG. 1C) and Muller cells treated with CRISPR-Cas9 RNP. In treated RPE cells, TA cloning of 20 randomly selected colonies produced readable results in 18. All 18 colonies showed indels at the predicted cut site defined by the guide sequence. The indels ranged from 1 to 148 nucleotides. In treated Muller cells, TA cloning of 25 randomly selected colonies produced readable results in 19. Seventeen of 19 colonies showed indels at the predicted cut site. The indels ranged from 1 to 81 nucleotides. In untreated cells, TA cloning of 32 randomly selected colonies from RPE and Muller cells, produced 20 readable results in each. No indels were found at the predicted cut site in Muller cells; however, there was a single nucleotide substitution at the predicted cut site in one colony from RPE cells. In all CRISPR-Cas9 treated and untreated RPE cells and Muller cells there were random mutations outside of the guide area in some colonies. These mutations were generally single nucleotide substitutions (data not shown). Overall, the data indicated that LCM delivery of the CRISPR-Cas9 RNP yielded efficient editing at the target site, on the VEGF-A gene, in both RPE and Muller cells.

The Effects of the VEGF-A Gene Disruption on the VEGF-A mRNA and Protein Expression.

[0145] To assess whether CRISPR-Cas9, delivered as an RNP complex, can affect VEGF-A expression, RPE and Muller cells were transfected with CRISPR-Cas9 targeting the exon 1 of the VEGF-A gene. The transfection was performed 1 day after seeding, and expression assays were performed 2 days after transfection. Quantitative RT-PCR showed no significant reduction in the VEGF-A mRNA expression in RPE cells but a modest reduction in Muller cells that underwent VEGF-A gene disruption (FIG. 2). Comparing CRISPSR-Cas9 treated cells to untreated cells, the VEGF-A mRNA expression was 5% less in RPE cells (p=0.297) and 17% less in Muller cells (p<0.0001). On the other hand, VEGF-A gene disruption resulted in robust reduction of the VEGF-A protein expression in both RPE and Muller cells (FIG. 2). Comparing the CRISPSR-Cas9 treated cells to untreated cells, the VEGF-A protein level was 43% less in RPE cells (p<0.0001) and 38% less in Muller cells (p<0.0001).

CRISPR-Cas9 RNP Complexed with LCM does not Result in Cell Loss.

[0146] To assess whether CRISPR-Cas9 RNP delivery via LCM caused cell loss, CRISPR- Cas9 treated cells were compared with untreated cells using hemocytometer manual cell counting system. No significant difference was noted for RPE (p=0.42) nor Muller cells (p=0.9) between the two groups (FIGS. 3 A and 3B)

Discussion

[0147] Frequent anti-VEGF injection, although effective, is a burden to patients and to the healthcare system. Gene therapy has the potential to reduce this burden by potentially eliminating the need for, or reducing the frequency of, intravitreal anti-VEGF injections. Applicant successfully employed CRISPR-Cas9 RNP to disrupt the VEGF-A gene in RPE and Muller cells, which are major VEGF-A producing cells in the eye. Applicant further established that VEGF-A gene disruption achieved with this method can successfully reduce VEGF-A expression. The results of this study demonstrate feasibility of CRISPR-Cas9 RNP in non-specifically targeting more than one cell type. This method can be employed to simultaneously disrupt the VEGF-A gene in all VEGF-A producing cells of the eye in order to significantly reduce the intraocular VEGF-A level and treat retinal vascular diseases such as AMD, diabetic retinopathy and RVO.

[0148] A major advantage of nanoparticle (e.g., LCM) delivery of CRISPR-Cas9 RNP is its lack of specificity in cell transfection. Genomic insertion of CRISPR-Cas9 via viral vectors may be helpful when the target is a specific cell type. However, when non-specific targeting of several cell types is desirable, as it is the case for the VEGF-A gene disruption, this could become a significant limitation. For example, the use of lentivirus following subretinal injection limits the delivery to the RPE cells only. In contrast, CRISPR-Cas9 RNP delivery via lipid nanoparticles is not cell specific and several cell types could be targeted simultaneously. For the VEGF-A gene disruption, this is a significant advantage as all the VEGF-A producing cells in the retina, including RPE cells and Muller cells, could be targeted simultaneously. Based on morphometric studies, the cell density of Muller cells appears to be approximately five times higher than RPE cells in the human retina ^{16 19}. Therefore, in order to achieve a significant reduction in intraocular VEGF, it is important to target Muller cells as well as RPE cells.

[0149] Another advantage of using the CRISPR-Cas9 RNP is that it has a short half-life ²⁰ and has a short-term effect. This is in contrast to genomic insertion of CRISPR-Cas9 which would continuously produce Cas9 and sgRNA, and may potentially increase the rate of off- target effects. This is particularly more concerning when lentivirus is used, as the transgene integrates into the human genome ²¹. Applicant chose LCM for our study because it has been shown to be superior to other nanoparticles for delivering CRISPR-Cas9 RNP into mammalian cells ²². Lipofectamine 2000, another lipid nanoparticle, has been reported to cause cell toxicity ²³. Although no such toxicity has been reported with LCM, its potential toxicity was evaluated in RPE and Muller cells and did not find any toxicity in either cell types. (0150) Applicant demonstrated here that VEGF-A gene disruption using CRISPR-Cas9 RNP significantly reduced VEGF-A protein expression in both RPE and Muller cells. These results are similar to previous studies on RPE cells ^10-12 but to the best of our knowledge this is the first time that Muller cells have been studied. Yiu et al. used genomic insertion of CRISPR- Cas9 delivered via lentivirus to target VEGF-A gene in RPE cells¹⁰. Although this approach was effective in disrupting the VEGF-A gene in RPE cells, it is associated with some challenges when it comes to human treatment. Lentivirus has a good tropism for RPE cells but only when is delivered into the subretinal space ²⁴. Subretinal injection of genomic CRISPR-Cas9 via lentivirus has been shown to successfully transfect RPE cells and disrupt VEGF-A gene in mice ^u. In addition, subretinal injection of CRISPR-Cas9 RNP has been shown to reduce the size of the choroidal neovascular membrane in mice ¹². This success is less likely to apply to human retina. This is because the target area is limited to the RPE cells within the bleb created during the subretinal injection, and the bleb formed in human is much smaller than the one in mice. In humans, the bleb is contained in the posterior pole, and this would result in the transfection of only a fraction of RPE cells; it is unclear whether this would be sufficient for significant reduction of intraocular VEGF.

[0151] Unlike subretinal injection, it is believed that intravitreal injection can distribute CRISPR-Cas9 to the entire retinal surface.

[0152] Applicant showed that CRISPR-Cas9 mediated VEGF-A gene disruption induces various indels at the predicted cut site in both RPE cells and Muller cells. Applicant also noted unexpected mutations outside the target area. These mutations, which almost exclusively were single nucleotide substitutions, were also seen in control cells that did not receive VEGF-A gene disruption. These, as well as a single nucleotide substitution seen at the predicted cute site in the control RPE cells, likely represent the well-established phenomenon of single nucleotide variants that result from clonal expansion of human cells ²⁶.

[0153] VEGF is constitutively expressed in the eye and there is a concern that gene therapy may eliminate intraocular VEGF and result in unforeseen consequences. Systemic neutralization of VEGF using gene augmentation of sFlt-1, a soluble VEGF receptor, via adenovirus in mice showed no effects on the normal vasculature but a significant cell loss in the inner and outer nuclear layers ¹¹. However, a long-term study on intraocular delivery of the same factor, sFlt-1 via adeno-associated virus (AAV) in mice and monkeys did not show any toxicity ²⁸. In addition, phase 1 and 2a human clinical trials have demonstrated safety of AAV-mediated gene augmentation of sFlt-1 in the treatment of wet age related macular degeneration, although only a portion of patients showed some response to treatment in these trials ^{4 6}. Although gene augmentation of a soluble VEGF receptor may theoretically result in production of enough receptor to potentially block all the released VEGF, gene disruption through CRISPR-Cas9 is not efficient enough to eliminate VEGF release from all VEGF producing cells and is unlikely to result in total lack of VEGF (FIG. 5). A limitation of VEGF-A gene disruption in reducing its level is that it may not reach therapeutic level for some patients (FIG. 5)

[0154] In summary, this experiment demonstrated that VEGF-A gene disruption using CRISPR-Cas9 RNP results in significant reduction in VEGF-A expression in both human RPE and Muller cells. Given the abundance of Muller cells in human retina, it is imperative to use therapeutic approaches that target these cells as well as RPE cells.

[0155] Experiment No. 2

[0156] Instead of a CRISPR ribonucleotide protein (e.g., Cas9), a CRISPR ribonucleotide mRNA is used to carry out VEGF-A gene disruption. In this method, lipid nanoparticle or other nanoparticles carry CRISPR ribonucleotide mRNA and sgRNA. The mixture is then be injected into the eye through or administered through any mode of administration described herein. Once the ribonucleoprotein (e.g. Cas9) mRNA enters target cells, it is translated to Cas9 protein which will form a complex with sgRNA; this complex targets VEGF-A gene at the intended location similar to when Cas9-sgRNA ribonucleoprotein is injected into the eye. Examples of commercially available lipid nanoparticles for Cas9 mRNA and sgRNA delivery include lipofectamine MessengerMAX and lipofectamine RNAiMAX; however, lipid nanoparticles can be custom made. On the other hand, Cas9 mRNA is commercially available but can be easily constructed using established methods.

Equivalents

[0157] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this technology belongs.

[0158] The present technology illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms “comprising,” “including,” “containing,” etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the present technology claimed.

[0159] Thus, it should be understood that the materials, methods, and examples provided here are representative of preferred aspects, are exemplary, and are not intended as limitations on the scope of the present technology.

[0160] It should be understood that although the present invention has been specifically disclosed by certain aspects, embodiments, and optional features, modification, improvement and variation of such aspects, embodiments, and optional features can be resorted to by those skilled in the art, and that such modifications, improvements and variations are considered to be within the scope of this disclosure.

[0161] The present technology has been described broadly and genetically herein. Each of the narrower species and sub-generic groupings falling within the generic disclosure also form part of the present technology. This includes the generic description of the present technology with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.

[01 2] In addition, where features or aspects of the present technology are described in terms of Markush groups, those skilled in the art will recognize that the present technology is also thereby described in terms of any individual member or subgroup of members of the Markush group.

[01 3] All publications, patent applications, patents, and other references mentioned herein are expressly incorporated by reference in their entirety, to the same extent as if each were incorporated by reference individually. In case of conflict, the present specification, including definitions, will control.

[0164] Other aspects are set forth within the following claims. References

1. Keyt, B. A., et al. The carboxyl-terminal domain (111-165) of vascular endothelial growth factor is critical for its mitogenic potency. J Biol Chem 271, 7788-7795 (1996).

2. Taylor, S.C., Huecker, J.B., Gordon, M.O., Vollman, D.E. & Apte, R.S. Physician- Industry Interactions and Anti-Vascular Endothelial Growth Factor Use Among US Ophthalmologists. JAMA ophthalmology 134, 897-903 (2016).

3. Erie, J.C., Barkmeier, A.J., Hodge, D.O. & Mahr, M.A. High Variation of Intravitreal Injection Rates and Medicare Anti- Vascular Endothelial Growth Factor Payments per Injection in the United States. Ophthalmology 123, 1257-1262 (2016).

4. Rakoczy, E.P., et al. Gene therapy with recombinant adeno-associated vectors for neovascular age-related macular degeneration: 1 year follow-up of a phase 1 randomised clinical trial. Lancet 386, 2395-2403 (2015).

5. Heier, J.S., et al. Intravitreous injection of AAV2-sFLT01 in patients with advanced neovascular age-related macular degeneration: a phase 1, open-label trial. Lancet 390, 50-61 (2017).

6. Constable, I.J., et al. Phase 2a Randomized Clinical Trial: Safety and Post Hoc Analysis of Subretinal rAAV.sFLT-1 for Wet Age-related Macular Degeneration. EBioMedicine 14, 168-175 (2016).

7. Askou, A.L., et al. Reduction of choroidal neovascularization in mice by adeno- associated virus-delivered anti-vascular endothelial growth factor short hairpin RNA. J Gene Med 14, 632-641 (2012).

8. Pihlmann, M., et al. Adeno-associated virus-delivered polycistronic microRNA- clusters for knockdown of vascular endothelial growth factor in vivo. J Gene Med 14, 328-338 (2012).

9. Haque, R., Hur, E.H., Farrell, A.N., Iuvone, P.M. & Howell, J.C. MicroRNA-152 represses VEGF and TGFbetal expressions through post-transcriptional inhibition of (Pro)renin receptor in human retinal endothelial cells. Mol Vis 21, 224-235 (2015).

10. Yiu, G., Tieu, E., Nguyen, A.T., Wong, B. & Smit-McBride, Z. Genomic Disruption of VEGF-A Expression in Human Retinal Pigment Epithelial Cells Using CRISPR- Cas9 Endonuclease. Invest Ophthalmol Vis Sci 57, 5490-5497 (2016).

11. Holmgaard, A., et al. In Vivo Knockout of the Vegfa Gene by Lentiviral Delivery of CRISPR/Cas9 in Mouse Retinal Pigment Epithelium Cells. Mol Ther Nucleic Acids 9, 89-99 (2017).

12. Kim, K., et al. Genome surgery using Cas9 ribonucleoproteins for the treatment of age-related macular degeneration. Genome Res 27, 419-426 (2017).

13. Robbins, S.G., Conaway, J.R., Ford, B.L., Roberto, K.A. & Penn, J.S. Detection of vascular endothelial growth factor (VEGF) protein in vascular and non-vascular cells of the normal and oxygen-injured rat retina. Growth Factors 14, 229-241 (1997).

14. Kliffen, M., Sharma, H.S., Mooy, C.M., Kerkvliet, S. & de Jong, P.T. Increased expression of angiogenic growth factors in age-related maculopathy. Br J Ophthalmol 81, 154-162 (1997). Tangprasertchai, N.S., et al. CRISPR-Cas9 Mediated DNA Unwinding Detected Using Site-Directed Spin Labeling. ACS Chem Biol 12, 1489-1493 (2017). Panda-Jonas, S., Jonas, J.B. & Jakobczyk-Zmija, M. Retinal pigment epithelial cell count, distribution, and correlations in normal human eyes. Am J Ophthalmol 121, 181-189 (1996). Nishikawa, S. & Tamai, M. Muller cells in the human foveal region. Curr Eye Res 22, 34-41 (2001). Bhatia, S.K., et al. Analysis of RPE morphometry in human eyes. Mol Vis 22, 898- 916 (2016). Del Priore, L.V., Kuo, Y.H. & Tezel, T.H. Age-related changes in human RPE cell density and apoptosis proportion in situ. Invest Ophthalmol Vis Sci 43, 3312-3318 (2002). Ma, EL, et al. CRISPR-Cas9 nuclear dynamics and target recognition in living cells. J Cell Biol 214, 529-537 (2016). Moiani, A., et al. Lentiviral vector integration in the human genome induces alternative splicing and generates aberrant transcripts. J Clin Invest 122, 1653-1666 (2012). Yu, X., et al. Improved delivery of Cas9 protein/gRNA complexes using lipofectamine CRISPRMAX. Biotechnol Lett 38, 919-929 (2016). Zuris, J.A., et al. Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo. Nat Biotechnol 33, 73-80 (2015). Harvey, A.R., et al. Intravitreal injection of adeno-associated viral vectors results in the transduction of different types of retinal neurons in neonatal and adult rats: a comparison with lentiviral vectors. Mol Cell Neurosci 21, 141-157 (2002). Dalkara, D., et al. Inner limiting membrane barriers to AAV-mediated retinal transduction from the vitreous. Mol Ther 17, 2096-2102 (2009). Franco, I., et al. Whole genome DNA sequencing provides an atlas of somatic mutagenesis in healthy human cells and identifies a tumor-prone cell type. Genome Biol 20, 285 (2019). Saint-Geniez, M., et al. Endogenous VEGF is required for visual function: evidence for a survival role on muller cells and photoreceptors. PLoS One 3, e3554 (2008). Lai, C.M., et al. Long-term evaluation of AAV-mediated sFlt-1 gene therapy for ocular neovascularization in mice and monkeys. Mol Ther 12, 659-668 (2005). Pierce, E.A., Avery, R.L., Foley, E.D., Aiello, L.P. & Smith, L.E. Vascular endothelial growth factor/vascular permeability factor expression in a mouse model of retinal neovascularization. Proc Natl Acad Sci USA 92, 905-909 (1995). Murata, T., et al. Vascular endothelial growth factor plays a role in hyperpermeability of diabetic retinal vessels. Ophthalmic Res 27, 48-52 (1995).

Claims

WHAT IS CLAIMED IS:

1. A CRISPR gene editing system comprising: 1) a CRISPR ribonucleotide protein or polypeptide or an mRNA encoding the ribonucleotide protein or polypeptide; 2) one or more guide RNA (sgRNA or gRNA) that targets a VEGF polynucleotide; and 3) a nanoparticle encapsulating the CRISPR ribonucleotide protein or polypeptide or mRNA and the one or more guide RNA.

2. The CRISPR gene editing system or claim 1 wherein the CRISPR ribonucleotide protein or polypeptide or mRNA encoding the ribonucleotide protein or polypeptide is selected from Cas9 or a CRISPR Cpfl and/or the VEGF gene is selected from VEGF-A, VEFG-165 or an isoform of each thereof.

3. The CRISPR gene editing system of claim 1 or 2, further comprising a detectable or purification label.

4. The CRISPR gene editing system of any one of claims 1 to 3, wherein the guide RNA comprises SEQ ID NO 2.

5. The CRISPR gene editing system of any one of claims 1-4, wherein the system targets one or more of: a) one or more exons of the VEGF gene; b) at least exon 1 of the VEGF gene; or c) the target sequence of SEQ ID NO 6 or an equivalent thereof.

6. The CRISPR gene editing system of claim 5, wherein the target sequence comprises SEQ ID NO 6 or an equivalent thereof.

7. The CRISPR gene editing system of any of claims 1 to 6, further comprising a forward primer and a reverse primer for the VEGF polynucleotide.

8. The CRISPR gene editing system of any one of claims 1 to 7 with the proviso that the system does not comprise the nanoparticle.

9. A plurality of the nanoparticles of any one of claims 1-7, wherein the nanoparticles are the same or different from each other.

10. A composition comprising a carrier and the CRISPR gene editing system of any one of claims 1 to 8 or the plurality of claim 9.

11. The composition of claim 10, wherein the composition further comprises a preservative or stabilizer and wherein the composition is optionally frozen or lyophilized.

12. A cell comprising the CRISPR gene editing system any one of claims 1 to 8.

13. The cell of claim 12, wherein the cell expresses VEGF protein that optionally is VEGF-A, VEFG-165 or an isoform of each thereof.

14. The cell of claim 13, wherein the cell is selected from a Muller cell, a retinal pigment epithelial (RPE) cell or a ganglion cell.

15. A method to edit or reduce expression of a VEGF gene in a cell that expresses VEGF protein or polypeptide comprising contacting the cell with the CRISPR gene editing system of any one of claims 1 to 8, the plurality of claim 9 or the composition of claim 10.

16. The method of claim 15, wherein the contacting is in vitro or in vivo.

17. The method of claim 15 or 16, wherein the cell is a mammalian cell.

18. The method of claim 17, wherein the mammalian cell is of the group of: a canine cell, a feline cell, a rat cell, a murine cell, a simian cell or a human cell.

19. A method to treat a condition mediated by VEGF gene expression or pathologic angiogenic states in a subject in need thereof, comprising administering to the subject one or more of: the CRISPR gene editing system of any one of claims 1 to 8, the plurality of claim 9 or the composition of claim 10.

20. The method of claim 19, wherein the condition is of the group of: age-related macular degeneration (AMD), diabetic retinopathy, retinal vein occlusion (RVO), or a retinal vascular disease.

21. The method of claim 19 or 20, wherein the subject is a mammal.

22. The method of claim 21, wherein the mammal is of the group of: a canine, a feline, a rat, a murine, a simian or a human.

23. The method of any one of claims 18 to 22, wherein the administration is intravitreal injection, suprachoroidal, intraocular injection, topical, or subretinal injection.

24. A kit comprising the nanoparticle of any one of claims 1 to 8, and instructions for use.