RU2812850C2 - MODULATION OF REP PROTEIN ACTIVITY WHEN PRODUCING CLOSED-END DNA (ceDNA) - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: group of inventions including a DNA vector for delivering a polynucleotide sequence (variants), a polynucleotide for creating a DNA vector, a method of producing a DNA vector, a pharmaceutical composition for gene therapy, a kit for producing a DNA vector, a cell for producing a ceDNA vector. In one embodiment, the DNA vector is derived from a vector polynucleotide, wherein the vector polynucleotide encodes a nucleic acid sequence located between a first inverted terminal repeat (ITR) and a second ITR, wherein at least one of the first ITR and the second ITR contains a nucleic acid sequence, corresponding to a replication protein (Rep) binding site to induce replication of a DNA vector in a cell in the presence of a single type of Rep protein having at least DNA binding and DNA nicking functionality.

EFFECT: invention expands the range of means for delivering a polynucleotide sequence.

89 cl, 64 dwg, 16 tbl, 6 ex

Description

RELATED APPLICATIONS

[0001] This application claims priority to US Provisional Application No. 62/806076, filed February 15, 2019, the contents of which are incorporated herein by reference in their entirety.

LIST OF SEQUENCES

[0002] This application includes a sequence listing, which is incorporated herein by reference in its entirety. The ASCII copy in question, created on February 13, 2020, is named 131698-05420_SL.txt and is 388,896 bytes in size.

TECHNICAL FIELD

[0003] This invention relates to the field of gene therapy, including the delivery of exogenous DNA sequences to a target cell, tissue, organ or organism.

BACKGROUND OF THE ART

[0004] The goal of gene therapy is to improve clinical outcomes in patients suffering from either genetic mutations or acquired diseases caused by aberrations in the gene expression profile. Gene therapy includes the treatment or prevention of medical conditions caused by defective genes or abnormal regulation or expression, such as underexpression or overexpression, that can lead to a disorder, disease, cancer, or the like. For example, treating, preventing, or ameliorating a disease or disorder caused by a defective gene may be accomplished by delivering corrective genetic material to a patient, resulting in therapeutic expression of said genetic material in said patient. Gene therapy is based on the provision of a transcription cassette with an active gene product (sometimes called a transgene), for example, which can lead to a positive gain-of-function effect, a negative loss-of-function effect, or another outcome, such as, for example, an oncolytic effect. Treatment of monogenic disorders in humans can be achieved by delivering and expressing a normal gene in target cells. Delivery and expression of the corrective gene into the target cells of a patient can be accomplished using numerous methods, including the use of engineered viruses and viral vectors for gene delivery. Among the many viral-derived vectors available (eg, recombinant retrovirus, recombinant lentivirus, recombinant adenovirus, etc.), recombinant adeno-associated virus (rAAV) is gaining popularity as a versatile vector for gene therapy.

[0005] Adeno-associated viruses (AAVs) belong to the family Parvoviridae, more specifically they constitute the genus Dependoparvovirus. The AAV genome consists of a linear, single-stranded DNA molecule that contains approximately 4.7 kilobase pairs (kb) and consists of two major open reading frames (ORFs) encoding the nonstructural protein Rep (replication) and the structural protein Cap (capsid ). A second ORF has been identified in the cap gene, which encodes an assembly-activating protein (AAP). The DNA flanking the AAV coding regions are two cis-acting inverted terminal repeat (ITR) sequences of approximately 145 nucleotides in length, with discontinuous palindromic sequences that can fold into energetically stable hairpin structures that function as primers for DNA replication. In addition to their role in DNA replication, these ITR sequences have been shown to be involved in the integration of viral DNA into the cellular genome, rescue from the host genome or plasmid, and encapsidation of the viral nucleic acid in mature virions (Muzyczka, (1992) Curr. Top Micro Immunol 158:97–129).

[0006] AAV-derived vectors (i.e., recombinant AAV (rAAV) or AAV vectors) are a promising method for delivering genetic material because (i) they are capable of infecting (transducing) a wide range of nondividing and dividing cell types, in including myocytes and neurons; (ii) they lack viral structural genes, which provides a reduction in host cell responses to viral infection, such as interferon-mediated responses; (iii) wild-type viruses are considered non-pathogenic to humans; (iv) unlike wild-type AAV, which is capable of integration into the host cell genome, replication-defective AAV vectors lack the rep gene and usually persist as episomes, which limits the risk of insertional mutagenesis or genotoxicity; and (v) compared to other vector systems, AAV vectors are generally considered to be relatively weak immunogens and, accordingly, do not induce a significant immune response (see ii), thus allowing persistence of vector DNA and potentially long-term expression of therapeutic transgenes. AAV vectors can also be prepared and formulated at high titers and delivered by intra-arterial, intravenous, or intraperitoneal injection, allowing vector distribution and gene transfer to relevant muscle regions through a single injection in rodents (Goyenvalle et al., 2004; Fougerousse et al., 2007; Koppanati et al., 2010; Wang et al., 2009) and dogs. In a clinical trial for the treatment of spinal muscular dystrophy type 1, AAV vectors were delivered systemically to target the brain, resulting in apparent clinical improvements.

[0007] However, the use of AAV particles as a vector for gene delivery has a number of serious disadvantages. One significant disadvantage associated with rAAV is the limited viral packaging capacity of approximately 4.5 kb. heterologous DNA (Dong et al., 1996; Athanasopoulos et al., 2004; Lai et al., 2010). As a result, the use of AAV vectors has been limited to protein coding capacity of less than 150 kDa. The second drawback is that, due to the prevalence of wild-type AAV infection in the population, candidates for rAAV gene therapy must be screened for the presence of neutralizing antibodies that eliminate the vector from the patient. A third disadvantage relates to the immunogenicity of the capsid, which precludes re-administration in patients who were not withdrawn from the initial treatment. The patient's immune system may respond to the vector, which essentially acts as a "booster" shot, stimulating the immune system to generate high titers of anti-AAV antibodies that preclude future treatment. Some recent reports have raised concerns regarding immunogenicity in situations involving high doses. Another notable disadvantage is the relatively slow onset of AAV-mediated gene expression, given that single-stranded AAV DNA must be converted to double-stranded DNA before expression of the heterologous gene. Although attempts have been made to circumvent this problem by constructing double-stranded DNA vectors, this strategy further limits the size of the transgene expression cassette that can be integrated into the AAV vector (McCarty, 2008; Varenika et al., 2009; Foust et al., 2009) .

[0008] In addition, standard AAV capsid virions are prepared by introducing a plasmid or plasmids containing the AAV genome, rep genes, and cap genes (Grimm et al., 1998). When these helper plasmids are introduced into the trans position, the AAV genome is “rescued” (i.e., released followed by amplification) from the host genome and further enclosed in the capsid (viral capsids) to obtain biologically active AAV vectors. However, such capsid-enclosed viral AAV vectors have been found to be ineffective at transducing certain cell and tissue types. These capsids also induce an immune response.

[0009] Accordingly, the use of adeno-associated virus vectors (AAV vectors) for gene therapy is limited to single administration to patients (due to the patient's immune response), limited to the range of transgenic genetic material suitable for delivery in AAV vectors due to the minimal viral capacity packaging (approximately 4.5 kb) of the associated AAV capsid, as well as slow AAV-mediated gene expression. The application of clinical gene therapy using rAAV is further complicated by variability among patients, which cannot be predicted based on dose response in syngeneic mouse models or other types of models.

[0010] Recombinant capsidless AAV vectors can be produced as an isolated linear nucleic acid molecule containing transgene expression regions and promoter regions flanked by two wild-type AAV inverted terminal repeat (ITR) sequences, including Rep binding sites and terminal resolution sites (TRS) ). These recombinant AAV vectors do not contain AAV capsid protein coding sequences and may be single-stranded, double-stranded, or duplex, where one or both ends are covalently linked through two palindromic wild-type ITR sequences (eg, WO2012/123430, US Pat. No. 9,598,703). They avoid many of the problems of AAV-mediated gene therapy due to significantly greater transgene capacity, rapid onset of transgene expression, and actual recognition by the patient's immune system of the DNA molecules as the virus that needs to be removed. However, persistent transgene expression may not be desirable in all cases, and canonical wild-type AAV ITRs may not be optimized for use as cccDNA. Therefore, there is still a significant unmet need for controlled recombinant DNA vectors, as well as improved production and/or expression characteristics.

BRIEF DESCRIPTION OF THE INVENTION

[0011] The invention described herein relates to the improved production of a non-viral capsidless DNA vector with covalently closed ends (referred to herein as a “closed-end DNA vector” or “ccDNA vector”). CccDNA vectors, which are prepared by the methods described herein, are capsidless linear duplex DNA molecules formed by a continuous strand of complementary DNA with covalently closed ends (linear, contiguous, and non-capsidized structure) that contain an inverted 5'-terminal repeat sequence (ITR) and the inverted 3' ITR sequence, which are different from each other or are asymmetric.

[0012] The described technology relates to the production of a cccDNA vector or an AAV vector in a cell (eg, insect cell, mammalian cell) or in a cell-free system with a single species of Rep protein. In particular, this disclosure is based in part on the unexpected discovery that Rep78 or Rep68 alone is sufficient to produce a cccDNA vector or an AAV vector in a cell. This is an improved and more efficient method for producing a cccDNA vector than that described in the prior art, in which AAV or cccDNA vectors are produced in cells (eg, insect cells) requiring two Rep proteins; for example, at least one small Rep protein (eg, Rep52 or Rep40) and at least one large Rep protein (eg, Rep78 or Rep68). Thus, the prior art describes the production of cccDNA vectors or AAV vectors using two Rep proteins, either encoded on separate nucleic acid constructs, each of which is operably linked to a promoter, or two Rep proteins, encoded on a single nucleic acid construct with two initiation sites operatively linked to a single promoter.

[0013] Accordingly, one aspect of the technology described herein relates to nucleic acid construct for the production of DNA vectors, e.g., cccDNA vectors and other recombinant parvovirus (e.g., adeno-associated virus) vectors in cells (e.g., insect cells, mammalian cells) and cell-free systems in which, for example, insect cells or a cell-free system contain a first nucleotide sequence encoding a single parvovirus Rep protein, in which the nucleotide sequence does not have an open reading frame (ORF) and does not have a functional initiation codon downstream of the first initiation codon and/or there are no alternative splice sites that prevent exon skipping, thereby allowing translation of only one parvovirus Rep protein (e.g., Rep78 or Rep 68 protein) without translation of additional Rep proteins at a later start codon (e.g., any one or more of Rep52 or Rep 40) in cells insects or acellular system. That is, the nucleic acid encoding Rep78 also does not produce the Rep52 protein, and similarly, the nucleic acid encoding Rep68 does not produce the Rep40 protein. Additionally, no other Rep protein is present or expressed in the system.

[0014] In some embodiments, the methods and compositions described herein for use, a single Rep protein can be used to produce any cccDNA vector, including, but not limited to, a cccDNA vector containing asymmetric ITRs, as described in PCT International Patent Application US18/49996 filed September 7, 2018 (see, for example, Examples 1-4); a cccDNA vector for gene editing, as described in International Patent Application PCT/US18/64242, filed December 6, 2018 (see, for example, Examples 1-7), or a cccDNA vector for producing antibodies or fusion proteins, as described in International patent application PCT/US19/18016, filed February 14, 2019 (for example, see Examples 1-4), all of which are incorporated herein by reference in their entirety. In some embodiments, it is also contemplated that the methods and compositions described herein, using a single Rep protein, can be used in the synthetic production of a cccDNA vector, for example, in a cell-free or non-insect ccDNA production system as disclosed in a PCT International Application /US19/14122, filed January 18, 2019, incorporated herein by reference in its entirety, in which a single Rep protein can be used to ligate ITR oligonucleotides contained therein with the protein.

[0015] The technology described herein relates to an improved method for producing a cccDNA vector containing at least one modified AAV inverted terminal repeat (ITR) sequence and an expressed transgene. As described herein, cccDNA vectors can be produced by the methods described herein in eukaryotic cells and are therefore free of prokaryotic DNA modifications and bacterial endotoxin contamination from insect cells.

[0016] Aspects of the invention relate to methods and compositions for producing cccDNA vectors and AAV vectors using a single Rep protein, as described herein. Other embodiments relate to a cccDNA vector produced using the method and compositions of the present invention.

[0017] In one aspect, non-viral, capsidless, covalently terminated DNA vectors produced using the methods described herein are preferably linear duplex molecules and can be derived from a vector polynucleotide that encodes a heterologous nucleic acid operably located between two sequences different inverted terminal repeats (ITRs) (e.g., the AAV ITR), wherein at least one of the ITRs contains a terminal resolution site and a replication protein binding site (RPS) (sometimes called a replication protein binding site), e.g., a Rep binding site, and one of the ITRs contains a deletion, insertion, or substitution relative to another ITR. That is, one of the ITRs is asymmetric with respect to the other ITR. In one embodiment, at least one of the ITRs is an AAV ITR, such as a wild-type AAV ITR or a modified AAV ITR. In one embodiment, at least one of the ITRs is a modified ITR relative to another ITR, that is, the cccDNA contains ITRs that are asymmetrical relative to each other. In one embodiment, at least one of the ITRs is a non-functional ITR.

[0018] In some embodiments, the cccDNA vector produced by the methods and compositions described herein comprises: (1) an expression cassette comprising a cis-regulatory element, a promoter, and at least one transgene; or (2) a promoter operably linked to at least one transgene, and (3) two self-complementary symmetrical sequences, for example symmetrical modified ITRs, flanking said expression cassette, wherein said cDNA vector is not associated with a capsid protein. In some embodiments, the cccDNA vector comprises two self-complementary sequences present in the AAV genome, wherein at least one ITR contains a functional Rep binding element (RBE) (also sometimes referred to herein as an "RBS") and a terminal resolution site (trs) ) AAV or functional RBE variant, and one or more cis-regulatory elements functionally associated with the transgene. In some embodiments, the cccDNA vector contains additional components for regulating transgene expression, such as regulatory switches, which are described herein in the section entitled “Regulatory Switches” for controlling and regulating transgene expression, and may include a regulatory switch, such as “ emergency switch" ensuring controlled cell death of the cell containing the cccDNA vector.

[0019] In some embodiments, the two self-complementary sequences may be ITR sequences from any known parvovirus, for example, a dependovirus such as AAV (eg, AAV1-AAV12). Any AAV serotype may be used, including, but not limited to, a modified AAV2 ITR sequence that retains a Rep binding site (RBS), such as 5'-GCGCGCTCGCTCGCTC-3' (SEQ ID NO: 531), and a terminal resolution site (trs ) in addition to a variable palindromic sequence allowing the formation of a hairpin secondary structure. In some embodiments, the ITR is a synthetic ITR sequence that retains a functional Rep binding site (RBS), such as 5'-GCGCGCTCGCTCGCTC-3' (SEQ ID NO: 531), and a terminal resolution site (TRS), in addition to a variable palindromic sequence that allows the formation of the secondary hairpin structure. In some examples, the modified ITR sequence retains the RBS sequence, trs, and the structure and position of the Rep binding element forming the terminal loop portion of one of the ITR hairpin secondary structures, as in the corresponding wild-type AAV2 ITR sequence.

[0020] Exemplary ITR sequences for use in cccDNA vectors produced by the methods and compositions described herein may be any one or more of Tables 2-10A and 10B, or SEQ ID NOs: 2, 52, 101-499 and 545-547, or partial ITR sequences shown in FIG. 26A-26B. In some embodiments, cccDNA vectors produced by the methods and compositions described herein do not have an ITR comprising any sequence selected from SEQ ID NOs: 500-529.

[0021] In some embodiments, a cccDNA vector produced by the methods and compositions described herein may contain an ITR with a modification in the ITR corresponding to any of the modifications in the ITR sequences or partial ITR sequences presented in any one or more of Tables 2 , 3, 4, 5, 6, 7, 8, 9, 10A and 10B of this document.

[0022] As a typical example, this invention provides a closed-end DNA vector prepared by the methods and compositions described herein, contains a promoter operably linked to a transgene, wherein the cccDNA is devoid of capsid proteins and: (a) is produced from the cccDNA -plasmid (e.g., see Examples 1-2 and/or Fig. 1A-B) that encodes a mutated right side of the AAV2 ITR having the same number of intramolecular duplex base pairs as SEQ ID NO:2, or a mutated left side An AAV2 ITR having the same number of intramolecular duplex base pairs as SEQ ID NO:51 in a secondary hairpin configuration (preferably excluding deletion of any AAA or TTT terminal loop in this configuration compared to such reference sequences), and ( b) identified as cccDNA using the cccDNA identification assay by agarose gel electrophoresis, native gel and denaturing conditions specified in Example 1. Examples of such modified ITR sequences are presented in Tables 2, 3, 4, 5, 6, 7, 8 , 9, 10A and 10B of this document.

[0023] The technology described herein also relates to the production of a cccDNA vector that can be used to deliver and encode one or more transgenes in a target cell, for example, if the ccDNA vector contains a multicistronic sequence, or if the transgene and its natural genomic context (eg, transgene, introns and endogenous untranslated regions) are included together in said cccDNA vector. These transgenes may be protein-coding transcripts, non-coding transcripts, or both. Said cccDNA vector produced by the methods and compositions described herein may contain multiple coding sequences and a non-canonical translation initiation site or more than one promoter for the expression of protein-coding transcripts, non-coding transcripts, or both. The transgene may contain a sequence encoding more than one protein, or may be a non-coding transcript sequence. The indicated expression cassette may contain, for example, more than 4000 nucleotides, 5000 nucleotides, 10,000 nucleotides or 20,000 nucleotides, or 30000 nucleotides, or 40,000 nucleotides, or 50,000 nucleotides, or any range of values between approximately 4000-10000 nucleotides or 10000-50000 nucleotides , or more than 50,000 nucleotides. These cccDNA vectors produced by the methods and compositions described herein do not have the size limitations of encapsided AAV vectors, allowing delivery of a significant size expression cassette to ensure efficient transgene expression. In some embodiments, the cccDNA vector produced by the methods and compositions described herein lacks prokaryote-specific methylation.

[0024] The cccDNA vector expression cassette produced by the methods and compositions described herein may also contain an internal ribosome entry site (IRES) and/or a 2A element. Cis-regulatory elements include, but are not limited to, a promoter, a riboswitch, an insulator, a miR-regulated element, a post-transcriptional regulatory element, a tissue-specific and cell-specific promoter, and an enhancer. In some embodiments, the ITR may act as a promoter for a transgene. In some embodiments, the cccDNA vector contains additional components for regulating transgene expression. For example, the additional regulatory component may be a regulatory switch as described herein, including, but not limited to, a “kill switch” that is capable of killing a cccDNA-infected cell, if necessary, and other inducible and/or repressible elements.

[0025] The technology described herein further provides new methods for efficiently producing a cccDNA vector or other AAV vector that can selectively express one or more transgenes. The cccDNA vector produced by the methods and compositions described herein can be taken up by host cells as well as transported into the nucleus in the absence of the AAV capsid. In addition, cccDNA vectors produced by the methods and compositions described herein lack a capsid and, accordingly, avoid the immune response that may occur in response to capsid-containing vectors.

[0026] In one embodiment, a capsid-free non-viral DNA vector (ccDNA vector) is derived from a plasmid (referred to herein as a “ccDNA plasmid”) containing a polynucleotide expression construct template that contains, in the following order: the first 5' inverted terminal repeat (eg AAV ITR); expression cassette; and 3' ITR (e.g., AAV ITR), where at least one of the 5' and 3' ITR is a modified ITR, or where both the 5' and 3' ITR are modified, and they have modifications different from each other and are not the same sequence. In such an embodiment, the cccDNA vector is prepared in a manner that is illustrated in the examples and shown in FIG. 4A-4D, where only a single Rep protein is required for production.

[0027] The cctDNA vector, as described herein, can be produced in several ways that will be apparent to one of ordinary skill in the art upon reading this document. For example, the expression construct polynucleotide template used to generate the ccDNA vectors of the present invention may be a ccDNA plasmid (eg, see Table 12 or FIG. 10B), a ccDNA bacmid, and/or a ccDNA baculovirus. In one embodiment, the cccDNA plasmid contains a restriction cloning site for possible insertion (e.g., SEQ ID NO: 7) operably located between the ITRs where an expression cassette can be inserted containing, for example, a promoter operably linked to a transgene, e.g., a reporter genome and/or therapeutic gene. In some embodiments, the cccDNA vectors are derived from a polynucleotide template (e.g., ccDNA plasmid, ccDNA bacmid, ccDNA baculovirus) containing an ITR modified from the corresponding flanking AAV3 ITR or wild-type AAV2 ITR sequence, wherein the modification is one or more than one of deletion, insertion and/or substitution.

[0028] In some aspects, the disclosure provides a method for producing a cccDNA vector in an insect cell (e.g., Sf9, Sf21 cells, Trichoplusia ni cells, and High Five cells) or mammalian cells (e.g., HEK293, Huh-7, HeLa, HepG2, HeplA, 911 , CHO, COS, MeWo, NIH3T3, A549, HT1080, monocytes and mature and immature dendritic cells); a method comprising culturing an insect cell or a mammalian cell containing a first nucleotide sequence encoding a single parvovirus Rep protein, wherein the first nucleotide sequence lacks a functional initiation codon downstream of the first initiation codon and lacks alternative splice sites that prevent exon skipping, allowing translation of only one protein Rep (eg, Rep78) without translation of additional Rep proteins to a later initiation codon (eg, any one or more Rep52 or Rep40) or a full-length splice variant (eg, Rep68) into the cell.

[0029] In accordance with certain other aspects, the disclosure provides a method for producing a cccDNA vector in an insect cell (e.g., Sf9, Sf21, Trichoplusia ni, and High Five cells) or mammalian cells (e.g., HEK293, Huh-7, HeLa, HepG2, HeplA, 911, CHO, COS, MeWo, NIH3T3, A549, HT1080, monocytes, as well as mature and immature dendritic cells); a method comprising culturing an insect cell or mammalian cell containing a first nucleotide sequence encoding a single parvovirus Rep protein, wherein the first nucleotide sequence lacks a functional start codon located downstream of the first start codon and contains a deletion at the carboxy terminus of the splice sequence (e.g., any part or full length of the c-terminal intron/skipped exon), thereby allowing translation of only the Rep signal protein (e.g., Rep68) without translation of additional Rep proteins at a later start codon (e.g., any one or more of Rep52 or Rep40) or full-length Rep72 protein in the cell.

[0030] In accordance with certain other aspects, the disclosure provides a method of producing a cccDNA vector in an insect cell (e.g., Sf9, Sf21, Trichoplusia ni, High Five cells) or mammalian cell (e.g., HEK293, Huh-7, HeLa, HepG2, HeplA, 911, CHO, COS, MeWo, NIH3T3, A549, HT1080, monocytes and mature and immature dendritic cells); a method comprising culturing an insect cell or a mammalian cell containing a first nucleotide sequence encoding one or two Rep proteins (e.g., Rep 78 and/or Rep68 protein), wherein the first nucleotide sequence lacks a functional initiation codon after the first initiation codon and intact alternative splice sites, thereby allowing translation of only Rep78 and/or Rep68 protein without translation of additional Rep proteins at a later start codon (eg, any one or more of Rep52 or Rep40).

[0031] The cell described in the methods above may further comprise a second nucleotide sequence comprising at least one AAV inverted terminal repeat (ITR) sequence flanking a heterologous sequence under the conditions that when the first sequence is expressed to produce Rep78 and/or Rep68, cccDNA is produced by Rep78 and/or Rep68 protein without the presence of Rep52 or Rep40. The cccDNA vector can then be extracted from the cell. In some embodiments, the nucleotide sequence comprising at least one AAV is part of an expression construct. In some embodiments, the heterologous sequence includes a therapeutic nucleic acid. In some embodiments, the therapeutic nucleic acid is part of an expression construct. In some embodiments, the cell further comprises a nucleic acid that serves as a marker. In some embodiments, the nucleic acid that serves as a marker is part of an expression construct.

[0032] In a permissive host cell, in the presence of, for example, a single Rep protein, a polynucleotide template containing at least one modified ITR is replicated to produce cccDNA vectors. Obtaining a cccDNA vector takes place in two stages: (i) excision (“release”) of the template from the template backbone (for example, ccDNA plasmid, ccDNA bacmid, ccDNA baculovirus genome, etc.) via Rep proteins; and (ii) Rep-mediated replication of the excised cccDNA vector. The single Rep protein required for steps (i) and (ii) of excision and replication may be any Rep protein described herein. Rep proteins and Rep binding sites in various AAV serotypes are well known to those skilled in the art.

[0033] One of ordinary skill in the art will appreciate that a Rep protein should be selected from a serotype that binds to and replicates a nucleic acid sequence based on at least one functional ITR. For example, if a replication competent ITR is of serotype AAV2, the corresponding Rep will be of an AAV serotype that works with that serotype, such as the AAV2 ITR with Rep AAV2 or AAV4, but not with Rep AAV5, which is unable to do so. After replication (e.g., after step (ii)), the cccDNA vector with covalently closed ends continues to accumulate in permissive cells, and the ccDNA vector is preferably sufficiently stable over time in the presence of the Rep protein under standard replication conditions, for example, to accumulate in quantities at least 1 pg/cell, preferably at least 2 pg/cell, preferably at least 3 pg/cell, more preferably at least 4 pg/cell, even more preferably at least 5 pg/cell cell.

[0034] Accordingly, one aspect of the invention relates to a method comprising the following steps: a) incubating a population of host cells (eg, insect cells) bearing said template polynucleotide expression construct (eg, ccDNA plasmid, ccDNA bacmid and/or ccDNA -baculovirus) that does not contain viral capsid coding sequences, in the presence of Rep protein alone, under effective conditions and for a period of time sufficient to induce production of the cDNA vector in host cells, wherein said host cells do not contain viral capsid coding sequences ; and b) collecting and isolating said cDNA vector from the host cells. The presence of a single Rep protein induces replication of the ITR-modified vector polynucleotide to produce a cccDNA vector in the host cell. However, viral particles (eg AAV virions) are not expressed. Thus, there are no size restrictions imposed by virions. It is proposed that if the nucleic acid sequence encoding the Rep protein encodes a large Rep protein, such as the Rep78 or Rep 68 protein, then the initiation codon for the smaller Rep proteins is modified such that only the large Rep protein is expressed in the cell.

[0035] In some aspects, the disclosure provides an insect cell (e.g., Sf9, Sf21, Trichoplusia ni, and High Five cells) or a mammalian cell (e.g., HEK293, Huh-7, HeLa, HepG2, HeplA, 911, CHO, COS, MeWo, NIH3T3, A549, HT1080, monocytes and mature and immature dendritic cells); an insect cell or mammalian cell line containing a first nucleotide sequence encoding a single parvovirus Rep protein, wherein the first nucleotide sequence lacks a functional initiation codon downstream of the first initiation codon and lacks alternative splice sites that prevent exon skipping, thereby allowing translation of only a single Rep protein ( e.g., Rep78) without translation of additional Rep proteins to a later initiation codon (e.g., any one or more of Rep52 or Rep40) or a full-length splice variant (e.g., Rep68) in the chamber.

[0036] In certain other aspects, the disclosure provides an insect cell (e.g., Sf9, Sf21, Trichoplusia ni, and High Five cells) or a mammalian cell (e.g., HEK293, Huh-7, HeLa, HepG2, HeplA, 911, CHO, COS , MeWo, NIH3T3, A549, HT1080, monocytes and mature and immature dendritic cells); an insect cell or mammalian cell containing a first nucleotide sequence encoding a single parvovirus Rep protein, wherein the first nucleotide sequence does not have a functional start codon downstream of the first start codon and contains a deletion of a carboxy-terminal splice sequence (e.g., any portion or full-length c-terminal intron/skipped exon ), thereby allowing translation of only the Rep signal protein (e.g., Rep68) without translation of additional Rep proteins at a later initiation codon (e.g., any one or more Rep52 or Rep40) or full-length Rep72 protein in the cell.

[0037] In certain other aspects, the disclosure provides an insect cell (e.g., Sf9, Sf21, Trichoplusia ni cells, High Five cells) or a mammalian cell (e.g., HEK293, Huh-7, HeLa, HepG2, HeplA, 911, CHO, COS , MeWo, NIH3T3, A549, HT1080, monocytes and mature and immature dendritic cells); an insect cell or mammalian cell line comprising a first nucleotide sequence encoding one or two Rep proteins (e.g., Rep78 and/or Rep68 protein), wherein the first nucleotide sequence lacks a functional initiation codon downstream of the first initiation codon and intact alternative splice sites, thereby allowing translation of only Rep78 and/or Rep68 protein, without translation of additional Rep proteins at a later initiation codon (e.g., any one or more of Rep52 or Rep40)

[0038] The cell described above may further comprise a second nucleotide sequence comprising at least one AAV inverted terminal repeat (ITR) sequence flanking the heterologous sequence under the conditions that when the first sequence is expressed to produce Rep78 and/or Rep68, cccDNA is produced by Rep78 and/or Rep68 proteins without the presence of Rep52 or Rep40. The cccDNA vector can then be extracted from the cell. In some embodiments, the nucleotide sequence comprising at least one AAV is part of an expression construct. In some embodiments, the heterologous sequence includes a therapeutic nucleic acid. In some embodiments, the therapeutic nucleic acid is part of an expression construct. In some embodiments, the cell further comprises a nucleic acid that serves as a marker. In some embodiments, the nucleic acid that serves as a marker is part of an expression construct.

[0039] In some aspects, the disclosure provides a cell-free system comprising a first nucleotide sequence encoding a single parvovirus Rep protein, wherein the nucleotide sequence lacks a functional initiation codon downstream of the first initiation codon and/or lacks alternative splice sites that prevent exon skipping, thereby providing translation of only a single parvovirus Rep protein (eg, Rep78 or Rep 68 protein) without translation of additional Rep proteins at a later initiation codon (eg, any one or more Rep52 or Rep 40) in a cell-free system. In some embodiments, the nucleic acid encoding Rep78 also does not produce Rep52 or Rep40 protein. In some embodiments, the nucleic acid encoding Rep68 does not produce Rep52 or Rep40 protein. In some embodiments, the insect cell, mammalian cell, or cell-free system does not express any other Rep protein.

[0040] An cccDNA vector prepared by the methods described herein using a single Rep protein is isolated from host cells, and its presence can be confirmed by digestion of DNA isolated from the host cell with a restriction enzyme having a single recognition site on the ccDNA -vector, and analysis of the digested DNA material on denaturing and non-denaturing gels to confirm the presence of characteristic bands of linear and continuous DNA compared to linear and discontinuous DNA.

BRIEF DESCRIPTION OF THE DRAWINGS

[0041] FIG. 1A illustrates a typical structure of a cccDNA vector produced using a single Rep protein in accordance with the methods and compositions described herein. According to the specified embodiment, the specified example cccDNA vector contains an expression cassette containing a CAG promoter, WPRE and BGHpA. The open reading frame (ORF) encoding the luciferase transgene is inserted into the cloning site (R3/R4) between the CAG promoter and the WPRE. The expression cassette is flanked by two inverted terminal repeats (ITRs) of the wild-type AAV2 ITR upstream (at the 5' end) and a modified ITR downstream (at the 3' end) of the expression cassette, thus the two ITRs flanking the expression cassette are asymmetrical relative to each other. friend. One of ordinary skill in the art will appreciate that any ITR can be used. For illustrative purposes, the ITRs in the cccDNA constructs in this Figure and in the Examples of this document are the modified ITR and the WT ITR. However, this document covers cccDNA vectors containing a heterologous nucleic acid sequence located between two inverted terminal repeat (ITR) sequences, wherein the ITR sequences may be an asymmetric ITR pair or a symmetric or substantially symmetric ITR pair, as those terms are defined herein . The cccDNA vector disclosed herein may contain ITR sequences selected from any of: (i) at least one wild-type ITR and at least one modified AAV inverted terminal repeat (mod-ITR) (e.g., asymmetric modified ITRs) ; (ii) two modified ITRs, wherein the mod-ITR pair has a different three-dimensional spatial organization relative to each other (e.g., asymmetric modified ITRs), or (iii) a symmetric or substantially symmetric WT-WT ITR pair, each of the ITR-WTs having the same three-dimensional spatial organization, or (iv) pairs of symmetric or substantially symmetric modified ITRs, each of the mod-ITRs having the same three-dimensional spatial organization. In some embodiments, the methods of this disclosure include using a single rep protein to produce a cccDNA vector that is formulated into a composition that includes a delivery system, such as, but not limited to, a liposomal nanoparticle delivery system.

[0042] FIG. 1B illustrates a typical structure of a cccDNA vector produced using a single Rep protein in accordance with the methods and compositions described herein, wherein the ccDNA vector includes an expression cassette containing a CAG promoter, WPRE and BGHpA. An open reading frame (ORF) encoding the luciferase transgene is inserted into the cloning site between the CAG promoter and the WPRE. The expression cassette is flanked by two inverted terminal repeats (ITRs), a modified ITR upstream (at the 5' end) and a wild-type ITR downstream (at the 3' end) of the expression cassette. As shown in FIG. 1A, one of skill in the art can readily select ITR sequences that will be an asymmetric ITR pair or a symmetric or substantially symmetric ITR pair, as those terms are defined herein.

[0043] FIG. 1C illustrates a typical structure of a cccDNA vector produced using a single Rep protein in accordance with the methods and compositions described herein, wherein the ccDNA vector includes an expression cassette containing an enhancer/promoter, an open reading frame (ORF) for transgene insertion, a post-transcriptional element ( WPRE) and polyA signal. The open reading frame (ORF) allows insertion of the transgene into the cloning site between the CAG promoter and the WPRE. The expression cassette is flanked by two inverted terminal repeats (ITRs), which are asymmetrical relative to each other - a modified ITR to the left of (at the 5' end) and a modified ITR to the right of (at the 3' end) the expression cassette, with the 5' ITR and The 3'-ITRs are both modified ITRs, but have different modifications (ie they do not have the same modifications). As shown in FIG. 1A, one of skill in the art can readily select ITR sequences that will be an asymmetric ITR pair or a symmetric or substantially symmetric ITR pair, as those terms are defined herein.

[0044] In FIG. 2A shows the T-shaped stem-loop structure of the left ITR wild type AAV2 (SEQ ID NO: 538) with the A-A' arm, B-B' arm, C-C' arm, two Rep binding sites (RBE) indicated and RBE'), as well as with the specified terminal resolution site (trs). RBE contains a series of 4 duplex tetramers believed to interact with either Rep 78 or Rep 68. In addition, RBE' is also believed to interact with the Rep complex assembled on a wild-type ITR or a mutated ITR of the construct. Regions D and D' contain transcription factor binding sites and other conserved structures. Fig. 2B shows the putative Rep-catalyzed nicking and ligation activities of the left-handed wild-type ITR (SEQ ID NO: 539), including the T-shaped stem-loop structure of the left-handed wild-type ITR of AAV2 labeled A-A' arm, B-B' arm, a C-C' arm, two Rep binding sites (RBE and RBE'), as well as a terminal resolution site (TRS), and a D and D' region containing several transcription factor binding sites and other conserved structure.

[0045] In FIG. 3A shows the primary structure (polynucleotide sequence) (left) and secondary structure (right) of the RBE-containing portions of the A-A' arm, and the C-C' and B-B' arms of the left ITR of wild-type AAV2 (SEQ ID NO : 540). Fig. 3B shows a typical example of a mutated ITR (also called modified ITR) sequence for the left ITR. Shown is the primary structure (left) and predicted secondary structure (right) of the RBE region of the A-A' arm, C arm, and B-B' arm of a typical mutated left ITR (ITR-1, left) (SEQ ID NO: 113 ). Fig. 3C shows the primary structure (left) and secondary structure (right) of the RBE-containing portion of the A-A' loop and the B-B' and C-C' arms of the right ITR of wild-type AAV2 (SEQ ID NO: 541). Fig. 3D shows a typical example of a right modified ITR. Shown are the primary structure (left) and predicted secondary structure (right) of the RBE-containing portion of the A-A' arm, B-B' and C arms of a representative example of a mutant right ITR (ITR-1, right) (SEQ ID NO: 114). Any combination of left and right ITRs (eg, AAV2 ITR or other viral serotype or synthetic ITRs) can be used, provided that the left ITR is asymmetric or different from the right ITR. Each of the polynucleotide sequences in FIG. 3A-3D refer to sequences used in the plasmid or bacmid/baculovirus genome used to produce cccDNA as described herein. Also each of FIGS. 3A-3D include corresponding predicted cccDNA secondary structures derived from the configurations of the cccDNA vector in the plasmid or bacmid/baculovirus genome and predicted Gibbs free energy values.

[0046] In FIG. 4A is a schematic representation of a prior process for producing baculovirus-infected insect cells (BIICs) that are suitable for producing cccDNA by the method schematically illustrated in FIG. 4B. In these embodiments, two bacmids are generated by transposing a cccDNA plasmid or a Rep plasmid (encoding a single Rep protein) into a baculovirus expression vector to create a cccDNA vector bacmid (i.e., Bacmid-1) and one Rep bacmid (Rep-Bacmids), which are used to transfect insect cells to produce baculovirus-injected insect cells, BIIC-1 and BICC-2 (single Rep), respectively. Fig. 4B is a diagram of an exemplary method for producing cccDNA using insect cells (eg, BICC-2) containing a Rep-Bacmid containing the nucleic acid sequence for a single Rep protein, and FIG. 4C illustrates the biochemical method and process for confirming the production of a cccDNA vector using the single Rep protein methodology described herein. In FIG. 4D and Fig. 4E is a schematic diagram describing the process of identifying the presence of cccDNA in DNA collected from cell pellets obtained during the ccDNA production process of FIG. 4B. Fig. 4E shows DNA having a discontinuous structure. CCDNA can be cut by a restriction endonuclease that has a single recognition site on the CCDNA vector to produce two DNA fragments of different sizes (1 kb and 2 kb) under both neutral and denaturing conditions. In FIG. 4E also shows cccDNA having a linear and continuous structure. The cccDNA vector can be cut with a restriction endonuclease to produce two DNA fragments that migrate as 1 kb fragments. and 2 kb. under neutral conditions, but under denaturing conditions these chains remain connected and form single chains that migrate as 2 kb fragments. and 4 kb. In FIG. 4D is a schematic representation of the expected bands for typical cccDNA undigested or restriction endonuclease digested and then electrophoresed on either a native or denaturing gel. The diagram on the far left shows a native gel and several bands indicating that, in duplex and uncut form, cccDNA exists in at least monomeric and dimeric states, which appear as a smaller faster-migrating monomer and a slower-migrating dimer with a size of 2 times greater than that of the monomer. The second schematic from the left shows that when cccDNA is cut with a restriction endonuclease, the original bands disappear and faster-migrating bands (e.g., smaller) appear, which correspond to the expected sizes of fragments remaining after cleavage. Under denaturing conditions, the original duplex DNA is single-stranded and migrates as an object twice the size of that observed on the native gel because the complementary strands are covalently linked. Accordingly, in the second diagram from the right, digested ccDNA exhibits a band distribution similar to that observed on the native gel, however, these bands migrate as fragments that are twice the size of their equivalents on the native gel. The diagram on the far right shows that uncut cccDNA under denaturing conditions migrates as a single-stranded open ring and, accordingly, the bands observed are twice as large as those observed under native conditions when the ring is not open. In the indicated figure, “t.p.o.” used to indicate the relative size of nucleotide molecules, based, depending on the context, on either the length of the nucleotide chain (for example, for single-stranded molecules observed under denaturing conditions) or the number of base pairs (for example, for double-stranded molecules observed under native conditions) .

[0047] FIG. 5 shows an exemplary denaturing gel run of example cccDNA vectors with (+) or without (-) endonuclease digestion (EcoRI for cccDNA constructs 1 and 2; BamH1 for cccDNA constructs 3 and 4; SpeI for cccDNA constructs 5 and 6 ; and XhoI for cDNA constructs 7 and 8). The dimensions for stripes marked with an asterisk are defined and shown at the bottom of the drawing.

[0048] In FIG. 6A shows the results of an in vitro protein expression assay measuring luciferase activity (y-axis, RQ (Luc)) in HEK293 cells 48 hours after transfection with 400 ng (black), 200 ng (gray), or 100 ng (white) of the construct identified in x-axis (construct-1, construct-3, construct-5, construct-7 (Table 12). Figure 6B shows luciferase activity (y-axis, RQ (Luc)) measured in HEK293 cells 48 hours after transfection of 400 ng (black), 200 ng (gray) or 100 ng (white) constructs identified on the x-axis (construct-2, construct-4, construct-6, construct-8) (Table 12) Also presented are the luciferase activities measured in HEK293 cells treated with Fugene without any plasmids (“Fugene”), or in untreated HEK293 cells (“Untreated”).

[0049] FIG. 7A shows the viability of HEK293 cells (y-axis) 48 hours after transfection with 400 ng (black), 200 ng (gray), or 100 ng (white) constructs identified on the x-axis (construct-1, construct-3, construct-5, construct-7). Fig. 7B shows HEK293 cell viability (y-axis) 48 hours after transfection with 400 ng (black), 200 ng (gray), or 100 ng (white) constructs identified on the x-axis (construct-2, construct-4, construct-6, construct-8).

[0050] FIG. 8A is a representative Rep bacmid in plasmid pFBDLSR containing nucleic acid sequences for a modified Rep78 protein, wherein the modified Rep 78 protein is a modification of amino acid residue 225 (Met) of SEQ ID NO: 530, with amino acid residue 225 replaced by glycine (Gly) (eg M225G or Met225Gly) or threonine (Thr) (eg M225T or Met225Thr). This exemplary Rep bacmid contains: an IE1 promoter fragment (SEQ ID NO: 66); a Rep78 nucleotide sequence encoding a modified Rep78 protein that lacks a functional start codon downstream of the first start codon, thereby allowing translation of a single Rep78 protein. As one skilled in the art will appreciate, it is possible to modify this modified Rep78 bacmid or modified Rep78 plasmid with a nucleic acid encoding any single Rep protein (e.g., Rep68, Rep52, Rep40) that has been modified to have a single start codon and therefore encodes a single protein Rep. In FIG. 8B is a schematic representation of an example ccDNA plasmid-1, with wt-L ITR (wild-type left ITR), CAG promoter, luciferase transgene, WPRE and polyadenylation sequence; and mod-R (modified right) ITR.

[0051] In FIG. 9A shows the predicted lowest energy structure containing the RBE portions of the A-A' and C-C' arms of a typical modified left ITR ("ITR-2 (Left)" SEQ ID NO: 101), and FIG. 9B shows the predicted lowest energy structure of the RBE portions of the A-A' and C-C' arms of a typical modified right ITR ("ITR-2 (Right)" SEQ ID NO: 102). They are predicted to form a structure with one arm (C-C') and one unpaired loop. The predicted values of their Gibbs free energies for unfolding are −72.6 kcal/mol.

[0052] In FIG. 10A shows the predicted lowest energy structure of the RBE-containing portions of the A-A' and B-B' arms of a typical modified left ITR ("ITR-3 (Left)" SEQ ID NO: 103), and FIG. 10B shows the predicted lowest energy structure of the RBE portions of the A-A' and B-B' arms of a typical modified right ITR ("ITR-3 (Right)" SEQ ID NO: 104). They are predicted to form a structure with one arm (B-B') and one unpaired loop. The predicted values of their Gibbs free energies for unfolding are −74.8 kcal/mol.

[0053] In FIG. 11A shows the predicted lowest energy structure of the RBE portions of the A-A' and C-C' arms of a typical modified left ITR ("ITR-4 (Left)" SEQ ID NO: 105), and FIG. 11B shows the predicted lowest energy structure containing the RBE portions of the A-A' and C-C' arms of a typical modified right ITR ("ITR-4 (Right)" SEQ ID NO: 106). They are predicted to form a structure with one arm (C-C') and one unpaired loop. The predicted values of their Gibbs free energies for unfolding are −76.9 kcal/mol.

[0054] In FIG. 12A shows the predicted lowest energy structure containing the RBE of the A-A' arm portion and the C-C' and B-B' portions of a typical modified left ITR, which shows the complementary base pairs of the C-B' and C'-B portions ("ITR-10 (Left)" SEQ ID NO: 107), and in Fig. 12B shows the predicted lowest energy structure of the RBE portion of the A-A' arm and the C-C' and B-B' portions of a typical modified left-handed ITR, which shows the complementary base pairs of the C-B' and C'-B portions (“ITR-10 (Right)” SEQ ID NO : 108). They are assumed to form a structure with one arm (part C'-B and C-B' or part B'-C and B-C') and one unpaired loop. Their predicted Gibbs free energies for unfolding are −83.7 kcal/mol.

[0055] In FIG. 13A shows the predicted lowest energy structure containing the RBE of the arm portion A-A' and the portions C-C' and B-B' of a typical modified left ITR (“ITR-17 (Left)” SEQ ID NO: 109); in Fig. 13B shows the predicted lowest energy structure of the RBE-containing arm portion A-A' and the portions C-C' and B-B' of a typical modified left ITR (“ITR-17 (Right)” SEQ ID NO: 110). Both ITR-17 (left) and ITR-17 (right) are predicted to form a structure with one arm (B-B') and one unpaired loop. The predicted values of their Gibbs free energies for unfolding are −73.3 kcal/mol.

[0056] In FIG. 14A shows the predicted lowest energy structure containing the RBE portion of the A-A' arm of a typical modified left ITR (“ITR-6 (Left)” SEQ ID NO: 111), and FIG. 14B shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm of a typical modified right ITR (“ITR-6 (Right)” SEQ ID NO: 112). Both ITR-6 (left) and ITR-6 (right) are hypothesized to form a single-arm structure. Their predicted Gibbs free energies for unfolding are −54.4 kcal/mol.

[0057] In FIG. 15A shows the predicted lowest energy structure containing the RBE portions of the A-A' arm, the C arm, and the B-B' arm of a typical modified left ITR ("ITR-1 (Left)" SEQ ID NO: 113), and FIG. 15B shows the predicted lowest energy structure of the RBE portions of arm A-A', arm C, and arm B-B' of a typical modified right ITR (“ITR-1 (Right)” SEQ ID NO: 114). It is proposed that both ITR-1 (left) and ITR-1 (right) form a structure with two arms, one of which is truncated. The predicted values of their Gibbs free energies for unfolding are −74.7 kcal/mol.

[0058] In FIG. 16A shows the predicted lowest energy structure containing the RBE portions of the A-A' arm, the C arm, and the B-B' arm of a typical modified left ITR ("ITR-5 (Left)" SEQ ID NO: 545), and FIG. 16B shows the predicted lowest energy structure of the RBE portions of arm A-A', arm B-B', and arm C of a typical modified right ITR (“ITR-5 (Right)” SEQ ID NO: 116). It is assumed that both ITR-5 (left) and ITR-5 (right) form a structure with two arms, one of which (eg, arm C') is truncated. The predicted values of their Gibbs free energies for unfolding are −73.4 kcal/mol.

[0059] In FIG. 17A shows the predicted lowest energy structure containing the RBE portions of the A-A' arm, the C-C' arm, and the B-B' arm of a typical modified left ITR ("ITR-7 (Left)" SEQ ID NO: 117), and FIG. 17B shows the predicted lowest energy structure of the RBE portions of the A-A' arm, the C-C' arm, and the B-B' arm of a typical modified right ITR ("ITR-7 (Right)" SEQ ID NO: 118). It is assumed that both ITR-17 (left) and ITR-17 (right) form a structure with two arms, one of which (eg, arm B-B') is truncated. Their predicted Gibbs free energies for unfolding are −89.6 kcal/mol.

[0060] In FIG. 18A shows the predicted lowest energy structure of the RBE-containing portions of the A-A' arm, the C-C' arm, and the B-B' arm of a typical modified left ITR ("ITR-8 (Left)" SEQ ID NO: 119), and FIG. 18B shows the predicted lowest energy structure of the RBE portions of the A-A' arm, the C-C' arm, and the B-B' arm of a typical modified right-handed ITR (“ITR-8 (Right)” SEQ ID NO: 120). It is assumed that both ITR-8 (left) and ITR-8 (right) form a structure with two arms, one of which is truncated. Their predicted Gibbs free energies for unfolding are −86.9 kcal/mol.

[0061] In FIG. 19A shows the predicted lowest energy structure containing the RBE portions of the A-A' arm, the C-C' arm, and the B-B' arm of a typical modified left ITR ("ITR-9 (Left)" SEQ ID NO: 121), and FIG. 19B shows the predicted lowest energy structure of the RBE-containing portions of the A-A' arm, the C-C' arm, and the B-B' arm of a typical modified right ITR ("ITR-9 (Right)" SEQ ID NO: 122). It is assumed that both ITR-9 (left) and ITR-9 (right) form a structure with two arms, one of which is truncated. Their predicted Gibbs free energies for unfolding are −85.0 kcal/mol.

[0062] In FIG. 20A shows the predicted lowest energy structure containing the RBE portions of the A-A' arm, the C-C' arm, and the B-B' arm of a typical modified left ITR ("ITR-11 (Left)" SEQ ID NO: 123), and FIG. 20B shows the predicted lowest energy structure of the RBE-containing portions of the A-A' arm, the C-C' arm, and the B-B' arm of a typical modified right-handed ITR (“ITR-11 (Right)” SEQ ID NO: 124). It is assumed that both ITR-11 (left) and ITR-11 (right) form a structure with two arms, one of which is truncated. Their predicted Gibbs free energies for unfolding are −89.5 kcal/mol.

[0063] In FIG. 21A shows the predicted lowest energy structure containing the RBE portions of the A-A' arm, the C-C' arm, and the B-B' arm of a typical modified left ITR ("ITR-12 (Left)" SEQ ID NO: 125), and FIG. 21B shows the predicted lowest energy structure of the RBE-containing portions of the A-A' arm, the C-C' arm, and the B-B' arm of a typical modified right ITR ("ITR-12 (Right)" SEQ ID NO: 126). It is assumed that both ITR-12 (left) and ITR-12 (right) form a structure with two arms, one of which is truncated. The predicted values of their Gibbs free energies for unfolding are −86.2 kcal/mol.

[0064] In FIG. 22A shows the predicted lowest energy structure containing the RBE portions of the A-A' arm, the C-C' arm, and the B-B' arm of a typical modified left ITR ("ITR-13 (Left)" SEQ ID NO: 127), and FIG. 22B shows the predicted lowest energy structure of the RBE-containing portions of the A-A' arm, the C-C' arm, and the B-B' arm of a typical modified right ITR ("ITR-13 (Right)" SEQ ID NO: 128). It is assumed that both ITR-13 (left) and ITR-13 (right) form a structure with two arms, one of which (eg, arm B-B') is truncated. Their predicted Gibbs free energies for unfolding are −82.9 kcal/mol.

[0065] In FIG. 23A shows the predicted lowest energy structure containing the RBE portions of the A-A' arm, the C-C' arm, and the B-B' arm of a typical modified left ITR ("ITR-14 (Left)" SEQ ID NO: 129), and FIG. 23B shows the predicted lowest energy structure of the RBE portions of the A-A' arm, the C-C' arm, and the B-B' arm of a typical modified right-handed ITR (“ITR-14 (Right)” SEQ ID NO: 130). It is assumed that both ITR-14 (left) and ITR-14 (right) form a structure with two arms, one of which (eg, arm B-B') is truncated. Their predicted Gibbs free energies for unfolding are −80.5 kcal/mol.

[0066] In FIG. 24A shows the predicted lowest energy structure containing the RBE portions of the A-A' arm, the C-C' arm, and the B-B' arm of a typical modified left ITR ("ITR-15 (Left)" SEQ ID NO: 131), and FIG. 24B shows the predicted lowest energy structure of the RBE-containing portions of the A-A' arm, the C-C' arm, and the B-B' arm of a typical modified right ITR ("ITR-15 (Right)" SEQ ID NO: 132). It is assumed that both ITR-15 (left) and ITR-15 (right) form a structure with two arms, one of which (eg, arm B-B') is truncated. The predicted values of their Gibbs free energies for unfolding are −77.2 kcal/mol.

[0067] In FIG. 25A shows the predicted lowest energy structure containing the RBE portions of the A-A' arm, the C-C' arm, and the B-B' arm of a typical modified left ITR ("ITR-16 (Left)" SEQ ID NO: 133), and FIG. 25B shows the predicted lowest energy structure of the RBE-containing portions of the A-A' arm, the C-C' arm, and the B-B' arm of a typical modified right ITR ("ITR-16 (Right)" SEQ ID NO: 134). It is assumed that both ITR-16 (left) and ITR-16 (right) form a structure with two arms, one of which (eg, arm B-B') is truncated. Their predicted Gibbs free energies for unfolding are −73.9 kcal/mol.

[0068] In FIG. 26A shows the predicted structures of the RBE-containing portion of the A-A' arm and the modified B-B' arm and/or the modified C-C' arm of representative examples of the modified right ITRs shown in Table 10A. Fig. 26B shows the predicted structures of the RBE-containing portion of the arm A-A' and the modified arm C-C' and/or the modified arm B-B' of the examples of modified right ITRs shown in Table 10B. The structures shown are the predicted structures with the lowest free energy. Designation by conventional colors: red = probability >99%; orange = 99% - 95% probability; beige = 95-90% probability; dark green 90% - 80%; bright green = 80% - 70%; blue = 70% - 60%; dark blue 60% - 50%; and pink = < 50%.

[0069] FIG. 27 shows the luciferase activity of Sf9 GlycoBac insect cells transfected with selected asymmetric ITR mutant variants from Tables 10A and 10B. The cccDNA vector had a luciferase gene flanked by a wild-type ITR and a modified asymmetric ITR selected from Tables 10A or 10B. “ITR-50 R no rep” is a known rescue mutant without Rep-containing baculovirus coinfection. “Mock” conditions are represented by transfection reagents only, without donor DNA.

[0070] FIG. 28 shows a native agarose gel (1% agarose, 1x TAE buffer) of representative crude cccDNA extracts from Sf9 insect cell cultures transfected with ccDNA plasmids containing a left-handed wt-ITR with a different ITR selected from the various mutant right-handed ITRs disclosed in Table 10A. 2 μg of total extract was added to each lane. From left to right: lane 1) 1 kb markers. plus, track 2) right ITR-18, track 3) right ITR-49 track 4) right ITR-19, track 5) right ITR-20, track 6) right ITR-21, track 7) right ITR-22, track 8) right ITR-23, track 9) right ITR-24, track 10) Right ITR-25, track 11) right ITR-26, track 12) right ITR-27, track 13), right ITR-28, track 14 ) right ITR-50, track 15) 1 kb. plus markers.

[0071] FIG. 29 shows a denaturing gel (0.8% alkaline agarose) of representative constructs from the ITR mutant library. The cccDNA vector is prepared from plasmid constructs containing a wild-type left ITR with another ITR selected from the various right ITR mutants described in Table 10A. From left to right, lane 1) 1 kb markers. plus, lane 2) right unsplit ITR-18, lane 3) right split ITR-18, lane 4) right uncut ITR-19, lane 5) right split ITR-19, lane 6) right uncut ITR-21, lane 7) right split ITR-21, track 8) right split ITR-25, track 9) right split ITR-25. Extracts were treated with restriction endonuclease EcoRI. Each mutant cccDNA is expected to have a single EcoRI recognition site, yielding two characteristic fragments, ~2000 bp. and ~3000 bp, which under denaturing conditions will be ~4000 and ~6000 bp in length, respectively. Raw cccDNA extracts are ~5000 bp in size and are expected to migrate to ~11,000 bp under denaturing conditions.

[0072] FIG. 30 shows in vitro luciferase activity in HEK293 cells of the ITR mutants right ITR-18, right ITR-19, right ITR-21 and right ITR-25, and ITR-49, where the left ITR in the cccDNA vector is the WT ITR. “Mock” conditions are represented by transfection reagents only, without donor DNA, and untreated is a negative control.

[0073] FIG. 31 is a table showing various properties and activities (eg, DNA binding, DNA nicking, helicase activity, ATPase activity, and Zn-finger activity) of different types of Rep proteins (eg, wild-type Rep78, wild-type Rep68, wild-type Rep52, and wild-type Rep40) and modified Rep68 species, for example, in which the amino acid of the Rep78 protein is modified to any of Y156, K340H, Met→Gly (M225G). When modified Met→Gly (M225G), Rep78 retains all the properties and activities of the wild-type Rep78 protein.

[0074] FIG. 32A and 32B are non-denaturing gels showing the presence of highly stable DNA vectors and characteristic bands confirming the presence of a highly stable closed-end DNA (ccDNA) vector produced using a single Rep protein using the methods described herein. In FIG. 32A, higher amounts of cccDNA vector are produced using a modified Rep78 nucleic acid with the modification of Rep78 to Met→Gly (M225G) (lane 1) or Rep to Met→Thr (M225T) (lane 2) compared to production using a nucleic acid encoding Wild-type Rep78 (lane 5), in which the nucleic acid expresses both the Rep78/68 protein and the Rep52/40 protein. The cccDNA vector was not produced with Rep78 binding/nicking mutants containing Gly (Y156F) (lane 3) or Thr (Y156F) (lane 4) modifications. In FIG. 32B, the Rep68 Met→Gly (M225G) and Rep68 Met→Thr (M225T) mutants also produced cccDNA vector at levels equal to or greater than the amount of ccDNA vector produced using Rep78-modified nucleic acid with the Rep78 modification to Met→Gly (M225G) or Rep Met→Thr (M225T). DLSR: plasmid construct expressing long (Rep78) and short (Rep52) Rep protein in tandem; pIE78: full-length wild-type Rep78 sequence; Rep78 M→G: full-length Rep78 containing a single mutation M225G; Rep78M→T: full-length Rep78 containing a single mutation M225T; Rep78Y156F: Full-length Rep78, which has a single mutation in the nickase domain.

DETAILED DESCRIPTION OF THE INVENTION

I. Definitions

[0075] Unless otherwise defined herein, scientific and technical terms used in connection with this application will have the meanings commonly understood by those skilled in the art to which this invention relates. It should be understood that the present invention is not limited to the specific methodology, protocols and reagents, etc. described herein and, accordingly, is subject to various variations. The terminology used herein is intended to describe specific embodiments only and is not intended to limit the scope of the invention, which is defined solely by the claims. Definitions of common immunology and molecular biology terms can be found in the following sources: The Merck Manual of Diagnosis and Therapy, 19th ed., published by Merck Sharp & Dohme Corp., 2011 (ISBN 978-0-911910-19-3); Robert S. Porter et al. (ed.), Fields Virology, 6th ed., published by Lippincott Williams & Wilkins, Philadelphia, PA, USA (2013), Knipe, D.M. and Howley, P.M. (ed.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); Immunology, Werner Luttmann, published by Elsevier, 2006; Janeway's Immunobiology, Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), Taylor & Francis Limited, 2014 (ISBN 0815345305, 9780815345305); Lewin's Genes XI, published by Jones & Bartlett Publishers, 2014 (ISBN-1449659055); Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012) (ISBN 1936113414); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X); Laboratory Methods in Enzymology: DNA, Jon Lorsch (ed.) Elsevier, 2013 (ISBN 0124199542); Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (ed.), John Wiley and Sons, 2014 (ISBN 047150338X, 9780471503385), Current Protocols in Protein Science (CPPS), John E. Coligan (ed.), John Wiley and Sons, Inc., 2005; and Current Protocols in Immunology (CPI) (John E. Coligan, ADA M Kruisbeek, David H Margulies, Ethan M Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc., 2003 (ISBN 0471142735, 9780471142737), contents which are incorporated herein by reference in their entirety.

[0076] As used herein, the terms “heterologous nucleotide sequence” and “transgene” are used interchangeably and refer to a nucleic acid of interest (other than a nucleic acid encoding a capsid polypeptide) that is inserted into a cccDNA vector and can be delivered and expressed by a cccDNA vector. vector as described in this document. Transgenes of interest include, but are not limited to, nucleic acids encoding polypeptides, preferably therapeutic (eg, for medical, diagnostic or veterinary purposes) or immunogenic polypeptides (eg, for vaccines). In some embodiments, the nucleic acids of interest include nucleic acids that are transcribed into therapeutic RNA. Transgenes included for use in cccDNA vectors of the invention include, but are not limited to, those expressing or encoding one or more polypeptides, peptides, ribozymes, aptamers, peptide nucleic acids, siRNAs, RNAi, microRNAs, lncRNAs (long non-coding RNAs), antisense oligos - or polynucleotides, antibodies, antigen-binding fragments, or any combination thereof.

[0077] As used herein, the terms "expression cassette" and "transcription cassette" are used interchangeably and refer to a linear stretch of nucleic acids that contains a transgene operably linked to one or more promoters or other regulatory sequences sufficient to direct transcription of the transgene, but does not contain capsid coding sequences, other vector sequences or inverted terminal repeat regions. The expression cassette may further comprise one or more cis-acting sequences (eg, promoters, enhancers, or repressors), one or more introns, and one or more post-transcriptional regulatory elements.

[0078] As used herein, the term “terminal repeat” or “TR” includes any viral terminal repeat or any synthetic sequence that contains at least one minimum required origin of replication and a region containing a palindromic hairpin structure. The Rep binding sequence (“RBS”) (also called the RBE (Rep binding element)) and the terminal resolution site (“TRS”) together form the “minimum required origin of replication” and, accordingly, the TR contains at least one RBS and at least at least one TRS. Each of the TRs that are inversely complementary to each other within a specific stretch of polynucleotide sequence is generally referred to as an “inverted terminal repeat” or “ITR.” In the context of a virus, ITRs mediate viral replication, packaging, integration, and proviral release. It has been surprisingly discovered by the present inventors that terminal repeats that are not reverse complementary throughout their entire length can still perform traditional ITR functions and thus the term ITR herein refers to a CP in a cccDNA genome or cccDNA vector , which is capable of mediating the replication of the cDNA vector. One skilled in the art will appreciate that cccDNA vectors of complex configuration may contain more than two pairs of ITRs or asymmetric ITRs. Said ITR may be an AAV ITR or a non-AAV ITR, or may be derived from an AAV ITR or a non-AAV ITR. For example, the ITR may be from the Parvoviridae family, which includes parvoviruses and dependoviruses (eg, canine parvovirus, bovine parvovirus, murine parvovirus, porcine parvovirus, human parvovirus B-19), or the SV40 hairpin, which serves as an origin of replication SV40 may be used as an ITR, which may further be modified by truncation, substitution, deletion, insertion and/or addition. The Parvoviridae family of viruses consists of two subfamilies: Parvovirinae, which infect vertebrates, and Densovirinae, which infect invertebrates. Dependoparvoviruses include the adeno-associated virus (AAV) family of viruses that are capable of replication in vertebrate hosts, including, but not limited to, human, primate, bovine, canine, equine, and sheep species. For convenience, herein the ITR located 5' upstream of the expression cassette in the cccDNA vector is referred to as the "5' ITR" or "left ITR", and the ITR located 3' downstream of the expression cassette in the cccDNA vector. -vector, is called the “3' ITR” or “right ITR”.

[0079] “Wild-type ITR” or “WT-ITR” refers to a naturally occurring AAV or other dependovirus ITR sequence that retains, for example, Rep binding activity and Rep nicking ability. The nucleotide sequence of the WT-ITR from any AAV serotype may differ slightly from the canonical naturally occurring sequence due to degeneracy of the genetic code or drift, and accordingly, the WT-ITR sequences provided for use herein include the WT-ITR sequences generated as a result of naturally occurring changes that occur during the production process (for example, replication errors).

[0080] As used herein, the term “substantially symmetric WT-ITRs” or “substantially symmetric WT-ITR pair” refers to a pair of WT-ITRs within a single ccDNA genome or ccDNA vector, where both ITRs are wild-type ITRs , which have a reverse complementary sequence along their entire length. For example, an ITR may be considered a wild-type sequence even if it contains one or more nucleotides that differ from nucleotides in the canonical naturally occurring sequence, provided that such changes do not affect the properties and overall three-dimensional structure of the sequence. In some aspects, said differing nucleotides represent conservative sequence changes. A non-limiting example is a sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to the canonical sequence (as assessed, for example, by BLAST using default parameters), and also has a symmetrical three-dimensional spatial organization relative to another WT-ITR such that their 3D structure has the same shape in geometric space. This substantially symmetrical WT-ITR contains the same A, C-C' and B-B' loops in three-dimensional space. An essentially symmetrical WT-ITR can be functionally confirmed to be WT by determining whether it contains a functional Rep binding site (RBE or RBE') and a terminal resolution site (trs) that pairs with the corresponding Rep protein. Other functions can be further tested, including transgene expression under permissive conditions.

[0081] As used herein, the expressions “modified ITR” or “mod-ITR” or “mutant ITR” are used interchangeably herein and refer to an ITR that contains a mutation in at least one or more nucleotides compared to the WT-ITR from the same serotype. The mutation may result in a change in one or more of regions A, C, C', B, B' in the ITR, and may result in a change in three-dimensional spatial organization (i.e., three-dimensional structure in geometric space) compared to three-dimensional spatial organization by the WT-ITR organization from the same serotype.

[0082] As used herein, the term “asymmetric ITRs,” also referred to as “asymmetric ITR pairs,” refers to a pair of ITRs in the same ccDNA genome or ccDNA vector that are not reverse complements in their full length. As one non-limiting example, in an asymmetric pair, the ITRs do not have a symmetrical three-dimensional spatial organization with their partner ITR, and their three-dimensional structures have different shapes in geometric space. In other words, an asymmetric ITR pair has different overall geometric structures, i.e. they have different organizations of their A, C-C' and B-B' loops in three-dimensional space (e.g., one ITR may have a short C-C' arm and/or a short B-B' arm compared to a cognate ITR). The sequence difference between two ITRs may be due to insertion, deletion, truncation, or point mutation of one or more nucleotides. In one embodiment, one ITR of an asymmetric ITR pair may be a wild-type AAV ITR sequence and the other ITR a modified ITR as defined herein (eg, a non-wild-type or synthetic ITR sequence). In another embodiment, neither of the ITRs of an asymmetric ITR pair is a wild-type AAV sequence, and the two ITRs are modified ITRs that have different shapes in geometric space (ie, a different overall geometric structure). In some embodiments, one mod-ITR of an asymmetric ITR pair may have a short C-C' arm, and the other ITR may have a different modification (e.g., single arm or short B-B' arm, etc.), such that they have a different three-dimensional spatial organization compared to its paired asymmetric mod-ITR.

[0083] As used herein, the term “symmetrical ITR” refers to a pair of ITRs within a single cccDNA genome or ccDNA vector that are mutated or modified relative to the wild-type dependoviral ITR sequences, and are reverse complementary throughout their entire length. Neither ITR is the wild-type AAV2 ITR sequence (ie, they are modified ITRs, also called mutant ITRs), and may differ from the wild-type ITR sequence due to insertion, deletion, substitution, truncation, or point mutation of nucleotides. For convenience, herein the ITR located 5' upstream of the expression cassette in the cccDNA vector is referred to as the "5' ITR" or "left ITR", and the ITR located 3' downstream of the expression cassette in the cccDNA vector. -vector, is called the “3' ITR” or “right ITR”.

[0084] As used herein, the term “substantially symmetric modified ITRs” or “substantially symmetric mod-ITR pair” refers to a pair of modified ITRs in a single ccDNA genome or ccDNA vector that both have reverse complementary sequences throughout their entire length. For example, a modified ITR may be considered substantially symmetrical even though it has some nucleotide sequences that deviate from the reverse complementary sequence, as long as the changes do not affect the properties and overall shape. One non-limiting example is a sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the canonical sequence (as assessed by BLAST using default parameters), and has a symmetrical three-dimensional spatial organization with respect to the related modified ITR, such that their three-dimensional structures have the same shape in geometric space. In other words, a pair of essentially symmetrical modified ITRs contains loops A, C-C' and B-B' that are identically organized in three-dimensional space. In some embodiments, the ITRs of a mod-ITR pair may contain different reverse complementary nucleotide sequences but still have the same symmetrical three-dimensional spatial organization—that is, both ITRs contain mutations that result in the same overall three-dimensional shape. For example, one ITR (eg, 5' ITR) in a mod-ITR pair may be from one serotype, and the other ITR (eg, 3' ITR) may be from a different serotype, but both ITRs may contain the same corresponding mutation (eg , in the event that a 5'ITR contains a deletion in region C, a related modified 3'ITR from a different serotype contains a deletion at a similar position in region C'), such that the ITRs in a pair of modified ITRs have the same symmetrical three-dimensional spatial organization. In such embodiments, each ITR in a pair of modified ITRs may belong to a different serotype (e.g., AAV1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12), such as a combination of AAV2 and AAV6, wherein the modification of one ITR is mapped to the corresponding position of the related ITR of the other serotype. In one embodiment, a pair of substantially symmetrical modified ITRs is referred to as a modified ITR (mod-ITR) pair, provided that the nucleotide sequence differences between the ITRs do not affect the properties or overall shape and they have substantially the same shape in three-dimensional space. A non-limiting example is provided by a mod-ITR that is at least 95%, 96%, 97%, 98%, or 99% sequence identical to the canonical mod-ITR as assessed using standard methods well known in the art, such as BLAST ( Basic Local Alignment Search Tool, or BLASTN, at its default settings, also has a symmetrical three-dimensional spatial organization, so that their three-dimensional structure has the same shape in geometric space. An ITR in a pair of essentially symmetric mod-ITRs contains identical A, C-C', and B-B' loops in three-dimensional space, e.g., if a modified ITR in a pair of essentially symmetric mod-ITRs contains a deletion in the C-C' arm, then the cognate mod -ITR contains a corresponding deletion in the C-C' arm and also has a similar three-dimensional structure of the remaining A and B-B' loops, adopting the same shape in geometric space as the related mod-ITR.

[0085] The term “flanking” refers to the relative position of one nucleic acid sequence with respect to another nucleic acid sequence. In general, in the ABC sequence, A and C flank B. The same is true for the AxBxC arrangement. Thus, the flanking sequence precedes or follows the flanking sequence, but need not be adjacent to, or immediately adjacent to, the flanking sequence. In one embodiment, the term flanking refers to the terminal repeats at each end of a linear duplex ccDNA vector.

[0086] As used herein, the term “ccDNA genome” refers to an expression cassette that further includes at least one inverted terminal repeat region. The cDNA genome may further comprise one or more spacer regions. In some embodiments, the cccDNA genome is included as an intermolecular duplex DNA polynucleotide in a plasmid or viral genome.

[0087] As used herein, the term “cDNA spacer region” refers to an intervening sequence that separates functional elements in a specified ccDNA vector or ccDNA genome. In some embodiments, the cccDNA spacer regions hold two functional elements at a desired distance for optimal functionality. In some embodiments, the cDNA spacer regions provide or enhance the genetic stability of the cDNA genome within, for example, a plasmid or baculovirus. In some embodiments, cccDNA spacer regions facilitate prepared genetic manipulation of the cccDNA genome by providing convenient locations for cloning sites and the like. For example, in certain aspects, an oligonucleotide "polylinker" containing multiple restriction endonuclease sites or non-open reading frame sequence, designed to not contain known protein (e.g., transcription factor) binding sites, can be placed in the cccDNA genome for separation cis-acting factors, for example, by insertion of a 6-mer, 12-mer, 18-mer, 24-mer, 48-mer, 86-mer, 176-mer, etc. between the terminal resolution site and the 5' transcriptional regulatory element. Likewise, a spacer can be inserted between the polyadenylation signal sequence and the 3' end resolution site.

[0088] As used herein, the terms “Rep binding site,” “Rep binding element,” “RBE,” and “RBS” are used interchangeably and refer to the binding site for a Rep protein (e.g., AAV Rep 78 or AAV Rep 68) that is binding by the Rep protein allows the Rep protein to perform site-specific endonuclease activity against the sequence including the RBS. The RBS sequence together with its reverse complement form one RBS. RBS sequences are known in the art and include, for example, 5'-GCGCGCTCGCTCGCTC-3' (SEQ ID NO: 531), which is the RBS sequence identified in AAV2. Any known RBS sequence may be used in embodiments of the present invention, including other known AAV RBS sequences and other known naturally occurring or synthetic RBS sequences. Without being bound by any theory, it is believed that the nuclease domain of the Rep protein binds to the duplex nucleotide sequence GCTC and, accordingly, on the duplex oligonucleotide 5'-(GCGC)(GCTC)(GCTC)(GCTC)-3' (SEQ ID NO : 531) direct binding and stable assembly of two known AAV Rep proteins occurs. In addition, soluble aggregated conformers (i.e., an indefinite number of interconnected Rep proteins) dissociate and bind to oligonucleotides that contain Rep binding sites. Each Rep protein interacts with both nitrogenous bases and phosphodiester backbones on each chain. Interactions with nitrogenous bases provide sequence specificity, whereas interactions with the phosphodiester backbone are nonspecific or less sequence specific and stabilize the protein-DNA complex.

[0089] As used herein, the terms "terminal resolution site" and "TRS" are used interchangeably and refer to the region at which Rep forms a tyrosine phosphodiester bond with a 5'-thymidine to form a 3'-OH, which serves as a substrate for elongation DNA using a cellular DNA polymerase, such as DNA polymerase delta or DNA polymerase epsilon. Alternatively, the Rep-thymidine complex may participate in a coordinated ligation reaction. In some embodiments, the TRS spans at least an unpaired thymidine base. In some embodiments, the nicking efficiency of the TRS can be controlled at least in part by the distance between it and the RBS within a single molecule. If the acceptor substrate is a complementary ITR, the resulting product is an intramolecular duplex. TRS sequences are known in the art and include, for example, 5'-GGTTGA-3' (SEQ ID NO: 45), which is a hexanucleotide sequence identified in AAV2. In embodiments of the present invention, any known TRS sequence may be used, including other known AAV TRS sequences and other known natural or synthetic TRS sequences, such as AGTT (SEQ ID NO: 46), GGTTGG (SEQ ID NO: 47), AGTTGG (SEQ ID NO: 48), AGTTGA (SEQ ID NO: 49); and other motifs such as RRTTRR (SEQ ID NO: 50).

[0090] As used herein, the term “ccDNA plasmid” refers to a plasmid that contains the cccDNA genome as an intermolecular duplex.

[0091] As used herein, the term “ccDNA bacmid” refers to an infectious baculovirus genome comprising the cccDNA genome as an intermolecular duplex capable of propagating in E. coli as a plasmid and thus serving as a shuttle vector for the baculovirus.

[0092] As used herein, the term “ccDNA-baculovirus” refers to a baculovirus that contains a cccDNA genome as an intermolecular duplex within the baculovirus genome.

[0093] As used herein, the terms “ccDNA-baculovirus-infected insect cell” and “ccDNA-BIIC” are used interchangeably and refer to an invertebrate animal host cell (including, without limitation, an insect cell (e.g., an Sf9 cell)) infected with cccDNA-BIIC. baculovirus.

[0094] As used herein, the term “ccDNA” refers to capsidless, closed linear double-stranded (ds) duplex DNA for non-viral gene transfer, synthetic or otherwise. A detailed description of cccDNA is contained in international application PCT/US2017/020828, filed March 3, 2017, the contents of which are expressly incorporated herein by reference in their entirety. Some methods for producing a cccDNA vector containing various sequences and inverted terminal repeat (ITR) configurations using cellular methods are described in example 1 in international application PCT/US18/49996, filed September 7, 2018, and international application PCT/US2018/ 064242, filed December 6, 2018, each of which is incorporated herein by reference in its entirety. Some methods for producing synthetic cccDNA vectors containing different ITR sequences and configurations are described, for example, in international application PCT/US2019/14122, filed January 18, 2019, the contents of which are incorporated herein by reference in their entirety.

[0095] As used herein, the term “closed-end DNA vector” refers to a non-capsid DNA vector with at least one covalently closed end, wherein at least a portion of the vector has an intramolecular duplex structure.

[0096] As used herein, the terms “ccDNA vector” and “ccDNA” are used interchangeably and refer to a closed-ended DNA vector containing at least one terminal palindrome. In some embodiments, the cccDNA comprises two covalently closed ends.

[0097] As used herein, the term “ncDNA” or “nicked cccDNA” refers to closed-ended DNA containing a 1-100 base pair break or gap in the stem region or 5' spacer region located upstream of the open reading frame (eg , promoter and transgene for expression).

[0098] As used herein, the terms “gap” and “break” are used interchangeably and refer to the interrupted portion of the synthetic DNA vector of the present invention, creating a stretch of a portion of single-stranded DNA in double-stranded ccDNA. The length of the gap can be from one 1 base pair to 100 base pairs in one strand of duplex DNA. Typical gaps designed and created using the methods described herein, and synthetic vectors obtained by these methods, may have a length of, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 , 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 or 60 base pairs . Examples of gaps herein may range in length from 1 bp to 10 bp, from 1 to 20 bp, from 1 to 30 bp.

[0099] As defined herein, “reporters” refer to proteins that can be used to provide detectable readouts. Reporters typically produce a measurable signal, such as fluorescence, color, or luminescence. Reporter protein coding sequences encode proteins whose presence in a cell or organism can be easily observed. For example, fluorescent proteins cause a cell to fluoresce when excited by light of a specific wavelength, luciferases cause a cell to catalyze a reaction that generates light, and enzymes such as β-galactosidase convert a substrate into a colored product. Typical examples of reporter polypeptides useful for experimental or diagnostic purposes include, but are not limited to, β-lactamase, β-galactosidase (LacZ), alkaline phosphatase (ALP), thymidine kinase (TK), green fluorescent protein (GFP), and other fluorescent proteins. chloramphenicol acetyltransferase (ChAT), luciferase and others well known in the art.

[00100] As used herein, the term "effector protein" refers to a polypeptide that provides a detectable readout, either, for example, as a reporter polypeptide, or, more preferably, as a cell killing polypeptide, such as a toxin, or a cell sensitizing agent. to killing by a specific agent or in the absence of a specific agent. Effector proteins include any protein or peptide that directly targets or damages the DNA and/or RNA of a host cell. For example, effector proteins may include, but are not limited to, a restriction endonuclease that targets a host cell DNA sequence (genomic or extrachromosomal element), a protease that cleaves a target polypeptide essential for cell survival, a DNA gyrase inhibitor, and a ribonuclease-type toxin. In some embodiments, effector protein expression controlled by a synthetic biological circuit as described herein may participate as a factor in another synthetic biological circuit, thereby expanding the range and complexity of the response of the biological circuit system.

[00101] Transcription regulators refer to transcriptional activators and repressors that either activate or repress transcription of a gene of interest. Promoters are sections of nucleic acid that initiate transcription of a particular gene. Transcription activators typically bind in the vicinity of transcriptional promoters and recruit RNA polymerase to directly initiate transcription. Repressors bind to transcriptional promoters and sterically interfere with the initiation of transcription by RNA polymerase. Other transcriptional regulators can serve as either an activator or a repressor depending on where they bind and the conditions in the cell and environment. Non-limiting examples of classes of transcription regulators include, but are not limited to, homeodomain proteins, zinc finger proteins, forkhead proteins, and leucine zipper proteins.

[00102] As used herein, a “repressor protein” or an “inducer protein” is a protein that binds to a regulatory sequence element and represses or activates, respectively, the transcription of sequences operably associated with said regulatory sequence element. Preferred repressor and inducer proteins as described herein are sensitive to the presence or absence of at least one input agent or environmental factor. Preferred proteins, as described herein, are modular in form and contain, for example, detachable DNA-binding and binding input agents, or elements or domains responsive thereto.

[00103] As used herein, the term “carrier” includes any and all possible solvents, dispersion media, bases, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption retarding agents, buffers, carrier solutions, suspensions, colloids, etc. P. The use of such media and agents for pharmaceutically active substances is well known in the art. Also, auxiliary active ingredients can be included in these compositions. The expression "pharmaceutically acceptable" refers to molecular entities and compositions that do not result in a toxic, allergic or similar adverse reaction when administered to a host.

[00104] As used herein, the term “input agent responsive domain” is a transcription factor domain that binds or otherwise responds to a condition or input agent by causing the DNA binding fusion domain attached thereto to respond to the presence of the condition or input impact. In one embodiment, the presence of said condition or input agent results in a conformational change in the input agent response domain, or in the protein to which it is fused, that modifies the transcription modulating activity of the transcription factor.

[00105] The term "in vivo" refers to assays or methods that are performed on or in an organism, such as a multicellular animal. In certain aspects described herein, the method or use may be stated to be performed "in vivo" if a single cell organism, such as a bacterium, is used. The term "ex vivo" refers to methods and uses that are carried out using a living cell with an intact membrane located outside the body of a multicellular animal or plant, for example, explants, cultured cells, including primary cells and cell lines, transformed cell lines, and extracted tissues or cells, including but not limited to blood cells. The term "in vitro" refers to assays and methods that do not require the presence of a cell with an intact membrane, such as cell extracts, and may refer to the introduction of a programmable synthetic biological circuit in a cell-free system, such as an environment containing no cells or cellular systems such as cell extracts.

[00106] The term “promoter” as used herein refers to any nucleic acid sequence that regulates the expression of another nucleic acid sequence by driving the transcription of said nucleic acid sequence, which may be a heterologous target gene encoding a protein or RNA. Promoters can be constitutive, inducible, repressible, tissue specific, or any combination of the above. A promoter is a control region of a nucleic acid sequence that controls the initiation and rate of transcription of the rest of the nucleic acid sequence. A promoter may also contain genetic elements to which regulatory proteins and molecules, such as RNA polymerase and other transcription factors, can bind. In some embodiments of aspects described herein, a promoter may drive the expression of a transcription factor that controls the expression of the promoter itself, or the expression of another promoter used in another modular component of the synthetic biological circuits described herein. The promoter sequence contains the transcription initiation site, as well as protein-binding domains responsible for binding RNA polymerase. Eukaryotic promoters often, but not always, contain TATA boxes and CAT boxes. Various promoters, including inducible promoters, can be used to drive the expression of transgenes in cDNA vectors as described herein.

[00107] The term “enhancer” as used herein refers to a cis-acting regulatory sequence (e.g., 50-1500 base pairs in size) that binds one or more proteins (e.g., activator proteins or transcription factor ) to enhance transcriptional activation of a nucleic acid sequence. Enhancers can be located up to 1,000,000 base pairs 5' from the start site of the gene or 3' from the start site of the gene they regulate. The enhancer may be located within an intronic region or within an exonic region of an unrelated gene.

[00108] A promoter can be said to drive the expression or drive the transcription of the nucleic acid sequence that it regulates. The expressions "operably linked", "operably located", "functionally linked", "under control" and "under transcriptional control" indicate that the promoter is in the correct functional position and/or orientation relative to the nucleic acid sequence that it regulates for control of transcription initiation and/or expression of this sequence. "Inverted promoter" as used herein refers to a promoter in which the nucleic acid sequence is arranged in reverse orientation such that a strand that was a sense strand becomes a non-coding strand and vice versa. Inverted promoter sequences can be used, according to various embodiments, to regulate the state of a switch. Additionally, in various embodiments, a promoter may be used in combination with an enhancer.

[00109] A promoter can be a promoter naturally associated with a gene or sequence, and can also be obtained by isolating 5' non-coding sequences located 5' in the direction of the coding segment and/or exon of a particular gene or sequence. Such a promoter may be called "endogenous". Likewise, in some embodiments, an enhancer may be an enhancer naturally associated with a nucleic acid sequence located either in the 5'-3' or 3'-5' direction of the sequence.

[00110] In some embodiments, the coding segment of the nucleic acid is located under the control of a “recombinant promoter” or “heterologous promoter”; both of these terms refer to a promoter not normally associated with the encoded nucleic acid sequence to which the promoter is operably associated in the natural environment. A recombinant or heterologous enhancer refers to an enhancer that is not normally associated with a particular nucleic acid sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers of other genes; promoters or enhancers isolated from any other prokaryotic, viral or eukaryotic cell; and synthetic promoters or enhancers that are not "naturally occurring", i.e., contain other elements of other transcriptional regulatory regions, and/or mutations that alter expression, obtained using genetic engineering methods that are known in the art . In addition to obtaining promoter and enhancer nucleic acid sequences synthetically, promoter sequences can be obtained using recombinant cloning and/or nucleic acid amplification technology, including PCR, in relation to synthetic biological circuits and modules as described herein (see, for example, US Patent No. 4683202, US Patent No. 5928906, each of which is incorporated herein by reference). In addition, it is also possible to use control sequences that direct transcription and/or expression of sequences in non-nuclear organelles such as mitochondria, chloroplasts, and the like.

[00111] As described herein, an “inducible promoter” is a promoter that is characterized by initiation or enhancement of transcriptional activity in the presence of, under the influence of, or upon contact with, an inducer or inducing agent. An "inducer" or "inducing agent" as defined herein may be an endogenous or normally exogenous compound or protein that is administered such that it is active in inducing the transcriptional activity of an inducible promoter. In some embodiments, said inducer or inducing agent, i.e., a chemical, compound, or protein, may itself be the result of transcription or expression of a nucleic acid sequence (i.e., the inducer may be an inducer protein expressed by another component or module ), which itself may be under the control or be an inducible promoter. In some embodiments, the inducible promoter is induced in the absence of certain agents, such as a repressor. Examples of inducible promoters include, but are not limited to, tetracycline, metallothioneine, ecdysone, mammalian viruses (eg, adenoviral late promoter; murine mammary tumor virus long terminal repeat (MMTV-LTR)) and other steroid-responsive promoters, rapamycin-responsive promoters and so on.

[00112] The term “subject” as used herein refers to a human or animal subject to treatment, including prophylactic treatment, with a cccDNA vector in accordance with this invention. Typically, said animal is a vertebrate such as, but not limited to, a primate, rodent, domestic animal or game. Primates include, but are not limited to, chimpanzees, cynomolgus monkeys, spider monkeys, and macaques such as rhesus monkeys. Rodents include mice, rats, marmots, ferrets, rabbits and hamsters. Domestic and wild animals include, but are not limited to, cows, horses, pigs, deer, bison, buffalo, felines such as domestic cats, canids such as dogs, foxes, wolves, bird species such as chicken, emu, ostrich, and fish such as trout, catfish and salmon. In certain embodiments of the aspects described herein, the subject is a mammal, such as a primate or a human. The subject may be male or female. In addition, the subject may be an infant or child. In some embodiments, the subject may be a newborn or unborn subject, for example, the subject is in utero. Preferably, said subject is a mammal. The mammal may be a human, non-human primate, mouse, rat, dog, cat, horse or cow, but these examples are not limiting. Mammals other than humans may be usefully used as subjects in animal models of diseases and disorders. In addition, the methods and compositions described herein can be used for domesticated animals and/or pets. The human subject may be of any age, gender, race or ethnicity, such as Caucasian (White), Asian, African, Black, African American, Afro-European, Hispanic, Middle Eastern, etc. In some embodiments, the subject may be a patient or other subject in a clinical setting. In some embodiments, the subject is already undergoing treatment.

[00113] As used herein, the term "antibody" is used in the broadest sense to cover a variety of antibody structures, including, but not limited to, monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments, provided that they demonstrate the required antigen-binding activity. "Antibody fragment" refers to a molecule, other than an intact antibody, that contains a portion of the intact antibody that binds the same antigen to which the intact antibody binds. In one embodiment, the antibody or fragment thereof comprises an immunoglobulin chain or antibody fragment and at least one immunoglobulin variable domain sequence. Examples of antibodies or fragments thereof include, but are not limited to, Fv, scFv, Fab fragment, Fab', F(ab') ₂ , Fab'-SH, single domain antibody (dAb), heavy chain, light chain, heavy and light chain , a complete antibody (e.g., including all of Fc, Fab, heavy chains, light chains, variable regions, etc.), bispecific antibody, diabody, linear antibody, single chain antibody, intrabody, monoclonal antibody, chimeric antibody, multispecific antibody, or multimeric antibody. The antibody or fragment thereof may belong to any class, including, but not limited to, IgA, IgD, IgE, IgG and IgM, and any subclass thereof, including, but not limited to, IgG1, IgG2, IgG3, IgG4 , IgA1 and IgA2. In addition, the antibody can be obtained from any mammal, such as primates, humans, rats, mice, horses, goats, etc. In one embodiment, said antibody is a human antibody or a humanized antibody. In some embodiments, the antibody is a modified antibody. In some embodiments, the antibody components may be expressed separately such that the antibody self-assembles upon expression of the protein components. In some embodiments, the antibody is "humanized" to reduce immunogenic reactions in humans. In some embodiments, the antibody has a desired function, for example, the function of interacting with and inhibiting a desired protein to treat a disease or symptom of a disease. In one embodiment, said antibody or antigen-binding fragment thereof comprises a framework region or _Fc region.

[00114] As used herein, the term “antigen binding domain” of an antibody molecule refers to the portion of an antibody molecule, such as an immunoglobulin (Ig) molecule, that is involved in binding an antigen. In embodiments, said antigen binding site is formed by amino acid residues of the variable (V) regions of the heavy (H) and light (L) chains. Three highly heterogeneous regions in the variable regions of the heavy and light chains, called hypervariable regions, are located between more conserved flanking regions called “framework regions” (FR). FRs are amino acid sequences that naturally occur between and adjacent to hypervariable regions in immunoglobulins. In embodiments, the antibody molecule has three light chain hypervariable regions and three heavy chain hypervariable regions located relative to each other in three-dimensional space such that they form an antigen-binding surface complementary to the three-dimensional surface of the antigen being bound. These three hypervariable regions of each of the heavy and light chains are called “complementarity determining regions” or “CDRs”. The framework region and CDR have been defined and described, for example, in: Kabat, E. A., et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242, and Chothia, C. et al. (1987) J. Mol. Biol. 196:901-917. Each variable chain (eg, variable heavy chain and variable light chain) typically consists of three CDRs and four FRs arranged in amino acid sequence, from the amino terminus to the carboxyl terminus, in the following order: FR1, CDR1, FR2, CDR2 , FR3, CDR3 and FR4.

[00115] As used herein, the term “full-length antibody” refers to an immunoglobulin (Ig) molecule (e.g., an IgG antibody), for example, naturally occurring and resulting from normal recombination processes of immunoglobulin gene fragments.

[00116] As used herein, the term “functional antibody fragment” refers to a fragment that binds to the same antigen as recognized by an intact (eg, full-length) antibody. The terms "antibody fragment" or "functional fragment" also include isolated fragments consisting of variable regions, such as "Fv" fragments consisting of heavy and light chain variable regions, or recombinant single chain polypeptide molecules in which light and heavy variable regions linked by a peptide linker (“scFv proteins”). In some embodiments, the antibody fragment does not contain portions of the antibodies without antigen-binding activity, such as Fc fragments or individual amino acid residues.

[00117] As used herein, “immunoglobulin variable domain sequence” refers to an amino acid sequence that can form the structure of an immunoglobulin variable domain. For example, the sequence may comprise all or part of the amino acid sequence of a naturally occurring variable domain. For example, the sequence may or may not include one, two or more N- or C-terminal amino acids, or may include other changes that are compatible with the formation of the protein structure.

[00118] The terms "polynucleotide" and "nucleic acid", used interchangeably herein, refer to the polymeric form of nucleotides of any length, whether ribonucleotides or deoxyribonucleotides. Thus, the term includes single-, double- or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derivatized nucleotide bases. "Oligonucleotide" generally refers to polynucleotides containing from about 5 to about 100 nucleotides of single- or double-stranded DNA. However, for the purposes of this invention, there is no upper limit on the length of the oligonucleotide. Oligonucleotides are also known as "oligomers" or "oligos" and can be isolated from genes or chemically synthesized by methods known in the art. The terms “polynucleotide” and “nucleic acid” should be understood to include, for the purposes of the described embodiments, single-stranded (such as sense or antisense) and double-stranded polynucleotides. The DNA may be in the form of, for example, antisense molecules, plasmid DNA, DNA-DNA duplexes, pre-condensed DNA, PCR products, vectors (P1, PAC, BAC, YAC, artificial chromosomes), expression cassettes, chimeric sequences, chromosomal DNA, or derivatives and combinations of these groups. The DNA may be in the form of a minicircle, plasmid, bacmid, minigene, utility DNA (linear covalently closed DNA vector), linear closed-end duplex DNA (CELiD or cccDNA), Doggybone DNA (dbDNA™), dumbbell DNA, minimalistic vector for immunological defined gene expression (MIDGE), viral vector or non-viral vectors. The RNA may be in the form of short interfering RNA (siRNA), Dicer substrate dsRNA, small hairpin RNA (shRNA), asymmetric interfering RNA (aiRNA), microRNA (miRNA), mRNA, rRNA, tRNA, viral RNA (vRNA), and combinations thereof . Nucleic acids include nucleic acids containing known nucleotide analogues or modified backbone residues or linkages that are synthetic, naturally occurring and non-naturally occurring, that have binding properties similar to those of the reference nucleic acid. Examples of such analogues and/or modified residues include, but are not limited to, phosphorothioates, phosphorodiamidate-morpholine oligomer (morpholino), phosphoramidates, methylphosphonates, chiral methylphosphonates, 2'-O-methyl ribonucleotides, locked nucleic acid (LNA™) and peptide nucleic acids ( PNK). Except as specifically stated, the term covers known analogues of natural nucleotides that have binding properties similar to those of the reference nucleic acid. Unless otherwise indicated, the specific nucleic acid sequence is also intended to include conservatively modified variants (eg, degenerate codon substitutions), alleles, orthologs, single nucleotide polymorphisms (SNPs), and complementary sequences, as well as explicitly stated sequence.

[00119] "Nucleotides" contain the sugar deoxyribose (DNA) or ribose (RNA), a base, and a phosphate group. The nucleotides are connected to each other by the indicated phosphate groups.

[00120] "Bases" include purines and pyrimidines, which further include the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine and natural analogs, as well as synthetic derivatives of purines and pyrimidines, which include, but are not limited to, modifications that introduce new reactive groups such as, but not limited to, amines, alcohols, thiols, carboxylates and alkyl halides.

[00121] By "hybridizable" or "complementary" or "substantially complementary" is meant that the nucleic acid (eg, RNA) includes a nucleotide sequence that allows it to bind non-covalently, i.e. form Watson-Crick base pairs and/or G/U base pairs, undergo "annealing" or "hybridize" with another nucleic acid in a sequence-specific, antiparallel manner (i.e., the nucleic acid specifically binds to a complementary nucleic acid) in appropriate in vitro and/or in vivo conditions of temperature and ionic strength of the solution. As is known in the art, standard Watson-Crick base pairing includes adenine (A) pairing with thymidine (T), adenine (A) pairing with uracil (U), and guanine (G) pairing with cytosine (C). In addition, it is also known in the art that when two RNA molecules (eg, dsRNA) are hybridized, a guanine (G) base is paired with a uracil (U). For example, G/U base pairing is partially responsible for the degeneracy (i.e., redundancy) of the genetic code in the context of the base pairing of tRNA anti-codons with codons in mRNA. In the context of the present invention, the guanine (G) of the protein-binding segment (dsRNA duplex) of the DNA-targeting RNA molecule of the present invention is considered complementary to uracil (U), and vice versa. Thus, when a G/U base pair can be produced at a given nucleotide position with the protein binding segment (dsRNA duplex) of the DNA-targeting RNA molecule of the present invention, that position is not considered to be non-complementary, but instead is considered to be complementary.

[00122] As used herein, the term “nucleic acid construct” refers to a nucleic acid molecule, single-stranded or double-stranded, that is isolated from a naturally occurring gene, or is modified to contain nucleic acid segments in a manner not found in nature, or is synthetic. The term "nucleic acid construct" is synonymous with the term "expression cassette" when the nucleic acid construct contains control sequences necessary for expression of the coding sequence of the present invention. An "expression cassette" includes a DNA coding sequence operably linked to a promoter.

[00123] As used herein, the terms “nucleic acid therapeutic,” “nucleic acid therapeutic,” and “TNA” are used interchangeably and refer to any therapeutic option using nucleic acids as the active component of a therapeutic agent for treating a disease or disorder. As used herein, these expressions refer to RNA-based therapeutics and DNA-based therapeutics. Non-limiting examples of RNA therapeutics include mRNA, antisense RNA and oligonucleotides, ribozymes, aptamers, RNA interfering (RNAi), Dicer substrate dsRNA, small hairpin RNA (shRNA), asymmetric interfering RNA (aiRNA), microRNA (miRNA). Non-limiting examples of DNA-based therapeutics include minicircle DNA, minigene, viral DNA (eg, lentivirus or AAV genome) or non-viral synthetic DNA vectors, closed-end linear duplex DNA (ccDNA/CELiD), plasmids, bacmids, Doggybone DNA vectors (dbDNA™), minimalistic immunologically defined gene expression (MIDGE) vector, non-viral utility DNA vector (linear covalently closed DNA vector), or dumbbell minimal DNA vector (“dumbbell DNA”).

[00124] The terms "peptide", "polypeptide" and "protein" are used interchangeably herein and refer to the polymeric form of amino acids of any length, which may include encoded and non-encoded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones.

[00125] As used herein, the terms “synthetic AAV vector” and “synthetic production of AAV vector” refer to the AAV vector and methods for producing it synthetically in a completely cell-free environment.

[00126] As used herein, the term “comprising” or “comprising” is used to refer to compositions, methods, and their respective component(s) essential to the specified method or composition, but capable of including unspecified elements, significant or not.

[00127] As used herein, the term “consisting essentially of” refers to elements required for a particular implementation. The specified term allows for the presence of elements that do not significantly affect the basic and new or functional characteristic(s) of the specified embodiment.

[00128] The term “consisting of” refers to compositions, methods and their respective components as described herein, which do not include any elements not specified in the above description of an embodiment.

[00129] In this specification and the accompanying claims, terms in the singular include their plural equivalents unless the context clearly indicates otherwise. Accordingly, for example, “method” includes one or more methods and/or steps of the type described herein and/or those that would be apparent to those skilled in the art upon reading this specification, and the like. Likewise, the term “or” includes “and” unless the context clearly requires otherwise. Although methods and materials similar or equivalent to those described herein may be used in the practice or testing of this invention, suitable methods and materials are described below. The expression “for example” as used herein indicates a non-limiting example. Accordingly, the expression “for example” is synonymous with the expression “for example”.

[00130] Except in the working examples, or where otherwise indicated, all numbers expressing amounts of ingredients or reaction conditions used herein are to be understood as modified by the term “about” in all cases. The term "about" when used in relation to a percentage may mean ±1%. The present invention is further explained in detail by the following examples, but they are not intended to limit the scope of the present invention.

[00131] It should be understood that the present invention is not limited to the specific methodology, protocols and reagents, etc. described herein and, accordingly, is subject to various variations. The terminology used herein is intended to describe specific embodiments only and is not intended to limit the scope of the invention, which is defined solely by the claims.

II. Initiator of replication proteins (Rep)

[00132] As described herein, the technology described herein relates to the composition and improved methods for producing DNA vectors, for example, a cccDNA vector as described herein, or an AAV vector with a single Rep protein species. In accordance with certain aspects, the disclosure provides a method for producing a DNA vector, such as a cccDNA vector as described herein, or an AAV vector using a single Rep protein, wherein the Rep protein is not Rep52 or Rep40. In some embodiments, the only Rep protein is Rep78. In some embodiments, the only Rep protein is Rep68. This is an improved and more efficient method for producing cccDNA vector, which gives a higher yield of cccDNA vector than methods described in the prior art, which use two Rep proteins, including Rep78 or 68 and Rep52 or 40 (for example, Rep78 and Rep 52, see Fig. 32). Indeed, prior to this invention, it was believed that in order to produce AAV particles, two Rep proteins must be present, one long (eg Rep78 or Rep 68) and one short (eg Rep52 or Rep40). In particular, it was thought that Rep78 and Rep52 must be present either as separate units or using a single coding sequence for the Rep78 and Rep52 proteins to produce AAV particles.

[00133] Accordingly, one aspect of the technology described herein relates to a method of producing a DNA vector, such as a cccDNA vector as described herein, or an AAV vector using a single Rep protein, as opposed to using two Rep proteins. In some embodiments, the only Rep protein is Rep78. In some embodiments, the only Rep protein is Rep68. In some embodiments, the Rep protein may be Rep78 and Rep68, but not Rep52 or Rep40.

[00134] Another aspect of the technology described herein relates to a composition comprising a nucleic acid construct that contains a first nucleotide sequence encoding a single parvovirus Rep protein, wherein the nucleotide sequence does not have an open reading frame (ORF) and does not contain a functional start codon , located downstream of the first start codon and/or lacks alternative splice sites that prevent exon skipping, thereby allowing translation of a single parvovirus Rep protein (e.g., Rep78 or Rep68 protein) without translation of additional Rep proteins (e.g., any one or more of Rep52 or Rep40) in insect cells or a cell-free system. That is, the nucleic acid encoding Rep78 also does not produce the Rep52 protein, and similarly, the nucleic acid encoding Rep68 does not produce the Rep40 protein. Additionally, no other Rep protein is present or expressed in the nucleic acid construct system for producing DNA vectors, e.g., cccDNA vectors and other recombinant parvovirus (e.g., adeno-associated virus) vectors in cells (e.g., insect cells, mammalian cells) and cell-free systems, such as insect cells or cell-free systems.

Rep proteins in general

[00135] Rep genes reproduce the viral genome. In a wild-type nucleic acid encoding Rep78 or Rep68, a splicing event in the Rep open reading frame of either Rep78 or Rep68 results in two Rep proteins upon translation: Rep52 and Rep40, respectively. That is, the Rep78 protein and the Rep68 protein are encoded by the same nucleic acid, which undergoes differential splicing to produce Rep78 and Rep68. Similarly, Rep52 protein and Rep40 protein are encoded by the same nucleic acid, which undergoes differential splicing to produce Rep52 and Rep40 proteins. Rep78 is a full-length protein produced from the original first translation initiation site, whereas Rep52 is a translation product from the downstream internal “second (AUG)” translation initiation site. Therefore, when the full-length wild-type AAV genome is expressed, all four types of Rep proteins (e.g., Rep78, Rep68, Rep52, and Rep40) are typically present, largely due to the two different translation initiation sites and also because the alternative splicing near the carboxyl end. Each Rep protein has different functionalities, such as DNA nicking, DNA binding, helicase activity, ligase activity, and ATPase activity. The functionality of this Rep protein is further described in FIG. 31 It has been previously reported that both Rep78 and Rep52 proteins are required for the production of AAV vector or cctDNA vector in various systems, such as insect cells and mammalian cell systems. However, as discussed herein, the inventors demonstrate that only one Rep protein, or alternatively at least a combination of long Rep proteins (Rep78 and Rep68), but not short Rep proteins (Rep52 and Rep40), can be used to produce AAV vector or cDNA vector. The only type of Rep protein used in the compositions and method described herein includes all three functions: DNA nicking, DNA binding, and functional DNA ligation. In some embodiments, the single Rep protein further comprises helicase and ATPase functional groups.

[00136] In some embodiments, the only type of Rep protein used in the compositions and methods described herein is the AAV2 Rep protein if the ITR is serotype 2 (eg, AAV2). In alternative embodiments, the single Rep protein may be derived from any of the 42 AAV serotypes or, more preferably, from the AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 Rep protein or the AAV12 Rep protein. In some embodiments, the only Rep protein covered for use in the methods and compositions disclosed herein corresponds to the Rep protein of an animal parvovirus if the ITR is serotype 2 (eg, AAV2). The Rep protein works as part of the ITR system to bind to the ITR and initiate finite resolution replication and catalyze the formation of a closed-ended cccDNA vector molecule.

[00137] In some embodiments, the only Rep protein used in the compositions and methods described herein is Rep78. In alternative embodiments, the only Rep protein used in the compositions and methods described herein is Rep68. In alternative embodiments, a single species of Rep protein is Rep52 or Rep40 that has been modified to contain the functionality of Rep78 or Rep68, for example, to have DNA binding, DNA nicking, helicase, and ATPase activities. Alternatively, in some embodiments, the Rep protein used in the composition and method described herein may be a combination of long Rep proteins (eg, Rep78 and Rep68) without Rep52 or Rep40, short Rep proteins.

[00138] Another aspect of the technology described herein relates to a nucleic acid construct encoding a single Rep protein, in which the nucleic acid does not induce or allow expression of a second Rep protein. Accordingly, in one aspect, the nucleic acid construct encoding a single Rep protein is modified so that it lacks a functional initiation codon for another Rep protein.

[00139] In one embodiment, the presence of a single Rep species (eg, in the absence of other species) is determined by specific mutations that prevent translation of p19 Rep and the absence of other Rep species on Western blotting using anti-Rep antibodies known in the art.

[00140] Nucleic acid constructs encoding modified Rep proteins

[00141] In one embodiment, a single species of Rep protein is encoded by a nucleotide sequence encoding a modified Rep protein, for example, it may encode a modified Rep78 protein, wherein the nucleotide sequence does not have a functional initiation codon to encode the Rep52 protein, and there are no splice sites to skip exons to produce Rep68 or Rep40. For example, the modified nucleotide sequence of Rep78 includes a modification or mutation in the initiation codon for Rep52, such that the initiation codon (eg, AUG) for Rep52 is changed and no longer encodes methionine, but encodes a different amino acid. In some embodiments, the initiation codon (Met) for Rep52 in the Rep78 nucleic acid sequence is mutated to encode glycine (e.g., AUG is mutated to one of: GGU, GGC, GGA, GGG, which encodes Gly) or the amino acid threonine (e.g., AUG is mutated to one of ACT, ACC, ACA and ACG, which encodes Thr).

Modified Rep proteins

[00142] In some embodiments, the modified Rep78 nucleotide sequence may encode a modified Rep78 protein that contains a modification of amino acid residue 225 (Met) of SEQ ID NO: 530, in which amino acid residue 225 is replaced by glycine (Gly) (e.g., M225G or Met225Gly) or threonine (Thr) (eg, M225T or Met225Thr). In one embodiment, the mutated Rep78 protein comprises the sequence of SEQ ID NO: 530 or comprises a sequence comprising at least 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 530, wherein the amino acid at position 225 is not Met, and wherein the modified Rep protein is, at least DNA binding and DNA nicking functionality, and the gene encoding it does not contribute to the production of the second Rep protein. One skilled in the art will be able to create a point mutation using, for example, site-directed mutagenesis. To assess whether a mutation in a nucleotide sequence was generated correctly, a sequence alignment can be performed with a modified Rep protein (ie, a Rep protein containing a point mutation) compared to the wild-type Rep protein.

[00143] In one embodiment, the nucleotide sequence encoding a single Rep protein used in the compositions and methods disclosed herein includes an expression control sequence, such as a promoter, cis-regulatory elements, or a regulatory switch as described herein, located before the initiation codon of a nucleotide sequence encoding the parvovirus protein Rep78, in which the nucleic acid sequence does not have a functional initiation codon for Rep52. In one embodiment, the nucleotide sequence encoding a single Rep protein used in the compositions and methods disclosed herein includes an expression control sequence upstream of the initiation codon of the nucleotide sequence encoding the parvovirus Rep78 protein, wherein the nucleic acid sequence does not have functional splice sites for encoding Rep68.

[00144] That is, in some embodiments, the nucleic acid encoding Rep78 has only one start codon, allowing translation of only the Rep78 protein or the Rep68 protein. In such embodiments, the Rep78 nucleic acid has a functional first start codon allowing translation of the Rep78 protein, but a modified (or non-functional) start codon downstream of the original start codon, resulting in Rep52 not being expressed.

[00145] In all cases, no other vectors that encode a different Rep are used. Also not used is the Rep protein that is already present in insect cells or mammalian cells used in methods for creating DNA vectors, such as cccDNA vectors or AAV vectors, in accordance with the methods described herein.

[00146] In one embodiment, the only Rep protein used in the compositions and methods disclosed herein is from the parvovirus family. In another embodiment, the single Rep protein used in the compositions and methods disclosed herein preferably comes from the Dependovirus subfamily of the Rep virus. In another embodiment, the only Rep protein used in the compositions and methods disclosed herein is more preferably AAV Rep.

[00147] In one embodiment, the nucleotide sequence of the invention includes an expression control sequence encoding an AAV Rep 68 protein, wherein the nucleic acid sequence does not have a functional start codon for Rep40, but has a deletion in the intron sequence at its carboxy terminus, resulting in Rep68 . In another embodiment, the nucleic acid sequence has a deletion in the intronic sequence of full-length Rep78 and no other functional splice sites, resulting in a transcript that is capable of translation only into Rep68. That is, in some embodiments, the nucleic acid encoding Rep68 has only one start codon, allowing translation of only the Rep68 protein with the C-terminal intron sequence removed. In such embodiments, the Rep68 nucleic acid has a functional first start codon allowing translation of the Rep68 protein, but the start codon located downstream of the original start codon is modified or rendered non-functional by a mutation (e.g., M225G or M225T) that results in Rep40 not being expressed. Alternatively, the nucleic acid encoding Rep68 is modified such that the second start codon is modified or nonfunctional by mutation (eg, M225G or M225T), but the downstream c-terminal splice sites are functional and allow expression of the Rep78 protein and the Rep68 protein.

[00148] A sequence substantially identical to the nucleotide sequence of SEQ. ID NO: 530 is a sequence that has at least 60%, 70%, 80%, or 90% identity with SEQ ID NO: 530.

III. Detailed description of the method for producing cccDNA vector using a single Rep protein

A. Receipt in general

[00149] As described herein, a cccDNA vector can be produced by a method using only one Rep protein, as opposed to more than one, eg, two Rep proteins. Accordingly, one aspect of the present invention relates to a method comprising the following steps: a) incubating a population of host cells (eg, insect cells) bearing said template polynucleotide expression construct (eg, ccDNA plasmid, ccDNA bacmid and/or ccDNA baculovirus ), which does not contain sequences encoding the viral capsid, in the presence of the Rep protein under effective conditions and for a period of time sufficient to induce production of the cDNA vector in host cells, wherein said host cells do not contain sequences encoding the viral capsid; and b) collecting and isolating said cDNA vector from the host cells. The presence of a single Rep protein induces replication of the ITR-modified vector polynucleotide to produce a cccDNA vector in the host cell. However, viral particles (eg AAV virions) are not expressed. Thus, there are no size restrictions such as those naturally present in AAV vectors or other viral vectors.

[00150] The presence of a cccDNA vector isolated from host cells can be confirmed by digesting DNA isolated from a host cell with a restriction enzyme having a single recognition site on the ccDNA vector and analyzing the digested DNA material on a non-denaturing gel for confirmation the presence of characteristic bands of linear and continuous DNA compared to linear and discontinuous DNA.

[00151] In another aspect, the invention provides for the use of host cell lines having a DNA expression vector polynucleotide template (ccDNA template) stably integrated into its own genome in the production of a non-viral DNA vector, for example, as described in: Lee, L. et al. (2013) Plos One 8(8): e69879. Preferably, Rep is added to host cells at an MOI (multiplicity of infection) of approximately 3. If the host cell line is a mammalian cell line, for example HEK293 cells, then said cell lines may contain a stably integrated polynucleotide vector template, and the second vector , for example, herpesvirus, can be used to introduce the Rep protein into cells, which ensures the excision and amplification of cctDNA in the presence of Rep and a helper virus.

[00152] In one embodiment, the host cells used to produce the cccDNA vectors described herein are insect cells, and to deliver both the polynucleotide that encodes the Rep protein and the template polynucleotide expression construct of the non-viral DNA vector for cccDNA is used by baculovirus, for example as described in FIG. 4A-4C and Example 1. In some embodiments, a host cell is modified to express a single Rep protein.

[00153] The cccDNA vector is then collected and isolated from the host cells. The timing of collection and recovery of the cccDNA vectors described herein from cells can be selected and optimized to ensure that the cccDNA vectors are obtained in high yield. For example, the collection time may be selected based on cell viability, cell morphology, cell growth, etc. In one embodiment, the cells are cultured under sufficient conditions and harvested sufficiently after infection with the baculovirus to produce cccDNA vectors, but before the majority of the cells begin to die due to toxicity of the baculovirus. These DNA vectors can be isolated using plasmid purification kits, such as Endo-Free Plasmid Kits from Qiagen. Other methods developed for isolating plasmids can also be adapted for DNA vectors. In general, any method for purifying nucleic acids can be used.

[00154] These DNA vectors can be purified by any DNA purification methods known to those skilled in the art. In one embodiment, purified cccDNA vectors are obtained as DNA molecules. In another embodiment, purified cDNA vectors are produced in the form of exosomes or microparticles.

[00155] The presence of a cccDNA vector can be confirmed by digesting vector DNA isolated from cells with a restriction enzyme having a single recognition site on the DNA vector and analyzing both digested and uncleaved DNA material using gel electrophoresis to confirm the presence characteristic bands of linear and continuous DNA, different from those of linear and discontinuous DNA. Fig. 4C and FIG. 4E illustrates one embodiment for identifying the presence of end-closed cccDNA vectors produced by the methods described herein. Fig. 5 depicts a gel confirming the production of cccDNA from multiple plasmid constructs using the method described in the examples.

B. cDNA plasmid

[00156] A cDNA plasmid is a plasmid used to subsequently produce a cDNA vector. In some embodiments, the cDNA plasmid can be constructed using known techniques to provide at least the following, as operably linked components, in the direction of transcription: (1) 5'-ITR; (2) an expression cassette containing a cis-regulatory element, for example, a promoter, an inducible promoter, a regulatory switch, enhancers, and the like; and (3) 3'-ITR, wherein the 3'-ITR sequence is asymmetric to the 5'-ITR sequence. In some embodiments, the ITR-flanked expression cassette contains a cloning site for introducing an exogenous sequence. This expression cassette replaces the rep and cap coding regions of the AAV genomes.

[00157] In one aspect, the ccDNA vector is derived from a plasmid, referred to herein as a "ccDNA plasmid", encoding, in this order: the first inverted terminal repeat (ITR) of an adeno-associated virus (AAV), an expression cassette containing the transgene, and a mutated or a modified AAV ITR, wherein said cDNA plasmid does not contain coding sequences for the AAV capsid protein. In alternative embodiments, such a ccDNA plasmid encodes, in that order: a first (or 5') modified or mutated AAV ITR, an expression cassette containing the transgene, and a second (or 3') wild-type AAV ITR, wherein said ccDNA plasmid lacks coding sequences of the AAV capsid protein, and the 5'- and 3'-ITRs are asymmetrical relative to each other. In alternative embodiments, the ccDNA plasmid encodes, in that order: a first (or 5') modified or mutated AAV ITR, an expression cassette containing the transgene, and a second (or 3') mutated or modified AAV ITR, wherein said ccDNA plasmid lacks coding sequences of the AAV capsid protein, and the modified 5'- and 3'-ITRs are different and do not have the same modifications.

[00158] In a further embodiment, the cDNA plasmid system is devoid of viral capsid protein coding sequences (i.e., does not contain AAV capsid genes as well as capsid genes of other viruses). In addition, in a particular embodiment, the cccDNA plasmid also lacks AAV Rep protein coding sequences. Accordingly, in a preferred embodiment, the cccDNA plasmid lacks the functional AAV cap and AAV rep genes, GG-3′ for AAV2), as well as the variable palindromic sequence responsible for hairpin formation.

[00159] The cDNA plasmid of this invention can be obtained using natural nucleotide sequences from the genomes of any AAV serotypes well known in the art. In one embodiment, the cccDNA plasmid backbone is derived from the genome of AAV1, AAV2, AAV3, AAV4, AAV5, AAV5, AAV7, AAV8, AAV9, AAV10, AAV 11, AAV12, AAVrh8, AAVrh10, AAV-DJ, and AAV-DJ8. For example, NCBI: NC 002077; NC001401; NC001729; NC001829; NC006152; NC 006260; NC 006261; from the Kotin and Smith virus index ("The Springer Index of Viruses"), available at a link maintained by Springer (web address: oesys.springer.de/viruses/database/mkchapter.asp?virID=42.04.) (note: links URL or database refers to the contents of the URL or database available from the link as of the actual filing date of this application). In a specific embodiment, the cDNA plasmid backbone is derived from the AAV2 genome. In another specific embodiment, the cDNA plasmid backbone is a synthetic backbone engineered to include ITRs at the 5' and 3' ends derived from one of the AAV genomes.

[00160] The cccDNA plasmid may optionally include a selectable or selectable marker for use in creating a cell line that produces the ccDNA vector. In one embodiment, said selectable marker may be inserted downstream (ie, in the 3' direction) of the 3'ITR sequence. In another embodiment, said selectable marker may be inserted upstream (ie, in the 5' direction) of the 5' ITR sequence. Suitable selectable markers include, for example, markers that confer drug resistance. Selection markers can be, for example, genes for resistance to blasticidin S, kanamycin, geneticin, etc. In a preferred embodiment, the selectable marker for selecting for drug sensitivity is a blasticidin S resistance gene.

[00161] A typical cccDNA (eg, rAAV0) is produced from the pAAV plasmid. A method for producing an rAAV vector may include: (a) delivering an rAAV plasmid to a host cell as described above, wherein both the host cell and the plasmid do not contain genes encoding a capsid protein, (b) culturing said host cell under conditions , ensuring the production of the cDNA genome; and (c) collecting cells and isolating the AAV genome produced by said cells.

C. Examples of a method for obtaining cDNA vectors from cDNA plasmids

[00162] This document also provides methods for producing capsidless cccDNA vectors, in particular, a method with sufficiently high yield to provide sufficient quantities of vector for in vivo experiments.

[00163] In some embodiments, a method for producing a cccDNA vector includes the following steps: (1) introducing a nucleic acid construct containing an expression cassette and two asymmetric ITR sequences into a host cell (e.g., Sf9 cells), (2) optionally obtaining clonal cell line, for example, using a selectable marker present on a plasmid, (3) introducing a gene encoding Rep (by transfection or infection with a baculovirus carrying the gene) into said insect cell; and (4) cell collection and cDNA vector purification. The nucleic acid construct containing the expression cassette and the two ITR sequences described above to produce a capsidless AAV vector may be in the form of a cfAAV plasmid, or a bacmid or baculovirus derived from a cfAAV plasmid as described below. Said nucleic acid construct can be introduced into a host cell by transfection, viral transduction, stable integration, or other methods known in the art.

D. Cell lines:

[00164] The host cell lines used to produce the cccDNA vector may include insect cell lines derived from Spodoptera frugiperda, such as Sf9, Sf21 cells or Trichoplusia ni cells, or cell lines of other invertebrates, vertebrates or other eukaryotes, including mammalian cells. Other cell lines known to one skilled in the art may also be used, such as HEK293, Huh-7, HeLa, HepG2, HeplA, 911, CHO, COS, MeWo, NIH3T3, A549, HT1080, monocytes, and mature and immature dendritic cells. Host cell lines can be transfected to stably express the cccDNA plasmid to produce a ccDNA vector in high yield.

[00165] CCDNA plasmids can be introduced into Sf9 cells by transient transfection using reagents (eg, liposomes, calcium phosphate) or physical methods (eg, electroporation) known in the art. Alternatively, stable Sf9 cell lines can be generated that stably integrate the cccDNA plasmid into the genome. Such stable cell lines can be created by incorporating a selectable marker into a cccDNA plasmid as described above. If the cccDNA plasmid used to transfect a cell line includes a selectable marker, such as an antibiotic, cells that have been transfected with the ccDNA plasmid and have integrated the ccDNA plasmid into the genome can be selected by adding the antibiotic to the cell growth medium. Stable cell clones can then be isolated using single cell expansion or colony transfer methods and expanded.

E. Isolation and purification of cDNA vectors

[00166] Examples of the method for preparing and isolating cccDNA vectors are presented in FIG. 4A-4E and in the specific examples below. The ccDNA vectors as described herein can be derived from producer cells expressing the AAV Rep protein(s) further transformed with a ccDNA plasmid, a ccDNA bacmid, or a ccDNA baculovirus. Plasmids suitable for the production of cccDNA vectors include those shown in FIG. 8A (suitable for obtaining Rep BIIC), FIG. 8B (plasmid used to produce the cDNA vector).

[00167] In one aspect, the polynucleotide encodes an AAV Rep protein (Rep78 or 68) delivered to the producing cell on a plasmid (Rep-plasmid), bacmid (Rep-bacmid), or baculovirus (Rep-baculovirus). Rep plasmid, Rep bacmid and Rep baculovirus can be produced by the methods described above.

[00168] Methods for producing a cccDNA vector, which is an example of a ccDNA vector, are described herein. Expression constructs used to produce cccDNA vectors of the present invention may be a plasmid (eg, ccDNA plasmids), bacmid (eg, ccDNA-baculovirus), and/or baculovirus (eg, ccDNA-baculovirus). In a non-limiting example, the cDNA vector can be obtained from cells coinfected with cDNA baculovirus and Rep baculovirus. Rep proteins produced from Rep baculovirus can replicate cccDNA baculovirus to produce cccDNA vectors. Alternatively, cccDNA vectors can be prepared from cells stably transfected with constructs containing a sequence encoding a single AAV Rep protein (eg, Rep78, Rep68, or Rep52) delivered in Rep plasmids, Rep bacmids, or Rep baculovirus. The cDNA baculovirus can transiently transfect cells, can be replicated by the Rep protein, and can produce cDNA vectors.

[00169] Permissive insect cells such as Sf9, Sf21, Tni (Trichoplusia ni), High Five cells can be transfected with a bacmid (e.g., cccDNA bacmid), and said bacmid produces a cccDNA baculovirus, which is a recombinant baculovirus comprising sequences containing asymmetric ITRs and an expression cassette. The insect cells can then be infected with the cDNA baculovirus to produce a new generation of recombinant baculovirus. Optionally, this step can be repeated one or more times to obtain more recombinant baculovirus.

[00170] The timing of collection and recovery of the cccDNA vectors described herein from cells can be selected and optimized to ensure that the cccDNA vectors are obtained in high yield. For example, the collection time may be selected based on cell viability, cell morphology, cell growth, and the like. Typically, cells can be harvested after sufficient time has passed after baculovirus infection to produce cDNA vectors (eg, cDNA vectors) but before most cells begin to die due to viral toxicity. CctDNA vectors can be isolated from Sf9 cells using plasmid purification kits such as the ENDO-FREE PLASMID® kits from Qiagen. Other methods developed for plasmid isolation can also be adapted for cDNA vectors. In general, any nucleic acid purification methods known in the art, as well as commercially available DNA extraction kits, can be used.

[00171] Alternatively, purification can be accomplished by alkaline lysis of the cell pellet, centrifuging the resulting lysate, and performing chromatographic separation. As one non-limiting example, this process can be accomplished by loading the supernatant onto an ion exchange column (e.g., SARTOBIND Q®) that retains nucleic acids, followed by elution (e.g., 1.2 M NaCl), and further chromatographic purification on gel filtration column (for example, 6 Fast Flow GE). The capsidless AAV vector is then isolated, for example by sedimentation.

[00172] In some embodiments, cccDNA vectors may also be purified in the form of exosomes, or microparticles. It is known in the art that many cell types release not only soluble proteins, but also complex protein/nucleic acid cargos by shedding membrane microvesicles (Cocucci et al, 2009; EP 10306226.1). Such vesicles include microvesicles (also called microparticles) and exosomes (also called nanovesicles); both the former and the latter contain proteins and RNA as cargo. Microvesicles are formed by direct budding from the plasma membrane, and exosomes are released into the extracellular environment upon fusion of multivesicular endosomes with the plasma membrane. Accordingly, cccDNA vector-containing microvesicles and/or exosomes can be isolated from cells transduced with the ccDNA plasmid, or bacmid, or baculovirus produced using the ccDNA plasmid.

[00173] Microvesicles can be isolated by filtering or ultracentrifuging the culture medium at 20,000 x g, and exosomes at 100,000 x g. The optimal duration of ultracentrifugation can be determined experimentally and depends on the specific cell type from which the vesicles are isolated. Preferably, the culture medium is first cleared by low-speed centrifugation (eg at 2000 x g for 5-20 minutes) and subjected to centrifugation using, for example, an AMICON® spin column (Millipore, Watford, UK). Microvesicles and exosomes can be further purified by FACS or MACS using specific antibodies that recognize specific surface antigens present on microvesicles and exosomes. Other methods for purifying microvesicles and exosomes include, but are not limited to, immunoprecipitation, affinity chromatography, filtration, and magnetic beads coated with specific antibodies or aptamers. After purification, the vesicles are washed, for example, with phosphate-buffered saline. One advantage of using microvesicles or exosomes to deliver cccDNA-containing vesicles is that these vesicles can be targeted to different cell types by incorporating proteins into their membranes that are recognized by specific receptors on the relevant cell types. (see also EP 10306226).

[00174] Another aspect of the present invention relates to methods for purifying cccDNA vectors from host cell lines that have stably integrated the cccDNA construct into the genome. In one embodiment, purified cccDNA vectors are obtained as DNA molecules. In another embodiment, purified cDNA vectors are produced in the form of exosomes or microparticles.

[00175] In FIG. 5 shows a gel confirming the production of cccDNA from several ccDNA plasmid constructs using the method described in the Examples section. The cctDNA is confirmed by a characteristic banding pattern in the gel, as described with reference to FIG. 4D in Examples. Other characteristics of the cccDNA production process and intermediates are summarized in FIG. 6A and 6B and FIG. 7A and 7B, as described in the Examples.

IV. cccDNA vector

[00176] As described herein, methods and compositions that use a single Rep protein are useful for producing a capsidless ccDNA molecule with covalently closed-end (ccDNA) vectors. In some embodiments, these cccDNA vectors can be produced in permissive host cells that contain a single Rep protein and are derived from expression constructs (e.g., ccDNA plasmid, ccDNA bacmid, baculovirus ccDNA, or integrated cell line) containing a heterologous gene (transgene) , located between two inverted terminal repeat (ITR) sequences, where the ITR sequences may be an asymmetric ITR pair or a symmetric or substantially symmetric ITR pair, as those terms are defined herein. A cccDNA vector containing an NLS as described herein may contain ITR sequences that are selected from any of: (i) at least one wild-type (WT) ITR and at least one modified AAV inverted terminal repeat (mod-ITR) (for example, asymmetric modified ITR); (ii) two modified ITRs, wherein the mod-ITR pair has a different three-dimensional spatial organization relative to each other (e.g., asymmetric modified ITRs), or (iii) a symmetric or substantially symmetric WT-WT ITR pair, in which each ITR-WT has the same three-dimensional spatial organization, or (iv) pairs of symmetrical or substantially symmetrical modified ITRs, wherein each mod-ITR has the same three-dimensional spatial organization, wherein the methods of this invention may further include a delivery system, such as, but not limited to, a delivery system based on liposomal nanoparticles.

[00177] The cccDNA vector is preferably duplex, eg, self-complementary, in at least part of the molecule, such as an expression cassette (eg, the ccDNA is not a double-stranded circular molecule). The cDNA vector has covalently closed ends and is thus resistant to digestion by an exonuclease (eg, exonuclease I or exonuclease III), for example, for an hour at 37°C.

[00178] The cctDNA vector produced in accordance with the methods and compositions using a single Rep protein described herein does not have the packaging limitations imposed by limited space within the viral capsid. CCDNA vectors provide a viable eukaryotic-produced alternative to prokaryotic-produced plasmid DNA vectors, as opposed to encapsulated AAV genomes. This allows the insertion of control elements, such as regulatory switches as described herein, large transgenes, multiple transgenes, etc.

[00179] In one embodiment, a cccDNA vector prepared in accordance with the methods and compositions using a single Rep protein described herein comprises, in the 5' to 3' direction: the first inverted terminal repeat (ITR) of an adeno-associated virus ( AAV), a nucleotide sequence of interest (e.g., an expression cassette as described herein), and a second AAV ITR, wherein the first ITR and the second ITR are asymmetric with respect to each other, i.e. they are different from each other. As an exemplary embodiment, the first ITR may be a wild-type ITR, and the second ITR may be a mutated or modified ITR. In some embodiments, the first ITR may be a mutated or modified ITR, and the second ITR may be a wild-type ITR. In another embodiment, the first ITR and the second ITR are both modified, but are different sequences, or have different modifications, or are not identically modified ITRs. In other words, ITRs are asymmetrical in the sense that any changes in one ITR are not reflected in the other ITR; or alternatively if the ITRs are different from each other. Typical examples of asymmetric ITRs in a cDNA vector and for use in making a cDNA plasmid are described below in the section entitled “ITRs”.

[00180] Wild-type or mutated or otherwise modified ITR sequences provided herein are DNA sequences included in an expression construct (eg, ccDNA plasmid, ccDNA bacmid, ccDNA baculovirus) to produce a ccDNA vector. Accordingly, the ITR sequences actually contained in said cccDNA vector produced from a cccDNA plasmid or other expression construct may or may not be identical to the ITR sequences of the present invention due to natural variations occurring during production (e.g., replication error). .

[00181] In some embodiments, a cccDNA vector produced in accordance with the methods and compositions using a single Rep protein described herein comprises a transgene expression cassette, which may be, for example, a regulatory sequence, a nucleic acid coding sequence (eg, such as a miR or antisense sequence), or a polypeptide coding sequence (eg, such as a transgene). In one embodiment, the transgene may be operably linked to one or more regulatory sequences that provide or control expression of the transgene. In one embodiment, said polynucleotide comprises a first ITR sequence and a second ITR sequence, wherein the nucleotide sequence of interest is flanked by the first and second ITR sequences, and the first and second ITR sequences are asymmetric to each other.

[00182] In one embodiment, in each of these aspects, the expression cassette is located between two ITRs that contain, in the following order, together with one or more of the following: a promoter operably linked to the transgene, a post-transcriptional regulatory element; and polyadenylation and termination signal. In one embodiment, the promoter is regulated - inducible or repressible. A promoter can be any sequence that facilitates transcription of a transgene. In one embodiment, said promoter is a CAG promoter (eg, SEQ ID NO: 03) or a variant thereof. Said post-transcriptional regulatory element is a sequence that modulates the expression of a transgene, in a non-limiting example, any sequence forming a tertiary structure that enhances the expression of a transgene.

[00183] In one embodiment, said post-transcriptional regulatory element comprises a WPRE (eg, SEQ ID NO: 08). In one embodiment, said polyadenylation and termination signal comprises poly(A) BGH (eg, SEQ ID NO: 09). Additionally, any cis-regulatory element known in the art, or a combination thereof, can be used, for example, the SV40 late polyadenylation signal 5' enhancer sequence (USE) or other post-transcriptional processing elements, including, but not limited to, the gene thymidine kinase of herpes simplex virus or hepatitis B virus (HBV). In one embodiment, the length of the expression cassette in the 5'-3' direction is greater than the known maximum length of sequence enclosed in the AAV virion capsid. In one embodiment, said length is greater than 4.6 kb, or greater than 5 kb, or greater than 6 kb, or greater than 7 kb. Various examples of expression cassettes are presented herein.

[00184] Said expression cassette in a cccDNA vector prepared in accordance with the methods and compositions using a single Rep protein described herein may contain more than 4000 nucleotides, 5000 nucleotides, 10000 nucleotides or 20000 nucleotides, or 30000 nucleotides, or 40000 nucleotides , or 50,000 nucleotides, or any range between about 4,000-10,000 nucleotides, or 10,000-50,000 nucleotides, or greater than 50,000 nucleotides. In some embodiments, the expression cassette may comprise a transgene or nucleic acid having a length ranging from 500 to 50,000 nucleotides. In some embodiments, the expression cassette may comprise a transgene or nucleic acid having a length ranging from 500 to 75,000 nucleotides. In some embodiments, the expression cassette may comprise a transgene or nucleic acid having a length ranging from 500 to 10,000 nucleotides. In some embodiments, the expression cassette may comprise a transgene or nucleic acid having a length in the range of 1000 to 10,000 nucleotides. In some embodiments, the expression cassette may comprise a transgene or nucleic acid having a length in the range of 500 to 5000 nucleotides. These cccDNA vectors do not have the size restrictions characteristic of capsid-enclosed AAV vectors, which allows delivery of a significant size expression cassette to ensure efficient transgene expression. In some embodiments, the cDNA vector does not contain prokaryote-specific methylation.

[00185] In some embodiments, an expression cassette in a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein may also comprise an internal ribosome entry site (IRES) and/or a 2A element. Cis-regulatory elements include, but are not limited to, a promoter, a riboswitch, an insulator, a miR-regulated element, a post-transcriptional regulatory element, a tissue-specific and cell-specific promoter, and an enhancer. In some embodiments, the ITR may act as a promoter for a transgene. In some embodiments, said cccDNA vector contains additional components for regulating the expression of said transgene, for example, one or more regulatory switches, which are described herein in the "Regulatory Switches" section, for controlling and regulating the expression of said transgene, and may comprise, at necessary, a regulatory switch that provides a “safety switch” to allow controlled death of the cell containing the cccDNA vector.

[00186] In FIG. 1A-1C are schematic representations of non-limiting exemplary examples of cDNA vectors, or the corresponding sequence of cDNA plasmids. CccDNA vectors are capsidless and can be derived from a plasmid encoding, in this order: a first ITR, an expressed transgene cassette, and a second ITR, wherein at least one of the first and/or second ITR sequences is mutated relative to the corresponding wild-type AAV2 ITR sequence . Said expressed transgene cassette preferably includes, in that order, one or more of the following: an enhancer/promoter, an ORF reporter (transgene), a post-transcriptional regulatory element (e.g., WPRE), and a polyadenylation and termination signal (e.g., poly(A) BGH).

[00187] An expression cassette in a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein may contain any transgene of interest. Transgenes of interest include, but are not limited to, polypeptide-encoding nucleic acids or non-coding nucleic acids (e.g., RNAi, miR, etc.), preferably therapeutic (e.g., for medical, diagnostic, or veterinary purposes) or immunogenic polypeptides (for example, for vaccines) polypeptides. In some embodiments, the transgenes in the expression cassette encode one or more polypeptides, peptides, ribozymes, peptide nucleic acids, siRNA, RNAi, antisense oligonucleotides, antisense polynucleotides, antibodies, antigen binding fragments, or any combination thereof. In some embodiments, the transgene is a therapeutic gene or marker protein. In some embodiments, the transgene is an agonist or antagonist. In some embodiments, said antagonist is an antibody mimetic or antibody fragment, or an antigen-binding fragment thereof, e.g., a neutralizing antibody or antibody fragment, or the like. In some embodiments, the transgene encodes an antibody, including a full-length antibody or antibody fragment as defined herein. In some embodiments, the antibody is an antigen binding domain or an immunoglobulin variable domain sequence as defined herein.

[00188] In particular, the transgene may encode one or more therapeutic agents, including, but not limited to, protein(s), polypeptide(s), peptide(s), enzyme(s), antibodies, antigen-binding fragments, as well as variants and/or active fragments thereof, for use in the treatment, prevention and/or alleviation of one or more symptoms of diseases, dysfunctions, injuries and/or disorders. Examples of transgenes are described herein in the section entitled "Method of Treatment".

[00189] There are many structural features of cccDNA vectors produced in accordance with methods and compositions using a single Rep protein as disclosed herein that distinguish them from plasmid-based expression vectors. CccDNA vectors may have one or more of the following characteristics: the absence of original (i.e., not inserted) bacterial DNA, the absence of a prokaryotic origin of replication, autonomy, i.e., they do not require any sequences other than two ITRs, including Rep binding sites and terminal resolution sites (RBS and TRS), and exogenous sequence between ITRs, the presence of ITR sequences that form hairpins are of eukaryotic origin (i.e., they are produced in eukaryotic cells), and the absence of bacterial-type DNA methylation or , essentially any other methylation perceived as abnormal by the mammalian host. In general, it is preferred that the present vectors do not contain any prokaryotic DNA, but it is possible to insert some prokaryotic DNA as an exogenous sequence, by way of non-limiting example, in a promoter or enhancer region. Another important feature that distinguishes cccDNA vectors from plasmid expression vectors is that cccDNA vectors are single-stranded linear DNA with closed ends, while plasmids are always double-stranded DNA.

[00190] CctDNA vectors prepared in accordance with methods and compositions using a single Rep protein as disclosed herein preferably have a linear and continuous structure rather than a discontinuous structure, as determined by a restriction enzyme digestion assay (Figure 4D) . A linear and continuous structure is thought to be more resistant to attack by cellular endonucleases and is also less likely to undergo recombination and cause mutagenesis. Accordingly, a cccDNA vector having a linear and continuous structure is a preferred embodiment. A continuous linear single-stranded cccDNA vector with an intramolecular duplex can have covalently linked ends without AAV capsid protein coding sequences. These cDNA plasmids are structurally different from plasmids (including the cDNA plasmids described herein), which are circular duplex nucleic acid molecules of bacterial origin. The complementary strands of plasmids can be separated after denaturation to produce two nucleic acid molecules, while, on the contrary, cccDNA vectors containing complementary strands are represented by a single DNA molecule and, accordingly, even after denaturation remain as a single molecule. In some embodiments, cccDNA vectors, as described herein, can be produced without prokaryotic DNA base methylation, unlike plasmids. Accordingly, cccDNA vectors and ccDNA plasmids differ both in structure (in particular, linear or circular), and in the methods used to obtain and purify these different objects (see below), as well as in the nature of DNA methylation, which occurs in a prokaryotic manner in cDNA plasmids and in the eukaryotic type in the cDNA vector.

[00191] Several advantages of using a cccDNA vector as described herein over plasmid-based expression vectors include, but are not limited to: 1) plasmids contain bacterial DNA sequences and are subject to specific prokaryotic methylation, e.g. 6-methyladenosine and 5-methylcytosine, whereas the capsid-free sequences of the AAV vector are of eukaryotic origin and are not subject to specific prokaryotic methylation; as a result, capsidless AAV vectors will be less likely to induce inflammatory and immune responses compared to plasmids; 2) if plasmids require the presence of a resistance gene during production, then ccDNA vectors do not; 3) if the circular plasmid is not delivered to the nucleus when introduced into the cell and requires an excess load to avoid degradation by cellular nucleases, then ccDNA vectors contain viral cis-elements, i.e. ITRs confer nuclease resistance and can be engineered to target and deliver to the nucleus. It has been proposed that the minimum defining elements required for ITR function are the Rep binding site (RBS; 5'-GCGCGCTCGCTCGCTC-3' (SEQ ID NO: 531) for AAV2) and the terminal resolution site (TRS; 5'-AGTTGG- 3' (SEQ ID NO: 48) for AAV2), plus a variable palindromic hairpin sequence; and 4) cccDNA vectors do not exhibit the common overrepresentation of CpG dinucleotides found in prokaryotic-derived plasmids, which have been shown to bind to a member of the Toll-like receptor family to elicit a T cell-mediated immune response. In contrast, transduction with capsidless AAV vectors as described herein can effectively target cell and tissue types that are difficult to transduce with standard AAV virions using different delivery reagents.

V. ITR

[00192] A cccDNA vector prepared in accordance with methods and compositions using a single Rep protein as disclosed herein contains a heterologous gene located between two inverted terminal repeat (ITR) sequences that are different from each other (i.e. are asymmetric ITRs). In some embodiments, at least one of the ITRs is modified by deletion, insertion, and/or substitution relative to the wild-type ITR sequence (eg, AAV ITR); and at least one of the ITRs contains a functional Rep binding site (RBS; e.g., 5'-GCGCGCTCGCTCGCTC-3' for AAV2, SEQ ID NO: 531) and a functional terminal resolution site (TRS; e.g., 5'-AGTT-3' SEQ ID NO: 46.) In one embodiment, at least one of the ITRs is a non-functional ITR. In one embodiment, not each of the different or modified ITRs is a wild-type ITR from different serotypes.

[00193] Although the ITRs given for illustration herein in the Description and Examples are the AAV2 ITRs, one skilled in the art will recognize that, as stated above, ITRs from any known parvovirus, for example a dependovirus, such as AAV (e.g., from the genome of AAV1, AAV2, AAV3, AAV4, AAV5, AAV 5, AAV7, AAV8, AAV9, AAV10, AAV 11, AAV12, AAVrh8, AAVrh10, AAV-DJ, and AAV-DJ8. For example, NCBI: NC 002077 ; NC 001401; NC001729; NC001829; NC006152; NC 006260; NC 006261), chimeric ITRs or ITRs from any synthetic AAV. In some embodiments, the AAV is capable of infecting warm-blooded animals, such as avian adeno-associated viruses (AAAV), bovine adeno-associated virus (BAAV), canine, equine, and sheep. In some embodiments, the ITR is derived from parvovirus B19 (GenBank accession number: NC 000883), mouse small virus (MVM) (GenBank accession number NC 001510); goose parvovirus (GenBank accession number NC 001701); snake parvovirus 1 (GenBank accession number NC 006148).

[00194] In some embodiments, said ITR sequence in a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein may be from viruses of the Parvoviridae family, which includes two subfamilies: Parvovirinae, which infect vertebrates, and Densovirinae, which infect insects. The subfamily Parvovirinae (called parvoviruses) includes the genus Dependovirus, members of which, in most cases, require coinfection with a helper virus, such as adenovirus or herpes virus, for productive infection. The genus Dependovirus includes adeno-associated virus (AAV), which commonly infects humans (e.g., serotypes 2, 3A, 3B, 5, and 6) or primates (e.g., serotypes 1 and 4), and related viruses that infect other warm-blooded animals (e.g. adeno-associated viruses of cattle, canines, horses, sheep). For a general description of parvoviruses and other members of the family Parvoviridae, see Kenneth I. Berns, "Parvoviridae: The Viruses and Their Replication," chapter 69 of FIELDS VIROLOGY (3rd edition, 1996).

[00195] One skilled in the art will recognize that ITR sequences have a general structure containing a double-stranded Holliday structure, which is typically a T-shaped or Y-shaped hairpin structure (see, for example, FIG. 2A and FIG. 3A), with each ITR formed by two palindromic arms or loops (B-B' and C-C') embedded in a larger palindromic arm (A-A'), and a single-stranded sequence D (the order of these palindromic sequences determining the orientation of the ITR ), and accordingly, appropriate modified ITR sequences from any AAV serotype can be easily determined for use in a ccDNA vector or ccDNA plasmid based on the representative AAV2 ITR sequences provided herein. See, for example, for a description of the structural analysis and comparison of ITR sequences from different AAV serotypes (AAV1-AAV6) in Grimm et al., J. Virology, 2006; 80(1); 426-439; Yan et al., J. Virology, 2005; 364-379; Duan et al., Virology 1999; 261; 8-14.

[00196] Specific changes and mutations in ITRs are described in detail herein, but in the context of "altered" or "mutated" or "modified" ITRs, these definitions indicate that nucleotides have been inserted, deleted and/or substituted relative to those belonging to wild type, reference or original ITR sequence, and may be modified relative to another flanking ITR in a ccDNA vector having two flanking ITRs. The altered or mutated ITR may be an engineered ITR. In this document, “constructed” refers to an aspect that is subject to human manipulation. For example, a polypeptide is considered "recombinant" when at least one aspect of the polypeptide, such as its sequence, has been manipulated by humans to be different from the aspect in which it exists in nature.

[00197] In some embodiments, the ITR in a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein may be synthetic. In one embodiment, the synthetic ITR is based on ITR sequences from more than one AAV serotype. In another embodiment, the synthetic ITR does not include AAV-based sequences. In yet another embodiment, the synthetic ITR retains the ITR structure described above, although it contains only part or no AAV-derived sequence. In some aspects, the synthetic ITR may interact preferentially with wild-type Rep or with Rep of a particular serotype, or, in some cases, will not be recognized by wild-type Rep and will be recognized only by mutated Rep.

[00198] ITR sequences are uniformly arranged and contain a double-stranded Holliday structure, which is typically a T-shaped or Y-shaped hairpin structure (see, for example, Fig. 2A and Fig. 3A), with each ITR formed by two palindromic arms or loops (B-B' and C-C') embedded in a larger palindromic arm (A-A'), and a single-stranded sequence D (where the order of said palindromic sequences determines the direction of ITR orientation). One of ordinary skill in the art can readily determine ITR or modified ITR sequences from any AAV serotype for use in a ccDNA vector or ccDNA plasmid based on the example AAV2 ITR sequences provided herein. See, for example, comparison of ITR sequences from different AAV serotypes (AAV1-AAV6 and avian AAV (AAAV) and bovine AAV (BAAV)) described in Grimm et al., J. Virology, 2006; 80(1); 426-439; where the % identity of the left ITR of AAV2 and the left ITRs from other serotypes are given: AAV-1 (84%), AAV-3 (86%), AAV-4 (79%), AAV-5 (58%) AAV-6 (left ITR) (100%) and AAV-6 (right ITR) (82%).

[00199] Accordingly, while AAV2 ITRs are used as exemplary ITRs in a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein, a cccDNA vector can be prepared with the ITRs of any known AAV serotype or based thereon, including, for example, AAV serotype 1 (AAV1), AAV serotype 2 (AAV2), AAV serotype 4 (AAV4), AAV serotype 5 (AAV5), AAV serotype 6 (AAV6), AAV serotype 7 (AAV7) , AAV serotype 8 (AAV8), AAV serotype 9 (AAV9), AAV serotype 10 (AAV10), AAV serotype 11 (AAV11), or AAV serotype 12 (AAV12). One skilled in the art will be able to determine the corresponding sequence in other serotypes by known methods. For example, by determining whether the change is in region A, A', B, B', C, C', or D, and identifying the corresponding region in a different serotype. BLAST® (Basic Local Alignment Search Tool) or other homology alignment programs can be used with default settings to determine the corresponding sequence. The present invention also provides populations and sets of cccDNA vectors containing ITRs from a combination of different AAV serotypes - that is, one ITR can be taken from one AAV serotype and another ITR can be taken from a different serotype. Without being bound by any theory, in one embodiment, one ITR may be taken from or based on an AAV2 ITR sequence, and the other cDNA vector ITR may be taken from or be based on any one or more AAV ITR sequences serotype 1 (AAV1), AAV serotype 4 (AAV4), AAV serotype 5 (AAV5), AAV serotype 6 (AAV6), AAV serotype 7 (AAV7), AAV serotype 8 (AAV8), AAV serotype 9 (AAV9), AAV serotype 10 (AAV10), AAV serotype 11 (AAV11), or AAV serotype 12 (AAV12).

[00200] Any parvovirus ITR can be used as an ITR or as a base ITR for modification. Preferably, said parvovirus is a dependovirus. More preferably, said parvovirus is AAV. Serotype selection may be based on tissue tropism of the serotype. AAV2 has tropism for a wide range of tissues, AAV1 predominantly targets neural tissue and skeletal muscle, and AAV5 predominantly targets neural tissue, retinal pigmented epithelium and photoreceptors. AAV6 predominantly targets skeletal muscle and lungs. AAV8 predominantly targets the liver, skeletal muscle, heart, and pancreatic tissue. AAV9 is predominantly targeted to the liver, skeletal muscle, and lung tissue. In one embodiment, the modified ITR is based on the AAV2 ITR. For example, it is selected from the group consisting of: SEQ ID NO: 2 and SEQ ID NO: 52. In one embodiment of each of these aspects, the vector polynucleotide comprises a pair of ITRs selected from the group consisting of: SEQ ID NO: 1 and SEQ ID NO: 52; and SEQ ID NO: 2 and SEQ ID NO: 51. In one embodiment of each of these aspects, the vector polynucleotide or non-viral, non-capsid DNA vectors with covalently closed ends comprise a pair of different ITRs selected from the group consisting of: SEQ ID NO: 101 and SEQ ID NO. : 102; SEQ ID NO: 103 and SEQ ID NO: 104, SEQ ID NO: 105 and SEQ ID NO: 106; SEQ ID NO: 107 and SEQ ID NO: 108; SEQ ID NO: 109 and SEQ ID NO: 110; SEQ ID NO: 111 and SEQ ID NO: 112; SEQ ID NO: 113 and SEQ ID NO: 114; and SEQ ID NO: 115 and SEQ ID NO: 116. In some embodiments, the modified ITR is selected from any of the ITR or partial ITR sequences of SEQ ID NO: 2, 52, 63, 64, 101-499, or 545-547.

[00201] In some embodiments, a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein may contain an ITR with a modification in the ITR corresponding to any of the modifications in the ITR sequences or partial ITR sequences, presented in any one or more of tables 2, 3, 4, 5, 6, 7, 8, 9, 10A and 10B of this document, or the sequences presented in Fig. 26A or 26B.

[00202] In some embodiments, a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein may form an intramolecular duplex secondary structure. In a non-limiting example, the secondary structure of the first ITR and the asymmetric second ITR is presented in the context of wild-type ITR (see, e.g., Figures 2A, 3A, 3C) and/or modified ITR structures (see, e.g., Figure 2B and Figure 3B , 3D). Secondary structures are inferred or predicted based on the ITR sequences of the plasmid used to generate the cccDNA vector. Exemplary secondary structures of modified ITRs in which part of the stem-loop structure has been removed are shown in FIG. 9A-25B and FIG. 26A-26B and are also shown in Tables 10A and 10B. Typical secondary structures of modified ITRs containing a single stem and two loops are shown in Fig. 9A-13B. An exemplary secondary structure of a modified one-stem, one-loop ITR is shown in FIG. 14. In some embodiments, said secondary structure can be inferred, as shown herein, using thermodynamic methods based on nearest neighbor rules, which predict structure stability as quantified by changes in folding free energy. For example, the specified structure can be predicted by finding the structure with the lowest free energy. In some embodiments, the algorithm described in Reuter, J. S., & Mathews, D. H. (2010) RNAstructure: software for RNA secondary structure prediction and analysis can be used to predict ITR structure. BMC Bioinformatics. 11, 129, and implemented in the RNAstructure software (available on the Internet at: “rna.urmc.rochester.edu/RNAstructureWeb/index.html”). This algorithm can also include both free energy change parameters at 37°C and enthalpy change parameters obtained from the experimental literature, which allows predicting conformational stability at an arbitrary temperature. Using RNA structure analysis software, some of the modified ITR structures can be predicted as modified T-shaped loop-on-stem structures with the estimated Gibbs free energy (ΔG) for unfolding under physiological conditions presented in FIG. 3A-3D. Using RNA structure analysis software, three types of modified ITRs are predicted to have a higher Gibbs free energy for unfolding than the wild-type AAV2 ITR (−92.9 kcal/mol); these ITRs are as follows: (a) modified ITRs with a single arm/single unpaired loop structure according to the present invention, predicted to have a Gibbs free energy for unfolding in the range of -85 to -70 kcal/mol. (b) the modified ITRs having a single hairpin structure described herein are predicted to have a Gibbs free energy for unfolding in the range of -70 to -40 kcal/mol. (c) The modified ITRs having the two-arm structure described herein are predicted to have a Gibbs free energy for unfolding in the range of -90 to -70 kcal/mol. Without wishing to be bound by any theory, structures with a higher Gibbs free energy will be more easily unfolded for replication by the Rep 68 or Rep 78 replication proteins. Thus, modified ITRs having a higher Gibbs free energy for unfolding - for example, a single-arm structure single unpaired loop, single hairpin structure, truncated structure - show a tendency to replicate more efficiently than the wild type ITR.

[00203] In one embodiment, the left ITR of a cccDNA vector prepared in accordance with methods and compositions using a single Rep protein as disclosed herein is modified or mutated from the wild type (wt) AAV ITR structure, and the right ITR is wild type AAV ITR. In one embodiment, the right ITR of the cccDNA vector is modified relative to the structure of the wild-type AAV ITR, and the left ITR is symmetrical (reverse complementary) to it and contains the same mutations. In such an embodiment, a modification of the ITR (eg, left or right ITR) can be achieved by deletion, insertion, or substitution of one or more nucleotides of a wild-type ITR derived from the AAV genome.

[00204] The ITRs used in this invention can be resolvable or non-resolvable, and the ITRs selected for use in cDNA vectors are preferably AAV sequences, with sequences from serotypes 1, 2, 3, 4, 5, 6, 7, 8 being preferred and 9. The permitted AAV ITRs are not necessarily represented by the wild-type ITR sequence (e.g., the endogenous AAV ITR sequence or the wild-type AAV ITR sequence may be altered by insertion, deletion, truncation, and/or introduction of missense mutations), provided that the specified terminal the repeat mediates required functions, such as replication, packaging, virus integration and/or provirus rescue, etc. Typically, but not necessarily, the ITRs are from the same AAV serotype, for example, both ITR sequences of a cccDNA vector are from AAV2. ITRs can be synthetic sequences that function as AAV inverted terminal repeats, such as the “double D sequence” as described in US Pat. No. No. 5478745, Samulski et al. Although not required, ITRs can be from the same parvovirus, for example both ITR sequences are derived from AAV2.

[00205] In one embodiment, the cccDNA produced in accordance with the methods and compositions using a single Rep protein as disclosed herein may include an ITR structure that is mutated relative to one of the wild type ITRs as disclosed herein, however the mutated or modified ITR retains a functional Rep binding site (RBE or RBE') and a terminal resolution site (trs). In one embodiment, the mutated ITR cDNA includes a functional replication protein site (RPS-1) and is produced using a replication competent protein that binds the RPS-1 site.

[00206] In one embodiment, at least one of the ITRs in a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein is a defective ITR for Rep binding and/or replication. According to one implementation option, the specified defect is represented by at least 30%, according to other implementation options - at least 35%..., 50%..., 65%..., 75%..., 85%... , 90%..., 95%..., 98%..., lack of function relative to the wild-type ITR or its complete absence, or lack of function corresponding to any intermediate value. The host cells do not express viral capsid proteins and the polynucleotide vector template does not contain any viral capsid coding sequences. In one embodiment, said polynucleotide vector templates and host cells that do not contain AAV capsid genes and resulting protein also do not encode or express capsid genes of other viruses. In addition, in a particular embodiment, said nucleic acid molecule also does not contain sequences encoding the AAV Rep protein.

[00207] In some embodiments, the ITR structural element can be any structural element that is involved in the functional interaction of the ITR with a single large Rep protein (eg, Rep 78 or Rep 68). In some embodiments, the structural element provides selectivity for the interaction of the ITR with a single large Rep protein, i.e., determines at least in part which Rep protein functionally interacts with the ITR. In other embodiments, said structural element physically interacts with a single large Rep protein upon binding of said Rep protein to the ITR. Each structural element may be, for example, an ITR secondary structure, an ITR nucleotide sequence, an intermediate sequence between two or more elements; or a combination of any of the above. In one embodiment, said structural elements are selected from the group consisting of arm A and arm A', arm B and arm B', arm C and arm C', arm D, Rep binding site (RBE) and RBE' (i.e. sequence complementary to the RBE) and a terminal resolution site (trs).

[00208] More specifically, the ability of an ITR structural element in a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein to operably interact with a particular single Rep protein, e.g., a large Rep protein or a small Rep protein , can be changed by changing the structural element. For example, the nucleotide sequence of the structural element may be modified compared to the wild-type ITR sequence. In one embodiment, the structural element (e.g., arm A, arm A', arm B, arm B', arm C, arm C', arm D, RBE, RBE', and trs) of the ITR may be removed and replaced with a wild-type structural element from another parvovirus. For example, the replacement structure may be taken from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, snake parvovirus (eg, royal python parvovirus), bovine parvovirus, parvovirus goat, avian parvovirus, canine parvovirus, equine parvovirus, shrimp parvovirus, porcine parvovirus or insect AAV. For example, the ITR may be an AAV2 ITR, and the A or A' arm or RBE may be replaced by a structural element from AAV5. In another example, the ITR may be the AAV5 ITR, and the C or C' arms, RBE and trs may be replaced by a structural element from AAV2. In another example, the AAV ITR may be an AAV5 ITR in which arms B and B' are replaced by arms B and B' of the AAV2 ITR.

[00209] By way of example only, Table 1 shows exemplary modifications of at least one nucleotide (e.g., deletion, insertion, and/or substitution) in modified ITR regions, wherein X indicates modification of at least one nucleic acid (e.g., deletion, insertion and/or substitution) in the indicated region relative to the corresponding wild-type ITR. In some embodiments, any modification of at least one nucleotide (e.g., deletion, insertion, and/or substitution) in any of regions C and/or C' and/or B and/or B' retains three consecutive nucleotides T ( i.e. TTT) in at least one terminal loop. For example, if the specified modification results in any of: an ITR with a single arm (for example, a single C-C' arm or a single B-B' arm), or a modified C-B' arm or a C'-B arm, or an ITR with two arms comprising at least one truncated arm (e.g., a truncated arm C-C' and/or a truncated arm B-B'), then in at least said single arm, or in at least one of the ITR arms with two arms (at of which one arm may be truncated) three consecutive T nucleotides (i.e. TTT) are retained in at least one terminal loop. In some embodiments, the C-C' truncated arm and/or the B-B' truncated arm contains three consecutive T nucleotides (ie, TTT) in the terminal loop.

Table 1: Examples of combinations of modifications to at least one nucleotide (e.g., deletion, insertion, and/or substitution) in different regions or arms B-B' and C-C' of the ITR (X indicates a nucleotide modification, e.g., addition, deletion, or substitution of at least one nucleotide in the indicated region).

Section B Section B' Section C Section C' X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X

[00210] In some embodiments, a modified ITR for use in a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein may contain any of the combinations of modifications presented in Table 1, and also modification by at least one nucleotide in any one or more regions selected from: the region between A' and C, between C and C', between C' and B, between B and B', and between B' and A. In some embodiments, when any modification of at least one nucleotide (eg, deletion, insertion and/or substitution) in region C or C' or B or B' still retains the terminal loop of the stem-loop structure. In some embodiments, any modification of at least one nucleotide (e.g., deletion, insertion, and/or substitution) between C and C' and/or B and B' preserves three consecutive T nucleotides (i.e., TTT) of at least at least in one terminal loop. In alternative embodiments, any modification of at least one nucleotide (e.g., deletion, insertion, and/or substitution) between C and C' and/or B and B' preserves three consecutive "A" (i.e., AAA) nucleotides at least in one terminal loop. In some embodiments, a modified ITR for use in a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein may contain any one of the combinations of modifications presented in Table 1, as well as a modification of at least single nucleotide (e.g., deletion, insertion, and/or substitution) at any of one or more regions selected from: A', A, and/or D. For example, in some embodiments, a modified ITR for use herein may comprise any of combinations of modifications presented in Table 1, as well as modification of at least one nucleotide (e.g., deletion, insertion, and/or substitution) in region A. In some embodiments, a modified ITR for use in a cccDNA vector prepared in accordance with the methods and compositions using a single Rep protein as disclosed herein, may contain any of the combinations of modifications presented in Table 1, as well as a modification of at least one nucleotide (eg, deletion, insertion and/or substitution) in the A' region. In some embodiments, a modified ITR for use herein may comprise any of the combinations of modifications presented in Table 1, as well as modification of at least one nucleotide (e.g., deletion, insertion, and/or substitution) in the A and/or A' region . In some embodiments, a modified ITR for use herein may comprise any of the combinations of modifications presented in Table 1, as well as a modification of at least one nucleotide (e.g., deletion, insertion, and/or substitution) in region D.

[00211] In one embodiment, the nucleotide sequence of the building block may be modified (e.g., by modifying 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 , 17, 18, 19, or 20 or more nucleotides, or any number of nucleotides in between) to produce a modified structural element. In one embodiment, specific ITR modifications in a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein are exemplified herein (e.g., SEQ ID NO: 2, 52, 63, 64, 101- 499, or 545-547). In some embodiments, the ITR in a cccDNA vector prepared in accordance with methods and compositions using a single Rep protein as disclosed herein may be modified (e.g., by modifying 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more nucleotides, or any number of nucleotides in between). In other embodiments, the ITR in a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein may be at least 80%, at least 85%, at least 90%, at least at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity with one of the modified ITR SEQ ID NOS: 469-499 or 545-547, or RBE-containing section of arm A-A' and arms C-C' and B-B' SEQ ID NO: 101-134 or 545-547.

[00212] In some embodiments, a modified ITR in a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein may, for example, include deleting or deleting a particular arm entirely, such as complete or partial deletion or deletion of arm A-A', or complete or partial deletion or deletion of arm B-B', or complete or partial deletion or deletion of arm C-C', or alternatively deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs forming a stem loop, as long as the resulting loop that terminates the stem (e.g., a single arm) is retained (e.g., see ITR-6). In some embodiments, the modified ITR may include removing 1, 2, 3, 4, 5, 6, 7, 8, 9, or more base pairs from the B-B' arm. In some embodiments, the modified ITR may include removing 1, 2, 3, 4, 5, 6, 7, 8, 9, or more base pairs from the C-C' arm. In some embodiments, the modified ITR may include deleting 1, 2, 3, 4, 5, 6, 7, 8, 9, or more base pairs from the C-C' arm and deleting 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs from arm B-B'. Any combination of base pair deletions is possible, for example, 6 base pairs may be deleted in the C-C' arm and 2 base pairs in the B-B' arm. As an illustrative example, FIG. 13A-13B show an example of a modified ITR with a deletion of at least 7 base pairs from each of part C and part C', a nucleotide substitution in the loop between region C and C', and a deletion of at least one base pair from each of region B and section B', such that the modified ITR contains two arms, at least one of which (eg, C-C') is truncated. Note that in this example, since the modified ITR contains at least one base pair deletion in each of the B and B' regions, the B-B' arm is also truncated compared to the WT ITR.

[00213] In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, or more complementary base pairs are removed from both the C portion and the C' portion of the C-C' arm, such such that the C-C' arm becomes truncated. In other words, when a base is removed from the C portion of the C-C' arm, the complementary base pair is removed from the C' portion, thereby truncating the C-C' arm. In such embodiments, 2, 4, 6, 8, or more base pairs are removed from the C-C' arm such that the C-C' arm is truncated. In alternative embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs are removed from the C portion of the C-C' arm such that only the C' portion of the arm is retained. Alternative embodiments remove 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs from the C' portion of the C-C' arm such that only the C portion of the arm is retained.

[00214] In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, or more complementary base pairs are removed from both the B portion and the B' portion of the B-B' arm such that arm B-B' becomes truncated. In other words, when a base is removed from the B portion of the B-B' arm, the complementary base pair is removed from the B' portion, thereby truncating the B-B' arm. Such embodiments remove 2, 4, 6, 8, or more base pairs from the B-B' arm such that the B-B' arm is truncated. Alternative embodiments remove 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs from the B portion of the B-B' arm such that only the B portion of the arm is retained. Alternative embodiments remove 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs from the B' portion of the B-B' arm such that only the B portion of the arm is retained.

[00215] In some embodiments, a modified ITR in a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein may contain from 1 to 50 (e.g., 1, 2, 3, 4, 5 , 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 , 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotide deletions relative to the full-length wild-type ITR sequence. In some embodiments, the modified ITR may contain from 1 to 30 nucleotide deletions relative to the full-length WT ITR sequence. In some embodiments, the modified ITR contains 2 to 20 nucleotide deletions relative to the full-length wild-type ITR sequence.

[00216] In some embodiments, the modified ITR forms two opposing, longitudinally symmetrical "loops-on-stem", eg, the C-C' loop has a different length than the B-B' loop. In some embodiments, one of the opposed longitudinally symmetrical stem-loops of the modified ITR comprises a C-C' and/or B-B' stem portion with a length ranging from 8 to 10 base pairs, and a loop portion (e.g., between C-C' or between B -B'), which contains from 2 to 5 unpaired deoxyribonucleotides. In some embodiments, one of the longitudinally symmetrical stem-loops of the modified ITR comprises a C-C' and/or B-B' stem portion less than 8 or less than 7, 6, 5, 4, 3, 2, 1 base pairs in length and a loop portion ( for example, between C-C' or between B-B'), which contains 0-5 nucleotides. In some embodiments, the modified longitudinally asymmetric stem-loop ITR comprises a C-C' and/or B-B' stem portion less than 3 base pairs in length.

[00217] In some embodiments, the modified ITR in a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein does not contain any nucleotide deletions in the RBE-containing portion of the A or A' regions, so as not to interfere with DNA replication (for example, binding to the RBE of the Rep protein or nicking at the end resolution site). In some embodiments, a modified ITR in a cccDNA vector prepared in accordance with methods and compositions using a single Rep protein as disclosed herein contains one or more deletions in the B, B', C, and/or C region as described herein . Several non-limiting examples of modified ITRs are shown in FIG. 9A-26B.

[00218] In some embodiments, the modified ITR in a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein may include deletion of the B-B' arm such that the C-C' arm remains, e.g. see typical ITR-2 (left) and ITR-2 (right) shown in FIG. 9A-9B, and ITR-4 (left) and ITR-4 (right) (FIGS. 11A-11B). In some embodiments, the modified ITR may include a deletion of the C-C' arm, thereby retaining the B-B' arm, for example, see the typical ITR-3 (left) and ITR-3 (right) shown in FIG. 10A-10B. In some embodiments, the modified ITR may include a deletion of the B-B' arm and the C-C' arm such that a single stem-loop is retained, e.g., see typical ITR-6 (left) and ITR-6 (right), shown in Fig. 14A-14B, and ITR-21 (left) and ITR-37 (right). In some embodiments, the modified ITR in a cccDNA vector prepared in accordance with methods and compositions using a single Rep protein as disclosed herein may include deletion of the C' region so that a truncated C-loop and B-B' arm are left. for example, see the typical ITR-1 (left) and ITR-1 (right) shown in FIG. 15A-15B. Likewise, in some embodiments, the modified ITR may contain a deletion of the C region such that a truncated C' loop and B-B' arm remains, for example, see the typical ITR-5 (left) and ITR-5 (right) shown in Fig. 16A-16B.

[00219] In some embodiments, a modified ITR in a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein may include a base pair deletion in any one or more of: the C portion, the C' portion -part, B-part or B'-part, so that between the C-B' parts and the C'-B parts, complementary base pairing occurs to produce a single arm, for example, see ITR-10 (right) and ITR-10 ( left) (Fig. 12A-12B).

[00220] In some embodiments, along with modification at one or more nucleotides in the C, C', B, and/or B' region, the modified ITR for use in a cccDNA vector prepared in accordance with methods and compositions using a single Rep protein, as disclosed herein, may comprise a modification (e.g., deletion, substitution, or addition) of at least 1, 2, 3, 4, 5, 6 nucleotides in any one or more regions selected from: the region between A' and C, between C and C', between C' and B, between B and B', and between B' and A. For example, nucleotide A between B' and C in a modified right-handed ITR may be replaced by G, C, or A, or deleted, or one or more nucleotides may be added; the T nucleotide between C' and B in the modified left ITR may be replaced by G, C or A, or deleted, or one or more nucleotides may be added.

[00221] In some embodiments, a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein does not have a modified ITR consisting of a nucleotide sequence selected from any of: SEQ ID NO: 550- 557. In some embodiments, the cccDNA vector produced in accordance with the methods and compositions using a single Rep protein as disclosed herein does not have a modified ITR comprising a nucleotide sequence selected from any of: SEQ ID NO: 550-557.

[00222] In some embodiments, the cccDNA vector comprises a regulatory switch, as described herein, and a selected modified ITR having a nucleotide sequence selected from any of the group consisting of: SEQ ID NO: 550-557.

[00223] In another embodiment, the structure of the ITR structural element in a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein may be altered. For example, in the specified structural element the height of the stem and/or the number of nucleotides in the loop are changed. For example, the stem height may be about 2, 3, 4, 5, 6, 7, 8 or 9 nucleotides or more, or any range of values. In one embodiment, the stem may be from about 5 nucleotides to about 9 nucleotides in height and operably interact with Rep. In another embodiment, the stem may be about 7 nucleotides in height and operably interact with Rep. In another example, the loop may be 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides or more, or any range thereof.

[00224] In another embodiment, the number of GAGY binding sites or GAGY-related binding sites within an RBE or extended RBE may be increased or decreased. According to one example, an RBE or extended RBE may contain 1, 2, 3, 4, 5 or 6 or more GAGY binding sites, or any number within the range of these values. Each GAGY binding site may independently be the exact GAGY sequence or a sequence similar to GAGY, provided that the sequence is sufficient for binding of the Rep protein.

[00225] In another embodiment, the intervening sequence between two elements (such as, but not limited to, an RBE and a hairpin) may be changed (eg, increased or decreased) to change the functional interaction with a single large Rep protein. For example, the spacing may be approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides, or more, or any range of specified values.

[00226] A cctDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein may include an ITR structure that is modified from the wild type AAV2 ITR structure disclosed herein but still retains functionality part of RBE, trs and RBE'. In FIG. 2A and Fig. Figure 2B demonstrates one of the possible mechanisms of operation of the trs site in part of the ITR structure of the wild type ccDNA vector. In some embodiments, the cccDNA vector contains one or more functional ITR polynucleotide sequences that contain a Rep binding site (RBS; 5'-GCGCGCTCGCTCGCTC-3' (SEQ ID NO: 531) for AAV2) and a terminal resolution site (TRS; 5 '-AGTT (SEQ ID NO: 46)). In some embodiments, at least one ITR (wild type or modified ITR) is functional. In alternative embodiments, when the cccDNA vector contains two modified ITRs that are different from or asymmetrical with respect to each other, at least one modified ITR is functional and at least one modified ITR is non-functional.

[00227] In some embodiments, a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein does not have a modified ITR selected from any sequence consisting of or consisting essentially of: SEQ ID NO: 500-529, as provided herein. In some embodiments, the cccDNA vector does not contain an ITR that is selected from any sequence selected from SEQ ID NO: 500-529.

[00228] In some embodiments, the modified ITR (e.g., left or right) of a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein has modifications within a loop arm, truncated arm, or spacer. Typical ITR sequences having modifications in the loop arm, truncated arm, or spacer are listed in Table 2.

[00229] In some embodiments, the modified ITR (e.g., left or right) of a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein has modifications within the loop arm and the truncated arm. Representative ITR sequences having modifications in the loop arm and truncated arm are listed in Table 3.

[00230] In some embodiments, the modified ITR (e.g., left or right) of a cccDNA vector prepared in accordance with methods and compositions using a single Rep protein as disclosed herein has modifications within the loop arm and spacer. Typical ITR sequences having modifications in the loop arm and spacer are listed in Table 4.

[00231] In some embodiments, a modified ITR (e.g., left or right) of a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein has modifications within the truncated arm and spacer. Typical ITR sequences having modifications in the truncated arm and spacer are listed in Table 5.

[00232] In some embodiments, the modified ITR (e.g., left or right) of a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein has modifications in the loop arm, truncated arm, and spacer. Typical ITR sequences having modifications in the loop arm, truncated arm, and spacer are listed in Table 6.

[00233] In some embodiments, the modified ITR (e.g., left or right) of a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein is modified so that it has the lowest unfolding energy (“low energy structure”). Low energy will have lower Gibbs free energy compared to wild type ITR. Representative ITR sequences that are modified to low (ie, reduced) energy for unfolding are presented here in Table 7-9.

[00234] In some embodiments, the modified ITR (e.g., left or right) of a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein is selected from any of the proteins or combinations thereof shown in the Tables 2-9, 10A or 10B.

[00235] Table 2: ITR sequences with changes in the loop arm, truncated arm or spacer. These include the RBS sequence GCGCGCTCGCTCGCTC (SEQ ID NO: 531) at the 5' end and the complementary RBE sequence GAGCGAGCGAGCGCGC (SEQ ID NO: 536) at the 3' end.

TABLE 2 SEQ ID Modified section Subsequence ΔG Structure Number 135 Truncated shoulder GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGAAGCCCGGGCTGCCTCAGTGAGCGAGCGAGCGCGC -73.6 1 136 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACACCCGGGTGGCCTCAGTGAGCGAGCGAGCGCGC -73.7 3 137 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGACCGGTCGGCCTCAGTGAGCGAGCGAGCGCGC -74.2 1 138 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCACGTGCGGCCTCAGTGAGCGAGCGAGCGCGC -75.7 2 139 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCATGGCGGCCTCAGTGAGCGAGCGAGCGCGC -75.2 1 140 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGAAGACCGGTCTGCCTCAGTGAGCGAGCGAGCGCGC -72.1 1 141 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACACACGTGTGGCCTCAGTGAGCGAGCGAGCGCGC -74.2 1 142 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGACATGTCGGCCTCAGTGAGCGAGCGAGCGCGC -73.3 2 143 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGAAGCACGTGCTGCCTCAGTGAGCGAGCGAGCGCGC -74.1 1 144 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCGAAACCCGGGTTGCCTCAGTGAGCGAGCGAGCGCGC -72.1 1 145 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGAAGCCATGGCTGCCTCAGTGAGCGAGCGAGCGCGC -73.6 1 146 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACAACCGGTTGGCCTCAGTGAGCGAGCGAGCGCGC -73.0 1 147 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACACCATGGTGGCCTCAGTGAGCGAGCGAGCGCGC -73.7 1 148 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGAACGTTCGGGCCTCAGTGAGCGAGCGAGCGCGC -73.7 1 149 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCAATTGCGGCCTCAGTGAGCGAGCGAGCGCGC -75.7 1 150 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGAAAACCGGTTTGCCTCAGTGAGCGAGCGAGCGCGC -72.1 1 151 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGAAGAACGTTCTGCCTCAGTGAGCGAGCGAGCGCGC -72.1 1 152 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGAAGCAATTGCTGCCTCAGTGAGCGAGCGAGCGCGC -74.1 1 153 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACAAAACGTTTGGCCTCAGTGAGCGAGCGAGCGCGC -73.0 1 154 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGAAATTTCGGCCTCAGTGAGCGAGCGAGCGCGC -73.7 2 155 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGAAGCAATTGCTGCCTCAGTGAGCGAGCGAGCGCGC -74.1 1 156 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGAAACCATGGTTGCCTCAGTGAGCGAGCGAGCGCGC -72.1 1 157 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACAACATGTTGGCCTCAGTGAGCGAGCGAGCGCGC -73.0 1 158 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGAAGACATGTCTGCCTCAGTGAGCGAGCGAGCGCGC -72.1 2 159 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACACAATTGTGGCCTCAGTGAGCGAGCGAGCGCGC -74.2 1 160 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGAAAAACGTTTTGCCTCAGTGAGCGAGCGAGCGCGC -72.1 1 161 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGAAAACATGTTTGCCTCAGTGAGCGAGCGAGCGCGC -72.1 2 162 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGAAACAATTGTTGCCTCAGTGAGCGAGCGAGCGCGC -72.1 1 163 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGAAGAAATTTCTGCCTCAGTGAGCGAGCGAGCGCGC -72.1 1 164 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACAAAATTTTGGCCTCAGTGAGCGAGCGAGCGCGC -73.0 1 165 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGAAAAAATTTTTGCCTCAGTGAGCGAGCGAGCGCGC -72.1 1 166 Spacer GCGCGCTCGCTCGCTCGCTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCTCAGCGAGCGAGCGAGCGCGC -76.7 1 167 GCGCGCTCGCTCGCTCAATGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCTCATTGAGCGAGCGAGCGCGC -72.9 1 168 GCGCGCTCGCTCGCTCACCGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCTCGGTGAGCGAGCGAGCGCGC -76.7 1 169 GCGCGCTCGCTCGCTCACTAAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCTTAGTGAGCGAGCGAGCGCGC -72.9 1 170 GCGCGCTCGCTCGCTCACTGGGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCCCAGTGAGCGAGCGAGCGCGC -77.3 2 171 GCGCGCTCGCTCGCTCACTGAAGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCTTCAGTGAGCGAGCGAGCGCGC -72.8 1 172 GCGCGCTCGCTCGCTCACTGAGACCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGTCTCAGTGAGCGAGCGAGCGCGC -73.1 1 173 GCGCGCTCGCTCGCTCGATGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCTCATCGAGCGAGCGAGCGCGC -74.7 1 174 GCGCGCTCGCTCGCTCGCGGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCTCCGCGAGCGAGCGAGCGCGC -78.2 2 175 GCGCGCTCGCTCGCTCGCTAAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCTTAGTGAGCGAGCGAGCGCGC -72.5 1 176 GCGCGCTCGCTCGCTCGCTGGGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCCCAGCGAGCGAGCGAGCGCGC -78.8 2 177 GCGCGCTCGCTCGCTCGCTGAAGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCTTCAGCGAGCGAGCGAGCGCGC -74.3 1 178 GCGCGCTCGCTCGCTCGCTGAGACCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGTCTCAGCGAGCGAGCGAGCGCGC -74.6 1 179 GCGCGCTCGCTCGCTCGAGGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCTCCTCGAGCGAGCGAGCGCGC -76.9 1 180 GCGCGCTCGCTCGCTCGATAAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCTTATCGAGCGAGCGAGCGCGC -72.4 1 181 GCGCGCTCGCTCGCTCGATGGGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCTCATCGAGCGAGCGAGCGCGC -73.8 2 182 GCGCGCTCGCTCGCTCGATGAAGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCTTCATCGAGCGAGCGAGCGCGC -72.3 1 183 GCGCGCTCGCTCGCTCGATGAGACCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGTCTCATCGAGCGAGCGAGCGCGC -72.6 1 184 GCGCGCTCGCTCGCTCGAGAAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCTTCTCGAGCGAGCGAGCGCGC -74.5 1 185 GCGCGCTCGCTCGCTCGAGGGGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCCCCTCGAGCGAGCGAGCGCGC -79 2 186 GCGCGCTCGCTCGCTCGAGGAAGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCTTCCTCGAGCGAGCGAGCGCGC -74.5 1 189 GCGCGCTCGCTCGCTCGAGGAGACCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGTCTCCTCGAGCGAGCGAGCGCGC -74.8 1 187 GCGCGCTCGCTCGCTCGAGGGGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCCCCTCGAGCGAGCGAGCGCGC -79 2 188 GCGCGCTCGCTCGCTCGAGGAAGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCTTCCTCGAGCGAGCGAGCGCGC -74.5 1 189 GCGCGCTCGCTCGCTCGAGGAGACCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGTCTCCTCGAGCGAGCGAGCGCGC -74.8 1 190 GCGCGCTCGCTCGCTCGAGAGGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCCTCTCGAGCGAGCGAGCGCGC -76.9 2 200 GCGCGCTCGCTCGCTCGAGAAAGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCTTTCTCGAGCGAGCGAGCGCGC -72.1 1 201 GCGCGCTCGCTCGCTCGAGAAGACCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCTTCTCGAGCGAGCGAGCGCGC -69.1 2 202 GCGCGCTCGCTCGCTCGAGAGAGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCTCTCTCGAGCGAGCGAGCGCGC -74.8 1 203 GCGCGCTCGCTCGCTCGAGAGGACCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGTCCTCTCGAGCGAGCGAGCGCGC -74.8 1 204 GCGCGCTCGCTCGCTCGAGAGAACCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGTTCTCTCGAGCGAGCGAGCGCGC -72.4 1 205 GCGCGCTCGCTCGCTCAAGAGAACCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGTTCTCTTGAGCGAGCGAGCGCGC -70.6 1 206 GCGCGCTCGCTCGCTCACGAGAACCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGTTCTCGTGAGCGAGCGAGCGCGC -72.2 1 207 GCGCGCTCGCTCGCTCACTAGAACCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGTTCTAGTGAGCGAGCGAGCGCGC -70.8 1 208 GCGCGCTCGCTCGCTCACTGGAACCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGTTCCAGTGAGCGAGCGAGCGCGC -72.8 1 209 GCGCGCTCGCTCGCTCACTGAAACCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGTTTCAGTGAGCGAGCGAGCGCGC -70.4 1 210 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCCCCGCGAGCGAGCGAGCGCGC -80.3 2 211 GCGCGCTCGCTCGCTCAATAAAACCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGTTTTTATTGAGCGAGCGAGCGCGC -65.8 1 212 Loop shoulder GCGCGCTCGCTCGCTCACTGAGGCCAGGCGACCAAAGGTCGCCTGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC -73.7 1 213 GCGCGCTCGCTCGCTCACTGAGGCCGAGCGACCAAAGGTCGCTCGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC -73.1 1 214 GCGCGCTCGCTCGCTCACTGAGGCCGGACGACCAAAGGTCGTCCGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC -73.1 2 215 GCGCGCTCGCTCGCTCACTGAGGCCGGGAGACCAAAGGTCTCCCGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC -73.9 1 216 GCGCGCTCGCTCGCTCACTGAGGCCGGGCAACCAAAGGTTGCCCGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC -73.4 1 217 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGGCCAAAGGCCGCCCGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC -77.3 2 218 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGAACAAAGTTCGCCCGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC -72.8 2 219 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACAAAATGTCGCCCGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC -73.5 1 220 GCGCGCTCGCTCGCTCACTGAGGCCAAGCGACCAAAGGTCGCTTGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC -71.3 1 221 GCGCGCTCGCTCGCTCACTGAGGCCAAACGACCAAAGGTCGTTTGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC -68.9 1 222 GCGCGCTCGCTCGCTCACTGAGGCCAAAAGACCAAAGGTCTTTTGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC -67.3 2 223 GCGCGCTCGCTCGCTCACTGAGGCCAAAAAACCAAAGGTTTTTTGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC -64.6 2 224 GCGCGCTCGCTCGCTCACTGAGGCCAAAAAGCCAAAGGCTTTTTGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC -67 2 225 GCGCGCTCGCTCGCTCACTGAGGCCAAAAAGACAAAGTCTTTTTGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC -64.9 1 226 GCGCGCTCGCTCGCTCACTGAGGCCAAAAAGAAAAATTCTTTTTGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC -63.1 1 227 GCGCGCTCGCTCGCTCACTGAGGCCAAAAAAAAAAATTTTTTTTGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC -60.4 1 228 GCGCGCTCGCTCGCTCACTGAGGCCGAAAAAAAAAATTTTTTTCGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC -62.2 1 229 GCGCGCTCGCTCGCTCACTGAGGCCGGAAAGAAAAATTCTTTCCGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC -67.3 1 230 GCGCGCTCGCTCGCTCACTGAGGCCGGGAAGAAAAAATTCTTCCCGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC -69.7 2 231 GCGCGCTCGCTCGCTCACTGAGGCCGGGGCAGAAAAATTCTGCCCGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC -71.9 1 232 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGGAAAAATTCCGCCCGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC -73.4 2 233 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGAAAAAATTTCGCCCGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC -71.0 2

Table 3: Modified ITR sequences with modifications in the loop arm and truncated arm

Table 3. SEQ ID Modified section Subsequence ΔG Structure Number 234 Loop shoulder and truncated shoulder GCGCGCTCGCTCGCTCACTGAGGCCAGGCGACCAAAGGTCGCCTGACACCCGGGTGGCCTCAGTGAGCGAGCGAGCGCGC -72.2 2 235 GCGCGCTCGCTCGCTCACTGAGGCCAGGCGACCAAAGGTCGCCTGACGCCATGGCGGCCTCAGTGAGCGAGCGAGCGCGC -73.7 1 236 GCGCGCTCGCTCGCTCACTGAGGCCAGGCGACCAAAGGTCGCCTGACGACATGTCGGCCTCAGTGAGCGAGCGAGCGCGC -71.8 1 237 GCGCGCTCGCTCGCTCACTGAGGCCAGGCGACCAAAGGTCGCCTGACGAACGTTCGGGCCTCAGTGAGCGAGCGAGCGCGC -72.2 1 238 GCGCGCTCGCTCGCTCACTGAGGCCAGGCGACCAAAGGTCGCCTGAAGCAATTGCTGCCTCAGTGAGCGAGCGAGCGCGC -72.6 1 239 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGGCCAAAGGCCGCCCGACACCCGGGTGGCCTCAGTGAGCGAGCGAGCGCGC -75.8 2 240 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGGCCAAAGGCCGCCCGACGCCATGGCGGCCTCAGTGAGCGAGCGAGCGCGC -77.3 1 241 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGGCCAAAGGCCGCCCGACGACATGTCGGCCTCAGTGAGCGAGCGAGCGCGC -75.4 1 242 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGGCCAAAGGCCGCCCGACGAACGTTCGGGCCTCAGTGAGCGAGCGAGCGCGC -75.8 1 243 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGGCCAAAGGCCGCCCGAAGCAATTGCTGCCTCAGTGAGCGAGCGAGCGCGC -76.2 1 244 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACAAAATGTCGCCCGACACCCGGGTGGCCTCAGTGAGCGAGCGAGCGCGC -72 1 245 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACAAAATGTCGCCCGACGCCATGGCGGCCTCAGTGAGCGAGCGAGCGCGC -73.5 1 246 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACAAAATGTCGCCCGACGACATGTCGGCCTCAGTGAGCGAGCGAGCGCGC -71.6 2 247 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACAAAATGTCGCCCGACGAACGTTCGGGCCTCAGTGAGCGAGCGAGCGCGC -72 2 248 GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACAAAATGTCGCCCGAAGCAATTGCTGCCTCAGTGAGCGAGCGAGCGCGC -72.4 1 249 GCGCGCTCGCTCGCTCACTGAGGCCAAAAGACCAAAGGTCTTTTGACACCCGGGTGGCCTCAGTGAGCGAGCGAGCGCGC -65.8 3 250 GCGCGCTCGCTCGCTCACTGAGGCCAAAAGACCAAAGGTCTTTTGACGCCATGGCGGCCTCAGTGAGCGAGCGAGCGCGC -67.3 2 251 GCGCGCTCGCTCGCTCACTGAGGCCAAAAGACCAAAGGTCTTTTGACGACATGTCGGCCTCAGTGAGCGAGCGAGCGCGC -65.4 2 252 GCGCGCTCGCTCGCTCACTGAGGCCAAAAGACCAAAGGTCTTTTGACGAACGTTCGGGCCTCAGTGAGCGAGCGAGCGCGC -65.8 2 253 GCGCGCTCGCTCGCTCACTGAGGCCAAAAGACCAAAGGTCTTTTGAAGCAATTGCTGCCTCAGTGAGCGAGCGAGCGCGC -66.2 1 254 GCGCGCTCGCTCGCTCACTGAGGCCAAAAAAAATTTTTTTTGACACCCGGGTGGCCTCAGTGAGCGAGCGAGCGCGC -59.6 2 255 GCGCGCTCGCTCGCTCACTGAGGCCAAAAAAAATTTTTTTTGACGCCATGGCGGCCTCAGTGAGCGAGCGAGCGCGC -60.4 1 256 GCGCGCTCGCTCGCTCACTGAGGCCAAAAAAAAAAATTTTTTTTGACGACATGTCGGCCTCAGTGAGCGAGCGAGCGCGC -59.8 1 257 GCGCGCTCGCTCGCTCACTGAGGCCAAAAAAAATTTTTTTTGACGAACGTTCGGCCTCAGTGAGCGAGCGAGCGCGC -58.9 2 258 GCGCGCTCGCTCGCTCACTGAGGCCAAAAAAAAATTTTTTTTGAAGCAATTGCTGCCTCAGTGAGCGAGCGAGCGCGC -59.3 2 259 GCGCGCTCGCTCGCTCACTGAGGCCGGGCAGAAAAATTCTGCCCGACACCCGGGTGGCCTCAGTGAGCGAGCGAGCGCGC -70.4 1 260 GCGCGCTCGCTCGCTCACTGAGGCCGGGCAGAAAAATTCTGCCCGACGCCATGGCGGCCTCAGTGAGCGAGCGAGCGCGC -71.9 1 261 GCGCGCTCGCTCGCTCACTGAGGCCGGGCAGAAAAATTCTGCCCGACGACATGTCGGCCTCAGTGAGCGAGCGAGCGCGC -70 1 262 GCGCGCTCGCTCGCTCACTGAGGCCGGGCAGAAAAATTCTGCCCGACGAACGTTCGGGCCTCAGTGAGCGAGCGAGCGCGC -70.4 1 263 GCGCGCTCGCTCGCTCACTGAGGCCGGGCAGAAAAATTCTGCCCGAAGCAATTGCTGCCTCAGTGAGCGAGCGAGCGCGC -70.8 1

Table 4: ITR sequences with loop arm and spacer changes

Table 4. SEQ ID Modified section Subsequence ΔG Structure Number 264 Loop arm and spacer GCGCGCTCGCTCGCTCACTAAGGCCAGGCGACCAAAGGTCGCCTGACGCCCGGGCGGCCTTAGTGAGCGAGCGAGCGCGC -71.4 1 265 GCGCGCTCGCTCGCTCACTAAGGCCGGGCGGCCAAAGGCCGCCCGACGCCCGGGCGGCCTTAGTGAGCGAGCGAGCGCGC -75 2 266 GCGCGCTCGCTCGCTCACTAAGGCCGGGCGACAAAATGTCGCCCGACGCCCGGGGCGGCCTTAGTGAGCGAGCGAGCGCGC -71.2 1 267 GCGCGCTCGCTCGCTCACTAAGGCCAAAAGACCAAAGGTCTTTTGACGCCCGGGCGGCCTTAGTGAGCGAGCGAGCGCGC -65 2 268 GCGCGCTCGCTCGCTCACTAAGGGCCAAAAAAAATTTTTTTTGACGCCCGGGCGGCCTTAGTGAGCGAGCGAGCGCGC -58.1 1 269 GCGCGCTCGCTCGCTCACTAAGGCCGGGCAGAAAAATTCTGCCCGACGCCCGGGCGGCCTTAGTGAGCGAGCGAGCGCGC -69.6 1 270 GCGCGCTCGCTCGCTCGATGGGGCCAGGCGACCAAAGGTCGCCTGACGCCCGGGCGGCCTCATCGAGCGAGCGAGCGCGC -72.3 2 271 GCGCGCTCGCTCGCTCGATGGGGCCGGGCGGCCAAAGGCCGCCCGACGCCCGGGCGGCCTCATCGAGCGAGCGAGCGCGC -75.9 3 272 GCGCGCTCGCTCGCTCGATGGGGCCGGGCGACAAAATGTCGCCCGACGCCCGGGCGGCCTCATCGAGCGAGCGAGCGCGC -72.1 2 273 GCGCGCTCGCTCGCTCGATGGGGCCAAAAGACCAAAGGTCTTTTGACGCCCGGGCGGCCTCATCGAGCGAGCGAGCGCGC -65.9 3 274 GCGCGCTCGCTCGCTCGATGGGGCCAAAAAAAATTTTTTTTGACGCCCGGGCGGCCTCATCGAGCGAGCGAGCGCGC -59 2 275 GCGCGCTCGCTCGCTCGATGGGGCCGGGCAGAAAAAATTCTGCCCGACGCCCGGGCGGCCTCATCGAGCGAGCGAGCGCGC -70.5 2 276 GCGCGCTCGCTCGCTCGAGAGAACCAGGCGACCAAAGGTCGCCTGACGCCCGGGCGGTTCTCTCGAGCGAGCGAGCGCGC -70.9 1 277 GCGCGCTCGCTCGCTCGAGAGAACCGGGCGGCCAAAGGCCGCCCGACGCCCGGGCGGTTCTCTCGAGCGAGCGAGCGCGC -74.5 1 278 GCGCGCTCGCTCGCTCGAGAGAACCGGGCGACAAAATGTCGCCCGACGCCCGGGCGGTTCTCTCGAGCGAGCGAGCGCGC -70.7 1 279 GCGCGCTCGCTCGCTCGAGAGAACCAAAAGACCAAAGGTCTTTTGACGCCCGGGCGGTTCTCTCGAGCGAGCGAGCGCGC -64.5 2 280 GCGCGCTCGCTCGCTCGAGAGAACCAAAAAAAATTTTTTTTGACGCCCGGGCGGTTCTCTCGAGCGAGCGAGCGCGC -57.6 1 281 GCGCGCTCGCTCGCTCGAGAGAACCGGGCAGAAAAATTCTGCCCGACGCCCGGGCGGTTCTCTCGAGCGAGCGAGCGCGC -69.1 1 282 GCGCGCTCGCTCGCTCGCGGGGGCCAGGCGACCAAAGGTCGCCTGACGCCCGGGCGGCCCCCGCGAGCGAGCGAGCGCGC -78.8 2 283 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCGGCCAAAGGCCGCCCGACGCCCGGGCGGCCCCCGCGAGCGAGCGAGCGCGC -82.4 3 284 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCGACAAAATGTCGCCCGACGCCCGGGCGGCCCCCGCGAGCGAGCGAGCGCGC -78.6 2 285 GCGCGCTCGCTCGCTCGCGGGGGCCAAAAGACCAAAGGTCTTTTGACGCCCGGGCGGCCCCCGCGAGCGAGCGAGCGCGC -72.4 3 286 GCGCGCTCGCTCGCTCGCGGGGGCCAAAAAAAAATTTTTTTTGACGCCCGGGCGGCCCCCGCGAGCGAGCGAGCGCGC -65.5 1 287 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCAGAAAAATTCTGCCCGACGCCCGGGCGGCCCCCGCGAGCGAGCGAGCGCGC -77 2 288 GCGCGCTCGCTCGCTCAATAAAACCAGGCGACCAAAGGTCGCCTGACGCCCGGGCGGTTTTTATTGAGCGAGCGAGCGCGC -64.3 1 289 GCGCGCTCGCTCGCTCAATAAAACCGGGCGGCCAAAGGCCGCCCGACGCCCGGGCGGTTTTTATTGAGCGAGCGAGCGCGC -67.9 1 290 GCGCGCTCGCTCGCTCAATAAAACCGGGCGACAAAATGTCGCCCGACGCCCGGGCGGTTTTTATTGAGCGAGCGAGCGCGC -64.1 1 291 GCGCGCTCGCTCGCTCAATAAAACCAAAAGACCAAAGGTCTTTTGACGCCCGGGCGGTTTTTATTGAGCGAGCGAGCGCGC -57.9 2 292 GCGCGCTCGCTCGCTCAATAAAACCAAAAAAAAATTTTTTTTGACGCCCGGGCGGTTTTTATTGAGCGAGCGAGCGCGC -51 1 293 GCGCGCTCGCTCGCTCAATAAAACCGGGCAGAAAAATTCTGCCCGACGCCCGGGCGGTTTTATTGAGCGAGCGAGCGCGC -62.5 1

Table 5: ITR sequences with truncated arm and spacer changes

TABLE 5 SEQ ID Modified section Subsequence ΔG Structure Number 294 Truncated loop and spacer GCGCGCTCGCTCGCTCACTAAGGCCGGGCGACCAAAGGTCGCCCGACACCCGGGTGGCCTTAGTGAGCGAGCGAGCGCGC -71.4 1 295 GCGCGCTCGCTCGCTCACTAAGGCCGGGCGACCAAAGGTCGCCCGACGCCATGGCGGCCTTAGTGAGCGAGCGAGCGCGC -72.9 1 296 GCGCGCTCGCTCGCTCACTAAGGCCGGGCGACCAAAGGTCGCCCGACGACATGTCGGCCTTAGTGAGCGAGCGAGCGCGC -71 1 297 GCGCGCTCGCTCGCTCACTAAGGCCGGGCGACCAAAGGTCGCCCGACGAACGTTCGGCCTTAGTGAGCGAGCGAGCGCGC -71.4 1 298 GCGCGCTCGCTCGCTCACTAAGGCCGGGCGACCAAAGGTCGCCCGAAGCAATTGCTGCCTTAGTGAGCGAGCGAGCGCGC -71.8 1 299 GCGCGCTCGCTCGCTCGATGGGGCCGGGCGACCAAAGGTCGCCCGACACCCGGGTGGCCTCATCGAGCGAGCGAGCGCGC -72.3 2 300 GCGCGCTCGCTCGCTCGATGGGGCCGGGCGACCAAAGGTCGCCCGACGCCATGGCGGCCTCATCGAGCGAGCGAGCGCGC -73.8 1 301 GCGCGCTCGCTCGCTCGATGGGGCCGGGCGACCAAAGGTCGCCCGACGACATGTCGGCCTCATCGAGCGAGCGAGCGCGC -71.9 1 302 GCGCGCTCGCTCGCTCGATGGGGCCGGGCGACCAAAGGTCGCCCGACGAACGTTCGGCCTCATCGAGCGAGCGAGCGCGC -72.3 1 303 GCGCGCTCGCTCGCTCGATGGGGCCGGGCGACCAAAGGTCGCCCGAAGCAATTGCTGCCTCATCGAGCGAGCGAGCGCGC -72.7 1 304 GCGCGCTCGCTCGCTCGAGAGAACCGGGCGACCAAAGGTCGCCCGACACCCGGGTGGTTCTCTCGAGCGAGCGAGCGCGC -70.9 1 305 GCGCGCTCGCTCGCTCGAGAGAACCGGGCGACCAAAGGTCGCCCGACGCCATGGCGGTTCTCTCGAGCGAGCGAGCGCGC -72.4 1 306 GCGCGCTCGCTCGCTCGAGAGAACCGGGCGACCAAAGGTCGCCCGACGACATGTCGGTTCTCTCGAGCGAGCGAGCGCGC -70.5 1 307 GCGCGCTCGCTCGCTCGAGAGAACCGGGCGACCAAAGGTCGCCCGACGAACGTTCGGTTCTCTCGAGCGAGCGAGCGCGC -70.9 1 308 GCGCGCTCGCTCGCTCGAGAGAACCGGGCGACCAAAGGTCGCCCGAAGCAATTGCTGTTCTCTCGAGCGAGCGAGCGCGC -71.3 1 309 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCGACCAAAGGTCGCCCGACACCCGGGTGGCCCCCGCGAGCGAGCGAGCGCGC -78.8 1 310 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCGACCAAAGGTCGCCCGACGCCATGGCGGCCCCCGCGAGCGAGCGAGCGCGC -80.3 1 311 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCGACCAAAGGTCGCCCGACGACATGTCGGCCCCCGCGAGCGAGCGAGCGCGC -78.4 1 312 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCGACCAAAGGTCGCCCGACGAACGTTCGGCCCCCGCGAGCGAGCGAGCGCGC -78.8 1 313 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCGACCAAAGGTCGCCCGAAGCAATTGCTGCCCCCGCGAGCGAGCGAGCGCGC -79.2 1 314 GCGCGCTCGCTCGCTCAATAAAACCGGGCGACCAAAGGTCGCCCGACACCCGGGTGGTTTTTATTGAGCGAGCGAGCGCGC -64.3 1 315 GCGCGCTCGCTCGCTCAATAAAACCGGGCGACCAAAGGTCGCCCGACGCCATGGCGGTTTTTATTGAGCGAGCGAGCGCGC -65.8 1 316 GCGCGCTCGCTCGCTCAATAAAACCGGGCGACCAAAGGTCGCCCGACGACATGTCGGTTTTATTGAGCGAGCGAGCGCGC -63.9 1 317 GCGCGCTCGCTCGCTCAATAAAACCGGGCGACCAAAGGTCGCCCGACGAACGTTCGGTTTTTATTGAGCGAGCGAGCGCGC -64.3 1 318 GCGCGCTCGCTCGCTCAATAAAACCGGGCGACCAAAGGTCGCCCGAAGCAATTGCTGTTTTTATTGAGCGAGCGAGCGCGC -64.7 1

Table 6: ITR sequences with changes in loop arm, truncated arm and spacer

Table 6 SEQ ID Modified section Subsequence ΔG Structure Number 319 Loop arm, truncated arm and spacer GCGCGCTCGCTCGCTCACTAAGGCCAGGCGACCAAAGGTCGCCTGACACCCGGGTGGCCTTAGTGAGCGAGCGAGCGCGC -69.9 2 320 GCGCGCTCGCTCGCTCACTAAGGCCAGGCGACCAAAGGTCGCCTGACGCCATGGCGGCCTTAGTGAGCGAGCGAGCGCGC -71.4 1 321 GCGCGCTCGCTCGCTCACTAAGGCCAGGCGACCAAAGGTCGCCTGACGACATGTCGGCCTTAGTGAGCGAGCGAGCGCGC -69.5 1 322 GCGCGCTCGCTCGCTCACTAAGGCCAGGCGACCAAAGGTCGCCTGACGAACGTTCGGCCTTAGTGAGCGAGCGAGCGCGC -69.9 1 323 GCGCGCTCGCTCGCTCACTAAGGCCAGGCGACCAAAGGTCGCCTGAAGCAATTGCTGCCTTAGTGAGCGAGCGAGCGCGC -70.3 1 324 GCGCGCTCGCTCGCTCACTAAGGCCGGGCGGCCAAAGGCCGCCCGACACCCGGGTGGCCTTAGTGAGCGAGCGAGCGCGC -73.5 2 325 GCGCGCTCGCTCGCTCACTAAGGCCGGGCGGCCAAAGGCCGCCCGACGCCATGGCGGCCTTAGTGAGCGAGCGAGCGCGC -75 1 326 GCGCGCTCGCTCGCTCACTAAGGCCGGGCGGCCAAAGGCCGCCCGACGACATGTCGGCCTTAGTGAGCGAGCGAGCGCGC -73.1 1 327 GCGCGCTCGCTCGCTCACTAAGGCCGGGCGGCCAAAGGCCGCCCGACGAACGTTCGGCCTTAGTGAGCGAGCGAGCGCGC -73.5 1 328 GCGCGCTCGCTCGCTCACTAAGGCCGGGCGGCCAAAGGCCGCCCGAAGCAATTGCTGCCTTAGTGAGCGAGCGAGCGCGC -73.9 1 329 GCGCGCTCGCTCGCTCACTAAGGCCGGGCGACAAAATGTCGCCCGACACCCGGGTGGCCTTAGTGAGCGAGCGAGCGCGC -69.7 1 330 GCGCGCTCGCTCGCTCACTAAGGCCGGGCGACAAAATGTCGCCCGACGCCATGGCGGCCTTAGTGAGCGAGCGAGCGCGC -71.2 1 331 GCGCGCTCGCTCGCTCACTAAGGCCGGGCGACAAAATGTCGCCCGACGACATGTCGGCCTTAGTGAGCGAGCGAGCGCGC -69.3 2 332 GCGCGCTCGCTCGCTCACTAAGGCCGGGCGACAAAATGTCGCCCGACGAACGTTCGGCCTTAGTGAGCGAGCGAGCGCGC -69.7 2 333 GCGCGCTCGCTCGCTCACTAAGGCCGGGCGACAAAATGTCGCCCGAAGCAATTGCTGCCTTAGTGAGCGAGCGAGCGCGC -70.1 1 334 GCGCGCTCGCTCGCTCACTAAGGCCAAAGACCAAAGGTCTTTTGACACCCGGGTGGCCTTAGTGAGCGAGCGAGCGCGC -63.5 2 335 GCGCGCTCGCTCGCTCACTAAGGCCAAAAGACCAAAGGTCTTTTGACGCCATGGCGGCCTTAGTGAGCGAGCGAGCGCGC -65 2 336 GCGCGCTCGCTCGCTCACTAAGGCCAAAAGACCAAAGGTCTTTTGACGACATGTCGGCCTTAGTGAGCGAGCGAGCGCGC -63.1 2 337 GCGCGCTCGCTCGCTCACTAAGGCCAAAGACCAAAGGTCTTTTGACGAACGTTCGGCCTTAGTGAGCGAGCGAGCGCGC -63.5 2 338 GCGCGCTCGCTCGCTCACTAAGGCCAAAAGACCAAAGGTCTTTTGAAGCAATTGCTGCCTTAGTGAGCGAGCGAGCGCGC -63.9 1 339 GCGCGCTCGCTCGCTCACTAAGGCCAAAAAAAATTTTTTTTGACACCCGGGTGGCCTTAGTGAGCGAGCGAGCGCGC -57.3 2 340 GCGCGCTCGCTCGCTCACTAAGGGCCAAAAAAAATTTTTTTTGACGCCATGGCGGCCTTAGTGAGCGAGCGAGCGCGC -58.1 1 341 GCGCGCTCGCTCGCTCACTAAGGGCCAAAAAAAAAAATTTTTTTTGACGACATGTCGGCCTTAGTGAGCGAGCGAGCGCGC -57.5 1 342 GCGCGCTCGCTCGCTCACTAAGGCCAAAAAAAATTTTTTTTGACGAACGTTCGGCCTTAGTGAGCGAGCGAGCGCGC -56.6 2 343 GCGCGCTCGCTCGCTCACTAAGGCCAAAAAAAATTTTTTTTGAAGCAATTGCTGCCTTAGTGAGCGAGCGAGCGCGC -57 2 344 GCGCGCTCGCTCGCTCACTAAGGCCGGGCAGAAAAAATTCTGCCCGACACCCGGGTGGCCTTAGTGAGCGAGCGAGCGCGC -68.1 1 345 GCGCGCTCGCTCGCTCACTAAGGCCGGGCAGAAAAATTCTGCCCGACGCCATGGCGGCCTTAGTGAGCGAGCGAGCGCGC -69.6 1 346 GCGCGCTCGCTCGCTCACTAAGGCCGGGCAGAAAAATTCTGCCCGACGACATGTCGGCCTTAGTGAGCGAGCGAGCGCGC -67.7 1 347 GCGCGCTCGCTCGCTCACTAAGGCCGGGCAGAAAAATTCTGCCCGACGAACGTTCGGCCTTAGTGAGCGAGCGAGCGCGC -68.1 1 348 GCGCGCTCGCTCGCTCACTAAGGCCGGGCAGAAAAATTCTGCCCGAAGCAATTGCTGCCTTAGTGAGCGAGCGAGCGCGC -68.5 1 349 GCGCGCTCGCTCGCTCGATGGGGCCAGGCGACCAAAGGTCGCCTGACACCCGGGTGGCCTCATCGAGCGAGCGAGCGCGC -70.8 3 350 GCGCGCTCGCTCGCTCGATGGGGCCAGGCGACCAAAGGTCGCCTGACGCCATGGCGGCCTCATCGAGCGAGCGAGCGCGC -72.3 1 351 GCGCGCTCGCTCGCTCGATGGGGCCAGGCGACCAAAGGTCGCCTGACGACATGTCGGCCTCATCGAGCGAGCGAGCGCGC -70.4 1 352 GCGCGCTCGCTCGCTCGATGGGGCCAGGCGACCAAAGGTCGCCTGACGAACGTTCGGCCTCATCGAGCGAGCGAGCGCGC -70.8 1 353 GCGCGCTCGCTCGCTCGATGGGGCCAGGCGACCAAAGGTCGCCTGAAGCAATTGCTGCCTCATCGAGCGAGCGAGCGCGC -71.2 1 354 GCGCGCTCGCTCGCTCGATGGGGCCGGGCGGCCAAAGGCCGCCCGACACCCGGGTGGCCTCATCGAGCGAGCGAGCGCGC -74.4 3 355 GCGCGCTCGCTCGCTCGATGGGGCCGGGCGGCCAAAGGCCGCCCGACGCCATGGCGGCCTCATCGAGCGAGCGAGCGCGC -75.9 1 356 GCGCGCTCGCTCGCTCGATGGGGCCGGGCGGCCAAAGGCCGCCCGACGACATGTCGGCCTCATCGAGCGAGCGAGCGCGC -74 1 357 GCGCGCTCGCTCGCTCGATGGGGCCGGGCGGCCAAAGGCCGCCCGACGAACGTTCGGCCTCATCGAGCGAGCGAGCGCGC -74.4 1 358 GCGCGCTCGCTCGCTCGATGGGGCCGGGCGGCCAAAGGCCGCCCGAAGCAATTGCTGCCTCATCGAGCGAGCGAGCGCGC -74.8 1 359 GCGCGCTCGCTCGCTCGATGGGGCCGGGCGACAAAATGTCGCCCGACACCCGGGTGGCCTCATCGAGCGAGCGAGCGCGC -70.6 2 360 GCGCGCTCGCTCGCTCGATGGGGCCGGGCGACAAAATGTCGCCCGACGCCATGGCGGCCTCATCGAGCGAGCGAGCGCGC -72.1 1 361 GCGCGCTCGCTCGCTCGATGGGGCCGGGCGACAAAATGTCGCCCGACGACATGTCGGCCTCATCGAGCGAGCGAGCGCGC -70.2 2 362 GCGCGCTCGCTCGCTCGATGGGGCCGGGCGACAAAATGTCGCCCGACGAACGTTCGGCCTCATCGAGCGAGCGAGCGCGC -70.6 2 363 GCGCGCTCGCTCGCTCGATGGGGCCGGGCGACAAAATGTCGCCCGAAGCAATTGCTGCCTCATCGAGCGAGCGAGCGCGC -71 1 364 GCGCGCTCGCTCGCTCGATGGGGCCAAAAGACCAAAGGTCTTTTGACACCCGGGTGGCCTCATCGAGCGAGCGAGCGCGC -64.4 3 365 GCGCGCTCGCTCGCTCGATGGGGCCAAAAGACCAAAGGTCTTTTGACGCCATGGCGGCCTCATCGAGCGAGCGAGCGCGC -65.9 2 366 GCGCGCTCGCTCGCTCGATGGGGCCAAAAGACCAAAGGTCTTTTGACGACATGTCGGCCTCATCGAGCGAGCGAGCGCGC -64 2 367 GCGCGCTCGCTCGCTCGATGGGGCCAAAAGACCAAAGGTCTTTTGACGAACGTTCGGCCTCATCGAGCGAGCGAGCGCGC -64.4 2 368 GCGCGCTCGCTCGCTCGATGGGGCCAAAAGACCAAAGGTCTTTTGAAGCAATTGCTGCCTCATCGAGCGAGCGAGCGCGC -64.8 1 369 GCGCGCTCGCTCGCTCGATGGGGCCAAAAAAAATTTTTTTTGACACCCGGGTGGCCTCATCGAGCGAGCGAGCGCGC -58.2 2* 370 GCGCGCTCGCTCGCTCGATGGGGCCAAAAAAAAAAATTTTTTTGACGCCATGGCGGCCTCATCGAGCGAGCGAGCGCGC -59 1 371 GCGCGCTCGCTCGCTCGATGGGGCCAAAAAAAAAAATTTTTTTTGACGACATGTCGGCCTCATCGAGCGAGCGAGCGCGC -58.4 1 372 GCGCGCTCGCTCGCTCGATGGGGCCAAAAAAAATTTTTTTTGACGAACGTTCGGCCTCATCGAGCGAGCGAGCGCGC -57.5 2 373 GCGCGCTCGCTCGCTCGATGGGGCCAAAAAAAATTTTTTTTGAAGCAATTGCTGCCTCATCGAGCGAGCGAGCGCGC -57.9 2 374 GCGCGCTCGCTCGCTCGATGGGGCCGGGCAGAAAAAATTCTGCCCGACACCCGGGTGGCCTCATCGAGCGAGCGAGCGCGC -69 2 375 GCGCGCTCGCTCGCTCGATGGGGCCGGGCAGAAAAATTCTGCCCGACGCCATGGCGGCCTCATCGAGCGAGCGAGCGCGC -70.5 1 376 GCGCGCTCGCTCGCTCGATGGGGCCGGGCAGAAAAATTCTGCCCGACGACATGTCGGCCTCATCGAGCGAGCGAGCGCGC -68.6 1 377 GCGCGCTCGCTCGCTCGATGGGGCCGGGCAGAAAAATTCTGCCCGACGAACGTTCGGCCTCATCGAGCGAGCGAGCGCGC -69 1 378 GCGCGCTCGCTCGCTCGATGGGGCCGGGCAGAAAAAATTCTGCCCGAAGCAATTGCTGCCTCATCGAGCGAGCGAGCGCGC -69.4 1 379 GCGCGCTCGCTCGCTCGAGAGAACCAGGCGACCAAAGGTCGCCTGACACCCGGGTGGTTCTCTCGAGCGAGCGAGCGCGC -69.4 2 380 GCGCGCTCGCTCGCTCGAGAGAACCAGGCGACCAAAGGTCGCCTGACGCCATGGCGGTTCTCTCGAGCGAGCGAGCGCGC -70.9 1 381 GCGCGCTCGCTCGCTCGAGAGAACCAGGCGACCAAAGGTCGCCTGACGACATGTCGGTTCTCTCGAGCGAGCGAGCGCGC -69 1 382 GCGCGCTCGCTCGCTCGAGAGAACCAGGCGACCAAAGGTCGCCTGACGAACGTTCGGTTCTCTCGAGCGAGCGAGCGCGC -69.4 1 383 GCGCGCTCGCTCGCTCGAGAGAACCAGGCGACCAAAGGTCGCCTGAAGCAATTGCTGTTCTCTCGAGCGAGCGAGCGCGC -69.8 1 384 GCGCGCTCGCTCGCTCGAGAGAACCGGGCGGCCAAAGGCCGCCCGACACCCGGGTGGTTCTCTCGAGCGAGCGAGCGCGC -73 1 385 GCGCGCTCGCTCGCTCGAGAGAACCGGGCGGCCAAAGGCCGCCCGACGCCATGGCGGTTCTCTCGAGCGAGCGAGCGCGC -74.5 1 386 GCGCGCTCGCTCGCTCGAGAGAACCGGGCGGCCAAAGGCCGCCCGACGACATGTCGGTTCTCTCGAGCGAGCGAGCGCGC -72.6 1 387 GCGCGCTCGCTCGCTCGAGAGAACCGGGCGGCCAAAGGCCGCCCGACGAACGTTCGGTTCTCTCGAGCGAGCGAGCGCGC -73 1 388 GCGCGCTCGCTCGCTCGAGAGAACCGGGCGGCCAAAGGCCGCCCGAAGCAATTGCTGTTCTCTCGAGCGAGCGAGCGCGC -73.4 1 389 GCGCGCTCGCTCGCTCGAGAGAACCGGGCGACAAAATGTCGCCCGACACCCGGGTGGTTCTCTCGAGCGAGCGAGCGCGC -69.2 1 390 GCGCGCTCGCTCGCTCGAGAGAACCGGGCGACAAAATGTCGCCCGACGCCATGGCGGTTCTCTCGAGCGAGCGAGCGCGC -70.7 1 391 GCGCGCTCGCTCGCTCGAGAGAACCGGGCGACAAAATGTCGCCCGACGACATGTCGGTTCTCTCGAGCGAGCGAGCGCGC -69.8 2 392 GCGCGCTCGCTCGCTCGAGAGAACCGGGCGACAAAATGTCGCCCGACGAACGTTCGGTTCTCTCGAGCGAGCGAGCGCGC -69.2 2 393 GCGCGCTCGCTCGCTCGAGAGAACCGGGCGACAAAATGTCGCCCGAAGCAATTGCTGTTCTCTCGAGCGAGCGAGCGCGC -69.6 1 394 GCGCGCTCGCTCGCTCGAGAGAACCAAAAGACCAAAGGTCTTTTGACACCCGGGTGGTTCTCTCGAGCGAGCGAGCGCGC -63 2 395 GCGCGCTCGCTCGCTCGAGAGAACCAAAAGACCAAAGGTCTTTTGACGCCATGGCGGTTCTCTCGAGCGAGCGAGCGCGC -64.5 2 396 GCGCGCTCGCTCGCTCGAGAGAACCAAAAGACCAAAGGTCTTTTGACGACATGTCGGTTCTCTCGAGCGAGCGAGCGCGC -62.6 2 397 GCGCGCTCGCTCGCTCGAGAGAACCAAAAGACCAAAGGTCTTTTGACGAACGTTCGGTTCTCTCGAGCGAGCGAGCGCGC -63 2 398 GCGCGCTCGCTCGCTCGAGAGAACCAAAAGACCAAAGGTCTTTTGAAGCAATTGCTGTTCTCTCGAGCGAGCGAGCGCGC -63.4 1 399 GCGCGCTCGCTCGCTCGAGAGAACCAAAAAAAAATTTTTTTTGACACCCGGGTGGTTCTCTCGAGCGAGCGAGCGCGC -56.8 2 400 GCGCGCTCGCTCGCTCGAGAGAACCAAAAAAAATTTTTTTTGACGCCATGGCGGTTCTCTCGAGCGAGCGAGCGCGC -57.6 1 401 GCGCGCTCGCTCGCTCGAGAGAACCAAAAAAAAAAATTTTTTTTGACGACATGTCGGTTCTCTCGAGCGAGCGAGCGCGC -57 1 402 GCGCGCTCGCTCGCTCGAGAGAACCAAAAAAAAAAATTTTTTTTGACGAACGTTCGGTTCTCTCGAGCGAGCGAGCGCGC -56.1 2 403 GCGCGCTCGCTCGCTCGAGAGAACCAAAAAAAATTTTTTTTGAAGCAATTGCTGTTCTCTCGAGCGAGCGAGCGCGC -56.5 2 404 GCGCGCTCGCTCGCTCGAGAGAACCGGGCAGAAAAATTCTGCCCGACACCCGGGTGGTTCTCTCGAGCGAGCGAGCGCGC -67.6 1 405 GCGCGCTCGCTCGCTCGAGAGAACCGGGCAGAAAAATTCTGCCCGACGCCATGGCGGTTCTCTCGAGCGAGCGAGCGCGC -69.1 1 406 GCGCGCTCGCTCGCTCGAGAGAACCGGGCAGAAAAATTCTGCCCGACGACATGTCGGTTCTCTCGAGCGAGCGAGCGCGC -67.2 1 407 GCGCGCTCGCTCGCTCGAGAGAACCGGGCAGAAAAATTCTGCCCGACGAACGTTCGGTTCTCTCGAGCGAGCGAGCGCGC -67.6 1 408 GCGCGCTCGCTCGCTCGAGAGAACCGGGCAGAAAAATTCTGCCCGAAGCAATTGCTGTTCTCTCGAGCGAGCGAGCGCGC -68 1 409 GCGCGCTCGCTCGCTCGCGGGGGCCAGGCGACCAAAGGTCGCCTGACACCCGGGTGGCCCCCGCGAGCGAGCGAGCGCGC -77.3 2 410 GCGCGCTCGCTCGCTCGCGGGGGCCAGGCGACCAAAGGTCGCCTGACGCCATGGCGGCCCCCGCGAGCGAGCGAGCGCGC -78.8 1 411 GCGCGCTCGCTCGCTCGCGGGGGCCAGGCGACCAAAGGTCGCCTGACGACATGTCGGCCCCCGCGAGCGAGCGAGCGCGC -76.9 1 412 GCGCGCTCGCTCGCTCGCGGGGGCCAGGCGACCAAAGGTCGCCTGACGAACGTTCGGCCCCCGCGAGCGAGCGAGCGCGC -77.3 1 413 GCGCGCTCGCTCGCTCGCGGGGGCCAGGCGACCAAAGGTCGCCTGAAGCAATTGCTGCCCCCGCGAGCGAGCGAGCGCGC -77.7 1 414 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCGGCCAAAGGCCGCCCGACACCCGGGTGGCCCCCGCGAGCGAGCGAGCGCGC -80.9 2 415 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCGGCCAAAGGCCGCCCGACGCCATGGCGGCCCCCGCGAGCGAGCGAGCGCGC -82.4 1 416 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCGGCCAAAGGCCGCCCGACGACATGTCGGCCCCCGCGAGCGAGCGAGCGCGC -80.5 1 417 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCGGCCAAAGGCCGCCCGACGAACGTTCGGCCCCCGCGAGCGAGCGAGCGCGC -80.9 1 418 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCGGCCAAAGGCCGCCCGAAGCAATTGCTGCCCCCGCGAGCGAGCGAGCGCGC -81.3 1 419 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCGACAAAATGTCGCCCGACACCCGGGTGGCCCCCGCGAGCGAGCGAGCGCGC -77.1 1 420 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCGACAAAATGTCGCCCGACGCCATGGCGGCCCCCGCGAGCGAGCGAGCGCGC -78.6 1 421 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCGACAAAATGTCGCCCGACGACATGTCGGCCCCCGCGAGCGAGCGAGCGCGC -76.7 2 422 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCGACAAAATGTCGCCCGACGAACGTTCGGCCCCCGCGAGCGAGCGAGCGCGC -77.1 2 423 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCGACAAAATGTCGCCCGAAGCAATTGCTGCCCCCGCGAGCGAGCGAGCGCGC -77.5 1 424 GCGCGCTCGCTCGCTCGCGGGGGCCAAAAGACCAAAGGTCTTTTGACACCCGGGTGGCCCCCGCGAGCGAGCGAGCGCGC -70.9 3 425 GCGCGCTCGCTCGCTCGCGGGGGCCAAAAGACCAAAGGTCTTTTGACGCCATGGCGGCCCCCGCGAGCGAGCGAGCGCGC -72.4 2 426 GCGCGCTCGCTCGCTCGCGGGGGCCAAAAGACCAAAGGTCTTTTGACGACATGTCGGCCCCCGCGAGCGAGCGAGCGCGC -70.5 2 427 GCGCGCTCGCTCGCTCGCGGGGGCCAAAAGACCAAAGGTCTTTTGACGAACGTTCGGCCCCCGCGAGCGAGCGAGCGCGC -70.9 2 428 GCGCGCTCGCTCGCTCGCGGGGGCCAAAAGACCAAAGGTCTTTTGAAGCAATTGCTGCCCCCGCGAGCGAGCGAGCGCGC -71.3 1 429 GCGCGCTCGCTCGCTCGCGGGGGCCAAAAAAAAATTTTTTTTGACACCCGGGTGGCCCCCGCGAGCGAGCGAGCGCGC -64.7 2 430 GCGCGCTCGCTCGCTCGCGGGGGCCAAAAAAAATTTTTTTTGACGCCATGGCGGCCCCCGCGAGCGAGCGAGCGCGC -65.5 1 431 GCGCGCTCGCTCGCTCGCGGGGGCCAAAAAAAATTTTTTTTGACGACATGTCGGCCCCCGCGAGCGAGCGAGCGCGC -64.9 1 432 GCGCGCTCGCTCGCTCGCGGGGGCCAAAAAAAAATTTTTTTTGACGAACGTTCGGCCCCCGCGAGCGAGCGAGCGCGC -64 2 433 GCGCGCTCGCTCGCTCGCGGGGGCCAAAAAAAAATTTTTTTTGAAGCAATTGCTGCCCCCGCGAGCGAGCGAGCGCGC -64.4 2 434 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCAGAAAAATTCTGCCCGACACCCGGGTGGCCCCCGCGAGCGAGCGAGCGCGC -75.5 1 435 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCAGAAAAATTCTGCCCGACGCCATGGCGGCCCCCGCGAGCGAGCGAGCGCGC -77 1 436 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCAGAAAAATTCTGCCCGACGACATGTCGGCCCCCGCGAGCGAGCGAGCGCGC -75.1 1 437 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCAGAAAAATTCTGCCCGACGAACGTTCGGCCCCCGCGAGCGAGCGAGCGCGC -75.5 1 438 GCGCGCTCGCTCGCTCGCGGGGGCCGGGCAGAAAAATTCTGCCCGAAGCAATTGCTGCCCCCGCGAGCGAGCGAGCGCGC -75.9 1 439 GCGCGCTCGCTCGCTCAATAAAACCAGGCGACCAAAGGTCGCCTGACACCCGGGTGGTTTTTATTGAGCGAGCGAGCGCGC -62.8 2 440 GCGCGCTCGCTCGCTCAATAAAACCAGGCGACCAAAGGTCGCCTGACGCCATGGCGGTTTTTATTGAGCGAGCGAGCGCGC -64.3 1 441 GCGCGCTCGCTCGCTCAATAAAACCAGGCGACCAAAGGTCGCCTGACGACATGTCGGTTTTTATTGAGCGAGCGAGCGCGC -62.4 1 442 GCGCGCTCGCTCGCTCAATAAAACCAGGCGACCAAAGGTCGCCTGACGAACGTTCGGTTTTATTGAGCGAGCGAGCGCGC -62.8 1 443 GCGCGCTCGCTCGCTCAATAAAACCAGGCGACCAAAGGTCGCCTGAAGCAATTGCTGTTTTTATTGAGCGAGCGAGCGCGC -63.2 1 444 GCGCGCTCGCTCGCTCAATAAAACCGGGCGGCCAAAGGCCGCCCGACACCCGGGTGGTTTTTATTGAGCGAGCGAGCGCGC -66.4 1 445 GCGCGCTCGCTCGCTCAATAAAACCGGGCGGCCAAAGGCCGCCCGACGCCATGGCGGTTTTTATTGAGCGAGCGAGCGCGC -67.9 1 446 GCGCGCTCGCTCGCTCAATAAAACCGGGCGGCCAAAGGCCGCCCGACGACATGTCGGTTTTTATTGAGCGAGCGAGCGCGC -66 1 447 GCGCGCTCGCTCGCTCAATAAAACCGGGCGGCCAAAGGCCGCCCGACGAACGTTCGGTTTTTATTGAGCGAGCGAGCGCGC -66.4 1 448 GCGCGCTCGCTCGCTCAATAAAACCGGGCGGCCAAAGGCCGCCCGAAGCAATTGCTGTTTTTATTGAGCGAGCGAGCGCGC -66.8 1 449 GCGCGCTCGCTCGCTCAATAAAACCGGGCGACAAAATGTCGCCCGACACCCGGGTGGTTTTTATTGAGCGAGCGAGCGCGC -62.6 1 450 GCGCGCTCGCTCGCTCAATAAAACCGGGCGACAAAATGTCGCCCGACGCCATGGCGGTTTTTATTGAGCGAGCGAGCGCGC -64.1 1 451 GCGCGCTCGCTCGCTCAATAAAACCGGGCGACAAAATGTCGCCCGACGACATGTCGGTTTTTATTGAGCGAGCGAGCGCGC -62.2 2 452 GCGCGCTCGCTCGCTCAATAAAACCGGGCGACAAAATGTCGCCCGACGAACGTTCGGTTTTTATTGAGCGAGCGAGCGCGC -62.6 2 453 GCGCGCTCGCTCGCTCAATAAAACCGGGCGACAAAATGTCGCCCGAAGCAATTGCTGTTTTTATTGAGCGAGCGAGCGCGC -63 1 454 GCGCGCTCGCTCGCTCAATAAAACCAAAAGACCAAAGGTCTTTTGACACCCGGGTGGTTTTTATTGAGCGAGCGAGCGCGC -56.4 2 455 GCGCGCTCGCTCGCTCAATAAAACCAAAAGACCAAAGGTCTTTTGACGCCATGGCGGTTTTTATTGAGCGAGCGAGCGCGC -57.9 2 456 GCGCGCTCGCTCGCTCAATAAAACCAAAAGACCAAAGGTCTTTTGACGACATGTCGGTTTTTATTGAGCGAGCGAGCGCGC -56 2 457 GCGCGCTCGCTCGCTCAATAAAACCAAAAGACCAAAGGTCTTTTGACGAACGTTCGGTTTTATTGAGCGAGCGAGCGCGC -56.4 2 458 GCGCGCTCGCTCGCTCAATAAAACCAAAAGACCAAAGGTCTTTTGAAGCAATTGCTGTTTTTATTGAGCGAGCGAGCGCGC -56.8 1 459 GCGCGCTCGCTCGCTCAATAAAACCAAAAAAAAATTTTTTTTGACACCCGGGTGGTTTTTATTGAGCGAGCGAGCGCGC -50.2 2 460 GCGCGCTCGCTCGCTCAATAAAACCAAAAAAAAATTTTTTTTGACGCCATGGCGGTTTTTATTGAGCGAGCGAGCGCGC -51 1 461 GCGCGCTCGCTCGCTCAATAAAACCAAAAAAAAATTTTTTTTGACGACATGTCGGTTTTTATTGAGCGAGCGAGCGCGC -50.4 1 462 GCGCGCTCGCTCGCTCAATAAAACCAAAAAAAAATTTTTTTTGACGAACGTTCGGTTTTTATTGAGCGAGCGAGCGCGC -49.5 2 463 GCGCGCTCGCTCGCTCAATAAAACCAAAAAAAAATTTTTTTTGAAGCAATTGCTGTTTTTATTGAGCGAGCGAGCGCGC -49.9 1 464 GCGCGCTCGCTCGCTCAATAAAACCGGGCAGAAAAATTCTGCCCGACACCCGGGTGGTTTTTATTGAGCGAGCGAGCGCGC -61 1 465 GCGCGCTCGCTCGCTCAATAAAACCGGGCAGAAAAATTCTGCCCGACGCCATGGCGGTTTTTATTGAGCGAGCGAGCGCGC -62.5 1 466 GCGCGCTCGCTCGCTCAATAAAACCGGGCAGAAAAATTCTGCCCGACGACATGTCGGTTTTATTGAGCGAGCGAGCGCGC -60.6 1 467 GCGCGCTCGCTCGCTCAATAAAACCGGGCAGAAAAATTCTGCCCGACGAACGTTCGGTTTTATTGAGCGAGCGAGCGCGC -61 1 468 GCGCGCTCGCTCGCTCAATAAAACCGGGCAGAAAAATTCTGCCCGAAGCAATTGCTGTTTTTATTGAGCGAGCGAGCGCGC -61.4 1

[00236] As disclosed herein, a modified ITR in a cccDNA vector prepared in accordance with methods and compositions using a single Rep protein disclosed herein can be constructed to include the deletion, insertion, or substitution of one or more nucleotides from the wild ITR type derived from the AAV genome. The modified ITR can be produced by genetic modification during plasmid propagation in Escherichia coli or as a baculovirus genome in Spodoptera frugiperda cells or by other biological methods, for example in vitro using polymerase chain reaction or chemical synthesis.

[00237] In some embodiments, a modified ITR in a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein may include the deletion, insertion, or substitution of one or more nucleotides from the AAV2 wild-type ITR (left ) (SEQ ID NO: 51) or wild-type AAV2 ITR (right) (SEQ ID NO: 1). Specifically, one or more nucleotides are deleted, inserted, or replaced from B-C' or C-C' in a T-shaped stem-loop structure. Additionally, the modified ITR does not include modification of the Rep binding elements (RBEs) and terminal resolution site (trs) of the wild-type AAV2 ITR, although the RBE' (TTT) may or may not be present depending on whether the template has undergone one round of replication , thereby converting the triplet AAA into the complementary RBE' - TTT.

[00238] Examples of three types of modified ITRs are provided: (1) a modified ITR having a lowest energy structure of one arm and one unpaired loop (“single arm/one unpaired loop structure”); (2) a modified ITR having the lowest energy single hairpin structure (“single hairpin structure”); and (3) a modified ITR having a lowest energy structure with two arms, one of which is truncated (“truncated structure”).

[00239] Modified single arm/single unpaired loop ITR.

[00240] A wild-type ITR can be modified to form a secondary structure containing one arm and one unpaired loop (ie, a “single arm/one unpaired loop structure”). The Gibbs free energy (ΔG) for unfolding a structure can range from -85 kcal/mol to -70 kcal/mol. Typical structures of modified ITRs are given.

[00241] The modified ITRs are contemplated to form a single arm/single unpaired loop structure, which may include deletion, insertion or substitution of one or more nucleotides relative to the wild type ITR in the sequences forming arms B and B' and/or arms C and C '. The modified ITR can be obtained by genetic modification or biological and/or chemical synthesis.

[00242] For example, ITR-2 left and right shown in FIG. 9A-9B (SEQ ID NOs: 101 and 102) are designed to include a two-nucleotide deletion from the C-C' arm and a 16-nucleotide deletion from the B-B' arm of the wild-type AAV2 ITR. The three nucleotides remaining in the B-B' arm of the modified ITR do not form complementary pairing. Thus, the left and right ITR-2 have the lowest energy structure with one C-C' arm and one unpaired loop. The Gibbs free energy for unfolding the structure is about -72.6 kcal/mol.

[00243] The left and right ITR-3 shown in FIG. 10A and 10B (SEQ ID NOs: 103 and 104) are designed to include 19 nucleotide deletions in the C-C' arm of the wild-type AAV2 ITR. The three nucleotides remaining in the B-B' arm of the modified ITR do not form complementary pairing. Thus, the left and right ITR-3 have the lowest energy structure with one B-B' arm and one unpaired loop. The Gibbs free energy for unfolding the structure is about -74.8 kcal/mol.

[00244] The left and right ITR-4 shown in FIG. 11A and 11B (SEQ ID NOs: 105 and 106) are designed to include 19 nucleotide deletions in the B-B' arm of the wild-type AAV2 ITR. The three nucleotides remaining in the B-B' arm of the modified ITR do not form complementary pairing. Thus, the left and right ITR-4 have the lowest energy structure with one C-C' arm and one unpaired loop. The Gibbs free energy for unfolding the structure is about -76.9 kcal/mol.

[00245] The right and left ITR-10 shown in FIG. 12A and 12B (SEQ ID NOs: 107 and 108) are designed to include 8 nucleotide deletions in the B-B' arm of the wild-type AAV2 ITR. The nucleotides remaining in the B-B' and C-C' arms form new additional bonds between motifs B and C' (left ITR-10) or between motifs C and B' (right ITR-10). Thus, the left and right ITR-10 have the lowest energy structure with one B-C' or C-B' arm and one unpaired loop. The Gibbs free energy for unfolding the structure is about -83.7 kcal/mol.

[00246] The left and right ITR-17 shown in FIG. 13A and 13B (SEQ ID NOs: 109 and 110) are designed to include 14 nucleotide deletions in the C-C' arm of the wild-type AAV2 ITR. The eight nucleotides remaining in the C-C' arm do not form additional bonds. As a result, the left and right ITR-17 have the lowest energy structure with one B-B' arm and one unpaired loop. The Gibbs free energy for unfolding the structure is about -73.3 kcal/mol.

[00247] Left and right wild-type ITR sequences (top) and various left and right modified ITRs (bottom) that are predicted to form a single arm/single unpaired loop structure are aligned and presented below in Table 7.

[00248] Table 7: Alignment of wt-ITR and modified ITRs (ITR-2, ITR-3, ITR-4, ITR-10 and ITR-17) with single-stranded/single unpaired loop.

TABLE 7 Modified ITR
(SEQ ID NO) Alignment of wild-type ITR sequences; WT-L ITR (SEQ ID NO: 540) or WT-R ITR (SEQ ID NO: 17) (upper sequence) and modified ITR sequences (SEQ ID NO: 101, 102, 103, 104, 105, 106, 107, 108, 109, 110) (lower sequences)) ΔG (kcal/mol) Left
ITR-2
(SEQ:101) 10 20 30 40 50 60
GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGG
::::::::::::::::::::::::::::::::::: :::::::::: :::
GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGGAAA--CCCGGGCGT---GCG--------
10 20 30 40
70 80 90
TCGCCCGGCCTCAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::::::
--------CCTCAGTGAGCGAGCGAGCGCGC
50 60 70 -72.6 Right
ITR-2
(SEQ:102) 10 20 30 40 50
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACG--CCCGGGCGGC
:::::::::::::::::::::::: : :::::: ::::::::::
GCGCGCTCGCTCGCTCACTGAGGC------------------GCACGCCCGGGTTTCCCGGGCGGC
10 20 30 40
60 70 80
CTCAGTGAGCGAGCGAGCGCGC
:::::::::::::::::::::::
CTCAGTGAGCGAGCGAGCGCGC
50 60 70 -72.6 Left
ITR-3
(SEQ:103) 10 20 30 40 50 60
GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGG
:::::::::::::::::::::::::::::::::::::::::::::::
GCGCGCTCGCTCGCTCACTGAGGCCG------------------TCGGGCGACCTTTGG
10 20 30 40
70 80 90
TCGCCCGGCCTCAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::::::::::::::
TCGCCCGGCCTCAGTGAGCGAGCGAGCGCGC
50 60 70 -74.8 Right
ITR-3
(SEQ:104) 10 20 30 40 50 60
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCT
::::::::::::::::::::::::::::::::::::::::::::::::: :: ::
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACG--------GCCT
10 20 30 40 50
70 80
CAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::
CAGTGAGCGAGCGAGCGCGC
60 70 -74.8 Left
ITR-4
(SEQ:105) 10 20 30 40 50 60
GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGG
::::::::::::::::::::::::::::::::::::::::::::::::::
GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGG-----------
10 20 30 40
70 80 90
TCGCCCGGCCTCAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::::::
--------CCTCAGTGAGCGAGCGAGCGCGC
50 60 70 -76.9 Right
ITR-4
(SEQ:106) 10 20 30 40 50 60
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCT
::::::::::::::::::::::::::: : : :: : :::::::::::::
GCGCGCTCGCTCGCTCACTGAGGCCG--------ACGCCCGGGCTTTGCCCGGGCGGCCT
10 20 30 40 50
70 80
CAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::
CAGTGAGCGAGCGAGCGCGC
60 70 -76.9 Left
ITR-10
(SEQ:107) 10 20 30 40 50 60
GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGG
:::::::::::::::::::::::::::::::::::::::::::::::::: : :::
GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGC----TTT--
10 20 30 40 50
70 80 90
TCGCCCGGCCTCAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::::::::::::
--GCCCGGCCTCAGTGAGCGAGCGAGCGCGC
60 70 80 -83.7 Right
ITR-10
(SEQ:108) 10 20 30 40 50
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAG---GTCGCCCGAC----GCCCGG
::::::::::::::::::::::::::::: :::: : :::::: ::::::
GCGCGCTCGCTCGCTCACTGAGGCCGGGC----AAAGCCCGACGCCCGGGCTTTGCCCGG
10 20 30 40 50
60 70 80
GCGGCCTCAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::::::::::
GCGGCCTCAGTGAGCGAGCGAGCGCGC
60 70 80 -83.7 Left
ITR-17
(SEQ:109) 10 20 30 40 50 60
gcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttgg
:::::::::::::::::::::::::::::::::::::::::::::::::::
GCGCGCTCGCTCGCTCACTGAGGCCG-------AAA-------CGTCGGGCGACCTTTGG
10 20 30 40
70 80 90
TCGCCCGGCCTCAGTGAGCGAGCGAGCGCGC
:::::::::::::::::::::::::::::::::
TCGCCCGGCCTCAGTGAGCGAGCGAGCGCGC
50 60 70 -73.3 Right
ITR-17
(SEQ:110) 10 20 30 40 50 60
gcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggcggcct
::::::::::::::::::::::::::::::::::::::::::::::::: :: ::::
gcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgttt---cggcct
10 20 30 40 50
70 80
CAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::
CAGTGAGCGAGCGAGCGCGC
60 70 -73.3

[00249] Modified ITR with single pin structure

[00250] The wild type ITR can be modified to obtain the lowest energy structure including a single hairpin structure. The Gibbs free energy (ΔG) for unfolding a structure can range from -70 kcal/mol to -40 kcal/mol. Typical structures of modified ITRs are shown in Fig. 14A and 14B.

[00251] The modified ITRs are contemplated to form a single hairpin structure, which may include deletion, insertion, or substitution of one or more nucleotides relative to the wild-type ITR in the sequences forming arms B and B' and/or arms C and C'. The modified ITR can be obtained by genetic modification or biological and/or chemical synthesis.

[00252] For example, the left and right ITR-6 shown in FIG. 14A-14B (SEQ ID NOs: 111 and 112), include deletions of 40 nucleotides in arms B-B' and C-C' compared to the wild-type AAV2 ITR. The nucleotides remaining in the modified ITR are predicted to form a single hairpin structure. The Gibbs free energy for unfolding the structure is about -54.4 kcal/mol.

[00253] The wild-type and ITR-6 ITR sequences (both left and right) have been aligned and are presented below in Table 8.

[00254] Table 8: Alignment of wt-ITR and modified ITR-6 with single hairpin structure

TABLE 8 Modified ITR
(SEQ ID NO) Alignment of wild-type ITR sequences; WT-L ITR (SEQ ID NO: 540) or WT-R ITR (SEQ ID NO: 543) (upper sequence)) and modified ITR-6 (SEQ ID NO: 111; ITR-6, left) (SEQ ID No. : 544, ITR-6, right) (lower sequence) ΔG (kcal/mol) Left
ITR-6
(SEQ:111) 10 20 30 40 50 60
GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGG
::::::::::::::::::::::::: ::::::
GCGCGCTCGCTCGCTCACTGAGGC--------AAAGCC---------------------
10 20 30
70 80 90
TCGCCCGGCCTCAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::::
----------TCAGTGAGCGAGCGAGCGCGC
40 50 -54.4 Right
ITR-6 (SEQ:544) 80 70 60 50 40 30
, GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCT
::::::::::::::::::::::::: :::: :::
, GCGCGCTCGCTCGCTCACTGAGGCC-------------------TTTG---------CCT
10 20
20 10
, CAGTGAGCGAGCGAGCGCGC (SEQ ID NO: 543)
::::::::::::::::::::
, CAGTGAGCGAGCGAGCGCGC (SEQ ID NO: 544)
40 50 -54.4

[00255] Modified ITR with truncated structure

[00256] The wild-type ITR can be modified to have a lowest energy structure consisting of two arms, one of which is truncated. Their Gibbs free energy (ΔG) for unfolding ranges from -90 to -70 kcal/mol. Thus, their free energies for Gibbs unfolding are lower than the wild-type AAV2 ITR.

[00257] Modified ITRs may include the deletion, insertion, or substitution of one or more nucleotides relative to the wild-type ITR in the sequences forming arms B and B' and/or arms C and C'. In some embodiments, the modified ITR may, for example, include deleting an entire particular loop, such as an A-A' loop, a B-B' loop, or a C-C' loop, or alternatively, deleting 1, 2, 3, 4, 5, 6 , 7, 8, 9 or more base pairs forming a stem loop, provided that the last loop at the end of the stem is still present. The modified ITR can be obtained by genetic modification or biological and/or chemical synthesis.

[00258] Typical structures of modified truncated ITRs are shown in FIG. 15A-15B.

[00259] The sequences of the various modified ITRs are predicted to form a truncated structure, aligned with the wild-type ITR sequence, and are presented below in Table 9.

[00260] Table 9: Alignment of wt-ITR and modified ITRs (ITR-5, ITR-7, ITR-8, ITR-9, ITR-11, ITR-12, ITR-13, ITR-14, ITR-1 and ITR-16) with a truncated structure.

TABLE 9 Modified ITR
(SEQ ID NO) Sequence alignment: wild-type ITR; WT-L ITR (SEQ ID NO: 540) or WT-R ITR (SEQ ID NO: 17) (upper sequence) and modified ITR (SEQ ID NO: 545 and 116-134) (lower sequence) ΔG (kcal/mol) Left
ITR-5
(SEQ:545) 10 20 30 40 50 60
gcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttgg
::::::::::::::::::::::::::::::::::::::::::::::::::
gcgcgctcgctcgctcactgaggc------------gcccgggcgtcgggcgacctttgg
10 20 30 40
70 80 90
tcgcccggcctcagtgagcgagcgagcgcgc
::::::::::::::::::::::::::::::::
tcgcccggcctcagtgagcgagcgagcgcgc (SEQ ID NO: 545)
50 60 70 -73.4 Right
ITR-5
(SEQ:116) 10 20 30 40 50 60
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCT
:::::::::::::::::::::::::::::::::::::::::::::::::: :::::: :::
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCG-CCT
10 20 30 40 50
70 80
CAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::
CAGTGAGCGAGCGAGCGCGC
60 70 -73.4 Left
ITR-7
(SEQ:117) 10 20 30 40 50 60
gcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttgg
:::::::::::::::::::::::::::::::::::::::::::::::::: :::: :: :
gcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgac--tttg
10 20 30 40 50
70 80 90
tcgcccggcctcagtgagcgagcgagcgcgc
::::::::::::::::::::::::::::::::
tcgcccggcctcagtgagcgagcgagcgcgc
60 70 80 -89.6 Right
ITR-7
(SEQ:118) 10 20 30 40 50
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGC-----
:::::::::::::::::::::::::::::::::::: ::::::::::::::::: ::
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACAAA--GTCGCCCGACGCCCGGGCTTTGC
10 20 30 40 50
60 70 80
------GGCCTCAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::::::::
CCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC
60 70 80 -89.6 Left
ITR-8
(SEQ:119) 10 20 30 40 50 60
gcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttgg
:::::::::::::::::::::::::::::::::::::::::::::::::: ::: :::
gcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcga--ttt--
10 20 30 40 50
70 80 90
tcgcccggcctcagtgagcgagcgagcgcgc
::::::::::::::::::::::::::::::::
tcgcccggcctcagtgagcgagcgagcgcgc
60 70 80 -86.9 Right
ITR-8
(SEQ:120) 10 20 30 40 50
gcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggc-----
::::::::::::::::::::::::::::::: ::: :::::::::::::::: :
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGA--AAA--TCGCCCGACGCCCGGGCTTTGC
10 20 30 40 50
60 70 80
------GGCCTCAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::::::::
CCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC
60 70 80 -86.9 Left
ITR-9
(SEQ:121) 10 20 30 40 50 60
GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGG
:::::::::::::::::::::::::::::::::::::::::::::::::: :: ::
GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCG----TT--
10 20 30 40 50
70 80 90
TCGCCCGGCCTCAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::::::::::::::
TCGCCCGGCCTCAGTGAGCGAGCGAGCGCGC
60 70 80 -85.0 Right
ITR-9
(SEQ:122) 10 20 30 40 50
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGC-----
:::::::::::::::::::::::::::::::::::::::::::::::::::
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGA--AA----CGCCCCGACGCCCGGGCTTTGC
10 20 30 40 50
60 70 80
------GGCCTCAGTGAGCGAGCGAGCGCGC
CCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC
60 70 80 -85.0 Left
ITR-11
(SEQ:123) 10 20 30 40 50 60
GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGG
:::::::::::::::::::::::::::::::::::: ::::::::::::::::: :::::::
GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGGAAA--CCCGGGCGTCGGGCGACCTTTGG
10 20 30 40 50
70 80 90
TCGCCCGGCCTCAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::::::::::::::
TCGCCCGGCCTCAGTGAGCGAGCGAGCGCGC
60 70 80 -89.5 Right
ITR-11
(SEQ:124) 10 20 30 40 50
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGG------
:::::::::::::::::::::::::::::::::::::::::::::::::: ::::
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGTTTCCC
70 80 90 100 110 120
60 70 80
---CGGCCTCAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::::::::::
GGGCGGCCTCAGTGAGCGAGCGAGCGCGC
130 140 150 -89.5 Left
ITR-12
(SEQ:125) 10 20 30 40 50 60
GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGG
::::::::::::::::::::::::::::::: ::: :::::::::::::::: ::::::
GCGCGCTCGCTCGCTCACTGAGGCCGCCCGG--AAA-CCGGGCGTCGGGCGACCTTTGG
10 20 30 40 50
70 80 90
TCGCCCGGCCTCAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::::::::::::::
TCGCCCGGCCTCAGTGAGCGAGCGAGCGCGC
60 70 80 -86.2 Right
ITR-12
(SEQ:126) 10 20 30 40 50
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCG-------
:::::::::::::::::::::::::::::::::::::::::::::::::: :::
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGTTTCCGG
10 20 30 40 50 60
60 70 80
GCGGCCTCAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::::::::::
GCGGCCTCAGTGAGCGAGCGAGCGCGC
70 80 -86.2 Left
ITR-13
(SEQ:127) 10 20 30 40 50 60
GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGG
::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: ::::
GCGCGCTCGCTCGCTCACTGAGGCCGCCCG---AAA---CGGGCGTCGGGCGACCTTTGG
10 20 30 40 50
70 80 90
TCGCCCGGCCTCAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::::::::::::::
TCGCCCGGCCTCAGTGAGCGAGCGAGCGCGC
60 70 80 -82.9 Right
ITR-13
(SEQ:128) 10 20 30 40 50
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCG-----GGC
:::::::::::::::::::::::::::::::::::::::::::::::::: :: :::
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGTTTCGGGC
10 20 30 40 50 60
60 70 80
GGCCTCAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::::::::
GGCCTCAGTGAGCGAGCGAGCGCGC
70 80 -82.9 Left
ITR-14
(SEQ:129) 10 20 30 40 50 60
GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGG
:::::::::::::::::::::::::::::::::::::::::::::::::::::::::: ::
GCGCGCTCGCTCGCTCACTGAGGCCGCCC----AAAG----GGCGTCGGGCGACCTTTTGG
10 20 30 40 50
70 80 90
TCGCCCGGCCTCAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::::::::::::::
TCGCCCGGCCTCAGTGAGCGAGCGAGCGCGC
60 70 80 -80.5 Right
ITR-14
(SEQ:130) 10 20 30 40 50
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCC---GGGCGG
:::::::::::::::::::::::::::::::::::::::::::::::::: : ::::::
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCTTTGGGCGG
10 20 30 40 50 60
60 70 80
CCTCAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::::::
CCTCAGTGAGCGAGCGAGCGCGC
70 80 -80.5 Left
ITR-15
(SEQ:131) 10 20 30 40 50 60
GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGG
::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
GCGCGCTCGCTCGCTCACTGAGGCCGCC-----AAAG-----GCGTCGGGCGACCTTTGG
10 20 30 40 50
70 80 90
TCGCCCGGCCTCAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::::::::::::::
TCGCCCGGCCTCAGTGAGCGAGCGAGCGCGC
60 70 80 -77.2 Right
ITR-15
(SEQ:132) 10 20 30 40 50
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCG-GGCGGCC
:::::::::::::::::::::::::::::::::::::::::::::::::: :::::::
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCTTTGGCGGCC
10 20 30 40 50 60
60 70 80
TCAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::::
TCAGTGAGCGAGCGAGCGCGC
70 80 -77.2 Left
ITR-16
(SEQ:133) 10 20 30 40 50 60
GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGG
::::::::::::::::::::::::::: ::::: ::::::::::::::::
GCGCGCTCGCTCGCTCACTGAGGCCGC------AAAGC------GTCGGGCGACCTTTTGG
10 20 30 40
70 80 90
TCGCCCGGCCTCAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::::::::::::::
TCGCCCGGCCTCAGTGAGCGAGCGAGCGCGC
50 60 70 -73.9 Right
ITR-16
(SEQ:134) 10 20 30 40 50 60
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCT
:::::::::::::::::::::::::::::::::::::::::::::::::: : ::::::
GCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCTTTG-CGGCCT
10 20 30 40 50
70 80
CAGTGAGCGAGCGAGCGCGC
::::::::::::::::::::
CAGTGAGCGAGCGAGCGCGC
60 70 -73.9

[00261] Additional exemplary modified ITRs in each of the above classes for use in a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein are presented in Tables 10A and 10B. The predicted secondary structure of the right modified ITRs in Table 10A is shown in FIG. 26A, and the predicted secondary structure of the left modified ITRs in Table 10B is shown in FIG. 26B.

[00262] Table 10A and Table 10B show typical right-handed and left-handed modified ITRs in a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein.

[00263] Table 10A: Typical Right Modified ITRs. These typical modified right ITRs may contain the RBE GCGCGCTCGCTCGCTC-3′ (SEQ ID NO: 531), the spacer ACTGAGGC (SEQ ID NO: 532), the spacer complement GCCTCAGT (SEQ ID NO: 535) and the RBE' (i.e., the complement RBE ) GAGCGAGCGAGCGCGC (SEQ ID NO: 536).

Table 10A: Typical Right Modified ITRs ITR construct Subsequence SEQ ID NO: ITR-18 right AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCGCACGCCCGGGTTTCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG 469 ITR-19 right AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG 470 ITR-20 right AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG 471 ITR-21 right AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCTTTGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG 472 ITR-22 right AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACAAAGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG 473 ITR-23 right AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGAAAATCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG 474 ITR-24 right AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGAAACGCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG 475 ITR-25 right AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCAAAGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG 476 ITR-26 right AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGTTTCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG 477 ITR-27 right AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGTTTCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG 478 ITR-28 right AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGTTTCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG 479 ITR-29 right AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCTTTGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG 480 ITR-30 right AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCTTTGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG 481 ITR-31 right AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCTTTGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG 482 ITR-32 right AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGTTTCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG 483 ITR-49 right AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGGCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG 99 ITR-50 right AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG 100

[00264] TABLE 10B: Representative modified left-handed ITRs in a cccDNA vector prepared in accordance with methods and compositions using a single Rep protein as disclosed herein. These examples of modified left ITRs may contain the RBE GCGCGCTCGCTCGCTC-3′ (SEQ ID NO: 531), the spacer ACTGAGGC (SEQ ID NO: 532), the spacer complement GCCTCAGT (SEQ ID NO: 535), and the complement RBE (RBE') GAGCGAGCGAGCGCGC (SEQ ID NO: 536).

Table 10B: Typical Modified Left ITRs ITR-33 left CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGGAAACCCGGGCGTGCGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT 484 ITR-34 left CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT 485 ITR-35 left CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT 486 ITR-36 left CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT 487 ITR-37 left CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCAAAGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT 488 ITR-38 left CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACTTTGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT 489 ITR-39 left CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGATTTTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT 490 ITR-40 left CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGTTTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT 491 ITR-41 left CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCTTTGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT 492 ITR-42 left CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGGAAACCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT 493 ITR-43 left CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGAAACCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT 494 ITR-44 left CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGAAACGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT 495 ITR-45 left CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCAAAGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT 496 ITR-46 left CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCAAAGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT 497 ITR-47 left CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCAAAGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT 498 ITR-48 left CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGAAACGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT 499

[00265] In embodiments of the present invention, a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein does not contain modified ITRs having a nucleotide sequence selected from any of the following SEQ ID Nos: 550, 551, 552, 553, 553, 554, 555, 556 and 557.

[00267] To the extent that a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein has a modified ITR that has one of the modifications at the B, B', C, or C region ' as described in SEQ ID NO: 550-557, as defined in one or more claims of this application, or in any invention to be defined in amended claims that may hereafter be filed in this application or in any patent derived from it, and to the extent that the laws of any relevant country or countries to which certain requirements apply, the right is hereby reserved to deny said disclosure of the claims of this application or any patent derived therefrom, to the extent to the extent necessary to prevent the invalidation of the application or any other patent obtained thereunder.

[00267] For example, without limitation, the right is reserved to refuse consideration of any of the following items from any claim of this application, now or as hereafter amended, or any patent derived therefrom:

[00268] A. a modified ITR selected from any of the group consisting of: SEQ ID NO: 2, 52, 63, 64, 113, 114, 550, 551; 552, 553, 553, 554, 555, 556, 557, used in a cccDNA vector prepared in accordance with methods and compositions using a single Rep protein as described herein, without a regulatory switch

[00269] B. the above modified ITRs in A., in a cccDNA vector prepared in accordance with methods and compositions using a single Rep protein as described herein, without a regulatory sequence, in which the heterologous nucleic acid encodes ABCA4, USA2A var1 , VEGFR CEP290, factor VIII BDD (FVIII), factor VIII, vWF_His, vWF, lecithin-cholesterol acetyltransferase, PAH, G6PC or CFTR

VI. Regulatory elements.

[00270] The composition used in methods for producing a cccDNA vector, for example, a cccDNA vector as described herein, or an AAV vector, contains a nucleic acid sequence encoding a single modified Rep protein, may further contain a regulatory element, for example, a cis-regulatory element element, as described herein, before or operably linked to a nucleic acid encoding a single modified Rep protein. For example, a nucleotide sequence encoding a modified Rep protein, such as encoding a modified Rep 78 protein, but not containing a functional initiation codon to encode Rep 52 protein or splice sites for exon skipping to produce Rep 68 or Rep40, is operably linked to a regulatory element, e.g. , a cis-regulatory element.

[00271] In one embodiment, the nucleotide sequence encoding a single Rep protein used in the compositions and methods disclosed herein includes an expression control sequence, such as a promoter, cis-regulatory elements, or a regulatory switch as described herein, located upstream of the initiation codon of a nucleotide sequence encoding the parvovirus Rep78 protein, wherein the nucleic acid sequence does not have a functional initiation codon for Rep52 and/or splice sites for exon skipping to produce Rep 68 or Rep40. In one embodiment, the nucleotide sequence encoding a single Rep protein used in the compositions and methods disclosed herein includes an expression control sequence upstream of the initiation codon of the nucleotide sequence encoding the parvovirus Rep78 protein, wherein the nucleic acid sequence does not have functional splice sites for encoding Rep68.

[00272] Likewise, a cccDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein can be produced from expression constructs that further contain a particular combination of cis-regulatory elements. Cis-regulatory elements include, but are not limited to, a promoter, a riboswitch, an insulator, a miR-regulated element, a post-transcriptional regulatory element, a tissue-specific and cell-specific promoter, and an enhancer. In some embodiments, the ITR may act as a promoter for a transgene. In some embodiments, the cccDNA vector contains additional components for regulating expression of the transgene, such as regulatory switches as described herein to regulate expression of the transgene, or a “kill switch” that is capable of killing a cell containing the cccDNA vector.

[00273] A cctDNA vector produced in accordance with methods and compositions using a single Rep protein as disclosed herein can be produced from expression constructs that further contain a specific combination of cis-regulatory elements, such as the post-transcriptional regulatory element WHP ( WPRE) (eg, SEQ ID NO: 8) and poly(A) BGH (SEQ ID NO: 9). Suitable expression cassettes for use in expression constructs do not have the packaging restrictions imposed by the viral capsid. The expression cassettes of this invention include a promoter that can influence overall expression levels as well as cell specificity. For transgene expression, they may include a highly active viral-derived immediate early promoter. Expression cassettes may contain tissue-specific eukaryotic promoters to restrict transgene expression to specific cell types and reduce toxic effects and immune responses caused by unregulated ectopic expression.

[00274] In preferred embodiments, promoters or regulatory elements for use in expressing a modified single Rep protein or in an expression cassette of a cccDNA vector produced by the methods described herein may comprise a synthetic regulatory element, such as a CAG promoter (SEQ ID NO: 3). The CAG promoter contains (i) the cytomegalovirus (CMV) early enhancer element, (ii) the promoter, first exon, and first intron of the chicken beta-actin gene, and (iii) the splice acceptor of the rabbit beta-globin gene. Alternatively, promoters or regulatory elements for use in expressing a modified single Rep protein or in an expression cassette of a cccDNA vector produced by the methods described herein may comprise an alpha-1-antripsin (AAT) promoter (SEQ ID NO: 4 or SEQ ID NO: 74 ), liver-specific (LP1) promoter (SEQ ID NO: 5 or SEQ ID NO: 16) or human elongation factor-1-alpha (EF1a) promoter (eg, SEQ ID NO: 6 or SEQ ID NO: 15). In some embodiments, promoters or regulatory elements for use in expressing a modified single Rep protein or in an expression cassette of a cccDNA vector produced by the methods described herein are selected from one or more constitutive promoters, such as a retrovirus. a Rous sarcoma virus (RSV) LTR promoter (optionally with an RSV enhancer) or a cytomegalovirus (CMV) immediate early promoter (optionally with a CMV enhancer, e.g., SEQ ID NO: 22). Alternatively, an inducible promoter, a native promoter for a transgene, a tissue-specific promoter, or various promoters known in the art can be operably linked to a nucleic acid encoding a modified single Rep protein or in an expression cassette of a cccDNA vector produced by the methods disclosed herein.

[00275] Suitable promoters, including those described above, may be derived from viruses and may thus be referred to as viral promoters, or they may be derived from any organism, including prokaryotic or eukaryotic organisms. Suitable promoters can be used to drive expression by any RNA polymerase (eg, pol I, pol II, pol III). Exemplary promoters that may be operably linked to a nucleic acid encoding a modified single Rep protein or to a cccDNA vector expression cassette produced by the methods described herein include, but are not limited to, the SV40 early promoter, the murine mammary tumor virus long terminal repeat promoter ( LTR); adenoviral large late promoter (Ad MLP); herpes simplex virus (HSV) promoter, cytomegalovirus (CMV) promoter such as the CMV immediate early (CMVIE) promoter region, Rous sarcoma virus (RSV) promoter, human small nuclear RNA U6 promoter (U6, e.g., SEQ ID NO: 18) (Miyagishi et al., Nature Biotechnology 20, 497-500 (2002)), enhanced U6 promoter (e.g. Xia et al., Nucleic Acids Res. 2003 Sep. 1; 31(17)), human H1 promoter (H1) (eg, SEQ ID NO: 19), CAG promoter, human alpha-1 antitrypsin (HAAT) promoter (eg, SEQ ID NO: 21), etc. In embodiments, the promoters are modified at the intron-containing 3′ end to include one or more nuclease cleavage sites. In some embodiments, the DNA containing the nuclease cleavage site(s) is foreign to the promoter DNA.

[00276] A promoter may contain one or more specific transcriptional regulatory sequences to further enhance expression, and/or to alter expression spatially and/or temporally. The promoter may also include distal enhancer or repressor elements, which may be located several thousand base pairs away from the transcription start site. The promoter can come from sources including viruses, bacteria, fungi, plants, insects and animals. A promoter may regulate expression of a gene component constitutively or differentially with respect to the cell, tissue or organ where expression occurs, or with respect to the developmental stage at which expression occurs, or in response to external stimuli such as physiological stresses, pathogens, metal ions or inducing agents. Representative examples of promoters that may be operably linked to a nucleic acid encoding a modified single Rep protein or to a cccDNA vector expression cassette produced by the methods described herein include, but are not limited to, bacteriophage T7 promoter, bacteriophage T3 promoter, SP6 promoter, operator promoter lac, tac promoter, SV40 late promoter, SV40 early promoter, RSV-LTR promoter, CMV IE promoter, SV40 early promoter or SV40 late promoter and CMV IE promoter, as well as the promoters listed below. Such promoters and/or enhancers can be used to express any gene of interest, for example, gene editing molecules, donor sequence, therapeutic proteins, and the like. For example, the vector may contain a promoter that is operably linked to a nucleic acid sequence encoding a therapeutic protein. Said promoter operably linked to the coding sequence of the therapeutic protein may be a simian virus 40 (SV40) promoter, a murine mammary tumor virus (MMTV) promoter, a human immunodeficiency virus (HIV) promoter, such as a long terminal repeat (LTR) virus promoter bovine immunodeficiency virus (BIV) promoter, Moloney virus promoter, avian leukemia virus (ALV) promoter, cytomegalovirus (CMV) promoter such as CMV early promoter, Epstein-Barr virus (EBV) promoter or Rous sarcoma virus (RSV) promoter. In some embodiments, the promoter may also be a human gene promoter, such as human ubiquitin C (hUbC), human actin, human myosin, human hemoglobin, human muscle creatine, or human metallothionein. The promoter may also be a tissue-specific promoter, such as a liver-specific promoter, such as the human alpha-1 antitrypsin (HAAT) promoter, natural or synthetic. In one embodiment, delivery to the liver can be achieved using endogenous ApoE-specific targeting of a cccDNA vector-containing composition to hepatocytes via the low-density lipoprotein (LDL) receptor present on the surface of hepatocytes.

[00277] In one embodiment, the promoter used is the native promoter of a gene encoding a therapeutic protein. The promoters and other regulatory sequences of the corresponding genes encoding therapeutic proteins are known and have been characterized. The promoter region used may further include one or more additional regulatory sequences (eg, native), such as enhancers (eg, SEQ ID NO: 22 and SEQ ID NO: 23).

[00278] Non-limiting examples of suitable promoters for use in the expression of a modified single Rep protein or cccDNA vector produced by the methods described herein include the CAG promoter, for example (SEQ ID NO: 3), the HAAT promoter (SEQ ID NO: 21), the EF1 promoter human -α (SEQ ID NO: 6) or a fragment of the EF1a promoter (SEQ ID NO: 15), the IE2 promoter (eg, SEQ ID NO: 20) and the rat EF1-α promoter (SEQ ID NO: 24).

[00279] Polyadenylation sequences: In some embodiments, the sequence encoding the polyadenylation sequence may be operably linked to a nucleic acid encoding a modified single Rep protein or a cccDNA vector produced by the methods described herein to stabilize the expressed mRNA, and/or to assist with nuclear export and broadcast. In one embodiment, the construct comprising a nucleic acid encoding a single modified Rep protein or a cccDNA vector produced by the methods described herein does not include a polyadenylation sequence. In other embodiments, a construct comprising a nucleic acid encoding a single modified Rep protein or cccDNA vector produced by the methods described herein comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 45, at least 50 or more adenine dinucleotides. In some embodiments, the polyadenylation sequence is about 43 nucleotides, about 40-50 nucleotides, about 40-55 nucleotides, about 45-50 nucleotides, about 35-50 nucleotides, or any range between these values.

[00280] A construct containing a nucleic acid encoding a single modified Rep protein, or a cccDNA vector produced by the methods described herein, may include a polyadenylation sequence known in the art, or a variant thereof, for example, a naturally occurring sequence isolated from bovine BGHpA (eg, SEQ ID NO: 74), or from viral SV40pA (eg, SEQ ID NO: 10), or a synthetic sequence (eg, SEQ ID NO: 27). Some expression cassettes also include the SV40 5' late poly(A) signal enhancer (USE) sequence. In some embodiments, these USEs may be used in combination with SV40pA or a heterologous poly(A) signal.

[00281] These expression cassettes may also include a post-transcriptional element to enhance expression of the transgene. In some embodiments, a woodchuck hepatitis virus (WHP) post-transcriptional regulatory element (WPRE) is used to enhance transgene expression (eg, SEQ ID NO: 8). Other post-transcriptional processing elements may be used, such as a post-transcriptional element of the herpes simplex virus or hepatitis B virus (HBV) thymidine kinase gene. Secretory sequences, such as VH-02 and VK-A26 sequences, such as SEQ ID NO: 25 and SEQ ID NO: 26, can be attached to the transgenes.

VI. Regulatory switches

[00282] A molecular regulatory switch is a switch that generates a measurable change of state in response to a signal. Such regulatory switches can be advantageously combined with a construct containing a nucleic acid encoding a modified single Rep protein or a cccDNA vector prepared by the methods described herein to control the yield of the ccDNA vector. In some embodiments, a construct comprising a nucleic acid encoding a single modified Rep protein or a cccDNA vector produced by methods described herein comprises a regulatory switch that serves to fine-tune the expression of a single Rep protein or transgene in the cccDNA vector. For example, it may serve to provide a biocontainment function to the cDNA vector. In some embodiments, the switch is a “toggle” switch that is designed to start or stop (ie, stop) expression of a gene of interest in cccDNA in a controlled and regulated manner. In some embodiments, the switch may include a "kill switch" that may instruct a cell containing the cccDNA vector to initiate programmed cell death upon activation of the switch.

[00283] A. Binary Regulator Switches

[00284] In some embodiments, the cDNA vector contains a regulator that can serve to controllably modulate transgene expression. In such an embodiment, said expression cassette located between the ITRs of the cccDNA vector may further comprise a regulatory region, such as a promoter, cis-element, repressor, enhancer, etc., operably linked to the gene of interest, wherein said regulatory region regulates one or more cofactors or exogenous agents. Accordingly, in one embodiment, transcription and expression of the gene of interest from the cccDNA vector will occur only when said one or more cofactors or exogenous agents are present in the cell. In another embodiment, one or more cofactors or exogenous agents can be used to derepress transcription and expression of a gene of interest.

[00285] Any nucleic acid regulatory regions known to one of ordinary skill in the art may be used in a cccDNA vector designed to contain a regulatory switch. In a non-limiting example, regulatory regions may modulate small molecule switches or inducible or repressible promoters. Non-limiting examples of inducible promoters are hormone inducible or metal inducible promoters. Other examples of inducible promoter/enhancer elements include, but are not limited to, the RU486 inducible promoter, the ecdysone inducible promoter, the rapamycin inducible promoter, and the metallothionein promoter. The use of classical switches based on tetracycline or other antibiotics, including those described in the source: (Fussenegger et al., Nature Biotechnol. 18: 1203-1208 (2000)) is envisaged.

[00286] B. Small Molecule Regulatory Switches

[00287] Various small molecule regulatory switches known in the art are known in the art and can be combined with cccDNA vectors as described herein to form a regulatory switch-controlled cccDNA vector. In some embodiments, said regulatory switch may be selected from any one or combination of the following: an orthogonal ligand/nuclear receptor pair, e.g., retinoid receptor variant/LG335 and GRQCIMFI, along with an artificial promoter controlling expression of an operably linked transgene, e.g. as described in: Taylor, et al. BMC Biotechnology 10 (2010): 15; engineered steroid receptors, such as a modified C-terminal truncated progesterone receptor that is unable to bind progesterone but binds RU486 (mifepristone) (US Patent No. 5,364,791); Drosophila ecdysone receptor and their ecdysteroid ligands (Saez, et al., PNAS, 97(26)(2000), 14512-14517; or the antibiotic trimethoprim (TMP) switch as described in Sando R 3 ^rd ; Nat Methods 2013, 10(11):1085-8.

[00288] Other small molecule regulatory switches known to one of ordinary skill in the art are also contemplated for use in controlling transgene expression of cccDNA and include, but are not limited to, those described in: Buskirk et al., Cell; Chem and Biol., 2005; 12(2); 151-161; abscisic acid sensitive positive switch; such as described in: Liang, F.-S., et al., (2011) Science Signaling, 4(164); exogenous L-arginine-sensitive positive switches, such as those described in Hartenbach, et al. Nucleic Acids Research, 35(20), 2007, synthetic bile acid-sensitive positive switches such as those described in: Rössger et al., Metab Eng. 2014, 21: 81-90; biotin-sensitive positive switches such as those described in Weber et al., Metab. Eng. Mar 2009; 11(2): 117-124; benzoate/vanillin supplement-sensitive dual input regulatory switches such as those described in Xie et al., Nucleic Acids Research, 2014; 42(14);e116; 4-hydroxytamoxifen sensitive switches such as those described in: Giuseppe et al., Molecular Therapy, 6(5), 653-663; and flavonoid (phloretin)-sensitive regulatory switches such as those described in Gitzinger et al., Proc. Natl. Acad. Sci. U S A. 2009 Jun 30; 106(26): 10638-10643.

[00289] In some embodiments, the regulatory switch for controlling the transgene or expressed by the cccDNA vector is a switch for activating prodrugs, such as those described in US Pat. Nos. 8,771,679 and 6,339,070.

[00290] Examples of regulatory switches for use in cDNA vectors include, but are not limited to, those presented in Table 11.

[00291] C. Regulatory switches "with access code"

[00292] In some embodiments, said control switch may be a "passcode switch" or a "passcode circuit." Switches with an access code allow you to fine-tune the control of transgene expression from a cDNA vector when specific conditions arise - that is, a combination of conditions must be met to implement transgene expression and/or repression. For example, for transgene expression to occur, at least conditions A and B must occur. A regulatory access code switch may require any number of conditions to occur, for example, at least 2 conditions, or at least 3, or either must occur for transgene expression to occur. at least 4, or at least 5, or at least 6, or at least 7 or more conditions. In some embodiments, at least 2 conditions must occur (eg, conditions A, B); in some embodiments, at least 3 conditions must occur (eg, A, B, and C, or A, B, and D). According to a non-limiting example, to perform gene expression with cccDNA containing a regulatory switch with access code "ABC", conditions A, B and C must be met. Conditions A, B and C may be as follows; condition A represents the presence of a condition or disease, condition B represents a hormonal response, and condition C represents a response to transgene expression. In a non-limiting exemplary example, where the transgene is insulin, condition A is satisfied if the subject has diabetes, condition B is high blood sugar, and condition C is the level of endogenous insulin when it is underexpressed. Once the sugar level drops or the required insulin level is reached, the transgene (eg insulin) is “turned off” until the above 3 conditions occur again, “turning it on” again. In another typical example, if the transgene is EPO, condition A is the presence of chronic kidney disease (CKD), condition B is satisfied under hypoxic conditions in the subject's kidneys, condition C is satisfied when the recruitment of erythropoietin-producing cells (EPC) to the kidneys is impaired ; or, alternatively, impaired HIF-2 activation. Once the oxygen level rises or the required EPO level is reached, the transgene (eg EPO) is "turned off" until the above 3 conditions occur again to "turn it on" again.

[00293] Access code regulatory switches are suitable for fine tuning transgene expression from a cccDNA vector. For example, a passcode regulatory switch may be modular, that is, it contains multiple switches, such as a tissue-specific inducible promoter that is turned on only in the presence of a certain level of a metabolite. In this embodiment, to achieve transgene expression from a cccDNA vector, the inducible agent must be present (condition A) in the desired cell type (condition B), and the level of the metabolite must be equal to, above, or below a certain threshold value (condition C). In alternative embodiments, said regulatory passcode switch may be designed such that transgene expression is "on" when conditions A and B are met, but "off" when condition C is met. This embodiment is useful when meeting condition C is a direct result expression of the transgene - that is, condition C is used as positive feedback to turn off transgene expression from the cccDNA vector after said transgene has had sufficient of the desired therapeutic effect.

[00294] In some embodiments, a passcode regulatory switch for use in a cccDNA vector is disclosed in WO2017/059245, the contents of which are incorporated herein by reference in their entirety, which describes a switch called a “passcode switch” ( "Passcode switch" or "Passcode circuit" or "Passcode kill switch", which is a synthetic biological circuit that uses hybrid transcription factors (TFs) to construct complex requirements for environmental conditions for cell survival. The access code regulatory switches described in WO2017/059245 are particularly suitable for use in cccDNA vectors because they are modular and tunable, both in terms of the environmental conditions that control circuit activation and the output modules that control cell fate. In addition, the access code strand in particular is suitable for use in cccDNA vectors because, without proper access code molecules, it allows transgene expression to occur only when the necessary predefined conditions are met. In the event that something unexpected happens to the cell, or for some reason transgene expression is no longer needed, an appropriate “safety switch” (i.e., blocking switch) can be activated.

[00295] In some embodiments, a passcode regulatory switch or “passcode circuit” provided for use in a cccDNA vector comprises hybrid transcription factors (TFs) to expand the range and complexity of environmental signals used to set biocontainment conditions. Unlike a blocking switch, which triggers cell death when a predetermined condition is met, a passcode circuit ensures cell survival or transgene expression in the presence of a specific passcode and can be easily reprogrammed to allow transgene expression and/or survival cells only when a predetermined environmental condition is met or an access code is present.

[00296] In one aspect, a passcode system that restricts cell growth to the presence of a predetermined set of at least two selected agents includes one or more nucleic acid constructs encoding expression modules, including: i) a toxin expression module that encodes a toxin that is toxic to the host cell, characterized in that the sequence encoding the toxin is functionally linked to the P1 promoter, the repression of which occurs upon binding of the first hybrid repressor protein hRP1; ii) an expression module of the first hybrid repressor protein, which encodes the first hybrid repressor protein hRP1, characterized in that the expression of hRP1 is controlled by a logical AND element formed by two hybrid transcription factors hTF1 and hTF2, the binding or activity of which depends on agents A1 and A2, respectively , such that both agents A1 and A2 are required for hRP1 expression, and in the absence of A1 or A2, hRP1 expression is insufficient to repress the P1 toxin promoter module and produce toxin, such that the host cell dies. In this system, the hybrid factors, hTF1, hTF2 and hRP1, all contain an environment-sensitive module from one transcription factor and a DNA recognition module from another transcription factor, which makes the binding of the corresponding regulatory switch to the access code sensitive to the presence of an environment agent, A1 or A2, which is different from the agent to which the corresponding subunits typically bind in nature.

[00297] Accordingly, the cccDNA vector may contain a “passcode regulatory circuit” that requires the presence and/or absence of specific molecules to activate the output module. In some embodiments, when genes encoding cellular toxins are placed in an output module, the access coded regulatory circuit can be used not only to regulate transgene expression, but also to create a "safety switch" mechanism in which the circuit kills cell if the specified cell behaves in an undesirable manner (for example, leaves a particular environment defined by sensory domains, or differentiates into a different cell type). In one non-limiting example, the modular structure of hybrid transcription factors, circuit architecture, and output module allow the circuit to be reconfigured to sense other environmental signals, respond to environmental signals in a different manner, and control other functions in the cell, along with inducible cell death, as is known in the art.

[00298] For a regulatory switch with an access code as described herein, any combination of regulatory switches as described herein can be used, for example, small molecule switches, nucleic acid-based switches, small molecule-nucleic acid hybrid switches, post-transcriptional switches transgene regulation, post-translational regulators, radiation-controlled switches, hypoxia-mediated switches, and other regulatory switches known to those skilled in the art. The control switches provided for the application are also described in the review article Kis et al., J R Soc Interface. 12: 20141000 (2015), and are summarized in Table 1 of the cited article. In some embodiments, the control switch for use in a password system may be selected from any of the switches shown in Table 11 or a combination thereof.

[00299] D. Nucleic acid-based regulatory switches to control transgene expression.

[00300] In some embodiments, the regulatory switch for controlling the transgene expressed by the cccDNA is based on a nucleic acid-based control mechanism. Examples of nucleic acid-based control mechanisms are known in the art and are contemplated for use. For example, such mechanisms include riboswitches such as those described, for example, in US2009/0305253, US2008/0269258, US2017/0204477, WO2018026762A1, US patent US 9222093 and application EP288071, all of which are incorporated herein by reference in their entirety and also disclosed in the review work by Villa JK et al., Microbiol Spectr. May 2018; 6(3), the contents of which are incorporated herein by reference in their entirety. Also included are transcriptional biosensors that respond to metabolites, such as those described in reference: WO2018/075486 and WO2017/147585, the contents of which are incorporated herein by reference in their entirety. Other mechanisms known in the art for use include transgene silencing using an miRNA or RNAi molecule (eg, miR, shRNA). For example, the cccDNA vector may contain a regulatory switch that encodes an RNAi molecule complementary to the transgene expressed by the cccDNA vector. When such RNAi is expressed, even if the cDNA vector expresses the transgene, its silencing will occur under the action of a complementary RNAi molecule, and if RNAi is not expressed when the transgene is expressed by the cDNA vector, silencing of the transgene under the influence of RNAi will not occur. Such an example of an RNAi molecule controlling gene expression, or used as a regulatory switch, is described in US2017/0183664. In some embodiments, the regulatory switch comprises a repressor that blocks expression of the transgene from the cccDNA vector. In some embodiments, the positive/negative switch is a small transcription activating RNA (STAR) switch, such as those described in Chappell J. et al., Nat Chem Biol. 2015 Mar;11(3):214-20; and Chappell et al., Microbiol Spectr. 2018 May;6(3). In some embodiments, the control switch is a toehold switch such as those described in US2009/0191546, US2016/0076083, WO2017/087530, US2017/0204477, WO2017/075486 and Green et al, Cell, 2014; 159(4); 925-939, all of which are incorporated herein by reference in their entirety.

[00301] In some embodiments, said regulatory switch is a tissue-specific self-inactivating regulatory switch, for example, as described in US2002/0022018, characterized in that it deliberately disables transgene expression at a site where transgene expression would otherwise be detrimental. In some embodiments, the regulatory switch is a recombinase-reversible gene expression system, for example, as described in US2014/0127162 and US Pat. No. 8,324,436.

[00302] In some embodiments, the regulatory switch for controlling a transgene of interest or a gene expressed by a cccDNA vector is a hybrid of a nucleic acid-based control mechanism and a small molecule regulatory system. Such systems are well known to those skilled in the art and are provided for use herein. Examples of such regulatory switches include, but are not limited to, the LTRi system or the Lac-Tet-RNAi system, for example, as described in US2010/0175141, Deans T. et al., Cell., 2007, 130(2); 363-372, WO2008/051854 and US Patent 9388425.

[00303] In some embodiments, a regulatory switch for controlling a transgene of interest or a gene expressed by a cccDNA vector includes cycling as described in US Pat. No. 8,338,138. In such an embodiment, the molecular switch is multistable, i.e. capable of switching between at least two states, or alternatively bistable, i.e. is either in an "off" or "on" state, such as being able or unable to emit light, able or unable to bind, able or unable to catalyze, able or unable to transfer electrons, and so on. According to another aspect, the molecular switch uses a fusion molecule, whereby the switch is capable of switching between more than two states. For example, in response to a particular threshold state exhibited by an insertion sequence or an acceptor sequence, a corresponding other fusion molecule sequence may exhibit a range of states (eg, a range of binding activity, a range of enzyme catalysis, etc.). Accordingly, rather than switching between an “on” and “off” state, the fusion molecule may exhibit a differential response to a stimulus.

[00304] In some embodiments, the nucleic acid regulatory switch may be selected from any switch or combination of switches from Table 11.

[00305] E. Post-transcriptional and post-translational regulatory switches.

[00306] In some embodiments, the regulatory switch for controlling a transgene of interest or a gene expressed by a cccDNA vector is a post-transcriptional modification system. For example, such a regulatory switch may be an aptazyme riboswitch sensitive to tetracycline or theophylline, as described in US2018/0119156, GB201107768, WO2001/064956A3, EP 2707487 and Beilstein et al., ACS Synth. Biol., 2015, 4 (5), pp 526-534; Zhong et al., Elife. 2016 Nov 2;5. pii: e18858. In some embodiments, it is contemplated that one skilled in the art can encode both the transgene and an inhibitory siRNA that contains a ligand-sensitive aptamer (negative switch), thereby generating a positive ligand-sensitive switch.

[00307] In some embodiments, the regulatory switch for controlling a transgene of interest or a gene expressed by a cccDNA vector is a post-translational modification system. In alternative embodiments, the gene or protein of interest is expressed as a proprotein or pre-proprotein, or contains a signal response element (SRE) or destabilizing domain (DD) attached to the expressed protein, which prevents the correct folding and/or activity of the protein until until post-translational modification occurs. In the case of a destabilizing domain (DD) or SRE, said destabilizing domain is post-translationally cleaved in the presence of an exogenous agent or small molecule. One skilled in the art will be able to use such control methods as described in US Pat. No. 8,173,792 and PCT Application WO2017180587. Other post-transcriptional control switches provided for use in a cccDNA vector to control the activity of a functional transgene are disclosed in: Rakhit et al., Chem Biol. 2014; 21 (9): 1238-52 and Navarro et al., ACS Chem Biol. 2016; 19; 11 (8): 2101-2104A.

[00308] In some embodiments, the regulatory switch for controlling a transgene of interest or a gene expressed by a cccDNA vector is a post-translational modification system that inserts ligand-responsive inteins into the coding sequence of the transgene such that the transgene or expressed protein remains inhibited until splicing. For example, this has been demonstrated using 4-hydroxytamoxifen and thyroid hormone (see, for example, US Patents 7541450, 9200045; 7192739, Buskirk, et al, Proc Natl Acad Sci U S A. 2004 Jul 20; 101(29): 10505- 10510; ACS Synth Biol. 2016 Dec 16; 5(12): 1475-1484; and 2005 Feb; 14(2): 523-532. In some embodiments, the post-transcriptional regulatory switch may be selected from any switch or combination thereof from Table eleven.

[00309] F. Other Examples of Regulatory Switches

[00310] Any known regulatory switch can be used in a cccDNA vector to control gene expression of a transgene expressed by the cccDNA vector, including switches triggered by environmental changes. Additional examples include, but are not limited to: Suzuki et al.'s BOC method (Suzuki et al., Scientific Reports 8; 10051 (2018)); genetic code expansion and non-physiological amino acid; radiation or ultrasound controlled positive/negative switches (see, for example, Scott S et al., Gene Ther. 2000 Jul;7(13):1121-5; US patents 5612318; 5571797; 5770581; 5817636; and WO1999/025385A1) . In some embodiments, said regulatory switch is controlled by an implantable system, such as US Pat. No. 7,840,263; US2007/0190028A1, where gene expression is controlled by one or more forms of energy, including electromagnetic energy, which activates promoters operably linked to the transgene in the cDNA vector.

[00311] In some embodiments, the regulatory switch provided for use in the cccDNA vector is a hypoxia-mediated or stress-activated switch, such as those described in WO1999060142A2, US Pat. No. 5,834,306; 6218179; 6709858; US2015/0322410; Greco et al., (2004) Targeted Cancer Therapies 9, S368, as well as FROG, TOAD and NRSE elements and condition-inducible silencing elements, including hypoxia response elements (HRE), inflammatory response elements (IRE) and shear-activated voltage elements (SSAE), for example, as described in US Pat. No. 9,394,526. This embodiment is suitable for “switching on” transgene expression from a cDNA vector after ischemia or in ischemic tissues and/or tumors.

[00312] In some embodiments, the regulatory switch provided for use in the cccDNA vector is an optogenetic (eg, light-controlled) regulatory switch, such as one of the switches discussed in: Poleskaya et al., BMC Neurosci . 2018; 19 (Suppl 1): 12, and are also provided for use according to this invention. In such embodiments, the cccDNA vector may contain genetic elements that are light-sensitive and can regulate transgene expression in response to light in the visible wavelength range (eg, blue light, near-infrared). cccDNA vectors containing optogenetic regulatory switches are suitable for transgene expression in locations in the body accessible to such light sources, such as skin, eyes, muscles, etc., and can also be used to express cccDNA vectors in internal organs and tissues where the light signal can be delivered in a suitable manner (for example, using an implantable device as described herein). Such optogenetic regulatory switches include the use of light-sensitive elements or light-inducible transcription effectors (LITEs) (eg, as described in 2014/0287938), the Light-On system (eg, as described in Wang et al., Nat Methods. 2012 Feb 12 ;9(3):266-9); which has been reported to allow in vivo control of insulin transgene expression, the Cry2/CIB1 system (eg, as described in Kennedy et al., Nature Methods; 7, 973-975 (2010); and the FKF1/GIGANTEA system (eg, as described in: Yazawa et al., Nat Biotechnol. 2009 Oct;27(10):941-5).

[00313] G. "Emergency Switches"

[00314] Other embodiments of the present invention provide a cccDNA vector containing a "kill switch". A “kill switch” as described herein allows the cell containing the specified cccDNA vector to be killed or undergo programmed cell death as a means of permanently removing the introduced cccDNA vector from the subject's system. One skilled in the art will appreciate that the use of "kill switches" in the cccDNA vectors of this invention typically involves targeting the cccDNA vector to a limited number of cells that the subject can tolerate losing, or to a cell type that is apoptotic. desirable (for example, on cancer cells). In all aspects, the "kill switch" as described herein is designed to provide rapid and reliable killing of a cell containing the cccDNA vector in the absence of an incoming survival signal or other specified condition. In other words, the "safety switch" encoded by the cccDNA vector herein may limit the survival of the cell containing the cccDNA vector to an environment defined by specific input signals. Such "kill switches" serve to provide a biological containment function if it is necessary to either remove the cccDNA vector from a subject or ensure that it does not express the encoded transgene. Accordingly, “kill switches” are synthetic biological circuits in the cDNA vector that couple environmental signals to the conditional survival of the cell containing said cDNA vector. In some embodiments, different cDNA vectors may be designed to have different "kill switches". This provides the ability to control which cells expressing the transgene are killed when using cocktails of cccDNA vectors.

[00315] In some embodiments, the cccDNA vector may comprise a “kill switch” that is a modular biological containment circuit. In some embodiments, a "safety switch" provided for use in a cccDNA vector is described in WO2017/059245, which describes a switch called a "safety switch" that contains at least two repressible sequences arranged in a mutually inhibitory manner such that the signal environment represses the activity of the second molecule in the construct (eg, a small molecule binding transcription factor is used to promote a "survival" state by repressing toxin production). In cells containing a cccDNA vector containing a "safety blocker", after loss of the environmental signal, the circuit finally switches to a "blocked" state in which derepression of the toxin occurs, leading to the production of the toxin, which kills the cell. Another embodiment provides a synthetic biological circuit, referred to as a "passcode circuit" or a "passcode kill switch", which uses hybrid transcription factors (TFs) to engineer complex environmental requirements for cell survival. “Emergency Interlocks” and “Access Code Emergency Stoppers” described in WO2017/059245 are particularly suitable for use in cccDNA vectors because they are modular and tunable, both in terms of the environmental conditions controlling circuit activation and in relation to output modules that control cell fate. With the proper selection of toxins, which include, but are not limited to, an endonuclease such as EcoRI, the "access code strands" present in the cccDNA vector, which can be used not only to kill the host cell containing the cccDNA vector, but also to destroy its genome and accompanying plasmids.

[00316] Other "kill switches" known to one skilled in the art are provided for use in a cccDNA vector as described herein, for example, as described in US2010/0175141; US2013/0009799; US2011/0172826; US2013/0109568, as well as the “kill switches” described in Jusiak et al, Reviews in Cell Biology and Molecular Medicine; 2014; 1-56; Kobayashi et al., PNAS, 2004; 101; 8419-9; Marchisio et al., Int. Journal of Biochem and Cell Biol., 2011; 43; 310-319; and Reinshagen et al., Science Translational Medicine, 2018, 11.

[00317] Accordingly, in some embodiments, said cccDNA vector may comprise a “kill switch” nucleic acid construct that contains a nucleic acid encoding an effector toxin or reporter protein, wherein expression of the effector toxin (e.g., death protein) or reporter protein is controlled in advance given condition. For example, a predetermined condition may be the presence of an environmental agent, such as an exogenous agent, without which the cell will by default express an effector toxin (eg, a death protein) and die. In alternative embodiments, the predetermined condition is the presence of two or more environmental agents, for example, the cell will survive only when supplied with two or more required exogenous agents, and without any of them, the cell containing the cccDNA vector will die.

[00318] In some embodiments, the cccDNA vector is modified to include a "kill switch" to kill cells containing the cccDNA vector to effectively stop in vivo expression of a transgene expressed by the cccDNA vector (e.g., a therapeutic gene, protein or peptide, etc.). In particular, the cccDNA vector is also genetically engineered to express a switch protein that does not function in mammalian cells under normal physiological conditions. Cells expressing the switch protein will only be killed upon administration of a drug or environmental condition specifically targeting said switch protein, and accordingly, expression of the therapeutic protein or peptide will then cease. For example, it has been reported that cells expressing HSV thymidine kinase can be killed by the administration of drugs such as ganciclovir and cytosine deaminase. See, for example, Dey and Evans, Suicide Gene Therapy by Herpes Simplex Virus-1 Thymidine Kinase (HSV-TK), in Targets in Gene Therapy, edited You (2011); and Beltinger et al., Proc. Natl. Acad. Sci. USA 96(15):8699–8704 (1999). In some embodiments, the cccDNA vector may contain a siRNA “kill switch” called DISE (Death Induced by Survival Gene Elimination) (Murmann et al., Oncotarget. 2017;8:84643-84658. Induction of DISE in ovarian cancer cells in vivo).

[00319] In some aspects, a "kill blocker" is a biological circuit or system that renders a cellular response sensitive to a predetermined condition, such as the absence of an agent in the environment in which the cells grow, such as an exogenous agent. Such a chain or system may comprise a nucleic acid containing expression modules that form an emergency regulatory circuit sensitive to a predetermined condition, said construct comprising:

i) a first repressor protein expression module, characterized in that said first repressor protein binds a nucleic acid of a first repressor protein binding element, and represses transcription from a coding sequence containing said first repressor protein binding element, wherein the repressor activity of the first repressor protein is sensitive to inhibition the first exogenous agent, the presence or absence of which determines a predetermined condition;

ii) a second repressor protein expression module, characterized in that the second repressor protein binds a nucleic acid of a second repressor protein binding element and represses transcription from a coding sequence containing said second repressor protein binding element, wherein the second repressor protein is different from the first repressor protein; And

iii) an effector expression module comprising a nucleic acid sequence encoding an effector protein operably linked to a genetic element comprising a second repressor protein binding element, such that expression of the second repressor protein causes repression of effector expression from the effector expression module, wherein the second expression module comprises the element , binding a nucleic acid of the first repressor protein, which provides transcriptional repression of the second repressor protein if the specified element is bound by the first repressor protein; the corresponding modules form a regulatory chain such that, in the absence of a first exogenous agent, a first repressor protein is produced from the expression module of the first repressor protein and represses transcription from the expression module of the second repressor protein, such that the inhibition of effector expression by the second repressor protein is eliminated, allowing expression of the effector protein , but in the presence of the first exogenous agent, the activity of the first repressor protein is inhibited, which allows expression of the second repressor protein, which maintains the expression of the effector protein in the "off" state, thus the first exogenous agent in the chain is required to maintain expression of the effector protein in the "off" state , and removal or absence of the first exogenous agent results in expression of the effector protein by default.

[00320] In some embodiments, the effector is a toxin or protein that induces a cell death program. Any protein that is toxic to the host cell can be used. In some embodiments, the toxin kills only those cells in which it is expressed. In other embodiments, the toxin also kills other cells of the same host organism. Any of a variety of products that cause cell death are suitable for use in a "kill blocker". In particular, it is advisable to use agents that inhibit DNA replication, protein translation or other processes or, for example, destroy the nucleic acid of the host cell. To identify an effective mechanism for killing host cells upon circuit activation, several toxin genes that directly damage host cell DNA or RNA were tested. The endonuclease ecoRI ²¹ , the DNA gyrase inhibitor ccdB ²² , and the ribonuclease type toxin mazF ²³ were tested because they are well characterized, are native to E. coli, and provide a range of killing mechanisms. To increase the reliability of the chain and provide a chain-independent mode of cell death, the system can be further adapted to express, for example, a targeted protease or nuclease that further interacts with a repressor that keeps the death gene in an "off" state. When the survival signal is lost or abolished, repression of the death gene is eliminated even more effectively due to, for example, active degradation of the repressor protein or its transcript. In a non-limiting example, mf-Lon protease was used not only to degrade LacI, but also to target important proteins for their degradation. The mf-Lon degradation tag pdt#1 can be attached to the 3′ end of five important genes whose protein products, in particular, are sensitive to mf-Lon degradation ²⁰ ; cell viability was measured after ATc removal. Among the important target genes tested, the peptidoglycan biosynthesis gene murC provided the most pronounced and rapid cell death phenotype (proportion of surviving cells < 1 x 10 ^-4 after no more than 6 hours).

[00321] As used herein, the term “predetermined input signal” refers to an agent or condition that is known to influence the activity of a transcription factor polypeptide. Typically, such agents are capable of binding a transcription factor polypeptide and/or changing its conformation, thereby modifying the activity of said transcription factor polypeptide. Examples of predetermined inputs include, but are not limited to, environmental inputs not required for the survival of a particular host organism (ie, in the absence of a synthetic biological circuit as described herein). Conditions that may provide a predetermined input signal include, for example, temperature, for example if the activity of one or more factors is temperature sensitive, the presence or absence of light, including light at wavelengths of a particular spectrum, and the concentration of a gas, salt, metal or mineral. Environmental inputs include, for example, small molecule, biological agents such as pheromones, hormones, growth factors, metabolites, nutrients, etc., and analogs thereof; concentrations of chemicals, environmental byproducts, metal ions and other such molecules or agents; light levels; temperature; mechanical stress or pressure; or electrical signals such as currents and voltages.

[00322] In some embodiments, reporters are used to quantify the strength or activity of a signal received by modules or programmable synthetic biological circuits of the present invention. In some embodiments, reporters can be fused in-frame to other coding sequences to identify the location of a protein in a cell or organism. Luciferases can be used as effector proteins in various embodiments of the present invention, for example, to alter low levels of gene expression, since cells typically have little or no background luminescence in the absence of luciferase. In other embodiments, enzymes that produce colored substrates can be quantified using spectrophotometers or other absorbance-measuring instruments, including plate readers. Like luciferases, enzymes such as β-galactosidase can be used to measure low levels of gene expression because they tend to amplify weak signals. In some embodiments, the effector protein may be an enzyme that can degrade or otherwise destroy a particular toxin. In some embodiments, the effector protein may be an odorant enzyme that converts the substrate into an odor-bearing product. In some embodiments, the effector protein may be an enzyme that phosphorylates or dephosphorylates either small molecules or other proteins, or an enzyme that methylates or demethylates other proteins or DNA.

[00323] In some embodiments, the effector protein may be a receptor, a ligand, or a lytic protein. Receptors typically have three domains: an extracellular domain for binding ligands such as proteins, peptides or small molecules, a transmembrane domain, and an intracellular or cytoplasmic domain, which can often be involved in some signal transduction phenomenon such as phosphorylation. In some embodiments, transporter, channel, or pump gene sequences are used as effector proteins. Non-limiting examples and sequences of effector proteins for use with "kill switches" as described herein can be found in the Registry of Standard Biological Parts on the World Wide Web at parts.igem.org.

[00324] As used herein, a “modulator protein” is a protein that modulates expression from a target nucleic acid sequence. Modulator proteins include, for example, transcription factors, including transcription activators and repressors, as well as proteins that bind or modify a transcription factor and influence its activity. In some embodiments, the modulator protein includes, for example, a protease that degrades a protein factor involved in regulating expression of a target nucleic acid sequence. Preferred modulator proteins include modular proteins in which, for example, the DNA binding and entry agent binding or response elements or domains are separated and can be transferred so that, for example, the DNA binding domain of the first modulator protein is fused to the entry agent response domain the second modulator protein leads to the formation of a new protein that binds the DNA sequence recognized by the first protein, but is sensitive to the input agent to which the second protein normally responds. Accordingly, as used herein, the term “modulator polypeptide,” more specifically “repressor polypeptide,” includes, along with said polypeptides such as “LacI (repressor) polypeptide,” variants or derivatives of such polypeptides that respond to a different input agent or variant entry agent. Accordingly, in the case of the LacI polypeptide, LacI mutants or variants are provided that bind to agents other than lactose or IPTG. A wide variety of such agents are known in the art.

[00325] Table 11. Examples of control switches ^{. b} Possibility of activation by the effector; different from removing the effector that provides the off state. ^c Possibility of switching off by the effector; different from removing the effector that provides the on state. ^d A ligand or other physical stimulus (e.g., temperature, electromagnetic radiation, electricity) that stabilizes the switch in either the on or off state. ^e Refers to the reference number given in: Kis et al., JR Soc Interface. 12:20141000 (2015), the contents of which, along with references cited, are incorporated herein by reference.

Number Name Positive switch ^b Negative switch ^c Source Effector ^d Sources ^e Transcription switches ° 1 ABA Yes No Arabidopsis thaliana, yeast Abscisic acid [19] 2 AIR Yes No Aspergillus nidulans Acetaldehyde [20] 3 ART Yes No Chlamydia pneumoniae L-arginine [21] 4 BEARON, BEAROFF Yes Yes Campylobacter jejuni Bile acid [22] 5 BirA-tTA No Yes Escherichia coli Biotin (vitamin H) [23] 6 BIT Yes No Escherichia coli Biotin (vitamin H) [24] 7 Cry2-CIB1 Yes No Arabidopsis thaliana, yeast blue light [25] 8 CTA, CTS Yes Yes Comamonas testosteroni, Homo sapiens food additives (benzoate, vanillate) [26] 9 cTA, rcTA Yes Yes Pseudomonas putida kumat [27] 10 Ecdysone Yes No Homo sapiens, Drosophila melanogaster Ecdysone [28] eleven EcR:RXR Yes No Homo sapiens, Locusta migratoria ecdysone [29] 12 electrogenic Yes No Aspergillus nidulans electricity, acetaldehyde [thirty] 13 ER-p65-ZF Yes No Homo sapiens, yeast 4,4′-dihydroxybenzyl [31] 14 E.REX Yes Yes Escherichia coli erythromycin [32] 15 EthR No Yes Mycobacterium tuberculosis 2-phenylethylbutyrate [33] 16 GAL4-ER Yes Yes yeast, Homo sapiens estrogen, 4-hydroxytamoxifen [34] 17 GAL4-hPR Yes Yes yeast, Homo sapiens mifepristone [35, 36] 18 GAL4-Raps Yes Yes yeast, Homo sapiens rapamycin and rapamycin derivatives [37] 19 GAL4-TR Yes No yeast, Homo sapiens thyroid hormone [38] 20 GyrB Yes Yes Escherichia coli coumermycin, novobiocin [39] 21 HEA-3 Yes No Homo sapiens 4-hydroxytamoxifen [40] 22 Intramer No Yes synthetic SELEX-derived aptamers theophylline [41] 23 LacI Yes No Escherichia coli IPTG [42-46] 24 LAD Yes No Arabidopsis thaliana, yeast blue light [47] 25 LightOn Yes No Neurospora crassa, yeast blue light [48] 26 NICE Yes Yes Arthrobacter nicotinovorans 6-hydroxynicotine [49] 27 PPAR* Yes No Homo sapiens rosiglitazone [50] 28 PEACE No Yes Pseudomonas putida flavonoids (eg phloretin) [51] 29 PIT Yes Yes Streptomyces coelicolor pristinamycin I, virginiamycin [12] thirty REDOX No Yes Streptomyces coelicolor NADH [52] 31 QuoRex Yes Yes Streptomyces coelicolor, Streptomyces pristinaespiralis butyrolactones (eg SCB1) [53] 32 ST-TA Yes Yes Streptomyces coelicolor, Escherichia coli, Herpes simplex γ-butyrolactone, tetracycline [54] 33 TIGR No Yes Streptomyces albus temperature [55] 34 TraR Yes No Agrobacterium tumefaciens N-(3-oxo-octanoyl)homoserine lactone [56] 35 TET-OFF, TET-ON Yes Yes Escherichia coli, Herpes simplex tetracycline, doxycycline [11, 57] 36 TRT Yes No Chlamydia trachomatis l-tryptophan [58] 37 UREX Yes No Deinococcus radiodurans uric acid [59] 38 VAC Yes Yes Caulobacter crescentus vanillic acid [60] 39 ZF-ER, ZF-RXR/EcR Yes Yes Mus musculus, Homo sapiens, Drosophila melanogaster 4-hydroxytamoxifen, ponasterone-A [61] 40 ZF-Raps Yes No Homo sapiens rapamycin [62] 41 ZF Switches Yes No Mus musculus, Homo sapiens, Drosophila melanogaster 4-hydroxytamoxifen, mifepristone [63] 42 ZF(TF)s Yes No Xenopus laevis, Homo sapiens ethyl 4-hydroxybenzoate, propyl 4-hydroxybenzoate [64] post-transcriptional switches 1 RNAi aptamer Yes No synthetic SELEX-derived aptamer theophylline [65] 2 RNAi aptamer No Yes synthetic SELEX-derived aptamer theophylline [66] 3 aptamer RNAi siRNA Yes No synthetic SELEX-derived aptamer theophylline, tetracycline, hypoxanthine [67] 4 Aptamer Splicing Yes Yes Homo sapiens, bacteriophage MS2 MS2, p65, p50, b-catenin [68] 5 aptazim No Yes synthetic SELEX-derived aptamer, Schistosoma mansoni theophylline [69] 6 replicon CytTS Yes No Sindbis virus temperature [70] 7 TET-OFF-shRNA, TET-ON-shRNA Yes Yes Escherichia coli, Herpes simplex, Homo sapiens doxycycline [71] 8 theo-aptamer No Yes synthetic SELEX-derived aptamer theophylline [72] 9 3′ UTR aptazim Yes No synthetic SELEX-derived aptamers, tobacco ringspot virus theophylline, tetracycline [73] 10 5′ UTR aptazim No Yes synthetic SELEX-derived aptamer, Schistosoma mansoni theophylline [74] broadcast switches 1 Hoechst aptamer No Yes synthetic RNA sequence Hoechst dyes [75] 2 aptamer H23 No Yes Archaeoglobus fulgidus L7Ae, L7KK [76] 3 L7Ae aptamer Yes Yes Archaeoglobus fulgidus L7Ae [77] 4 Aptamer MS2 No Yes Bacteriophage MS2 MS2 [78] post-translational switches 1 AID No Yes Arabidopsis thaliana, Oryza sativa, Gossypium hirsutum auxins (eg IAA) [79] 2 ER DD No Yes Homo sapiens CMP8, 4-hydroxytamoxifen [80] 3 FM Yes No Homo sapiens AP21998 [81] 4 HaloTag No Yes Rhodococcus sp. RHA1 HyT13 [82, 83] 5 HDV-aptazim No Yes hepatitis delta virus theophylline, guanine [84] 6 PROTAC No Yes Homo sapiens proteolysis-targeted chimeric molecules (PROTACS) [85] 7 Shield DD Yes No Homo sapiens Shield proteins (e.g. Shld1) [86] 8 Shield LID No Yes Homo sapiens Shield proteins (e.g. Shld1) [87] 9 TMP DD Yes No Escherichia coli trimethoprim (TMP) [88]

VII. Pharmaceutical compositions

[00326] In another aspect, pharmaceutical compositions are provided. Said pharmaceutical composition contains a cccDNA vector as described herein and a pharmaceutically acceptable carrier or diluent.

[00327] DNA vectors as described herein can be included in pharmaceutical compositions suitable for administration to a subject for in vivo delivery to cells, tissues or organs of the subject. Typically, said pharmaceutical composition contains a cccDNA vector as described herein and a pharmaceutically acceptable carrier. For example, the cccDNA vectors described herein can be included in a pharmaceutical composition suitable for the desired route of therapeutic administration (eg, parenteral administration). Passive tissue transduction by intravenous or intra-arterial high-pressure infusion, as well as intracellular injection such as intranuclear microinjection or intracytoplasmic injection, is also contemplated. Pharmaceutical compositions for therapeutic purposes can be formulated in a solution, microemulsion, dispersion, liposome or other ordered structure suitable for high concentration of cccDNA vector. Sterile injection solutions can be prepared by introducing the cDNA vector compound in the required amount into an appropriate buffer with one or a combination of ingredients listed above, if necessary, followed by sterilizing filtration.

[00328] Pharmaceutically active compositions containing a cccDNA vector can be formulated to deliver a transgene in nucleic acid into recipient cells, resulting in therapeutic expression of the transgene therein. The composition may also include a pharmaceutically acceptable carrier.

[00329] The cccDNA vector as described herein can be formulated into a pharmaceutical composition suitable for local, systemic, intra-amniotic, intrathecal, intracranial, intra-arterial, intravenous, intralymphatic, intraperitoneal, subcutaneous, tracheal, interstitial (e.g., intramuscular, intracardiac, intrahepatic, intrarenal, intracerebral), intrathecal, intravesical, conjunctival (eg, extraorbital, intraorbital, retroorbital, intraretinal, subretinal, choroidal, subchoroidal, intrastromal, intracameral and intravitreal), intracochlear and mucosal (eg, oral, rectal, nasal) administration . Passive tissue transduction by intravenous or intra-arterial high-pressure infusion, as well as intracellular injection such as intranuclear microinjection or intracytoplasmic injection, is also contemplated.

[00330] Pharmaceutical compositions for therapeutic purposes generally must be sterile and stable under the conditions of manufacture and storage. The composition may be formulated into a solution, microemulsion, dispersion, liposome or other ordered structure suitable for high concentration of cDNA vector. Sterile injection solutions can be prepared by introducing the cDNA vector compound in the required amount into an appropriate buffer with one or a combination of ingredients listed above, if necessary, followed by sterilizing filtration.

[00331] Various methods and methods for delivering nucleic acids into cells are known in the art. For example, nucleic acids such as cccDNA can be formulated into lipid nanoparticles (LNPs), lipidoids, liposomes, lipid nanoparticles, lipoplexes or core/shell nanoparticles. Typically, LNPs consist of a nucleic acid molecule (e.g., cccDNA), one or more ionizable or cationic lipids (or salts thereof), one or more nonionic or neutral lipids (e.g., a phospholipid), a molecule that prevents aggregation (e.g., PEG or PEG-lipid conjugate), and optionally a sterol (eg cholesterol).

[00332] Another method of delivering nucleic acids, such as cctDNA, into a cell is by conjugating the nucleic acid to a ligand that is internalized by the cell. For example, the ligand may bind to a cell surface receptor and be internalized through endocytosis. Said ligand may be covalently linked to a nucleotide in the nucleic acid. Examples of conjugates for delivering nucleic acids into a cell are described, for example, in WO2015/006740, WO2014/025805, WO2012/037254, WO2009/082606, WO2009/073809, WO2009/018332, WO2006/112872, WO 2004/090108, WO2004/091515 and WO2017 /177326.

[00333] Nucleic acids, such as cctDNA, can also be delivered into a cell by transfection. Suitable transfection methods include, but are not limited to, lipid-mediated transfection, cationic polymer-mediated transfection, or calcium phosphate precipitation. Transfection reagents are well known in the art and include, but are not limited to, TurboFect Transfection Reagent (Thermo Fisher Scientific), Pro-Ject Reagent (Thermo Fisher Scientific), TRANSPASS™ P Protein Transfection Reagent (New England Biolabs), CHARIOT™ Protein Delivery Reagent (Active Motif), PROTEOJUICE™ Protein Transfection Reagent (EMD Millipore), 293fectin Reagent, Lipofectamine - LIPOFECTAMINE™ 2000, LIPOFECTAMINE™ 3000 (Thermo Fisher Scientific), LIPOFECTAMINE™ (Thermo Fisher Scientific), Lipofectin - LIPOFECTIN™ (The rmo Fisher Scientific), DMRIE-C, CELLFECTIN™ (Thermo Fisher Scientific), OLIGOFECTAMINE™ (Thermo Fisher Scientific), LIPOFECTACE™, FUGENE™ (Roche, Basel, Switzerland), FUGENE™ HD (Roche), TRANSFECTAM™ (transfectam, Promega, Madison, WI), TFX-10™ (Promega), TFX-20™ (Promega), TFX-50™ (Promega), TRANSFECTIN™ (BioRad, Hercules, CA), SILENTFECT™ (Bio-Rad), Effectene™ ( Qiagen, Valencia, CA), DC-chol (Avanti Polar Lipids), GENEPORTER™ (Gene Therapy Systems, San Diego, CA), DHARMAFECT 1™ (Dharmacon, Lafayette, CO), DHARMAFECT 2™ (Dharmacon), DHARMAFECT 3 ™ (Dharmacon), DHARMAFECT 4™ (Dharmacon), ESCORT™ III (Sigma, St. Louis, MO), and ESCORT™ IV (Sigma Chemical Co.). Nucleic acids, such as cctDNA, can also be delivered into cells using microfluidics techniques known to those skilled in the art.

[00334] Methods for non-viral delivery of nucleic acids in vivo or ex vivo include electroporation, lipofection (see US Pat. No. 5,049,386; 4,946,787; and commercially available reagents such as Transfectam™ and Lipofectin™), microinjection, biolistics , virosomes, liposomes (see, for example, Crystal, Science 270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5: 382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al., Cancer Res. 52: 4817-4820 (1992); US patents No. 4186183, No. 4217344, No. 4235871, No. 4261975, No. 4485054, No. 4501728, No. 4774085, No. 4837028 and No. 4946787), immunoliposomes, conjugates of nucleic acids with polycations or lipids, “naked” DNA and agent-enhanced DNA uptake. Sonoporation using, for example, the Sonitron 2000 system (Rich-Mar) can also be used to deliver nucleic acids.

[00335] CCDNA vectors as described herein can also be administered directly into the body to transduce cells in vivo. Administration is by any of the routes commonly used to bring the molecule into maximum contact with blood or tissue cells, including, but not limited to, injection, infusion, topical application, and electroporation. Suitable routes for administering such nucleic acids are available and well known to those skilled in the art, and although more than one route may be used to administer a particular composition, a particular route can often provide a faster and more efficient response than another route of administration.

[00336] Methods of introducing a cccDNA nucleic acid vector as described herein may include delivery to hematopoietic stem cells, for example, by methods described, for example, in US Pat. No. 5,928,638.

[00337] CCDNA vectors in accordance with this invention can be added to liposomes for delivery to a cell or target organ of a subject. Liposomes are vesicles having at least one lipid bilayer. Liposomes are often used as carriers for drug/therapeutic delivery in the context of pharmaceutical development. They work by fusing with the cell membrane and rearranging its lipid structure to deliver a drug or active pharmaceutical ingredient (API). Liposomal compositions for such delivery consist of phospholipids, in particular compounds containing a phosphatidylcholine group, although these compositions may also include other lipids.

[00338] According to some aspects of the present invention, there is provided a liposomal formulation that includes one or more polyethylene glycol (PEG) functional compounds (so-called “PEGylated compounds”) that can reduce immunogenicity/antigenicity, provide hydrophilicity and hydrophobicity to the compound(s) and reducing the frequency of its dosing. In other cases, the liposomal composition simply contains a polyethylene glycol (PEG) polymer as an additional component. In such aspects, the molecular weight of the PEG or PEG functionality may range from 62 Da to about 5000 Da.

[00339] In some aspects, the present invention provides a liposome composition that delivers an API with a sustained or controlled release profile over a period of time ranging from hours to weeks. In some related aspects, the liposomal composition may include aqueous chambers that are connected by lipid bilayers. In other related aspects, the liposomal formulation encapsulates the API with components that undergo a physical transition at elevated temperature that releases the API over a period of hours to weeks.

[00340] In some aspects, the liposomal formulation comprises sphingomyelin and one or more lipids as described herein. In some aspects, the liposome composition contains optisomes.

[00341] In some aspects, the present invention provides a liposomal composition that includes one or more lipids selected from: N-(carbonylmethoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, (distearoyl-sn- glycerophosphoethanolamine), MPEG (methoxypolyethylene glycol)-conjugated lipid, HSPC (hydrogenated soy phosphatidylcholine); PEG (polyethylene glycol); DSPE (distearoyl-sn-glycerophosphoethanolamine); DSPC (distearoylphosphatidylcholine); DOPC (dioleoylphosphatidylcholine); DPPG (dipalmitoylphosphatidylglycerol); EPC (egg phosphatidylcholine); DOPS (dioleoylphosphatidylserine); POPC (palmitoyloleoylphosphatidylcholine); SM (sphingomyelin); MPEG (methoxy polyethylene glycol); DMPC (dimyristoylphosphatidylcholine); DMPG (dimyristoylphosphatidylglycerol); DSPG (distearoylphosphatidylglycerol); DEPC (dierucoylphosphatidylcholine); DOPE (dioleoyl-sn-glycerophosphoethanolamine), cholesteryl sulfate (CS), dipalmitoylphosphatidylglycerol (DPPG), DOPC (dioleoyl-sn-glycerophosphatidylcholine) or any combination thereof.

[00342] In some aspects, the present invention provides a liposomal composition comprising a phospholipid, cholesterol, and PEGylated lipid in a molar ratio of 56:38:5. In some aspects, the total lipid content of the liposomal formulation is 2-16 mg/ml. According to some aspects of the present invention, there is provided a liposomal composition comprising a phosphatidylcholine-functional lipid, an ethanolamine-functional lipid, and a PEGylated lipid. According to some aspects of the present invention, there is provided a liposomal composition comprising a phosphatidylcholine-functional lipid, an ethanolamine-functional lipid, and a PEGylated lipid in a molar ratio of 3:0.015:2, respectively. According to some aspects of the present invention, there is provided a liposomal composition comprising a lipid containing a phosphatidylcholine functionality, cholesterol and a pegylated lipid. According to some aspects of the present invention, there is provided a liposomal composition comprising a lipid containing a phosphatidylcholine functionality and cholesterol. In some aspects, said PEGylated lipid is PEG-2000-DSPE. According to some aspects of the present invention, there is provided a liposomal formulation comprising DPPG, soy PC, MPEG-DSPE lipid conjugate and cholesterol.

[00343] In some aspects of the present invention, there is provided a liposomal formulation comprising one or more phosphatidylcholine-functional lipids and one or more ethanolamine-functional lipids. According to some aspects of the present invention, there is provided a liposomal formulation comprising any one or more of: phosphatidylcholine-functional lipids, ethanolamine-functional lipids, and sterols, such as cholesterol. In some aspects, the liposomal formulation comprises DOPC/DEPC; and DOPE.

[00344] According to some aspects of the present invention, there is provided a liposomal formulation further containing one or more pharmaceutical excipients, for example, sucrose and/or glycine.

[00345] According to some aspects of the present invention, there is provided a liposomal composition having a unilamellar or multilamellar structure. In some aspects, the present invention relates to a liposomal composition that includes multivesicular particles and/or foam-based particles. In some aspects, the present invention provides a composition of liposomes that are larger in size than conventional nanoparticles, ranging from about 150 to 250 nm. In some aspects, the liposomal composition is a lyophilized powder.

[00346] In some aspects of the present invention, a liposomal formulation is provided that is prepared and loaded with cccDNA vectors disclosed or described herein by adding a weak base to a mixture containing isolated cccDNA outside of a liposome. This addition increases the pH outside the liposomes to approximately 7.3 and stimulates the entry of the API into the liposome. According to some aspects of the present invention, there is provided a liposomal composition having pH values that are acidic within the liposomes. In such cases, the pH value within the liposomes may be 4-6.9, and more preferably pH 6.5. According to other aspects of the present invention, a liposomal formulation is provided using intraliposomal drug stabilization technology. In such cases, polymeric or non-polymeric highly charged anions and intraliposomal entrapment agents, such as polyphosphate or sucrose octasulfate, are used.

[00347] In other aspects, the present invention provides a liposome composition containing phospholipids, lecithin, phosphatidylcholine and phosphatidylethanolamine.

[00348] Delivery reagents, such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like, can be used to introduce the compositions of this invention into suitable host cells. In particular, nucleic acid compositions can be formulated for delivery encapsulated in a lipid particle, liposome, vesicle, nanosphere, nanoparticle, gold particle, and the like. Such formulations may be preferred for administering the pharmaceutically acceptable nucleic acid compositions disclosed herein.

[00349] Various delivery methods known in the art, or modifications thereof, can be used to deliver cccDNA vectors in vitro or in vivo. For example, in some embodiments, cccDNA vectors are delivered by transiently permeating the cell membrane using mechanical, electrical, ultrasonic, hydrodynamic, or laser energy to facilitate entry of DNA into target cells. For example, the cccDNA vector can be delivered by transiently disrupting the cell membrane by forcing the cell through a channel of limited size or other methods known in the art. In some cases, the cccDNA vector is directly injected individually as deproteinized DNA into skin, thymus, cardiac, skeletal muscle, or liver cells.

[00350] In some cases, the cccDNA vector is delivered using a gene gun. Spherical gold or tungsten particles (1-3 µm in diameter) coated with capsidless AAV vectors can be accelerated to high speed using pressurized gas to penetrate target tissue cells.

[00351] In some embodiments, electroporation is used to deliver cccDNA vectors. Electroporation causes temporary destabilization of the cell membrane of target tissue cells by introducing a pair of electrodes into the tissue, so that DNA molecules from the environment around the destabilized membrane can penetrate into the cytoplasm and nucleoplasm of the specified cell. Electroporation has been used in vivo for many tissue types such as skin, lung, and muscle.

[00352] In some cases, the cccDNA vector is delivered by hydrodynamic injection, which is a simple and highly effective method for direct intracellular delivery of any water-soluble compounds and particles to the internal organs and skeletal muscles throughout the limb.

[00353] In some cases, cccDNA vectors are delivered using ultrasound, creating nanoscopic pores in the membrane to facilitate intracellular delivery of DNA particles into internal organ or tumor cells, so the size and concentration of plasmid DNA is of great importance to the efficiency of the system. In some cases, cccDNA vectors are delivered by magnetofection, using magnetic fields to concentrate particles containing the nucleic acid into target cells.

[00354] In some cases, chemical delivery systems can be used, for example, using nanometer complexes that involve the compaction of negatively charged nucleic acid with polycationic nanometer particles, formulated in cationic liposomes/micelles or cationic polymers. Cationic lipids used in this delivery method include, but are not limited to, monovalent cationic lipids, polyvalent cationic lipids, guanidine-containing compounds, cholesterol-derived compounds, cationic polymers (e.g., polyethylenimine, poly-L-lysine, protamine, other cationic polymers ), and lipid-polymer hybrids.

[00355] A. Exosomes:

[00356] In some embodiments, a cccDNA vector as disclosed herein is delivered by packaging into an exosome. Exosomes are small membrane vesicles of endocytic origin that are released into the extracellular environment after the fusion of multivesicular bodies with the plasma membrane. Their surface consists of the lipid bilayer of the cell membrane of the donor cell, they contain cytosol from the cell that produced the exosome, and they expose membrane proteins of the parent cell on the surface. Exosomes are produced by various cell types, including epithelial cells, B and T lymphocytes, mast cells (MC), and dendritic cells (DC). In some embodiments, exosomes with a diameter of 10 nm to 1 μm, 20 nm to 500 nm, 30 nm to 250 nm, or 50 to 100 nm are provided for use. Exosomes can be isolated for delivery to target cells either using donor cells or by introducing specific nucleic acids into them. Various approaches known in the art can be used to obtain exosomes containing capsidless AAV vectors according to this invention.

[00357] B. Microparticles/nanoparticles

[00358] In some embodiments, a cccDNA vector as described herein is delivered on a lipid nanoparticle. Typically, lipid nanoparticles contain an ionizable aminolipid (e.g., heptatriakonta-6, 9, 28, 31-tetraen-19-yl 4-(dimethylamino)butanoate, DLin-MC3-DMA, phosphatidylcholine (1,2-distearoyl-sn-glycero-3 -phosphocholine, DSPC), cholesterol and envelope lipid (polyethylene glycol-dimyristoylglycerol, PEG-DMG), for example, as described in Tam et al. (2013). Advances in Lipid Nanoparticles for siRNA delivery. Pharmaceuticals 5(3): 498 -507.

[00359] In some embodiments, the lipid nanoparticle has an average diameter of from about 10 nm to about 1000 nm. In some embodiments, the lipid nanoparticle has a diameter of less than 300 nm. In some embodiments, the lipid nanoparticle has a diameter of from about 10 nm to about 300 nm. In some embodiments, the lipid nanoparticle has a diameter of less than 200 nm. In some embodiments, the lipid nanoparticle has a diameter of from about 25 nm to about 200 nm. In some embodiments, the lipid nanoparticle formulation (e.g., a composition containing a plurality of lipid nanoparticles) has a size distribution such that the average size (e.g., diameter) is from about 70 nm to about 200 nm, and more typically the average size is about 100 nm or less.

[00360] Various lipid nanoparticles known in the art can be used to deliver the cDNA vector disclosed herein. For example, various delivery methods using lipid nanoparticles are described in US patents No. 9404127, No. 9006417 and No. 9518272.

[00361] In some embodiments, a cccDNA vector as described herein is delivered on a gold nanoparticle. Typically, the nucleic acid may be covalently associated with the gold nanoparticle or non-covalently associated with the gold nanoparticle (eg, associated by charge-charge interaction), for example, as described in Ding et al. (2014). Gold Nanoparticles for Nucleic Acid Delivery. Mol. Ther. 22(6); 1075-1083. In some embodiments, gold nanoparticle-nucleic acid conjugates are prepared using methods described, for example, in US Pat. No. 6,812,334.

[00362] C. Liposomes

[00363] The preparation and use of liposomes is generally known to those skilled in the art. Liposomes with improved serum stability and circulatory half-life have been developed (US Patent No. 5,741,516). In addition, various methods for preparing liposomal and liposomal-like formulations as potential drug carriers have been described (US Pat. No. 5,567,434; US Pat. No. 5,552,157; US Pat. No. 5,565,213; US Pat. No. 5,738,868 and US Pat. No. 5,795,587).

[00364] Liposomes have been used successfully with certain cell types that are generally resistant to transfection using other procedures. In addition, liposomes are free of DNA length restrictions typical of viral-based delivery systems. Liposomes have been used effectively to introduce genes, drugs, radiotherapeutic agents, viruses, transcription factors, and allosteric effectors into a variety of cultured cell lines and animals. In addition, several successful clinical trials have been completed to study the effectiveness of liposome-mediated drug delivery.

[00365] Liposomes are formed from phospholipids that are dispersed in an aqueous environment and spontaneously form multilamellar concentric bilayer vesicles (also called multilamellar vesicles (MLV). MLVs typically have a diameter of 25 nm to 4 μm. Sonication of MLVs results in the formation of small unilamellar vesicles (SUV) with a diameter ranging from 200 to 500 angstroms containing an aqueous solution in the core.

[00366] In some embodiments, the liposome contains cationic lipids. The term "cationic lipid" includes lipids and synthetic lipids having both polar and nonpolar domains that may be positively charged at or near physiological pH, and that bind to polyanions, such as nucleic acids, and facilitate the delivery of nucleic acids to cells. In some embodiments, cationic lipids include saturated and unsaturated alkyl and alicyclic ethers and esters of amines, amides, or derivatives thereof. In some embodiments, the cationic lipids include straight-chain, branched-chain alkyl, alkenyl groups, or any combination of the foregoing. In some embodiments, cationic lipids contain from 1 to about 25 carbon atoms (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 , 18, 19, 20, 21, 22, 23, 24 or 25 carbon atoms). In some embodiments, the cationic lipids contain more than 25 carbon atoms. In some embodiments, the straight-chain or branched alkyl or alkene groups contain six or more carbon atoms. The cationic lipid may also contain, in some embodiments, one or more alicyclic groups. Non-limiting examples of alicyclic groups include cholesterol and other steroid groups. In some embodiments, political lipids are implemented using one or more counterions. Examples of counterions (anions) include, but are not limited to, Cl-, Br-, I-, F-, acetate, trifluoroacetate, sulfate, nitrite and nitrate.

[00367] Non-limiting examples of cationic lipids include star dendrimers of polyethylenimine and polyamidoamine (PAMAM), lipofectin (combination of DOTMA and DOPE), lipofectase, lipofectamine (LIPOFECTAMINE™, e.g. LIPOFECTAMINE™ 2000), DOPE, cytofectin (Gilead Sciences, Foster City, California) and eupectins (JBL, San Luis Obispo, CA). Examples of cationic liposomes can be prepared from N-[1-(2, 3-dioleoloxy)-propyl]-N, N,N-trimethyl ammonium chloride (DOTMA), N-[1-(2, 3-dioleoloxy)-propyl] -N,N,N-trimethylammonium methyl sulfate (DOTAP), 3β-[N-(N′, N′-dimethylaminoethane)carbamoyl]cholesterol (DC-Chol), 2, 3-dioleyloxy-N-[2(sperminecarboxamido)ethyl ]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA), 1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide; and dimethyldioctadecylammonium bromide (DDAB). Nucleic acids (eg, CELiD) may also be complexed with, for example, poly(L-lysine) or avidin, and lipids, such as steryl-poly(L-lysine), may or may not be included in the mixture.

[00368] In some embodiments, the cccDNA vector as described herein is delivered using a cationic lipid described in US Pat. No. 8,158,601, or a polyamine compound or lipid as described in US Pat. No. 8,034,376.

[00369] C. Conjugates

[00370] In some embodiments, the cccDNA vector as described herein is conjugated (eg, covalently linked to an agent that enhances cellular uptake). A "cellular uptake enhancing agent" is a molecule that facilitates the transport of nucleic acid across a lipid membrane. For example, the nucleic acid may be conjugated to a lipophilic compound (e.g., cholesterol, tocopherol, etc.), cell penetrating peptide (CPP) (e.g., penetratin, TAT, Syn1B, etc.), and polyamines (e.g., spermine ). Additional examples of agents that enhance cellular uptake are disclosed, for example, in Winkler (2013). Oligonucleotide conjugates for therapeutic applications. Ther. Deliv. 4(7); 791-809.

[00371] In some embodiments, the cccDNA vector as described herein is conjugated to a polymer (eg, a polymer molecule) or a folate molecule (eg, a folic acid molecule). In general, delivery of nucleic acids conjugated to polymers is known in the art, for example, described in WO2000/34343 and WO2008/022309. In some embodiments, the cccDNA vector as described herein is conjugated to a poly(amide) polymer, for example, as described in US Pat. No. 8,987,377. In some embodiments, the nucleic acid described herein is conjugated to a folic acid molecule as described in US Patent No. 8507455.

[00372] In some embodiments, the cccDNA vector as described herein is conjugated to a carbohydrate, for example, as described in US Pat. No. 8,450,467.

[00373] E. Nanocapsule

[00374] Alternatively, cDNA vector nanocapsule formulations as described herein may be used. Generally, nanocapsules can entrap substances in a stable and reproducible manner. To avoid side effects due to intracellular polymer overload, such ultrafine particles (about 0.1 μm in size) must be constructed using polymers that are degradable in vivo. Biodegradable polyalkyl cyanoacrylate nanoparticles that meet the specified requirements are provided for use.

VIII. Methods for delivering cccDNA vectors

[00375] In some embodiments, the cccDNA vector can be delivered to the target cell in vitro or in vivo by various suitable methods. The cccDNA vectors can be used or introduced separately. CctDNA vectors can be delivered into cells without the need for a transfection reagent or other physical method. Alternatively, cccDNA vectors can be delivered using any transfection reagent known in the art or other physical method known in the art that facilitates DNA entry into the cell, e.g., liposomes, alcohols, polylysine-rich compounds, arginine-rich compounds , calcium phosphate, microvesicles, microinjections, electroporation, etc.

[00376] In contrast, transduction with capsidless AAV vectors as described herein can effectively target cell and tissue types that are difficult to transduce with standard AAV virions using different delivery reagents.

IX. Additional applications of cccDNA vectors

[00377] The compositions and cccDNA vectors described herein can be used to deliver a transgene for a variety of purposes. In some embodiments, the transgene encodes a protein or functional RNA that is intended to be used for research purposes, for example, to create a somatic model of transgenic animals carrying the transgene, for example, to study the function of the transgene product. In another example, the transgene encodes a protein or functional RNA that is intended for use in creating an animal model of a disease. In some embodiments, the transgene encodes one or more peptides, polypeptides, or proteins that are useful for treating, preventing, or alleviating disease states or disorders in a mammalian subject. The transgene may be transferred into a subject (eg, expressed in a patient) in an amount sufficient to treat a disease associated with decreased expression, absence of expression, or dysfunction of the gene. In some embodiments, the transgene may be transferred into a subject (e.g., expressed in the subject) in an amount sufficient to treat a disease associated with increased expression, activity of a gene product, or inappropriate stimulatory regulation of a gene that suppresses or otherwise reduces expression of the gene. transgene

X. Directions for use

[00378] The cDNA vector of the present invention can also be used in a method for delivering a nucleotide sequence of interest to a target cell. The method may in particular be a method of delivering a therapeutic gene of interest to a cell of a subject in need thereof. This invention allows for in vivo expression of a polypeptide, protein or oligonucleotide encoded by a therapeutic exogenous DNA sequence in cells of a subject such that the polypeptide, protein or oligonucleotide is expressed at therapeutic levels. These results are observed both in vivo and in vitro delivery modes of the cDNA vector.

[00379] A method of delivering a nucleic acid of interest to a cell of a subject may include administering to the subject a cccDNA vector of the present invention containing said nucleic acid of interest. The present invention further provides a method for delivering a nucleic acid of interest to a cell of a subject in need thereof, comprising repeatedly administering a cccDNA vector of the present invention containing said nucleic acid of interest. Since the cccDNA vector of the present invention does not induce an immune response, this multiple administration strategy will not disrupt the host immune system response against the cccDNA vector of the present invention, unlike the situation that occurs with encapsidated vectors.

[00380] The cccDNA vector nucleic acid(s) are administered in sufficient quantities to transfect cells of the desired tissue and to ensure sufficient levels of gene transfer and expression without undesirable side effects. Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, intravenous (eg, in a liposomal formulation), direct delivery to an organ of choice (eg, intraportal delivery to the liver), intramuscular, and other parenteral routes of administration. Routes of administration can be combined if required.

[00381] The cccDNA vector is not limited to one type of ccDNA vector. Therefore, in another aspect, multiple cDNA vectors containing different exogenous DNA sequences can be delivered simultaneously or sequentially to a target cell, tissue, organ, or body of a subject. Accordingly, this strategy can ensure the expression of multiple genes. Delivery can also be done multiple times and, importantly for gene therapy in a clinical setting, with subsequent increases or decreases in doses given the lack of host immune response against the capsid due to the absence of the viral capsid. It is expected that no reaction against the capsid will occur due to the absence of the capsid.

[00382] The present invention also provides a method of treating a disease in a subject, comprising administering to a target cell in need thereof (particularly a muscle cell or tissue) of said subject a therapeutically effective amount of a cccDNA vector, optionally with a pharmaceutically acceptable carrier. Although said cDNA vector can be introduced in the presence of a carrier, such a carrier is not necessary. The proposed cccDNA vector contains a nucleotide sequence of interest suitable for treating a disease. In particular, said cDNA vector may contain a desired exogenous DNA sequence operably linked to control elements capable of directing transcription of the desired polypeptide, protein or oligonucleotide encoded by said exogenous DNA sequence when administered to a subject. The specified cDNA vector can be introduced by any suitable route, as described above and elsewhere in this document.

XI. Treatment options

[00383] The technology described herein also demonstrates methods for producing, as well as methods for using, the disclosed cccDNA vectors in a variety of ways, including, for example, uses, methods, diagnostic procedures and/or gene therapy regimens ex situ, in vitro and in vivo.

[00384] The present invention provides a method of treating a disease or disorder in a subject, comprising administering to a target cell in need thereof (e.g., a muscle cell or tissue, or other type of diseased cell) of the subject a therapeutically effective amount of a cccDNA vector, optionally with a pharmaceutically acceptable carrier. . Although said cDNA vector can be introduced in the presence of a carrier, such a carrier is not necessary. The proposed cccDNA vector contains a nucleotide sequence of interest suitable for treating a disease. In particular, said cDNA vector may contain a desired exogenous DNA sequence operably linked to control elements capable of directing transcription of the desired polypeptide, protein or oligonucleotide encoded by said exogenous DNA sequence when administered to a subject. The specified cDNA vector can be introduced by any suitable route, as described above and elsewhere in this document.

[00385] Any transgene can be delivered using cDNA vectors as described herein. Transgenes of interest include polypeptide-encoding nucleic acids or non-coding nucleic acids (e.g., RNAi, miR, etc.), preferably therapeutic (e.g., for medical, diagnostic or veterinary use) or immunogenic (e.g., for vaccines) polypeptides.

[00386] In some embodiments, the transgenes to be expressed by the cccDNA vectors described herein express or encode one or more polypeptides, peptides, ribozymes, peptide nucleic acids, siRNA, RNAi, antisense oligonucleotides, antisense polynucleotides, antibodies , antigen-binding fragments, or any combination of the above.

[00387] In particular, the transgene may encode one or more therapeutic agents, including, but not limited to, protein(s), polypeptide(s), peptide(s), enzyme(s), antibodies, antigen binding fragments, as well as variants and/or active fragments of the above, agonists, antagonists, mimetics for use in the treatment, prevention and/or alleviation of one or more symptoms of a disease, dysfunction, injury and/or disorder. In one aspect, the disease, dysfunction, injury, injury, and/or disorder is a disease, dysfunction, injury, injury, and/or disorder in a human.

[00388] As noted herein, the transgene may encode a therapeutic protein or peptide, or a therapeutic nucleic acid sequence or therapeutic agent, including, but not limited to, one or more agonists, antagonists, antiapoptotic factors, inhibitors, receptors, cytokines, cytotoxins, erythropoietic agents, glycoproteins, growth factors, growth factor receptors, hormones, hormone receptors, interferons, interleukins, interleukin receptors, nerve growth factors, neuroactive peptides, neuroactive peptide receptors, proteases, protease inhibitors, protein decarboxylases, protein kinases, protein kinase inhibitors , enzymes, receptor binding proteins, transport proteins or one or more inhibitors thereof, serotonin receptors or one or more serotonin uptake inhibitors, serpins, serpin receptors, tumor suppressors, diagnostic molecules, chemotherapeutic agents, cytotoxins, or any combination of the above.

[00389] In some embodiments, a transgene in an expression cassette, expression construct, or cDNA vector described herein may be codon-optimized for a host cell. As used herein, the term “codon-optimized” or “codon optimization” refers to the process of modifying a nucleic acid sequence to enhance expression in vertebrate cells of interest, e.g., mouse or human (e.g., humanized sequences), by replacing at least one, more than one or a significant number of codons of a native sequence (eg, a prokaryotic sequence) to the codons that are most or most frequently used in the genes of the specified vertebrate. Different species exhibit specific systematic preponderance of certain codons for specific amino acids. Typically, codon optimization does not change the amino acid sequence of the original translated protein. Optimized codons can be determined using, for example, the Gene Forge® codon optimization and customized gene synthesis platform from Aptagen (Aptagen, Inc.) or other publicly available database.

[00390] Disclosed herein are compositions and formulations of cccDNA vectors that include one or more ccDNA vectors of this invention along with one or more pharmaceutically acceptable buffers, diluents, or excipients. Such compositions may be included in one or more diagnostic or therapeutic kits for diagnosing, preventing, treating, or alleviating one or more symptoms of a disease, injury, disorder, injury, or dysfunction. In one aspect, said disease, injury, disorder, injury, or dysfunction is a disease, injury, disorder, injury, or dysfunction in a human.

[00391] Another aspect of the technology described herein provides a method of providing a diagnostically or therapeutically effective amount of a cccDNA vector to a subject in need thereof, the method comprising introducing into a cell, tissue or organ of the subject in need thereof an amount of the cccDNA vector as described herein herein for a period of time allowing the transgene to be expressed from a cccDNA vector, thereby providing the subject with a diagnostically or therapeutically effective amount of the protein, peptide, nucleic acid expressed by said cccDNA vector. According to a further aspect, said subject is a human.

[00392] According to another aspect of the technology described herein, there is provided a method of diagnosing, preventing, treating, or alleviating at least one or more symptoms of a disease, disorder, dysfunction, injury, abnormal condition, or injury in a subject. In a general and broad sense, the method includes at least the step of administering to a subject in need thereof one or more disclosed cccDNA vectors, in an amount and for a duration of time sufficient to diagnose, prevent, treat, or alleviate one or more symptoms of a disease, disorder , dysfunction, damage, abnormal condition, or injury in the subject. According to a further aspect, said subject is a human.

[00393] Another aspect is provided by the use of said cccDNA vector as a tool for treating or reducing one or more symptoms of a disease or disease state. There are a number of hereditary diseases for which defective genes are known and which are generally divided into two classes: states of deficiency, usually enzyme deficiencies, which are usually inherited in a recessive manner, and states of imbalance, which may involve regulatory or structural proteins, and which are usually, but not always, inherited in a dominant manner. For diseases with deficiency conditions, cccDNA vectors can be used to deliver transgenes to introduce the normal gene into diseased tissues for replacement therapy, and, in some embodiments, to create animal models of the disease using antisense mutations. In the case of disease states of imbalance, cccDNA vectors can be used to create a disease state in a model system, which can then be used to counteract said disease state. Thus, the cccDNA vectors and methods disclosed herein enable the treatment of genetic diseases. According to this document, treatment of a disease state is carried out by partially or completely eliminating the deficiency or imbalance that causes the disease or makes it more severe.

[00394] In yet another additional aspect, a cccDNA vector as described herein can be used to deliver a heterologous nucleotide sequence in situations where regulation of the level of transgene expression (for example, the expression of transgenes encoding hormones or growth factors, as described herein) is required. .

[00395] Accordingly, in some embodiments, a cccDNA vector described herein can be used to correct an abnormal level and/or function of a gene product (eg, a missing or defective protein) that results in a disease or disorder. Said cccDNA vector may produce a functional protein and/or modify levels of said protein to alleviate or reduce symptoms resulting from or provide an advantage to a particular disease or disorder caused by the absence or defect of the protein. For example, treatment of OTC deficiency can be achieved by producing a functional OTC enzyme; treatment of hemophilia A and B can be achieved by modifying the levels of factor VIII, factor IX and factor X; treatment of PKU can be achieved by modifying levels of the enzyme phenylalanine hydroxylase; treatment of Fabry disease or Gaucher disease can be achieved by producing functional alpha-galactosidase or beta-glucocerebrosidase, respectively; treatment of MLD or MPSII can be achieved by producing functional arylsulfatase A or iduronate-2-sulfatase, respectively; treatment of cystic fibrosis can be carried out by producing a functional regulator of transmembrane conductance in cystic fibrosis; treatment of glycogen storage disease can be carried out by restoring the function of the functional enzyme glucose-6-phosphatase; and treatment of PFIC can be achieved by obtaining functional ATP8B1, ABCB11, ABCB4 or TJP2 genes.

[00396] In alternative embodiments, cccDNA vectors as described herein can be used to provide antisense nucleic acid to a cell in vitro or in vivo. For example, if the transgene is an RNAi molecule, expression of an antisense nucleic acid or RNAi in a target cell reduces the level of expression of a particular protein by that cell. Accordingly, transgenes, which are RNAi molecules or antisense nucleic acids, can be introduced to reduce the level of expression of a particular protein in a subject in need thereof. Antisense nucleic acids can also be introduced into cells in vitro to regulate cell physiology, for example to optimize cell or tissue culture systems.

[00379] In some embodiments, representative examples of transgenes encoded by a cccDNA vector include, but are not limited to: X, lysosomal enzymes (e.g., hexosaminidase A associated with Tay-Sachs disease or iduronate sulfatase associated with Gunther syndrome/MPS II), erythropoietin, angiostatin, endostatin, superoxide dismutase, globin, leptin, catalase, tyrosine hydroxylase, and cytokines (eg, interferon, β-interferon, interferon-γ, interleukin-2, interleukin-4, interleukin 12, granulocyte-macrophage colony-stimulating factor, lymphotoxin etc.), peptide growth factors and hormones (for example, somatotropin, insulin, insulin-like growth factors 1 and 2, platelet-derived growth factor (TRF), epidermal growth factor (EGF), fibroblast growth factor (FGF), nerve growth factor (NGF), neurotrophic factor-3 and 4, brain-derived neurotrophic factor (BDNF), glial growth factor (GDNF), transforming growth factors α and β; etc.), receptors (eg, tumor necrosis factor receptor). In some example embodiments, the transgene encodes a monoclonal antibody specific for one or more desired targets. In some example embodiments, the cDNA vector encodes more than one transgene. In some example embodiments, the transgene encodes a fusion protein comprising two different polypeptides of interest. In some embodiments, the transgene encodes an antibody, including a full-length antibody or antibody fragment as defined herein. In some embodiments, the antibody is an antigen binding domain or immunoglobulin variable domain sequence as defined herein. Other illustrative examples of transgene sequences encode suicide gene products (thymidine kinase, cytosine deaminase, diphtheria toxin, cytochrome P450, deoxycytidine kinase, and tumor necrosis factor), proteins that confer resistance to drugs used in anticancer therapy, and tumor suppressor gene products.

[00398] In an exemplary embodiment, a transgene expressed by said cccDNA vector can be used to treat muscular dystrophy in a subject in need thereof, the method comprising: administering an effective amount of the cccDNA vector described herein to treat, alleviate, or prevent, said cccDNA vector contains a heterologous nucleic acid encoding dystrophin, minidystrophin, microdystrophin, myostatin propeptide, follistatin, soluble type II activin receptor, IGF-1, anti-inflammatory polypeptides such as dominant mutant I-kappa-B, sarcospan, utrophin, microdystrophin, laminin-α2, α-sarcoglycan, β-sarcoglycan, γ-sarcoglycan, Δ-sarcoglycan, IGF-1, antibody or antibody fragment against myostatin or myostatin propeptide, and/or RNAi directed against myostatin. In specific embodiments, the cccDNA vector can be introduced into skeletal, diaphragmatic, and/or cardiac muscle as described herein.

[00399] In some embodiments, the cccDNA vector can be used to deliver a transgene to skeletal, cardiac, or diaphragmatic muscle to produce a polypeptide (e.g., enzyme) or functional RNA (e.g., RNA interference, microRNA, antisense RNA) that normally circulates in the blood, or for systemic delivery to other tissues, to treat, alleviate, and/or prevent a disorder (eg, a metabolic disorder such as diabetes (eg, insulin), hemophilia (eg, VIII), mucopolysaccharidosis disorder (eg, Sly's syndrome, Hurler's syndrome, Scheie's syndrome, Hurler-Scheie's syndrome, Gunther's syndrome, Sanfilippo's syndrome A, B, C, D, Morquio's syndrome, Maroteaux-Lamy syndrome, etc., or a lysosomal storage disorder (such as Gaucher's disease [glucocerebrosidase ], Pompe disease [lysosomal acid alpha-glucosidase] or Fabry disease [alpha-galactosidase A]) or glycogen storage disorders (such as Pompe disease [lysosomal acid alpha-glucosidase]). Other suitable proteins for the treatment, amelioration and/or prevention of metabolic disorders are described above.

[00400] In other embodiments, a cccDNA vector as described herein can be used to deliver a transgene in a method of treating, ameliorating, and/or preventing a metabolic disorder in a subject in need thereof. Illustrative examples of metabolic disorders and transgenes encoding polypeptides are described herein. Optionally, the polypeptide is secreted (e.g., a polypeptide that is a naturally occurring secreted polypeptide, or a polypeptide that is engineered to be secreted, e.g., by achieving functional association with a secretory signal sequence, as is known to those skilled in the art ).

[00401] In other embodiments, a cccDNA vector as described herein can be used to treat seizures, for example, to reduce the occurrence, frequency, or severity of seizures. The effectiveness of therapeutic treatment of seizures can be assessed based on behavioral signs (eg, trembling, eye or oral tics) and/or electrographic methods (most seizures are characterized by distinctive electrographic abnormalities). Thus, the cccDNA vector described herein can also be used to treat epilepsy, which is characterized by multiple seizures over time. In one exemplary embodiment, somatostatin (or an active fragment thereof) is administered to the brain using a cccDNA vector as described herein for the treatment of a pituitary tumor. In accordance with this embodiment, a cccDNA vector as described herein encoding somatostatin (or an active fragment thereof) is introduced into the pituitary gland by microinfusion. Similarly, this treatment can be used to treat acromegaly (abnormal secretion of growth hormone by the pituitary gland). The nucleic acid sequence (eg, GenBank Accession No. J00306) and amino acid sequence (eg, GenBank Accession No. P01166; contains the processed active peptides somatostatin-28 and somatostatin-14) of somatostatins are known to those skilled in the art. In specific embodiments, the cccDNA vector may encode a transgene that contains a secretory signal as described in US Pat. No. 7,071,172.

[00402] Another aspect of the present invention relates to the use of a cccDNA vector as described herein to produce antisense RNA, RNAi, or other functional RNA (eg, a ribozyme) for systemic delivery to a subject in vivo. Accordingly, in some embodiments, the cccDNA vector may contain a transgene that encodes an antisense nucleic acid, a ribozyme (e.g., as described in US Pat. No. 5,877,022), RNAs that affect spliceosome-mediated trans-splicing (see Puttaraju et al. , (1999) Nature Biotech. 17:246; US Patent No. 6013487; US Patent No. 6083702), interfering RNAs (RNAi) mediating gene silencing (see Sharp et al., (2000) Science 287:2431), or others untranslated RNAs such as guide RNAs (Gorman et al., (1998) Proc. Nat. Acad. Sci. USA 95:4929; US Pat. No. 5,869,248 to Yuan et al.); and so on.

[00403] In some embodiments, the cccDNA vector may further also contain a transgene that encodes a reporter polypeptide (eg, an enzyme such as green fluorescent protein or alkaline phosphatase). In some embodiments, the transgene that encodes a reporter protein suitable for experimental or diagnostic purposes is selected from any of the following transgenes: β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase ( CAT), luciferase and other genes well known in the art. In some aspects, cccDNA vectors containing a transgene encoding a reporter polypeptide can be used for diagnostic purposes or as markers of cccDNA vector activity in a subject to which they are administered.

[00404] In some embodiments, the cccDNA vector may contain a transgene or heterologous nucleotide sequence that has homology to and recombines with a locus on the host chromosome. This approach can be used to correct a genetic defect in a host cell.

XII. Introduction

[00405] In certain embodiments, more than one administration (e.g., two, three, four, or more administrations) may be administered to achieve the desired level of gene expression over a period of time at intervals of varying lengths, such as daily, weekly, monthly, annually, and etc.

[00406] Examples of routes for administering the cccDNA vector described herein include oral, rectal, transmucosal, intranasal, inhalation (e.g., aerosol), buccal (e.g., sublingual), vaginal, intrathecal, intraocular, transdermal, intraendothelial, in utero (or in ovo), parenteral (e.g., intravenous, subcutaneous, intradermal, intracranial, intramuscular [including skeletal, diaphragmatic, and/or cardiac], intrapleural, intracerebral, and intraarticular), local (e.g., on the surface of the skin and mucous membranes, including the surface of the respiratory tract, and percutaneous administration), intralymphatic administration, etc., as well as direct injection into a tissue or organ (for example, into the liver, eye, skeletal muscle, cardiac muscle, diaphragm muscle or brain).

[00407] Administration of said cccDNA vector to a subject may be at any site, including, but not limited to, a site selected from the group consisting of brain, skeletal muscle, smooth muscle, heart, diaphragm, respiratory epithelium, liver, kidney, spleen , pancreas, skin and eyes. The cccDNA vector may also be introduced into a tumor (eg, into or near a tumor or lymph node). The most appropriate route in any given case depends on the nature and severity of the condition being treated, ameliorated and/or prevented, and the nature of the particular cccDNA vector used. In addition, cccDNA allows the introduction of more than one transgene in a single vector or in multiple cccDNA vectors (eg, a cccDNA cocktail).

[00408] A. Dose Ranges

[00409] Optionally, in vivo and/or in vitro assays may be used to determine optimal dosage ranges for use. The exact dosage to be used in the composition will also depend on the route of administration and the severity of the condition and should be determined based on the judgment of one skilled in the art and taking into account the circumstances of each subject. Effective doses can be extrapolated from dose-response curves obtained from in vitro test systems or animal models.

[00410] The cccDNA vector is administered in sufficient quantities to transfect cells of the desired tissue and provide sufficient levels of gene transfer and expression without excessive adverse effects. Standard and pharmaceutically acceptable routes of administration include, but are not limited to, those described below in the Introduction section, such as direct delivery to the target organ (e.g., intraportal delivery to the liver), oral delivery, inhalation (including intranasal and intratracheal delivery), intraocular, intravenous, intramuscular, subcutaneous, intradermal, intratumoral delivery; and other parenteral routes of administration. Routes of administration can be combined if required.

[00411] The dosage amount of cccDNA vector required to achieve a given "therapeutic effect" will vary depending on several factors, including, but not limited to: the route of administration of the nucleic acid, the level of gene or RNA expression required to achieve therapeutic effect, the specific disease or disorder being treated, and the stability of the gene(s), RNA product(s), or resulting protein(s) expressed. One skilled in the art will readily be able to determine a dosage range of a cccDNA vector for treating a patient having a particular disease or disorder based on the above factors as well as other factors well known in the art.

[00412] The dosage regimen may be adjusted to provide an optimal therapeutic response. For example, the oligonucleotide may be administered repeatedly, for example multiple doses may be administered daily, or the dose may be proportionally reduced based on the therapeutic situation dictated. One skilled in the art will readily be able to determine suitable dosages and administration schedules for the oligonucleotides of this invention, both for administration to cells and for administration to subjects.

[00413] A "therapeutically effective dose" is within a relatively wide range of values that can be determined in clinical trials and depends on the specific application (nerve cells will require very small amounts, whereas systemic injections will require significant amounts). For example, for direct in vivo injection into human skeletal or cardiac muscle, a therapeutically effective dose would range from about 1 μg to 100 g of cccDNA vector. If exosomes or microparticles are used to deliver the cccDNA vector, the therapeutically effective dose can be determined experimentally but is expected to deliver between 1 μg and approximately 100 g of vector.

[00414] The preparation of pharmaceutically acceptable excipients and carrier solutions is well known to those skilled in the art, as is the development of suitable dosage and treatment regimens for use of the specific compositions described herein in various treatment regimens.

[00415] For in vitro transfection, the effective amount of ccDNA vector to be delivered into cells (1×10 ⁶ cells) is on the order of 0.1-100 μg of ccDNA vector, preferably from 1 to 20 μg, and more preferably from 1 up to 15 mcg, or from 8 to 10 mcg. Larger cccDNA vectors require higher doses. If exosomes or microparticles are used, the effective in vitro dose can be determined experimentally, but must deliver generally the same amount of cccDNA vector.

[00416] Treatment may include administration of a single dose or multiple doses. In some embodiments, more than one dose may be administered to a subject; in fact, doses can be administered multiple times as needed since the cccDNA vector does not induce an immune response against the capsid in the host due to the absence of a viral capsid. Therefore, one skilled in the art can easily determine the appropriate number of doses. The number of doses administered may be, for example, about 1-100, preferably 2-20 doses.

[00417] Without wishing to be bound by any particular theory, the absence of a typical antiviral immune response upon administration of a cccDNA vector as described herein (ie, the absence of capsid components) allows the cccDNA vector to be administered to a host repeatedly. In some embodiments, the number of times the heterologous nucleic acid is administered to a subject is 2 to 10 times (eg, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times). In some embodiments, the cccDNA vector is delivered to a subject more than 10 times.

[00418] In some embodiments, a dose of the cccDNA vector is administered to a subject no more than once per calendar day (eg, in a 24-hour period). In some embodiments, a dose of the cccDNA vector is administered to a subject no more than once every 2, 3, 4, 5, 6, or 7 calendar days. In some embodiments, a dose of the cccDNA vector is administered to a subject no more than once per calendar week (eg, 7 calendar days). In some embodiments, a dose of the cccDNA vector is administered to a subject no more than once every two weeks (eg, once every two calendar weeks). In some embodiments, a dose of the cccDNA vector is administered to a subject no more than once per calendar month (eg, once every 30 calendar days). In some embodiments, a dose of the cccDNA vector is administered to a subject no more than once every six calendar months. In some embodiments, a dose of the cccDNA vector is administered to a subject no more than once per calendar year (eg, 365 days or 366 days in a high year).

[00419] B. Unit Dosage Forms

[00420] In some embodiments, the pharmaceutical compositions may be conveniently presented in a unit dosage form. The unit dosage form will typically be adapted to one or more specific routes of administration of the pharmaceutical composition. In some embodiments, said unit dosage form is adapted for administration by inhalation. In some embodiments, said unit dosage form is adapted for administration via a vaporizer. In some embodiments, said unit dosage form is adapted for administration via a nebulizer. In some embodiments, the unit dosage form is adapted for administration using an aerosol generator. In some embodiments, the unit dosage form is adapted for oral administration, for buccal administration, or for sublingual administration. In some embodiments, the unit dosage form is adapted for intravenous, intramuscular, or subcutaneous administration. In some embodiments, the unit dosage form is adapted for intrathecal or intracerebroventricular administration. In some embodiments, the pharmaceutical composition is a formulation for topical administration. The amount of active ingredient that can be combined with the carrier material to form a unit dosage form is usually that amount of said compound that provides a therapeutic effect.

XIII. Various Applications

[00421] The compositions and cccDNA vectors presented herein can be used to deliver a transgene for various purposes, as described above. In some embodiments, the transgene encodes a protein or functional RNA that is intended to be used for research purposes, for example, to create a somatic model of transgenic animals carrying the transgene, for example, to study the function of the transgene product. In another example, the transgene encodes a protein or functional RNA that is intended for use in creating an animal model of a disease.

[00422] In some embodiments, the transgene encodes one or more peptides, polypeptides, or proteins that are useful for treating, ameliorating, or preventing disease states in a mammalian subject. The transgene may be transferred into a patient's body (eg, expressed in the patient) in an amount sufficient to treat a disease associated with decreased expression, absence of expression, or dysfunction of the gene.

[00423] Some embodiments provide for the use of these cccDNA vectors in diagnostic and screening methods where the transgene is transiently or stably expressed in a cell culture system or, alternatively, in a transgenic animal model.

[00424] In another aspect, the technology described herein provides a method for transducing a population of mammalian cells. In a general and broad sense, the method includes at least the step of introducing into one or more cells of a population a composition that contains an effective amount of one or more cccDNAs as described herein.

[00425] In addition, the present invention provides compositions, as well as therapeutic and/or diagnostic kits, that include one or more disclosed cccDNA vectors or one or more disclosed cccDNA compositions, in formulations prepared using one or more additional ingredients, or prepared together with one or more instructions for their use.

EXAMPLES

[00426] The following examples are intended to be illustrative and not limiting.

EXAMPLE 1: Construction of cDNA vectors

[00427] The preparation of cDNA vectors using a polynucleotide construct template is described. For example, the polynucleotide construct template used to produce the cDNA vectors of the present invention may be a cDNA plasmid, a cDNA bacmid, and/or a cDNA baculovirus. Without being limited by theory, in a permissive host cell in the presence of, for example, Rep, a polynucleotide construct template containing two ITRs and an expression construct where at least one of the ITRs is modified is replicated to produce cccDNA vectors. Obtaining a cccDNA vector takes place in two stages: first, excision (“rescue”) of the template from the matrix backbone (for example, ccDNA plasmid, ccDNA bacmid, ccDNA baculovirus genome, etc.) using Rep proteins, and, second, Rep-mediated replication of the excised cccDNA vector.

[00428] An example of a method for producing cccDNA vectors is a ccDNA plasmid as described herein. In FIG. 1A and 1B, the polynucleotide construct template of each ccDNA plasmid includes both a left mutated ITR and a right mutated ITR, with the following sequences located between said ITRs: (i) an enhancer/promoter; (ii) the transgene cloning site; (iii) a post-transcriptional response element (eg, woodchuck hepatitis virus post-transcriptional regulatory element (WPRE)); and (iv) a polyadenylation signal (eg, from the bovine growth hormone gene (BGHpA)). Unique restriction endonuclease recognition sites (R1-R6) were also introduced between all components (shown in Fig. 1A and Fig. 1B) to facilitate the introduction of new genetic components into specific sites of the construct. Enzyme sites R3 (PmeI) GTTTAAAC (SEQ ID NO: 7) and R4 (PacI) TTAATTAA (SEQ ID NO: 542) are inserted into the cloning site to introduce the open reading frame of the transgene. The indicated sequences were cloned into the pFastBac HT B plasmid obtained from ThermoFisher Scientific.

[00429] Briefly, a number of cccDNA vectors were prepared from the ccDNA plasmid constructs shown in Table 12 using the method shown in FIG. 4A-4C. Table 12 lists the number of corresponding polynucleotide sequences for each component, including sequences active as a replication protein site (RPS) (eg, a Rep binding site) at either end of the promoter operably linked to the transgene. The numbers in Table 12 refer to the SEQ ID NOs herein corresponding to the sequences of each component.

[00430] Table 12: Typical cccDNA constructs

Plasmid ITR-L Promoter Transgene ITR-R Construct-1 51 3 Luciferase 2 Construct-2 52 3 Luciferase 1 Construct-3 51 4 with SV40 intron Luciferase 2 Construct-4 52 4 with SV40 intron Luciferase 1 Construct-5 51 5 with SV40 intron Luciferase 2 Construct-6 52 5 with SV40 intron Luciferase 1 Construct-7 51 6 Luciferase 2 Construct-8 52 6 Luciferase 1

[00431] In some embodiments, the cccDNA vector construct comprises a promoter that is a regulatory switch as described herein, such as an inducible promoter. Other constructs have been used to generate cccDNA vectors, such as Construct-10, Construct-11, Construct-12, and Construct-13 (see, e.g., Table 14A), which contain an MND or HLCR promoter operably linked to a luciferase transgene.

[00432] Production of cccDNA-bacmid:

[00433] As shown in FIG. 4A, DH10Bac competent cells (MAX EFFICIENCY® DH10Bac™ competent cells, Thermo Fisher) were transformed with either the test or control plasmid according to the protocol according to the manufacturer's instructions. Recombination between the plasmid and the baculovirus shuttle vector was induced in DH10Bac cells to produce recombinant cccDNA bacmids. Recombinant bacmids were selected by positive selection based blue-white screening in E. coli (marker Φ80dlacZΔM15 provides α-complementation of the β-galactosidase gene from the bacmid vector) on a bacterial agar plate containing X-gal and IPTG with antibiotics for selection transformants and maintenance of bacmid and transposase plasmids. White colonies resulting from transposition that disrupts the β-galactoside indicator gene were selected and cultured in 10 ml of medium.

[00434] Recombinant cccDNA bacmids were isolated from E. coli and transfected into Sf9 or Sf21 insect cells using FugeneHD to produce infectious baculovirus. Adherent insect cells Sf9 or Sf21 were cultured in 50 ml of medium in T25 flasks at 25 °C. After 4 days, the culture medium (containing P0 virus) was separated from the cells and filtered through a 0.45-μm pore size filter, separating infectious baculovirus particles from cells or cellular debris.

[00435] Optionally, the first generation of baculovirus (P0) was amplified by infecting naive Sf9 or Sf21 insect cells in 50-500 ml of medium. Cells were cultured in suspension cultures in an orbital shaker incubator at 130 rpm at 25°C, monitoring cell diameter and cell viability until the cells reached a diameter of 18-19 nm (from a naïve cell diameter of 14-15 nm) and a density of about 4.0E+6 cells/ml. 3–8 days after infection, baculovirus P1 particles in the medium were collected after centrifugation to remove cells and debris, followed by filtration through a 0.45-μm pore size filter.

[00436] The cDNA baculovirus containing the test constructs was collected and the infectivity or titer of the baculovirus was determined. In particular, 4 × 20 ml of Sf9 cell culture with a density of 2.5E+6 cells/ml were treated with baculovirus P1 in the following dilutions: 1/1000, 1/10000, 1/50000, 1/100000, and incubated at 25-27°C C. Infectivity was determined daily for 4-5 days by the increase in cell diameter and cell cycle arrest, as well as changes in cell viability.

[00437] Referring to FIG. 4A, a “Rep plasmid” that contains a single Rep protein (see, e.g., FIG. 8A), was produced in the expression vector pFASTBAC™-Dual (ThermoFisher).

[00438] The Rep plasmid was transformed into DH10Bac competent cells (MAX EFFICIENCY® DH10Bac™ Competent Cells (Thermo Fisher)) following the protocol provided by the manufacturer. Recombination between the Rep plasmid and the baculovirus shuttle vector was induced in DH10Bac cells to produce recombinant bacmids (“Rep bacmid”). Recombinant bacmids were selected by positive selection, which involved blue-white screening in E. coli (marker Φ80dlacZΔM15 provides α-complementation of the β-galactosidase gene from the bacmid vector) on a bacterial agar plate containing X-gal and IPTG. Isolated white colonies were collected and inoculated into 10 ml of selective medium (kanamycin, gentamicin, tetracycline in LB broth). Recombinant bacmids (Rep bacmids) were isolated from E. coli, and Sf9 or Sf21 insect cells were transfected with these Rep bacmids to produce infectious baculovirus.

[00439] Sf9 or Sf21 insect cells were cultured in 50 ml of medium for 4 days and an infectious recombinant baculovirus (“Rep-baculovirus”) was isolated from the culture. Optionally, first generation Rep baculovirus (P0) was amplified by infecting untreated insect cells with Sf9 or Sf21 and culturing in 50-500 ml of medium. After 3 to 8 days postinfection, baculovirus P1 particles in the medium were collected by separating cells by centrifugation or filtration, or using another fractionation method. Rep-baculovirus was collected and the infectivity of the baculovirus was determined. Specifically, 4 x 20 ml Sf9 cell cultures at a density of 2.5 x 10 ⁶ cells/ml were treated with baculovirus P1 at the following dilutions: 1/1000, 1/10000, 1/50000, 1/100000, and incubated. Infectivity was determined daily for 4-5 days by the increase in cell diameter and cell cycle arrest, as well as changes in cell viability.

[00440] Preparation and characterization of cccDNA vector

[00441] As shown in FIG. 4B, Sf9 insect cell culture medium containing either (1) a sample containing cccDNA bacmid or cccDNA baculovirus or (2) Rep baculovirus described above was then added to a fresh Sf9 cell culture (2.5E+6 cells /ml, 20 ml) in a ratio of 1:1000 and 1:10000, respectively. Cells were then cultured at 130 rpm at 25°C. Cell diameter and viability were detected 4–5 days after coinfection. When the cell diameter reached 18-20 nm with a viability of approximately 70-80%, the cell cultures were centrifuged, the medium was removed and the cell pellets were collected. Cell pellets were first resuspended in a sufficient volume of aqueous medium, either water or buffer. The cccDNA vector was isolated from cells and purified using the Qiagen MIDI PLUS™ purification protocol (Qiagen, treatment 0.2 mg cell pellet weight per column).

[00442] Yield values for cccDNA vectors produced and purified from Sf9 insect cells were initially determined based on UV absorbance at 260 nm. The yields of various cccDNA vectors determined based on UV absorbance are presented below in Table 13.

[00443] Table 13: Yield of cccDNA vectors from typical constructs.

Construct Volume of culture Culture parameters
(Diameter in micrometers) Yield (mg/l) Estimated yield (pg/cell) construct-1 2x1 l Total: 6.02 x10e ⁶
Viability: 53.3%
Diameter: 18.4 15.8 5.23

[00444] Evaluation of cccDNA vectors can be accomplished by identification using agarose gel electrophoresis under native or denaturing conditions, as illustrated in FIG. 4D, where there is (a) the presence of characteristic bands migrating at twice the size on denaturing gels compared to native gels after restriction endonuclease digestion and gel electrophoretic analysis, and (b) the presence of monomer and dimer bands (2×) on denaturing gels for undigested material, which is characteristic of the presence of a cDNA vector.

[00445] The structures of the isolated cccDNA vectors were further analyzed by digesting DNA obtained from coinfected Sf9 cells (as described herein) with restriction endonucleases selected based on a) the presence of only one cut site in the ccDNA vectors, and b) obtaining the resulting fragments large enough to be clearly visible when fractionated on a 0.8% denaturing agarose gel (>800 bp). As shown in FIG. 4E, linear discontinuous DNA vectors and linear and continuous cccDNA vectors can be distinguished by the size of the reaction products—for example, a discontinuous DNA vector is expected to produce 1 kb fragments. and 2 kb, and the unencapsidated vector with a continuous structure - fragments of 2 kb. and 4 kb.

[00446] Thus, in order to qualitatively demonstrate that the isolated cccDNA vectors have covalently closed ends as required by their definition, samples were digested with a restriction endonuclease identified in the context of the specific DNA vector sequence as a single site restriction endonuclease, preferably providing the formation of two cleavage products of unequal size (eg, 1000 bp and 2000 bp). After digestion and electrophoresis on a denaturing gel (which separates two complementary DNA strands), linear DNA that is not covalently closed will be separated into 1000 bp fragments. and 2000 bp, while covalently closed DNA (i.e. cDNA vector) will be divided into fragments 2 times larger (2000 bp and 4000 bp), since two chains The DNA is linked, and after unfolding it will be twice as long (although single-stranded). Additionally, when the monomeric, dimeric, and n-mer forms of DNA vectors are digested, they will all separate into fragments of equal sizes due to the end-binding of the multimeric DNA vectors (see Figure 4D).

[00447] FIG. 5 is an illustrative picture of a denaturing gel with cccDNA vectors as follows: construct-1, construct-2, construct-3, construct-4, construct-5, construct-6, construct-7, and construct-8 (all described in Table 12 above), with (+) or without (-) endonuclease cleavage. Each cccDNA vector from construct-1 to construct-8 produced two bands (*) after the endonuclease reaction. The sizes of their two stripes, determined based on the size of the marker, are presented at the bottom of the figure. The sizes of the bands confirm that each of the cccDNA vectors derived from the plasmids containing construct-1 to construct-8 has a continuous structure.

[00448] As used herein, the phrase “assay for identifying DNA vectors by agarose gel electrophoresis under native and denaturing gel conditions” refers to an assay for assessing the presence of closed ends of cccDNA by performing restriction endonuclease digestion followed by electrophoretic assessment of the digestion products. One example of such an analysis is given below, although one skilled in the art will appreciate that many variations of this example known in the art can be performed. The restriction endonuclease is selected to be the enzyme that makes a single cut of the cDNA vector of interest to produce products that are approximately 1/3× and 2/3× the length of the DNA vector. This ensures band separation on both native and denaturing gels. It is important to remove the buffer from the sample before denaturation. Qiagen's PCR Product Purification Kit or desalting “spun columns,” such as the GE HEALTHCARE ILUSTRA™ MICROSPIN™ G-25 columns, are examples of endonuclease digestion agents known in the art. This analysis includes, for example, i) digestion of DNA with suitable restriction endonuclease(s), 2) addition, for example, to a Qiagen PCR purification kit, eluting with distilled water, iii) addition of a 10x denaturing solution (10× = 0.5 M NaOH, 10 mM EDTA), adding 10x unbuffered dye solution and running the analysis along with DNA markers obtained by adding 10x denaturing solution to a 4x, 0.8-1.0% gel pre-incubated with 1 mM EDTA and 200 mM NaOH to ensure uniform NaOH concentration in the gel and gel chamber, and run the gel in the presence of 1× denaturing solution (50 mM NaOH, 1 mM EDTA). One skilled in the art will understand what voltage should be used to perform electrophoresis depending on the size and desired time to obtain results. After electrophoresis, the gels are dried and neutralized in 1× TBE or TAE and transferred to distilled water or 1× TBE/TAE with 1× SYBR Gold. The bands can then be visualized, for example, using Thermo Fisher's SYBR® Gold Nucleic Acid Gel Stain (10,000X concentrate in DMSO) and epifluorescent light (blue) or UV (312 nm).

[00449] The purity of the resulting cccDNA vector can be assessed using any method known in the art. In one non-limiting example of a method, the contribution of the ccDNA plasmid to the total UV absorbance of the sample can be calculated by comparing the fluorescence intensity of the ccDNA vector and the standard. For example, if based on UV absorbance it is determined that 4 μg of ccDNA vector is loaded on the gel, and the fluorescence intensity of the ccDNA vector is equivalent to a 2 kb band. with a known mass of 1 μg, then the mass of the ccDNA vector is 1 μg, and the ccDNA vector constitutes 25% of the total amount of UV absorbing material. The intensity of the band on the gel is then plotted against the calculated input amount to which the band corresponds - for example, if the total amount of ccDNA vector corresponds to 8 kb, and the excised comparative band corresponds to 2 kb, then the intensity of the indicated the bars on the graph will correspond to 25% of the total amount administered, which in this case would be 0.25 mcg when 1.0 mcg was administered. Using titration of the cccDNA vector plasmid to construct a standard curve, the quantity for the cccDNA vector band is calculated from the regression line equation, which can then be used to determine the percentage of the total input amount represented by the cccDNA vector, or the percentage purity.

EXAMPLE 2: obtaining viral DNA in cDNA cells

[00450] cccDNA vectors were also obtained from constructs 11, 12, 13 and 14 shown in Table 14A. CctDNA plasmids containing constructs 11-14 were obtained by molecular cloning methods well known in the art. The plasmids in Table 14A were constructed with a WPRE containing SEQ ID NO: 8 followed by BGHpA containing SEQ ID NO: 9 in the 3' untranslated region between the transgene and the right ITR.

Table 14A

Plasmid ITR-L Promoter Transgene ITR-R Construct-11 (SEQ ID NO: 63) (SEQ ID NO: 70) SEQ ID NO: 71 (SEQ ID NO: 1) Construct-12 (SEQ ID NO: 51) (SEQ ID NO: 70) SEQ ID NO: 71 (SEQ ID NO: 64) Construct-13 (SEQ ID NO: 63) (SEQ ID NO: 74) SEQ ID NO: 71 (SEQ ID NO: 1) Construct-14 (SEQ ID NO: 51) (SEQ ID NO: 74) SEQ ID NO: 71 (SEQ ID NO: 64)

[00451] The vector backbone for constructs 11-14 is as follows: (i) asymITR-MND -luciferase-wPRE-BGH-polyA-ITR in pFB-HTb (construct-11), (ii) ITR-MND-luciferase -wPRE -BGH-polyA-asymITR in pFB-HTb (construct-12), (iii) asymITR-HLCR-AAT-luc-wPRE(O)-BGH-polyA-ITR in pFB-HTb (construct-13); and ITR -HLCR-AAT-luc-wPRE(O)-BGH-polyA-asymITR in pFB-HTb (construct-14), each construct having at least one asymmetric ITR relative to each other. These constructs also contain one or more of the following sequences: wPRE0 (SEQ ID NO: 72) and a BGH-PolyA sequence (SEQ ID NO: 73), or sequences that are at least 85%, or at least 90%, or at least 95%. identical to the indicated sequences.

[00452] The cccDNA vector was then prepared according to the procedure shown in FIG. 4A-4C, for example, (a) producing recombinant cccDNA-bacmid DNA and transfecting insect cells with the recombinant ccDNA-bacmid DNA; (b) obtain a P1 (low titer) stock, a P2 (high titer) stock solution and determine the virus titer by qPCR to obtain 5 ml, >1E+7 plaque-forming units or infectious units "PFU" per ml baculovirus volume, according to the certificate analysis of baculovirus volume. Isolation of the cccDNA vector was carried out by co-infecting 50 ml of insect cells with a baculovirus volume, for subsequent infection pairs: Rep-bacmid, as described herein, and at least one of the following constructs: construct-11, construct-12, construct-13 and construct-14. Isolation of the cccDNA vector was performed using the QIAGEN Plasmid Midi Kit to obtain purified DNA material for further analysis. Table 14B and Table 14C show the yield (as determined by OD values) of the cccDNA vector obtained from constructs 11-14.

[00453] Table 14B: Yield (determined by OD metrics) of typical cccDNA vectors derived from constructs 11-14.

Construct number DNA concentration OD260 and standard factor 50 Ratio 260/280 total amount of DNA [μg] from 50 ml infection volume (cDNA acquisition volume) Total DNA yield [mg] per liter (calculated) Construct-11 342.7 ng/µl 1.79 8.57 0.171 Construct-12 197.5 ng/µl 1.9 4.54 0.090 Construct-13 145 ng/µl 1.9 3.62 0.072 Construct-14 443.1 ng/µl 1.79 11.08 0.221

[00454] Table 14C shows the amount of DNA material obtained (determined by OD values) using constructs 12 and 14 from Table 14C. The yield of total DNA material was acceptable compared to typical yields of about 3 mg/L of DNA material from the process in Example 1 above (Table 13).

Construct number A ₂₃₀ 260/230 260/280 DNA Conc. OD260 and standard ratio 50 Yield μg per 0.2 g cell pellet Total DNA yield [mg] per liter (calculated) 14 0.038 2,789 1,860 265 ng/µl 53.0 2.6 12 0.017 6,176 1.842 263 ng/µl 52.6 2.6

EXAMPLE 3: Expression of a luciferase transgene by a cccDNA vector in vitro

[00455] The constructs were obtained by introducing an open reading frame encoding a luciferase reporter gene into the cloning site of the cccDNA plasmid constructs: construct-1, construct-3, construct-5 and construct-7. The cDNA plasmids (see Table 12 above), including the luciferase coding sequence, are referred to as the 1-Luc plasmid construct, the 3-Luc plasmid construct, the -5-Luc plasmid construct, and the 7-Luc plasmid construct, respectively.

[00456] HEK293 cells were cultured and transfected with 100 ng, 200 ng or 400 ng of plasmid constructs 1, 3, 5 and 7 using FUGENE® (Promega Corp.) as the transfection agent. Luciferase expression from each of the plasmids was determined based on the luciferase activity in each cell culture, and the results are presented in FIG. 6A. No luciferase activity was detected in untreated control cells (“Untreated”) or in cells treated with Fugene alone (“Fugene”), confirming that luciferase activity results from expression of genes from plasmids. As shown in FIG. 6A and FIG. 6B, robust expression of luciferase was detected in constructs 1 and 7. Expression from construct-7 expressed luciferase with a dose-dependent increase in luciferase activity detected.

[00457] The growth and viability of cells transfected with each of the plasmids were also determined and presented in FIG. 7A and FIG. 7B. Cell growth and viability of transfected cells did not differ significantly between different groups of cells treated with different constructs.

[00458] Accordingly, luciferase activity measured in each group and normalized based on cell growth and viability was no different from luciferase activity without normalization. The cDNA plasmid with the 1-Luc construct showed the most robust luciferase expression with or without normalization.

[00459] Thus, the data presented in FIG. 6A, 6B, 7A and 7B show that construct-1 containing 5' to 3'-WT-ITR (SEQ ID NO: 51), CAG promoter (SEQ ID NO: 3), R3/R4 cloning site (SEQ ID NO: 7), WPRE (SEQ ID NO: 8), BGHpA (SEQ ID NO: 9) and modified ITR (SEQ ID NO: 2) are effective in producing a cccDNA vector that can express a transgene protein from the ccDNA vector.

EXAMPLE 4: Expression of transgenic luciferase protein in vivo from cDNA vectors.

[00460] In vivo transgene protein expression from cccDNA vectors produced from constructs 1-8 described above was assessed in mice. An cccDNA vector derived from the cccDNA plasmid construct-1 (as described in Table 12) was tested and demonstrated long-lasting and sustained transgenic luciferase expression in a mouse model following hydrodynamic injection of the cccDNA construct without liposomes and repeated dosing (at day 28). and duration (up to day 42) of exogenous firefly luciferase cDNA. In various experiments, luciferase expression in selected cccDNA vectors is assessed in vivo, wherein the cccDNA vectors contain a luciferase transgene and at least one modified ITR selected from any one shown in Tables 10A-10B, or an ITR containing at least one sequence shown in Fig. 26A-26B.

[00461] In vivo luciferase expression: 5-7 week old male CD-1 IGS mice (Charles River Laboratories) are administered 0.35 mg/kg of cccDNA vector expressing luciferase in a volume of 1.2 ml by intravenous (i.v.) c) hydrodynamic tail vein injection on day 0. Luciferase expression was assessed by IVIS imaging on days 3, 4, 7, 14, 21, 28, 31, 35 and 42. Briefly, mice were injected intraperitoneally with 150 mg/kg luciferin substrate , and then assess whole-body luminescence using IVIS® imaging.

[00462] IVIS imaging is performed on day 3, day 4, day 7, day 14, day 21, day 28, day 31, day 35 and day 42, and the selected organs are imaged ex vivo after sacrifice on day 42.

[00463] Animals are weighed daily throughout the study and their general health and well-being are monitored. At sacrifice, the blood of each animal is collected by terminal cardiac puncture, divided into two parts and processed to obtain 1) plasma and 2) serum, with the plasma flash frozen and the serum used for a liver enzyme panel and then flash frozen. In addition, livers, spleens, kidneys, and inguinal lymph nodes (LNs) were collected and imaged ex vivo using IVIS.

[00464] Liver luciferase expression is assessed using the MAXDISCOVERY® Luciferase ELISA assay kit (BIOO Scientific/PerkinElmer), liver luciferase qPCR, liver specimen histopathology, and/or serum liver enzyme panel (VetScanVS2; Abaxis Preventive Care Profile Plus).

EXAMPLE 5: Run-through screening for ITR mutants

[00465] Additional analyzes were performed on the relationship of ITR structure to cccDNA production. A series of mutants were constructed to study the effect of specific structural changes on the formation of cccDNA and the ability to express the transgene encoded by the specified cccDNA. Construction of mutants, analysis of cccDNA production, and evaluation of transgene expression of cccDNA in human cell culture are described in more detail below.

A. Construction of mutant ITRs

[00466] A library of 31 plasmids with unique type II symmetric mutant AAV ITR cassettes was developed in silico and then evaluated in Sf9 insect cells and human embryonic kidney (HEK293) cells. Each ITR cassette contained either a luciferase (LUC) or green fluorescent protein (GFP) reporter gene driven by a p10 promoter sequence for expression in insect cells, and a CAG promoter sequence for expression in mammalian cells. Mutations in the ITR sequence were created in either the right or left ITR region. The library contained 15 right-handed (RS) and 16 left-handed (LS) mutants, disclosed in Tables 10A and 10B and FIG. 26A and 26B herein.

[00467] Sf9 suspension cultures were grown in Sf900 III medium (Gibco) in vented 200 ml tissue culture flasks. Cultures were subcultured every 48 hours, and before each subculture, cell numbers and growth rates were measured using a ViCell Counter (Beckman Coulter). Cultures were grown on a shaker (1 inch (25 mm) orbit, 130 rpm) at 27°C. Adherent cultures of HEK293 cells were maintained in GlutiMax DMEM (Dulbecco's modified Eagle's medium, Gibco) with 1% fetal bovine serum and 0.1% penicillin-streptomycin (PenStrep) in 250 ml culture flasks at 37°C with 5% CO ₂ . Cultures were treated with trypsin and subcultured every 96 hours. For each subculture, a 1:10 dilution from a 90-100% confluent vial was used.

[00468] cccDNA vectors were prepared and constructed as described in Example 1 above. Briefly, as shown in FIG. 4B, Sf9 cells transduced with plasmid constructs were allowed to grow adhesively for 24 hours under steady-state conditions at 27°C. After 24 h, transfected Sf9 cells were infected with Rep vector via baculovirus-infected insect cells (BIIC). BIIC was pre-assayed to determine infectivity characteristics and used at a final dilution of 1:2000. BIIC at a 1:100 dilution in Sf900 insect cell medium was added to each well of preinfected cells. BIIC without Rep vector was added to a subset of wells as a negative control. The contents of the plates were mixed by gentle shaking on a plate shaker for 2 minutes. Cells were cultured for an additional 48 hours at 27°C under steady-state conditions. All experimental and control constructs were analyzed in triplicate.

[00469] After 48 hours, the 96-well plate was removed from the incubator, allowed to equilibrate briefly to room temperature, and luciferase expression was assayed (OneGlo Luciferase Assay (Promega Corporation)). Total luminescence was measured using a SpectraMax M Series microplate reader. Data for replicates were averaged. The results are presented in Fig. 27. As expected, three negative control samples (medium only, mock transfection without donor DNA, sample that was treated in the absence of Rep-containing baculovirus cells) showed no significant luciferase expression. Robust luciferase expression was observed in each of the mutant samples, indicating that for each sample, transfection with the cDNA-encoded transgene was successful and it was expressed regardless of the mutation.

B. Analysis of cDNA production

[00470] To ensure that the ccDNA obtained in the previous study had the expected closed-end structure, experiments were performed to obtain a sufficient amount of each ccDNA that could subsequently be tested for the proper structure. Briefly, Sf9 suspension cultures were transfected with DNA belonging to one ITR mutant plasmid from the library. Cultures were seeded at a density of 1.25 × 10 ⁶ cells/ml in Erlenmeyer culture flasks with limited gas exchange. DNA:lipid transfection complexes were prepared using FuGene transfection reagent according to the manufacturer's instructions. Mixtures of complexes were prepared and incubated in the same manner as described above for the luciferase plate assay, with volumes increasing in proportion to the number of cells transfected. As in the case of the reporter gene assay, a ratio of 4.5:1 (reagent volume/DNA mass) was used. Mock-transfected (transfection reagents only) and untreated control cultures were prepared in parallel with the experimental cultures. After adding transfection reagents, cultures were allowed to recover for 10–15 minutes at room temperature with gentle rotation before being transferred to a shaker incubator at 27°C. After 24 hours of incubation with shaking, cell counts were performed and growth rates were measured for all vials (experimental and control) using a ViCell counter (Beckman Coulter). All vials (except growth control) were infected with BIIC containing Rep vector at a final dilution of 1:5000. A positive control was also obtained using the established BIIC double infection procedure to obtain cccDNA. For a dual infection culture, a number of cells equal to the average number of viable cells in all experimental cultures were seeded. The dual infection control culture was infected with Rep and reporter gene BIIC at a final dilution of 1:5000 for each construct, respectively. After infection, the cultures were placed back into the incubator under the previously described shaking conditions. Cell counts, growth rates, and viability rates were measured daily for all vials for 3 days postinfection. Measurements at time T=0 were performed after newly infected cultures had been allowed to recover for approximately 2 hours under shaking incubation conditions. After 3 days, cells were collected by centrifugation for 15 minutes. The supernatant was discarded, the weight of the pellet was recorded, and the pellet was frozen at −80°C until DNA extraction.

[00471] Putative crude cccDNA was extracted from all vials (experimental and control) using the Qiagen Plasmid Plus Midi Purification Kit (Qiagen) according to the manufacturer's protocol for “high yield.” Quantification of eluates was performed using absorbance data obtained from NanoDrop OneC (ThermoFisher). The resulting cccDNA extracts were stored at 4°C.

[00472] The above cccDNA extracts were run on a native agarose gel (1% agarose, 1x TAE buffer) prepared using a 1:10,000 dilution of SYBR Safe Gel Stain (ThermoFisher Scientific) along with 1 kb DNA markers. TrackIt Plus DNA. The gel was then imaged using a Gbox Mini Imager under UV/blue light. Based on the previous description, cccDNA samples run on native gels are expected to have two primary bands: a band at approximately 5,500 bp, representing monomeric material, and a band at approximately 11,000 bp, corresponding to dimeric material. substance. All mutant samples were tested and showed the expected monomer and dimer bands on native agarose gels. Results for a representative sample of these constructs are presented in FIG. 28. Putative crude ITR mutant cccDNA and small scale control extracts were further analyzed using paired restriction digestion and denaturing agarose gel to confirm the double-stranded DNA structure indicative of cccDNA. Each cccDNA mutant is expected to have a single EcoR1 restriction site; therefore, if properly formed, it forms two characteristic fragments when cleavated by EcoR1. The high-precision restriction endonuclease EcoRI (New England Biolabs) was used to digest the putative ccDNA extract according to the manufacturer's instructions. Extracts from mock-transfected and control cultures were not analyzed because spectrophotometric quantitation using NanoDrop (ThermoFisher) as well as native agarose gel analysis indicated that there was no detectable ccDNA/plasmid-like product in the eluates. Digested material was purified using the Qiagen PCR Clean-up Kit (Qiagen according to the manufacturer's instructions, except that the purified digested material was eluted in nuclease-free water instead of Qiagen's elution buffer. Alkaline agarose gel (0.8% alkaline agarose) were equilibrated in equilibration buffer (1 mM EDTA, 200 mM NaOH) overnight at 4° C. A 10x denaturing solution (50 mM NaOH, 1 mM EDTA) was added to samples of purified digested cccDNAs and corresponding uncleaved cccDNAs (total 1 µg) and samples were heated at 65°C for 10 minutes. 10x loading dye (bromophenol blue, 50% glycerol) was added to each denatured sample and mixed. Plus DNA TrackIt 1 kb Markers (ThermoFisher Scientific) also applied to the gel as reference DNA. The gel was run for ~18 hours at 4°C and constant voltage (25 V), followed by washing with deionized H ₂ O and neutralization in buffer 1xTAE (Tris-acetate, EDTA), pH 7.6, for 20 minutes with gentle stirring. The gel was then transferred to a 1x TAE/1x SYBR Gold solution for approximately 1 hour with gentle stirring. The gel was then imaged using a Gbox Mini Imager (Syngene) under UV/blue light. Uncut denatured samples were expected to migrate at approximately 11,000 bp, and EcoRI-treated samples were expected to produce two bands, one at approximately 4,000 bp and the other at approximately 6,000 bp.

[00473] All mutant samples in this experiment showed similar results. Two significant bands were visible in each lane with EcoR1-treated samples migrating at the expected size on the denaturing gel, in stark contrast to the uncleaved samples, which migrated at the expected size of approximately 11,000 bp. In FIG. Figure 27 shows the results for a representative sample of mutants, where two bands are visible above background values for each cleaved mutant sample, in contrast to the single band observed for the uncleaved mutant samples. Accordingly, cccDNA apparently formed correctly in the mutant samples.

A. Functional expression in human cell culture

[00474] To evaluate the functionality of the ITR mutant cccDNA produced in the small scale production process, HEK293 cells were transfected with some representative samples of the mutant cccDNA. Actively dividing HEK293 cells were seeded into 96-well microtiter plates at a density of 3 x 10 ⁶ cells per well (80% confluent) and incubated for 24 hours under previously described conditions for adherent HEK293 cultures. After 24 hours, transfection was performed with 200 ng of crude, small-scale produced cccDNA using Lipofectamine (Invitrogen, ThermoFisher Scientific). Transfection complexes were prepared according to the manufacturer's instructions, and 10 μl of a total volume of transfection complex was used to transfect previously plated HEK293 cells. All experimental and control constructs were analyzed in triplicate. Transfected cells were incubated under previously described conditions for 72 hours. After 72 hours, the 96-well plate was removed from the incubator and allowed to equilibrate briefly to room temperature. OneGlo luciferase assay was performed. After 10 minutes on the orbital shaker, total luminescence was measured using a SpectraMax M Series microplate reader. Data for replicates were averaged. The results are presented in Fig. 30. Each of the mutant samples tested that expressed luciferase in human cell culture shows that the cccDNA was correctly generated and expressed for each sample in the context of human cells.

[00475] EXAMPLE 6: Constructs with only Rep78 or Rep68 are capable of producing cccDNA

[00476] The AAV replication (Rep) gene encodes four nonstructural or replication (Rep) proteins from the same open reading frame. Rep78, Rep68, Rep52 and Rep40 are named by their predicted molecular weights calculated from their mobility on SDS-PAGE (Mendelson et al., 1986. J Virol. 60: 823-832). Rep78/68 are translated from mRNA derived from the transcription promoter from element 5 in the diagram (P5). Rep78 and Rep68 serve as viral replication initiator proteins that recognize cognate binding sites at the viral origin of replication and “break” the origin at the end resolution site. The nicking process provides a free 3'-hydroxyl group, which triggers viral DNA synthesis. In addition to DNA-binding and site-specific endonuclease activities, Rep78 and Rep68 have been shown to have helicase and ATPase activities. Rep52/40 proteins are translated from mRNA derived from transcription promoter element 19 in diagram (P19). The Rep52 and Rep40 proteins mediate virus assembly. The Rep68 and Rep40 proteins differ from their longer counterparts in that they are translated from spliced mRNAs from the P5 and P19 promoters, respectively. Splicing removes 92 amino acid residues from the carboxyl termini of the Rep78 and Rep52 proteins and replaces them with 9 amino acids located at the C termini of Rep68 and Rep40.

[00477] Experiments were conducted to determine whether the presence of Rep78 or Rep68 is sufficient for the formation of cccDNA. A point mutation was added to eliminate translation of Rep 52 by the p19 promoter (M->G and M->T) to examine the effect of Rep52/40 deletion on ccDNA production as described in Example 1 above. Thus, constructs modified by a point mutation of Rep52 (e.g., amino acids 225 M->G and M->T) will exhibit only the cccDNA product from Rep78. Two additional constructs were generated to determine whether Rep68 had any activity in cccDNA formation. The Rep68 Met→Gly (M225G) and Rep68 Met→Thr (M225T) mutants were constructed to remove the internal translation site and the C-terminal intronic sequence (92 amino acid residues and a 9 amino acid substitution as described above). An additional mutant with a point mutation in the nickase activity domain (Y156F) was generated. In FIG. 32A and B are non-denaturing gels showing the presence of highly stable DNA vectors and characteristic bands confirming the presence of a highly stable closed-end DNA (ccDNA) vector produced using a single Rep protein using the methods described herein. As shown in FIG. 32A, higher amounts of cccDNA vector are produced using the Rep78 modified nucleic acid with the Rep78 modification of Met.→Gly (M225G) (lane 1) or Rep Met→Thr (M225T) (lane 2) compared to production using the nucleic acid, encoding wild-type Rep78 (lane 5), in which the nucleic acid expresses both the Rep78 protein and the Rep52 protein. The cccDNA vector was not produced with Rep78 binding mutants containing Gly (Y156F) (lane 3) or Thr (Y156F) (lane 4) modifications. Fig. 32B further shows that the Rep68 Met→Gly (M225G) and Rep68 Met→Thr (M225T) mutants also produced cccDNA vector to levels equal to or greater than the amount of ccDNA vector produced using Rep78-modified nucleic acid with the Rep78 modification to Met→Gly ( M225G) or Rep Met→ Thr (M225T) and deletion of the C-terminal intron.

[00478] Accordingly, these experiments demonstrated that Rep78 alone or Rep68 alone is sufficient to produce cccDNA without the presence of Rep52 or Rep40.

SOURCES

[00479] All sources listed and disclosed in this description and in the examples, including patents, patent applications, international patent applications and publications are incorporated herein in their entirety by reference.

[00480] REP sequences

SEQ ID NO. 558 is the amino acid sequence of Rep 40 from AAV1.

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ala

Pro Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

Asn Gly Tyr Glu Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

Gln Lys Arg Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Glu Phe Phe Arg Trp Ala Gln Asp His Val Thr Glu Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Asn Lys Arg Pro Ala

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

Asp Leu Ala Arg Gly Gln Pro Leu (SEQ ID NO: 558)

SEQ ID NO. 559 is the amino acid sequence of Rep 40 from AAV2.

Met Glu Leu Val Gly Trp Leu Val Asp Lys Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Gln Gln

Pro Val Glu Asp Ile Ser Ser Asn Arg Ile Tyr Lys Ile Leu Glu Leu

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

Thr Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Thr Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Asp Phe Phe Arg Trp Ala Lys Asp His Val Val Glu Val

Glu His Glu Phe Tyr Val Lys Lys Gly Gly Ala Lys Lys Arg Pro Ala

Pro Ser Asp Ala Asp Ile Ser Glu Pro Lys Arg Val Arg Glu Ser Val

Ala Gln Pro Ser Thr Ser Asp Ala Glu Ala Ser Ile Asn Tyr Ala Asp

Arg Leu Ala Arg Gly His Ser Leu (SEQ ID NO: 559)

SEQ ID NO. 560 is the amino acid sequence of Rep 40 from AAV3A.

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Ser Asn

Pro Pro Glu Asp Ile Thr Lys Asn Arg Ile Tyr Gln Ile Leu Glu Leu

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Glu Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Glu Phe

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Asp Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Lys Lys Arg Pro Ala

Ser Asn Asp Ala Asp Val Ser Glu Pro Lys Arg Glu Cys Thr Ser Leu

Ala Gln Pro Thr Thr Ser Asp Ala Glu Ala Pro Ala Asp Tyr Ala Asp

Leu Ala Arg Gly Gln Pro Phe (SEQ ID NO: 560)

SEQ ID NO. 561 is the amino acid sequence of Rep 40 from AAV3B.

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Ser Asn

Pro Pro Glu Asp Ile Thr Lys Asn Arg Ile Tyr Gln Ile Leu Glu Leu

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Glu Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Asp Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Lys Lys Arg Pro Ala

Ser Asn Asp Ala Asp Val Ser Glu Pro Lys Arg Gln Cys Thr Ser Leu

Ala Gln Pro Thr Thr Ser Asp Ala Glu Ala Pro Ala Asp Tyr Ala Asp

Leu Ala Arg Gly Gln Pro Phe (SEQ ID NO: 561)

SEQ ID NO. 562 is the amino acid sequence of Rep 40 from AAV4.

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Gln Asn

Pro Pro Glu Asp Ile Ser Ser Asn Arg Ile Tyr Arg Ile Leu Glu Met

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Lys Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

Thr His Glu Phe Tyr Val Arg Lys Gly Gly Ala Arg Lys Arg Pro Ala

Pro Asn Asp Ala Asp Ile Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

Ala Gln Pro Ser Thr Ser Asp Ala Glu Ala Pro Val Asp Tyr Ala Asp

Leu Ala Arg Gly Gln Pro Leu (SEQ ID NO: 562)

SEQ ID NO. 563 is the amino acid sequence of Rep 40 from AAV5.

Met Ala Leu Val Asn Trp Leu Val Glu His Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asn Gln Glu Ser Tyr Leu Ser Phe Asn Ser Thr

Gly Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Thr Lys

Ile Met Ser Leu Thr Lys Ser Ala Val Asp Tyr Leu Val Gly Ser Ser

Val Pro Glu Asp Ile Ser Lys Asn Arg Ile Trp Gln Ile Phe Glu Met

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Ile Leu Tyr Gly Trp Cys

Gln Arg Ser Phe Asn Lys Arg Asn Thr Val Trp Leu Tyr Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Thr Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Leu Ile Trp Trp Glu Glu Gly Lys Met Thr Asn

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Val Gln Ile Asp Ser Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Val Val Val Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Glu Asp Arg Met Phe Lys Phe

Glu Leu Thr Lys Arg Leu Pro Pro Asp Phe Gly Lys Ile Thr Lys Gln

Glu Val Lys Asp Phe Phe Ala Trp Ala Lys Val Asn Gln Val Pro Val

Thr His Glu Phe Lys Val Pro Arg Glu Leu Ala Gly Thr Lys Gly Ala

Glu Lys Ser Leu Lys Arg Pro Leu Gly Asp Val Thr Asn Thr Ser Tyr

Lys Ser Leu Glu Lys Arg Ala Arg Leu Ser Phe Val Pro Glu Thr Pro

Arg Ser Ser Asp Val Thr Val Asp Pro Ala Pro Leu Arg Pro Leu Asn

Trp Asn Ser Leu Val Gly Pro Ser Trp (SEQ ID NO: 563)

SEQ ID NO. 564 is the amino acid sequence of Rep 40 from AAV6.

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ala

Pro Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

Gln Lys Arg Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Glu Phe Phe Arg Trp Ala Gln Asp His Val Thr Glu Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Asn Lys Arg Pro Ala

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

Asp Leu Ala Arg Gly Gln Pro Leu (SEQ ID NO: 564)

SEQ ID NO. 565 is the amino acid sequence of Rep 40 from AAV7.

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ser

Leu Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Glu Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Ser Lys Arg Pro Ala

Pro Asp Asp Ala Asp Ile Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

Asp Leu Ala Arg Gly Gln Pro Leu (SEQ ID NO: 565)

SEQ ID NO. 566 is the amino acid sequence of Rep 40 from AAV8.

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ser

Leu Pro Ala Asp Ile Thr Gln Asn Arg Ile Tyr Arg Ile Leu Ala Leu

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Glu Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Ser Lys Arg Pro Ala

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

Asp Leu Ala Arg Gly Gln Pro Leu (SEQ ID NO: 566)

SEQ ID NO. 567 is the consensus amino acid sequence of SEQ ID NO: 558-566.

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Xaa Ser

Pro Pro Glu Asp Ile Ser Thr Asn Arg Ile Tyr Arg Ile Leu Ala Leu

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Glu Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Lys Lys Arg Pro Ala

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

Ala Xaa Pro Ser Thr Ser Asp Ala Glu Ala Pro Val Asp Phe Ala Asp

Leu Ala Arg Gly Gln Pro Leu (SEQ ID NO: 567)

SEQ ID NO. 568 is the amino acid sequence of Rep 52 from AAV1.

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ala

Pro Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

Asn Gly Tyr Glu Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

Gln Lys Arg Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Glu Phe Phe Arg Trp Ala Gln Asp His Val Thr Glu Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Asn Lys Arg Pro Ala

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

Asp Arg Tyr Gln Asn Lys Cys Ser Arg His Ala Gly Met Leu Gln Met

Leu Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Asn Phe Asn Ile

Cys Phe Thr His Gly Thr Arg Asp Cys Ser Glu Cys Phe Pro Gly Val

Ser Glu Ser Gln Pro Val Val Arg Lys Arg Thr Tyr Arg Lys Leu Cys

Ala Ile His His Leu Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser Ala

Cys Asp Leu Val Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln (SEQ ID NO: 568)

SEQ ID NO. 569 is the amino acid sequence of Rep 52 from AAV2.

Met Glu Leu Val Gly Trp Leu Val Asp Lys Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Gln Gln

Pro Val Glu Asp Ile Ser Ser Asn Arg Ile Tyr Lys Ile Leu Glu Leu

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

Thr Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Thr Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Asp Phe Phe Arg Trp Ala Lys Asp His Val Val Glu Val

Glu His Glu Phe Tyr Val Lys Lys Gly Gly Ala Lys Lys Arg Pro Ala

Pro Ser Asp Ala Asp Ile Ser Glu Pro Lys Arg Val Arg Glu Ser Val

Ala Gln Pro Ser Thr Ser Asp Ala Glu Ala Ser Ile Asn Tyr Ala Asp

Arg Tyr Gln Asn Lys Cys Ser Arg His Val Gly Met Asn Leu Met Leu

Phe Pro Cys Arg Gln Cys Glu Arg Met Asn Gln Asn Ser Asn Ile Cys

Phe Thr His Gly Gln Lys Asp Cys Leu Glu Cys Phe Pro Val Ser Glu

Ser Gln Pro Val Ser Val Val Lys Lys Ala Tyr Gln Lys Leu Cys Tyr

Ile His His Ile Met Gly Lys Val Pro Asp Ala Cys Thr Ala Cys Asp

Leu Val Asn Val Asp Leu Asp Asp Cys Ile Phe Glu Gln (SEQ ID NO: 569)

SEQ ID NO. 570 is the amino acid sequence of Rep 52 from AAV3A.

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Ser Asn

Pro Pro Glu Asp Ile Thr Lys Asn Arg Ile Tyr Gln Ile Leu Glu Leu

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Glu Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Glu Phe

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Asp Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Lys Lys Arg Pro Ala

Ser Asn Asp Ala Asp Val Ser Glu Pro Lys Arg Glu Cys Thr Ser Leu

Ala Gln Pro Thr Thr Ser Asp Ala Glu Ala Pro Ala Asp Tyr Ala Asp

Arg Tyr Gln Asn Lys Cys Ser Arg His Val Gly Met Asn Leu Met Leu

Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Ile Ser Asn Val Cys

Phe Thr His Gly Gln Arg Asp Cys Gly Glu Cys Phe Pro Gly Met Ser

Glu Ser Gln Pro Val Ser Val Val Lys Lys Lys Thr Tyr Gln Lys Leu

Cys Pro Ile His His Ile Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser

Ala Cys Asp Leu Ala Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln (SEQ ID NO: 570)

SEQ ID NO. 571 is the amino acid sequence of Rep 52 from AAV3B.

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Ser Asn

Pro Pro Glu Asp Ile Thr Lys Asn Arg Ile Tyr Gln Ile Leu Glu Leu

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Glu Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Asp Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Lys Lys Arg Pro Ala

Ser Asn Asp Ala Asp Val Ser Glu Pro Lys Arg Gln Cys Thr Ser Leu

Ala Gln Pro Thr Thr Ser Asp Ala Glu Ala Pro Ala Asp Tyr Ala Asp

Arg Tyr Gln Asn Lys Cys Ser Arg His Val Gly Met Asn Leu Met Leu

Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Ile Ser Asn Val Cys

Phe Thr His Gly Gln Arg Asp Cys Gly Glu Cys Phe Pro Gly Met Ser

Glu Ser Gln Pro Val Ser Val Val Lys Lys Lys Thr Tyr Gln Lys Leu

Cys Pro Ile His His Ile Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser

Ala Cys Asp Leu Ala Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln (SEQ ID NO: 571)

SEQ ID NO. 572 is the amino acid sequence of Rep 52 from AAV4.

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Gln Asn

Pro Pro Glu Asp Ile Ser Ser Asn Arg Ile Tyr Arg Ile Leu Glu Met

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Lys Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

Thr His Glu Phe Tyr Val Arg Lys Gly Gly Ala Arg Lys Arg Pro Ala

Pro Asn Asp Ala Asp Ile Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

Ala Gln Pro Ser Thr Ser Asp Ala Glu Ala Pro Val Asp Tyr Ala Asp

Arg Tyr Gln Asn Lys Cys Ser Arg His Val Gly Met Asn Leu Met Leu

Phe Pro Cys Arg Gln Cys Glu Arg Met Asn Gln Asn Val Asp Ile Cys

Phe Thr His Gly Val Met Asp Cys Ala Glu Cys Phe Pro Val Ser Glu

Ser Gln Pro Val Ser Val Val Arg Lys Arg Thr Tyr Gln Lys Leu Cys

Pro Ile His His Ile Met Gly Arg Ala Pro Glu Val Ala Cys Ser Ala

Cys Glu Leu Ala Asn Val Asp Leu Asp Asp Cys Asp Met Glu Gln (SEQ ID NO: 572)

SEQ ID NO. 573 is the amino acid sequence of Rep 52 from AAV5.

Met Ala Leu Val Asn Trp Leu Val Glu His Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asn Gln Glu Ser Tyr Leu Ser Phe Asn Ser Thr

Gly Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Thr Lys

Ile Met Ser Leu Thr Lys Ser Ala Val Asp Tyr Leu Val Gly Ser Ser

Val Pro Glu Asp Ile Ser Lys Asn Arg Ile Trp Gln Ile Phe Glu Met

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Ile Leu Tyr Gly Trp Cys

Gln Arg Ser Phe Asn Lys Arg Asn Thr Val Trp Leu Tyr Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Thr Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Leu Ile Trp Trp Glu Glu Gly Lys Met Thr Asn

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Val Gln Ile Asp Ser Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Val Val Val Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Glu Asp Arg Met Phe Lys Phe

Glu Leu Thr Lys Arg Leu Pro Pro Asp Phe Gly Lys Ile Thr Lys Gln

Glu Val Lys Asp Phe Phe Ala Trp Ala Lys Val Asn Gln Val Pro Val

Thr His Glu Phe Lys Val Pro Arg Glu Leu Ala Gly Thr Lys Gly Ala

Glu Lys Ser Leu Lys Arg Pro Leu Gly Asp Val Thr Asn Thr Ser Tyr

Lys Ser Leu Glu Lys Arg Ala Arg Leu Ser Phe Val Pro Glu Thr Pro

Arg Ser Ser Asp Val Thr Val Asp Pro Ala Pro Leu Arg Pro Leu Asn

Trp Asn Ser Arg Tyr Asp Cys Lys Cys Asp Tyr His Ala Gln Phe Asp

Asn Ile Ser Asn Lys Cys Asp Glu Cys Glu Tyr Leu Asn Arg Gly Lys

Asn Gly Cys Ile Cys His Asn Val Thr His Cys Gln Ile Cys His Gly

Ile Pro Pro Trp Glu Lys Glu Asn Leu Ser Asp Phe Gly Asp Phe Asp

Asp Ala Asn Lys Glu Gln (SEQ ID NO: 573)

SEQ ID NO. 574 is the amino acid sequence of Rep 52 from AAV6.

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ala

Pro Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

Gln Lys Arg Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Glu Phe Phe Arg Trp Ala Gln Asp His Val Thr Glu Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Asn Lys Arg Pro Ala

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

Asp Arg Tyr Gln Asn Lys Cys Ser Arg His Ala Gly Met Leu Gln Met

Leu Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Asn Phe Asn Ile

Cys Phe Thr His Gly Thr Arg Asp Cys Ser Glu Cys Phe Pro Gly Val

Ser Glu Ser Gln Pro Val Val Arg Lys Arg Thr Tyr Arg Lys Leu Cys

Ala Ile His His Leu Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser Ala

Cys Asp Leu Val Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln (SEQ ID NO: 574)

SEQ ID NO. 575 is the amino acid sequence of Rep 52 from AAV7.

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ser

Leu Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Glu Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Ser Lys Arg Pro Ala

Pro Asp Asp Ala Asp Ile Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

Asp Arg Tyr Gln Asn Lys Cys Ser Arg His Ala Gly Met Ile Gln Met

Leu Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Asn Phe Asn Ile

Cys Phe Thr His Gly Val Arg Asp Cys Leu Glu Cys Phe Pro Gly Val

Ser Glu Ser Gln Pro Val Val Arg Lys Lys Thr Tyr Arg Lys Leu Cys

Ala Ile His His Leu Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser Ala

Cys Asp Leu Val Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln (SEQ ID NO: 575)

SEQ ID NO. 576 is the amino acid sequence of Rep 52 from AAV8.

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ser

Leu Pro Ala Asp Ile Thr Gln Asn Arg Ile Tyr Arg Ile Leu Ala Leu

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Glu Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Ser Lys Arg Pro Ala

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

Asp Arg Tyr Gln Asn Lys Cys Ser Arg His Ala Gly Met Leu Gln Met

Leu Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Asn Phe Asn Ile

Cys Phe Thr His Gly Val Arg Asp Cys Ser Glu Cys Phe Pro Gly Val

Ser Glu Ser Gln Pro Val Val Arg Lys Arg Thr Tyr Arg Lys Leu Cys

Ala Ile His His Leu Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser Ala

Cys Asp Leu Val Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln (SEQ ID NO: 576)

SEQ ID NO. 577 is the consensus amino acid sequence of SEQ ID NOs 568-576.

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Xaa Ser

Pro Pro Glu Asp Ile Ser Thr Asn Arg Ile Tyr Arg Ile Leu Ala Leu

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Glu Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Lys Lys Arg Pro Ala

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

Ala Asp Pro Ser Thr Ser Asp Ala Glu Ala Pro Val Asp Phe Ala Asp

Arg Tyr Gln Asn Lys Cys Ser Arg His Ala Gly Met Xaa Gln Met Leu

Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Asn Xaa Asn Ile Cys

Phe Thr His Gly Xaa Arg Asp Cys Xaa Glu Cys Phe Pro Gly Val Ser

Glu Ser Gln Xaa Val Val Arg Lys Arg Thr Tyr Xaa Lys Leu Cys Xaa

Ile His His Leu Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser Ala Cys

Asp Leu Val Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln (SEQ ID NO: 577)

SEQ ID NO. 578 is the amino acid sequence of Rep 68 from AAV1.

Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Ser Trp Val Ala Glu

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu

Val Gln Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Leu His Ile Leu Val Glu

Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile

Arg Asp Lys Leu Val Gln Thr Ile Tyr Arg Gly Ile Glu Pro Thr Leu

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Glu Tyr Ile

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala Gln His

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Leu Asn

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ala

Pro Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

Asn Gly Tyr Glu Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

Gln Lys Arg Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Glu Phe Phe Arg Trp Ala Gln Asp His Val Thr Glu Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Asn Lys Arg Pro Ala

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

Asp Leu Ala Arg Gly Gln Pro Leu (SEQ ID NO: 578)

SEQ ID NO. 579 is the amino acid sequence of Rep 68 from AAV2.

Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asn Trp Val Ala Glu

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu

Thr Glu Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Met His Val Leu Val Glu

Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile

Arg Glu Lys Leu Ile Gln Arg Ile Tyr Arg Gly Ile Glu Pro Thr Leu

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Gln Tyr Leu

Ser Ala Cys Leu Asn Leu Thr Glu Arg Lys Arg Leu Val Ala Gln His

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Gln Asn

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

Met Glu Leu Val Gly Trp Leu Val Asp Lys Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Gln Gln

Pro Val Glu Asp Ile Ser Ser Asn Arg Ile Tyr Lys Ile Leu Glu Leu

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

Thr Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Thr Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Asp Phe Phe Arg Trp Ala Lys Asp His Val Val Glu Val

Glu His Glu Phe Tyr Val Lys Lys Gly Gly Ala Lys Lys Arg Pro Ala

Pro Ser Asp Ala Asp Ile Ser Glu Pro Lys Arg Val Arg Glu Ser Val

Ala Gln Pro Ser Thr Ser Asp Ala Glu Ala Ser Ile Asn Tyr Ala Asp

Arg Leu Ala Arg Gly His Ser Leu (SEQ ID NO: 579)

SEQ ID NO. 580 is the amino acid sequence of Rep 68 from AAV3A.

Met Pro Gly Phe Tyr Glu Ile Val Leu Lys Val Pro Ser Asp Leu Asp

Glu Arg Leu Pro Gly Ile Ser Asn Ser Phe Val Asn Trp Val Ala Glu

Lys Glu Trp Asp Val Pro Pro Asp Ser Asp Met Asp Pro Asn Leu Ile

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Glu Phe Leu

Val Glu Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

Gln Phe Glu Lys Gly Glu Thr Tyr Phe His Leu His Val Leu Ile Glu

Thr Ile Gly Val Lys Ser Met Val Val Gly Arg Tyr Val Ser Gln Ile

Lys Glu Lys Leu Val Thr Arg Ile Tyr Arg Gly Val Glu Pro Gln Leu

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

Asn Lys Val Val Asp Asp Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Asp Gln Tyr Leu

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala Gln His

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Gln Asn

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Ser Asn

Pro Pro Glu Asp Ile Thr Lys Asn Arg Ile Tyr Gln Ile Leu Glu Leu

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Glu Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Glu Phe

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Asp Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Lys Lys Arg Pro Ala

Ser Asn Asp Ala Asp Val Ser Glu Pro Lys Arg Glu Cys Thr Ser Leu

Ala Gln Pro Thr Thr Ser Asp Ala Glu Ala Pro Ala Asp Tyr Ala Asp

Leu Ala Arg Gly Gln Pro Phe (SEQ ID NO: 580)

SEQ ID NO. 581 is the amino acid sequence of Rep 68 from AAV3B.

Met Pro Gly Phe Tyr Glu Ile Val Leu Lys Val Pro Ser Asp Leu Asp

Glu His Leu Pro Gly Ile Ser Asn Ser Phe Val Asn Trp Val Ala Glu

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Pro Asn Leu Ile

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Glu Phe Leu

Val Glu Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

Gln Phe Glu Lys Gly Glu Thr Tyr Phe His Leu His Val Leu Ile Glu

Thr Ile Gly Val Lys Ser Met Val Val Gly Arg Tyr Val Ser Gln Ile

Lys Glu Lys Leu Val Thr Arg Ile Tyr Arg Gly Val Glu Pro Gln Leu

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

Asn Lys Val Val Asp Asp Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Asp Gln Tyr Leu

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala Gln His

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Gln Asn

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Ser Asn

Pro Pro Glu Asp Ile Thr Lys Asn Arg Ile Tyr Gln Ile Leu Glu Leu

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Glu Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Asp Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Lys Lys Arg Pro Ala

Ser Asn Asp Ala Asp Val Ser Glu Pro Lys Arg Gln Cys Thr Ser Leu

Ala Gln Pro Thr Thr Ser Asp Ala Glu Ala Pro Ala Asp Tyr Ala Asp

Leu Ala Arg Gly Gln Pro Phe (SEQ ID NO: 581)

SEQ ID NO. 582 is the amino acid sequence of Rep 68 from AAV4.

Met Pro Gly Phe Tyr Glu Ile Val Leu Lys Val Pro Ser Asp Leu Asp

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Ser Trp Val Ala Glu

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Glu Phe Leu

Val Glu Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

Gln Phe Glu Lys Gly Asp Ser Tyr Phe His Leu His Ile Leu Val Glu

Thr Val Gly Val Lys Ser Met Val Val Gly Arg Tyr Val Ser Gln Ile

Lys Glu Lys Leu Val Thr Arg Ile Tyr Arg Gly Val Glu Pro Gln Leu

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

Asn Lys Val Val Asp Asp Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Asp Gln Tyr Ile

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala Gln His

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Gln Asn

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Gln Asn

Pro Pro Glu Asp Ile Ser Ser Asn Arg Ile Tyr Arg Ile Leu Glu Met

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Lys Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

Thr His Glu Phe Tyr Val Arg Lys Gly Gly Ala Arg Lys Arg Pro Ala

Pro Asn Asp Ala Asp Ile Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

Ala Gln Pro Ser Thr Ser Asp Ala Glu Ala Pro Val Asp Tyr Ala Asp

Leu Ala Arg Gly Gln Pro Leu (SEQ ID NO: 582)

SEQ ID NO. 583 is the amino acid sequence of Rep 68 from AAV5.

Met Ala Thr Phe Tyr Glu Val Ile Val Arg Val Pro Phe Asp Val Glu

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asp Trp Val Thr Gly

Gln Ile Trp Glu Leu Pro Pro Glu Ser Asp Leu Asn Leu Thr Leu Val

Glu Gln Pro Gln Leu Thr Val Ala Asp Arg Ile Arg Arg Val Phe Leu

Tyr Glu Trp Asn Lys Phe Ser Lys Gln Glu Ser Lys Phe Phe Val Gln

Phe Glu Lys Gly Ser Glu Tyr Phe His Leu His Thr Leu Val Glu Thr

Ser Gly Ile Ser Ser Met Val Leu Gly Arg Tyr Val Ser Gln Ile Arg

Ala Gln Leu Val Lys Val Val Phe Gln Gly Ile Glu Pro Gln Ile Asn

Asp Trp Val Ala Ile Thr Lys Val Lys Lys Gly Gly Ala Asn Lys Val

Val Asp Ser Gly Tyr Ile Pro Ala Tyr Leu Leu Pro Lys Val Gln Pro

Glu Leu Gln Trp Ala Trp Thr Asn Leu Asp Glu Tyr Lys Leu Ala Ala

Leu Asn Leu Glu Glu Arg Lys Arg Leu Val Ala Gln Phe Leu Ala Glu

Ser Ser Gln Arg Ser Gln Glu Ala Ala Ser Gln Arg Glu Phe Ser Ala

Asp Pro Val Ile Lys Ser Lys Thr Ser Gln Lys Tyr Met Ala Leu Val

Asn Trp Leu Val Glu His Gly Ile Thr Ser Glu Lys Gln Trp Ile Gln

Glu Asn Gln Glu Ser Tyr Leu Ser Phe Asn Ser Thr Gly Asn Ser Arg

Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Thr Lys Ile Met Ser Leu

Thr Lys Ser Ala Val Asp Tyr Leu Val Gly Ser Ser Val Pro Glu Asp

Ile Ser Lys Asn Arg Ile Trp Gln Ile Phe Glu Met Asn Gly Tyr Asp

Pro Ala Tyr Ala Gly Ser Ile Leu Tyr Gly Trp Cys Gln Arg Ser Phe

Asn Lys Arg Asn Thr Val Trp Leu Tyr Gly Pro Ala Thr Thr Gly Lys

Thr Asn Ile Ala Glu Ala Ile Ala His Thr Val Pro Phe Tyr Gly Cys

Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp Cys Val Asp Lys

Met Leu Ile Trp Trp Glu Glu Gly Lys Met Thr Asn Lys Val Val Glu

Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg Val Asp Gln Lys

Cys Lys Ser Ser Val Gln Ile Asp Ser Thr Pro Val Ile Val Thr Ser

Asn Thr Asn Met Cys Val Val Val Asp Gly Asn Ser Thr Thr Phe Glu

His Gln Gln Pro Leu Glu Asp Arg Met Phe Lys Phe Glu Leu Thr Lys

Arg Leu Pro Pro Asp Phe Gly Lys Ile Thr Lys Gln Glu Val Lys Asp

Phe Phe Ala Trp Ala Lys Val Asn Gln Val Pro Val Thr His Glu Phe

Lys Val Pro Arg Glu Leu Ala Gly Thr Lys Gly Ala Glu Lys Ser Leu

Lys Arg Pro Leu Gly Asp Val Thr Asn Thr Ser Tyr Lys Ser Leu Glu

Lys Arg Ala Arg Leu Ser Phe Val Pro Glu Thr Pro Arg Ser Ser Asp

Val Thr Val Asp Pro Ala Pro Leu Arg Pro Leu Asn Trp Asn Ser Leu

Val Gly Pro Ser Trp (SEQ ID NO: 583)

SEQ ID NO. 584 is the amino acid sequence of Rep 68 from AAV6.

Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asn Trp Val Ala Glu

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu

Val Gln Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Leu His Ile Leu Val Glu

Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile

Arg Asp Lys Leu Val Gln Thr Ile Tyr Arg Gly Ile Glu Pro Thr Leu

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Glu Tyr Ile

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala His Asp

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Leu Asn

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ala

Pro Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

Gln Lys Arg Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Glu Phe Phe Arg Trp Ala Gln Asp His Val Thr Glu Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Asn Lys Arg Pro Ala

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

Asp Leu Ala Arg Gly Gln Pro Leu (SEQ ID NO: 584)

SEQ ID NO. 585 is the amino acid sequence of Rep 68 from AAV7.

Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asn Trp Val Ala Glu

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu

Val Gln Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Leu His Val Leu Val Glu

Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile

Arg Glu Lys Leu Val Gln Thr Ile Tyr Arg Gly Val Glu Pro Thr Leu

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Glu Tyr Ile

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala Gln His

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Leu Asn

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ser

Leu Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Glu Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Ser Lys Arg Pro Ala

Pro Asp Asp Ala Asp Ile Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

Asp Leu Ala Arg Gly Gln Pro Leu (SEQ ID NO: 585)

SEQ ID NO. 586 is the amino acid sequence of Rep 68 from AAV8.

Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asn Trp Val Ala Glu

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Arg Asn Leu Ile

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu

Val Gln Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Leu His Val Leu Val Glu

Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile

Arg Glu Lys Leu Gly Pro Asp His Leu Pro Ala Gly Ser Ser Pro Thr

Leu Pro Asn Trp Phe Ala Val Thr Lys Asp Ala Val Met Ala Pro Ala

Gly Gly Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu

Pro Lys Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Glu

Tyr Ile Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala

Gln His Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn

Leu Asn Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala

Arg Tyr Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser

Glu Lys Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn

Ala Ala Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala

Gly Lys Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly

Pro Ser Leu Pro Ala Asp Ile Thr Gln Asn Arg Ile Tyr Arg Ile Leu

Ala Leu Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly

Trp Ala Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly

Pro Ala Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala

Val Pro Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe

Asn Asp Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met

Thr Ala Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys

Val Arg Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr

Pro Val Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly

Asn Ser Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe

Lys Phe Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr

Lys Gln Glu Val Lys Glu Phe Phe Arg Trp Ala Ser Asp His Val Thr

Glu Val Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Ser Lys Arg

Pro Ala Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro

Ser Val Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp

Phe Ala Asp Leu Ala Arg Gly Gln Pro Leu (SEQ ID NO: 586)

SEQ ID NO. 587 is the amino acid sequence of Rep 78 from AAV1.

Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Ser Trp Val Ala Glu

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu

Val Gln Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Leu His Ile Leu Val Glu

Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile

Arg Asp Lys Leu Val Gln Thr Ile Tyr Arg Gly Ile Glu Pro Thr Leu

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Glu Tyr Ile

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala Gln His

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Leu Asn

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ala

Pro Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

Asn Gly Tyr Glu Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

Gln Lys Arg Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Glu Phe Phe Arg Trp Ala Gln Asp His Val Thr Glu Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Asn Lys Arg Pro Ala

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

Asp Arg Tyr Gln Asn Lys Cys Ser Arg His Ala Gly Met Leu Gln Met

Leu Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Asn Phe Asn Ile

Cys Phe Thr His Gly Thr Arg Asp Cys Ser Glu Cys Phe Pro Gly Val

Ser Glu Ser Gln Pro Val Val Arg Lys Arg Thr Tyr Arg Lys Leu Cys

Ala Ile His His Leu Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser Ala

Cys Asp Leu Val Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln (SEQ ID NO: 587)

SEQ ID NO. 588 is the amino acid sequence of Rep 78 from AAV2.

Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asn Trp Val Ala Glu

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu

Thr Glu Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Met His Val Leu Val Glu

Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile

Arg Glu Lys Leu Ile Gln Arg Ile Tyr Arg Gly Ile Glu Pro Thr Leu

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Gln Tyr Leu

Ser Ala Cys Leu Asn Leu Thr Glu Arg Lys Arg Leu Val Ala Gln His

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Gln Asn

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

Met Glu Leu Val Gly Trp Leu Val Asp Lys Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Gln Gln

Pro Val Glu Asp Ile Ser Ser Asn Arg Ile Tyr Lys Ile Leu Glu Leu

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

Thr Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Thr Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Asp Phe Phe Arg Trp Ala Lys Asp His Val Val Glu Val

Glu His Glu Phe Tyr Val Lys Lys Gly Gly Ala Lys Lys Arg Pro Ala

Pro Ser Asp Ala Asp Ile Ser Glu Pro Lys Arg Val Arg Glu Ser Val

Ala Gln Pro Ser Thr Ser Asp Ala Glu Ala Ser Ile Asn Tyr Ala Asp

Arg Tyr Gln Asn Lys Cys Ser Arg His Val Gly Met Asn Leu Met Leu

Phe Pro Cys Arg Gln Cys Glu Arg Met Asn Gln Asn Ser Asn Ile Cys

Phe Thr His Gly Gln Lys Asp Cys Leu Glu Cys Phe Pro Val Ser Glu

Ser Gln Pro Val Ser Val Val Lys Lys Ala Tyr Gln Lys Leu Cys Tyr

Ile His His Ile Met Gly Lys Val Pro Asp Ala Cys Thr Ala Cys Asp

Leu Val Asn Val Asp Leu Asp Asp Cys Ile Phe Glu Gln (SEQ ID NO: 588)

SEQ ID NO. 589 is the amino acid sequence of Rep 78 from AAV3A.

Met Pro Gly Phe Tyr Glu Ile Val Leu Lys Val Pro Ser Asp Leu Asp

Glu Arg Leu Pro Gly Ile Ser Asn Ser Phe Val Asn Trp Val Ala Glu

Lys Glu Trp Asp Val Pro Pro Asp Ser Asp Met Asp Pro Asn Leu Ile

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Glu Phe Leu

Val Glu Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

Gln Phe Glu Lys Gly Glu Thr Tyr Phe His Leu His Val Leu Ile Glu

Thr Ile Gly Val Lys Ser Met Val Val Gly Arg Tyr Val Ser Gln Ile

Lys Glu Lys Leu Val Thr Arg Ile Tyr Arg Gly Val Glu Pro Gln Leu

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

Asn Lys Val Val Asp Asp Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Asp Gln Tyr Leu

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala Gln His

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Gln Asn

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Ser Asn

Pro Pro Glu Asp Ile Thr Lys Asn Arg Ile Tyr Gln Ile Leu Glu Leu

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Glu Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Glu Phe

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Asp Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Lys Lys Arg Pro Ala

Ser Asn Asp Ala Asp Val Ser Glu Pro Lys Arg Glu Cys Thr Ser Leu

Ala Gln Pro Thr Thr Ser Asp Ala Glu Ala Pro Ala Asp Tyr Ala Asp

Arg Tyr Gln Asn Lys Cys Ser Arg His Val Gly Met Asn Leu Met Leu

Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Ile Ser Asn Val Cys

Phe Thr His Gly Gln Arg Asp Cys Gly Glu Cys Phe Pro Gly Met Ser

Glu Ser Gln Pro Val Ser Val Val Lys Lys Lys Thr Tyr Gln Lys Leu

Cys Pro Ile His His Ile Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser

Ala Cys Asp Leu Ala Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln (SEQ ID NO: 589)

SEQ ID NO. 590 is the amino acid sequence of Rep 78 from AAV3B.

Met Pro Gly Phe Tyr Glu Ile Val Leu Lys Val Pro Ser Asp Leu Asp

Glu His Leu Pro Gly Ile Ser Asn Ser Phe Val Asn Trp Val Ala Glu

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Pro Asn Leu Ile

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Glu Phe Leu

Val Glu Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

Gln Phe Glu Lys Gly Glu Thr Tyr Phe His Leu His Val Leu Ile Glu

Thr Ile Gly Val Lys Ser Met Val Val Gly Arg Tyr Val Ser Gln Ile

Lys Glu Lys Leu Val Thr Arg Ile Tyr Arg Gly Val Glu Pro Gln Leu

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

Asn Lys Val Val Asp Asp Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Asp Gln Tyr Leu

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala Gln His

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Gln Asn

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Ser Asn

Pro Pro Glu Asp Ile Thr Lys Asn Arg Ile Tyr Gln Ile Leu Glu Leu

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Glu Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Asp Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Lys Lys Arg Pro Ala

Ser Asn Asp Ala Asp Val Ser Glu Pro Lys Arg Gln Cys Thr Ser Leu

Ala Gln Pro Thr Thr Ser Asp Ala Glu Ala Pro Ala Asp Tyr Ala Asp

Arg Tyr Gln Asn Lys Cys Ser Arg His Val Gly Met Asn Leu Met Leu

Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Ile Ser Asn Val Cys

Phe Thr His Gly Gln Arg Asp Cys Gly Glu Cys Phe Pro Gly Met Ser

Glu Ser Gln Pro Val Ser Val Val Lys Lys Lys Thr Tyr Gln Lys Leu

Cys Pro Ile His His Ile Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser

Ala Cys Asp Leu Ala Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln (SEQ ID NO: 590)

SEQ ID NO. 591 is the amino acid sequence of Rep 78 from AAV4.

Met Pro Gly Phe Tyr Glu Ile Val Leu Lys Val Pro Ser Asp Leu Asp

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Ser Trp Val Ala Glu

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Glu Phe Leu

Val Glu Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

Gln Phe Glu Lys Gly Asp Ser Tyr Phe His Leu His Ile Leu Val Glu

Thr Val Gly Val Lys Ser Met Val Val Gly Arg Tyr Val Ser Gln Ile

Lys Glu Lys Leu Val Thr Arg Ile Tyr Arg Gly Val Glu Pro Gln Leu

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

Asn Lys Val Val Asp Asp Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Asp Gln Tyr Ile

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala Gln His

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Gln Asn

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Gln Asn

Pro Pro Glu Asp Ile Ser Ser Asn Arg Ile Tyr Arg Ile Leu Glu Met

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Lys Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

Thr His Glu Phe Tyr Val Arg Lys Gly Gly Ala Arg Lys Arg Pro Ala

Pro Asn Asp Ala Asp Ile Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

Ala Gln Pro Ser Thr Ser Asp Ala Glu Ala Pro Val Asp Tyr Ala Asp

Arg Tyr Gln Asn Lys Cys Ser Arg His Val Gly Met Asn Leu Met Leu

Phe Pro Cys Arg Gln Cys Glu Arg Met Asn Gln Asn Val Asp Ile Cys

Phe Thr His Gly Val Met Asp Cys Ala Glu Cys Phe Pro Val Ser Glu

Ser Gln Pro Val Ser Val Val Arg Lys Arg Thr Tyr Gln Lys Leu Cys

Pro Ile His His Ile Met Gly Arg Ala Pro Glu Val Ala Cys Ser Ala

Cys Glu Leu Ala Asn Val Asp Leu Asp Asp Cys Asp Met Glu Gln (SEQ ID NO: 591)

SEQ ID NO. 592 is the amino acid sequence of Rep 78 from AAV5.

Met Ala Thr Phe Tyr Glu Val Ile Val Arg Val Pro Phe Asp Val Glu

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asp Trp Val Thr Gly

Gln Ile Trp Glu Leu Pro Pro Glu Ser Asp Leu Asn Leu Thr Leu Val

Glu Gln Pro Gln Leu Thr Val Ala Asp Arg Ile Arg Arg Val Phe Leu

Tyr Glu Trp Asn Lys Phe Ser Lys Gln Glu Ser Lys Phe Phe Val Gln

Phe Glu Lys Gly Ser Glu Tyr Phe His Leu His Thr Leu Val Glu Thr

Ser Gly Ile Ser Ser Met Val Leu Gly Arg Tyr Val Ser Gln Ile Arg

Ala Gln Leu Val Lys Val Val Phe Gln Gly Ile Glu Pro Gln Ile Asn

Asp Trp Val Ala Ile Thr Lys Val Lys Lys Gly Gly Ala Asn Lys Val

Val Asp Ser Gly Tyr Ile Pro Ala Tyr Leu Leu Pro Lys Val Gln Pro

Glu Leu Gln Trp Ala Trp Thr Asn Leu Asp Glu Tyr Lys Leu Ala Ala

Leu Asn Leu Glu Glu Arg Lys Arg Leu Val Ala Gln Phe Leu Ala Glu

Ser Ser Gln Arg Ser Gln Glu Ala Ala Ser Gln Arg Glu Phe Ser Ala

Asp Pro Val Ile Lys Ser Lys Thr Ser Gln Lys Tyr Met Ala Leu Val

Asn Trp Leu Val Glu His Gly Ile Thr Ser Glu Lys Gln Trp Ile Gln

Glu Asn Gln Glu Ser Tyr Leu Ser Phe Asn Ser Thr Gly Asn Ser Arg

Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Thr Lys Ile Met Ser Leu

Thr Lys Ser Ala Val Asp Tyr Leu Val Gly Ser Ser Val Pro Glu Asp

Ile Ser Lys Asn Arg Ile Trp Gln Ile Phe Glu Met Asn Gly Tyr Asp

Pro Ala Tyr Ala Gly Ser Ile Leu Tyr Gly Trp Cys Gln Arg Ser Phe

Asn Lys Arg Asn Thr Val Trp Leu Tyr Gly Pro Ala Thr Thr Gly Lys

Thr Asn Ile Ala Glu Ala Ile Ala His Thr Val Pro Phe Tyr Gly Cys

Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp Cys Val Asp Lys

Met Leu Ile Trp Trp Glu Glu Gly Lys Met Thr Asn Lys Val Val Glu

Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg Val Asp Gln Lys

Cys Lys Ser Ser Val Gln Ile Asp Ser Thr Pro Val Ile Val Thr Ser

Asn Thr Asn Met Cys Val Val Val Asp Gly Asn Ser Thr Thr Phe Glu

His Gln Gln Pro Leu Glu Asp Arg Met Phe Lys Phe Glu Leu Thr Lys

Arg Leu Pro Pro Asp Phe Gly Lys Ile Thr Lys Gln Glu Val Lys Asp

Phe Phe Ala Trp Ala Lys Val Asn Gln Val Pro Val Thr His Glu Phe

Lys Val Pro Arg Glu Leu Ala Gly Thr Lys Gly Ala Glu Lys Ser Leu

Lys Arg Pro Leu Gly Asp Val Thr Asn Thr Ser Tyr Lys Ser Leu Glu

Lys Arg Ala Arg Leu Ser Phe Val Pro Glu Thr Pro Arg Ser Ser Asp

Val Thr Val Asp Pro Ala Pro Leu Arg Pro Leu Asn Trp Asn Ser Arg

Tyr Asp Cys Lys Cys Asp Tyr His Ala Gln Phe Asp Asn Ile Ser Asn

Lys Cys Asp Glu Cys Glu Tyr Leu Asn Arg Gly Lys Asn Gly Cys Ile

Cys His Asn Val Thr His Cys Gln Ile Cys His Gly Ile Pro Pro Trp

Glu Lys Glu Asn Leu Ser Asp Phe Gly Asp Phe Asp Asp Ala Asn Lys

Glu Gln (SEQ ID NO: 592)

SEQ ID NO. 593 is the amino acid sequence of Rep 78 from AAV6.

Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asn Trp Val Ala Glu

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu

Val Gln Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Leu His Ile Leu Val Glu

Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile

Arg Asp Lys Leu Val Gln Thr Ile Tyr Arg Gly Ile Glu Pro Thr Leu

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Glu Tyr Ile

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala His Asp

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Leu Asn

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ala

Pro Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

Gln Lys Arg Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Glu Phe Phe Arg Trp Ala Gln Asp His Val Thr Glu Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Asn Lys Arg Pro Ala

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

Asp Arg Tyr Gln Asn Lys Cys Ser Arg His Ala Gly Met Leu Gln Met

Leu Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Asn Phe Asn Ile

Cys Phe Thr His Gly Thr Arg Asp Cys Ser Glu Cys Phe Pro Gly Val

Ser Glu Ser Gln Pro Val Val Arg Lys Arg Thr Tyr Arg Lys Leu Cys

Ala Ile His His Leu Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser Ala

Cys Asp Leu Val Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln (SEQ ID NO: 593)

SEQ ID NO. 594 is the amino acid sequence of Rep 78 from AAV7.

Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asn Trp Val Ala Glu

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu

Val Gln Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Leu His Val Leu Val Glu

Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile

Arg Glu Lys Leu Val Gln Thr Ile Tyr Arg Gly Val Glu Pro Thr Leu

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Glu Tyr Ile

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala Gln His

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Leu Asn

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ser

Leu Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Glu Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Ser Lys Arg Pro Ala

Pro Asp Asp Ala Asp Ile Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

Asp Arg Tyr Gln Asn Lys Cys Ser Arg His Ala Gly Met Ile Gln Met

Leu Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Asn Phe Asn Ile

Cys Phe Thr His Gly Val Arg Asp Cys Leu Glu Cys Phe Pro Gly Val

Ser Glu Ser Gln Pro Val Val Arg Lys Lys Thr Tyr Arg Lys Leu Cys

Ala Ile His His Leu Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser Ala

Cys Asp Leu Val Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln (SEQ ID NO: 594)

SEQ ID NO. 595 is the amino acid sequence of Rep 78 from AAV8.

Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asn Trp Val Ala Glu

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Arg Asn Leu Ile

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu

Val Gln Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Leu His Val Leu Val Glu

Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile

Arg Glu Lys Leu Gly Pro Asp His Leu Pro Ala Gly Ser Ser Pro Thr

Leu Pro Asn Trp Phe Ala Val Thr Lys Asp Ala Val Met Ala Pro Ala

Gly Gly Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu

Pro Lys Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Glu

Tyr Ile Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala

Gln His Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn

Leu Asn Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala

Arg Tyr Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser

Glu Lys Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn

Ala Ala Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala

Gly Lys Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly

Pro Ser Leu Pro Ala Asp Ile Thr Gln Asn Arg Ile Tyr Arg Ile Leu

Ala Leu Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly

Trp Ala Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly

Pro Ala Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala

Val Pro Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe

Asn Asp Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met

Thr Ala Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys

Val Arg Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr

Pro Val Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly

Asn Ser Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe

Lys Phe Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr

Lys Gln Glu Val Lys Glu Phe Phe Arg Trp Ala Ser Asp His Val Thr

Glu Val Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Ser Lys Arg

Pro Ala Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro

Ser Val Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp

Phe Ala Asp Arg Tyr Gln Asn Lys Cys Ser Arg His Ala Gly Met Leu

Gln Met Leu Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Asn Phe

Asn Ile Cys Phe Thr His Gly Val Arg Asp Cys Ser Glu Cys Phe Pro

Gly Val Ser Glu Ser Gln Pro Val Val Arg Lys Arg Thr Tyr Arg Lys

Leu Cys Ala Ile His His Leu Leu Gly Arg Ala Pro Glu Ile Ala Cys

Ser Ala Cys Asp Leu Val Asn Val Asp Leu Asp Asp Cys Val Ser Glu

Gln (SEQ ID NO: 595)

SEQ ID NO. 596 is the consensus amino acid sequence of Rep78 from SEQ ID NO: 587-595.

Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asn Trp Val Ala Glu

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Arg Asn Leu Ile

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu

Val Gln Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Leu His Val Leu Val Glu

Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile

Arg Glu Lys Leu Val Xaa Xaa Ile Tyr Arg Gly Ile Glu Pro Thr Leu

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Glu Tyr Ile

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala Gln His

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Leu Asn

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Xaa Ser

Pro Pro Glu Asp Ile Ser Thr Asn Arg Ile Tyr Arg Ile Leu Ala Leu

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

Glu Val Lys Glu Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Lys Lys Arg Pro Ala

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

Ala Asp Pro Ser Thr Ser Asp Ala Glu Ala Pro Val Asp Phe Ala Asp

Arg Tyr Gln Asn Lys Cys Ser Arg His Ala Gly Met Xaa Gln Met Leu

Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Asn Xaa Asn Ile Cys

Phe Thr His Gly Xaa Arg Asp Cys Xaa Glu Cys Phe Pro Gly Val Ser

Glu Ser Gln Xaa Val Val Arg Lys Arg Thr Tyr Xaa Lys Leu Cys Xaa

Ile His His Leu Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser Ala Cys

Asp Leu Val Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln

--->

LIST OF SEQUENCES

<110> GENERATION BIO CO.

<120> MODULATION OF REP PROTEIN ACTIVITY WHEN PRODUCING CLOSED-END DNA (CCDNA)

<130> 131698-05420

<140>

<141>

<150> 62/806,076

<151> 2019-02-15

<160> 606

<170> PatentIn version 3.5

<210> 1

<211> 141

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 1

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgggcgacc aaaggtcgcc cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc 120

gagcgcgcag ctgcctgcag g 141

<210> 2

<211> 130

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 2

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgggcgacc aaaggtcgcc cgacgcccgg gcggcctcag tgagcgagcg agcgcgcagc 120

tgcctgcagg 130

<210> 3

<211> 1923

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 3

tcaatattgg ccattagcca tattattcat tggttatata gcataaatca atattggcta 60

ttggccattg catacgttgt atctatatca taatatgtac atttatattg gctcatgtcc 120

aatatgaccg ccatgttggc attgattatt gactagttat taatagtaat caattacggg 180

gtcattagtt catagcccat atatggagtt ccgcgttaca taacttacgg taaatggccc 240

gcctggctga ccgcccaacg acccccgccc attgacgtca ataatgacgt atgttcccat 300

agtaacgcca atagggactt tccattgacg tcaatgggtg gagtatttac ggtaaactgc 360

ccacttggca gtacatcaag tgtatcatat gccaagtccg ccccctattg acgtcaatga 420

cggtaaatgg cccgcctggc attatgccca gtacatgacc ttacgggact ttcctacttg 480

gcagtacatc tacgtattag tcatcgctat taccatggtc gaggtgagcc ccacgttctg 540

cttcactctc cccatctccc ccccctcccc acccccaatt ttgtatttat ttatttttta 600

attattttgt gcagcgatgg gggcgggggg gggggggggg cgcgcgccag gcggggcggg 660

gcggggcgag gggcggggcg gggcgaggcg gagaggtgcg gcggcagcca atcagagcgg 720

cgcgctccga aagtttcctt ttatggcgag gcggcggcgg cggcggccct ataaaaagcg 780

aagcgcgcgg cgggcgggag tcgctgcgac gctgccttcg ccccgtgccc cgctccgccg 840

ccgcctcgcg ccgcccgccc cggctctgac tgaccgcgtt actcccacag gtgagcgggc 900

gggacggccc ttctcctccg ggctgtaatt agcgcttggt ttaatgacgg cttgtttctt 960

ttctgtggct gcgtgaaagc cttgaggggc tccgggaggg ccctttgtgc gggggggagc 1020

ggctcggggg gtgcgtgcgt gtgtgtgtgc gtggggagcg ccgcgtgcgg cccgcgctgc 1080

ccggcggctg tgagcgctgc gggcgcggcg cggggctttg tgcgctccgc agtgtgcgcg 1140

aggggagcgc ggccgggggc ggtgccccgc ggtgcggggg gggctgcgag gggaacaaag 1200

gctgcgtgcg gggtgtgtgc gtggggggggt gagcaggggg tgtgggcgcg gcggtcgggc 1260

tgtaaccccc ccctgcaccc ccctccccga gttgctgagc acggcccggc ttcgggtgcg 1320

gggctccgta cggggcgtgg cgcggggctc gccgtgccgg gcggggggtg gcggcaggtg 1380

ggggtgccgg gcggggcggg gccgcctcgg gccggggagg gctcggggga ggggcgcggc 1440

ggcccccgga gcgccggcgg ctgtcgaggc gcggcgagcc gcagccattg ccttttatgg 1500

taatcgtgcg agagggcgca gggacttcct ttgtcccaaa tctgtgcgga gccgaaatct 1560

gggaggcgcc gccgcacccc ctctagcggg cgcggggcga agcggtgcgg cgccggcagg 1620

aaggaaatgg gcggggaggg ccttcgtgcg tcgccgcgcc gccgtcccct tctccctctc 1680

cagcctcggg gctgtccgcg gggggacggc tgccttcggg ggggacgggg cagggcgggg 1740

ttcggcttct ggcgtgtgac cggcggctct agagcctctg ctaaccatgt tttagccttc 1800

ttctttttcc tacagctcct gggcaacgtg ctggttattg tgctgtctca tcatttgtcg 1860

acagaattcc tcgaagatcc gaaggggttc aagcttggca ttccggtact gttggtaaag 1920

cca 1923

<210> 4

<211> 1272

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 4

aggctcagag gcacacagga gtttctgggc tcaccctgcc cccttccaac ccctcagttc 60

ccatcctcca gcagctgttt gtgtgctgcc tctgaagtcc acactgaaca aacttcagcc 120

tactcatgtc cctaaaatgg gcaaacattg caagcagcaa acagcaaaca cacagccctc 180

cctgcctgct gaccttggag ctggggcaga ggtcagagac ctctctgggc ccatgccacc 240

tccaacatcc actcgacccc ttggaatttc ggtggagagg agcagaggtt gtcctggcgt 300

ggtttaggta gtgtgagagg gtccgggttc aaaaccactt gctgggtggg gagtcgtcag 360

taagtggcta tgccccgacc ccgaagcctg tttccccatc tgtacaatgg aaatgataaa 420

gacgcccatc tgatagggtt tttgtggcaa ataaacattt ggtttttttg ttttgttttg 480

ttttgttttt tgagatggag gtttgctctg tcgcccaggc tggagtgcag tgacacaatc 540

tcatctcacc acaaccttcc cctgcctcag cctcccaagt agctgggatt acaagcatgt 600

gccaccacac ctggctaatt ttctattttt agtagagacg ggtttctcca tgttggtcag 660

cctcagcctc ccaagtaact gggattacag gcctgtgcca ccacacccgg ctaatttttt 720

ctatttttga cagggacggg gtttcaccat gttggtcagg ctggtctaga ggtaccggat 780

cttgctacca gtggaacagc cactaaggat tctgcagtga gagcagaggg ccagctaagt 840

ggtactctcc cagagactgt ctgactcacg ccaccccctc caccttggac acaggacgct 900

gtggtttctg agccaggtac aatgactcct ttcggtaagt gcagtggaag ctgtacactg 960

cccaggcaaa gcgtccgggc agcgtaggcg ggcgactcag atcccagcca gtggacttag 1020

cccctgtttg ctcctccgat aactggggtg accttggtta atattcacca gcagcctccc 1080

ccgttgcccc tctggatcca ctgcttaaat acggacgagg acagggccct gtctcctcag 1140

cttcaggcac caccactgac ctgggacagt gaatccggac tctaaggtaa atataaaatt 1200

tttaagtgta taatgtgtta aactactgat tctaattgtt tctctctttt agattccaac 1260

ctttggaact ga 1272

<210> 5

<211> 547

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 5

ccctaaaatg ggcaaacatt gcaagcagca aacagcaaac acacagccct ccctgcctgc 60

tgaccttgga gctggggcag aggtcagaga cctctctggg cccatgccac ctccaacatc 120

cactcgaccc cttggaattt ttcggtggag aggagcagag gttgtcctgg cgtggtttag 180

gtagtgtgag aggggaatga ctcctttcgg taagtgcagt ggaagctgta cactgcccag 240

gcaaagcgtc cgggcagcgt aggcgggcga ctcagatccc agccagtgga cttagcccct 300

gtttgctcct ccgataactg gggtgacctt ggttaatatt caccagcagc ctcccccgtt 360

gcccctctgg atccactgct taaatacgga cgaggacagg gccctgtctc ctcagcttca 420

ggcaccacca ctgacctggg acagtgaatc cggactctaa ggtaaatata aaatttttaa 480

gtgtataatg tgttaaacta ctgattctaa ttgtttctct cttttagatt ccaacctttg 540

gaactga 547

<210> 6

<211> 1179

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 6

ggctccggtg cccgtcagtg ggcagagcgc acatcgccca cagtccccga gaagttgggg 60

ggaggggtcg gcaattgaac cggtgcctag agaaggtggc gcggggtaaa ctgggaaagt 120

gatgtcgtgt actggctccg cctttttccc gagggtgggg gagaaccgta tataagtgca 180

gtagtcgccg tgaacgttct ttttcgcaac gggtttgccg ccagaacaca ggtaagtgcc 240

gtgtgtggtt cccgcgggcc tggcctcttt acgggttatg gcccttgcgt gccttgaatt 300

acttccacct ggctgcagta cgtgattctt gatcccgagc ttcgggttgg aagtgggtgg 360

gagagttcga ggccttgcgc ttaaggagcc ccttcgcctc gtgcttgagt tgaggcctgg 420

cctgggcgct ggggccgccg cgtgcgaatc tggtggcacc ttcgcgcctg tctcgctgct 480

ttcgataagt ctctagccat ttaaaatttt tgatgacctg ctgcgacgct ttttttctgg 540

caagatagtc ttgtaaatgc gggccaagat ctgcacactg gtatttcggt ttttggggcc 600

gcgggcggcg acggggcccg tgcgtcccag cgcacatgtt cggcgaggcg gggcctgcga 660

gcgcggccac cgagaatcgg acggggggtag tctcaagctg gccggcctgc tctggtgcct 720

ggtctcgcgc cgccgtgtat cgccccgccc tgggcggcaa ggctggcccg gtcggcacca 780

gttgcgtgag cggaaagatg gccgcttccc ggccctgctg cagggagctc aaaatggagg 840

acgcggcgct cgggagagcg ggcgggtgag tcacccacac aaaggaaaag ggcctttccg 900

tcctcagccg tcgcttcatg tgactccacg gagtaccggg cgccgtccag gcacctcgat 960

tagttctcga gcttttggag tacgtcgtct ttaggttggg gggaggggtt ttatgcgatg 1020

gagtttcccc acactgagtg ggtggagact gaagttaggc cagcttggca cttgatgtaa 1080

ttctccttgg aatttgccct ttttgagttt ggatcttggt tcattctcaa gcctcagaca 1140

gtggttcaaa gtttttttct tccatttcag gtgtcgtga 1179

<210> 7

<211> 8

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 7

gtttaaac 8

<210> 8

<211> 581

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 8

gagcatctta ccgccattta ttcccatatt tgttctgttt ttcttgattt gggtatacat 60

ttaaatgtta ataaaacaaa atggtggggc aatcatttac atttttaggg atatgtaatt 120

actagttcag gtgtattgcc acaagacaaa catgttaaga aactttcccg ttatttacgc 180

tctgttcctg ttaatcaacc tctggattac aaaatttgtg aaagattgac tgatattctt 240

aactatgttg ctccttttac gctgtgtgga tatgctgctt tatagcctct gtatctagct 300

attgcttccc gtacggcttt cgttttctcc tccttgtata aatcctggtt gctgtctctt 360

ttagaggagt tgtggcccgt tgtccgtcaa cgtggcgtgg tgtgctctgt gtttgctgac 420

gcaaccccca ctggctgggg cattgccacc acctgtcaac tcctttctgg gactttcgct 480

ttccccctcc cgatcgccac ggcagaactc atcgccgcct gccttgcccg ctgctggaca 540

ggggctaggt tgctgggcac tgataattcc gtggtgttgt c 581

<210> 9

<211> 225

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 9

tgtgccttct agttgccagc catctgttgt ttgcccctcc cccgtgcctt ccttgaccct 60

ggaaggtgcc actcccactg tcctttccta ataaaatgag gaaattgcat cgcattgtct 120

gagtaggtgt cattctattc tggggggtgg ggtggggcag gacagcaagg gggaggattg 180

ggaagacaat agcaggcatg ctggggatgc ggtgggctct atggc 225

<210> 10

<211> 213

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 10

taagatacat tgatgagttt ggacaaacca caactagaat gcagtgaaaa aaatgcttta 60

tttgtgaaat ttgtgatgct attgctttat ttgtaaccat tataagctgc aataaacaag 120

ttaacaacaa caattgcatt cattttatgt ttcaggttca gggggaggtg tgggaggttt 180

tttaaagcaa gtaaaacctc tacaaatgtg gta 213

<210> 11

<211> 1386

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 11

atgcagcgcg tgaacatgat catggccgag agccccggcc tgatcaccat ctgcctgctg 60

ggctacctgc tgagcgccga gtgcaccgtg ttcctggacc acgagaacgc caacaagatc 120

ctgaaccgcc ccaagcgcta caacagcggc aagctggagg agttcgtgca gggcaacctg 180

gagcgcgagt gcatggagga gaagtgcagc ttcgaggagg cccgcgaggt gttcgagaac 240

accgagcgca ccaccgagtt ctggaagcag tacgtggacg gcgaccagtg cgagagcaac 300

ccctgcctga acggcggcag ctgcaaggac gacatcaaca gctacgagtg ctggtgcccc 360

ttcggcttcg agggcaagaa ctgcgagctg gacgtgacct gcaacatcaa gaacggccgc 420

tgcgagcagt tctgcaagaa cagcgccgac aacaaggtgg tgtgcagctg caccgaggc 480

taccgcctgg ccgagaacca gaagagctgc gagcccgccg tgcccttccc ctgcggcagg 540

gtgagcgtga gccagaccag caagctgacc cgcgccgagg ccgtgttccc cgacgtggac 600

tacgtgaaca gcaccgaggc cgagaccatc ctggacaaca tcacccagag cacccagagc 660

ttcaacgact tcacccgcgt ggtgggcggc gaggacgcca agcccggcca gttcccctgg 720

caggtggtgc tgaacggcaa ggtggacgcc ttctgcggcg gcagcatcgt gaacgagaag 780

tggatcgtga ccgccgccca ctgcgtggag accggcgtga agatcaccgt ggtggccggc 840

gagcacaaca tcgaggagac cgagcacacc gagcagaagc gcaacgtgat ccgcatcatc 900

ccccaccaca actacaacgc cgccatcaac aagtacaacc acgacatcgc cctgctggag 960

ctggacgagc ccctggtgct gaacagctac gtgaccccca tctgcatcgc cgacaaggag 1020

tacaccaaca tcttcctgaa gttcggcagc ggctacgtga gcggctgggg ccgcgtgttc 1080

cacaagggcc gcagcgccct ggtgctgcag tacctgcgcg tgcccctggt ggaccgcgcc 1140

acctgcctgc gcagcaccaa gttcaccatc tacaacaaca tgttctgcgc cggcttccac 1200

gagggcggca gggacagctg ccagggcgac agcggcggcc cccacgtgac cgaggtggag 1260

ggcaccagct tcctgaccgg catcatcagc tggggcgagg agtgcgccat gaagggcaag 1320

tacggcatct acaccaaggt gagccgctac gtgaactgga tcaaggagaa gaccaagctg 1380

actaa 1386

<210> 12

<211> 1386

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 12

atgcagcgcg tgaacatgat catggccgag agccccggcc tgatcaccat ctgcctgctg 60

ggctacctgc tgagcgccga gtgcaccgtg ttcctggacc acgagaacgc caacaagatc 120

ctgaaccgcc ccaagcgcta caacagcggc aagctggagg agttcgtgca gggcaacctg 180

gagcgcgagt gcatggagga gaagtgcagc ttcgaggagg cccgcgaggt gttcgagaac 240

accgagcgca ccaccgagtt ctggaagcag tacgtggacg gcgaccagtg cgagagcaac 300

ccctgcctga acggcggcag ctgcaaggac gacatcaaca gctacgagtg ctggtgcccc 360

ttcggcttcg agggcaagaa ctgcgagctg gacgtgacct gcaacatcaa gaacggccgc 420

tgcgagcagt tctgcaagaa cagcgccgac aacaaggtgg tgtgcagctg caccgaggc 480

taccgcctgg ccgagaacca gaagagctgc gagcccgccg tgcccttccc ctgcggcagg 540

gtgagcgtga gccagaccag caagctgacc cgcgccgagg ccgtgttccc cgacgtggac 600

tacgtgaaca gcaccgaggc cgagaccatc ctggacaaca tcacccagag cacccagagc 660

ttcaacgact tcacccgcgt ggtgggcggc gaggacgcca agcccggcca gttcccctgg 720

caggtggtgc tgaacggcaa ggtggacgcc ttctgcggcg gcagcatcgt gaacgagaag 780

tggatcgtga ccgccgccca ctgcgtggag accggcgtga agatcaccgt ggtggccggc 840

gagcacaaca tcgaggagac cgagcacacc gagcagaagc gcaacgtgat ccgcatcatc 900

ccccaccaca actacaacgc cgccatcaac aagtacaacc acgacatcgc cctgctggag 960

ctggacgagc ccctggtgct gaacagctac gtgaccccca tctgcatcgc cgacaaggag 1020

tacaccaaca tcttcctgaa gttcggcagc ggctacgtga gcggctgggg ccgcgtgttc 1080

cacaagggcc gcagcgccct ggtgctgcag tacctgcgcg tgcccctggt ggaccgcgcc 1140

acctgcctgc tgagcaccaa gttcaccatc tacaacaaca tgttctgcgc cggcttccac 1200

gagggcggca gggacagctg ccagggcgac agcggcggcc cccacgtgac cgaggtggag 1260

ggcaccagct tcctgaccgg catcatcagc tggggcgagg agtgcgccat gaagggcaag 1320

tacggcatct acaccaaggt gagccgctac gtgaactgga tcaaggagaa gaccaagctg 1380

actaa 1386

<210> 13

<211> 1876

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 13

cgcagccacc atggcggggt tttacgagat tgtgattaag gtccccagcg accttgacgg 60

gcatctgccc ggcatttctg acagctttgt gaactgggtg gccgagaagg aatgggagtt 120

gccgccagat tctgacatgg atctgaatct gattgagcag gcacccctga ccgtggccga 180

gaagctgcag cgcgactttc tgacggaatg gcgccgtgtg agtaaggccc cggaggccct 240

tttctttgtg caatttgaga agggagagag ctacttccac atgcacgtgc tcgtggaaac 300

caccggggtg aaatccatgg ttttgggacg tttcctgagt cagattcgcg aaaaactgat 360

tcagagaatt taccgcggga tcgagccgac tttgccaaac tggttcgcgg tcacaaagac 420

cagaaatggc gccggaggcg ggaacaaggt ggtggatgag tgctacatcc ccaattactt 480

gctccccaaa acccagcctg agctccagtg ggcgtggact aatatggaac agtatttaag 540

cgcctgtttg aatctcacgg agcgtaaacg gttggtggcg cagcatctga cgcacgtgtc 600

gcagacgcag gagcagaaca aagagaatca gaatcccaat tctgatgcgc cggtgatcag 660

atcaaaaact tcagccaggt acatggagct ggtcgggtgg ctcgtggaca aggggattac 720

ctcggagaag cagtggatcc aggaggacca ggcctcatac atctccttca atgcggcctc 780

caactcgcgg tcccaaatca aggctgcctt ggacaatgcg ggaaagatta tgagcctgac 840

taaaaccgcc cccgactacc tggtgggcca gcagcccgtg gaggacatt ccagcaatcg 900

gatttataaa attttggaac taaacgggta cgatccccaa tatgcggctt ccgtctttct 960

gggatgggcc acgaaaaagt tcggcaagag gaacaccatc tggctgtttg ggcctgcaac 1020

taccgggaag accaacatcg cggaggccat agcccacact gtgcccttct acgggtgcgt 1080

aaactggacc aatgagaact ttcccttcaa cgactgtgtc gacaagatgg tgatctggtg 1140

ggaggagggg aagatgaccg ccaaggtcgt ggagtcggcc aaagccattc tcggaggaag 1200

caaggtgcgc gtggaccaga aatgcaagtc ctcggcccag atagacccga ctcccgtgat 1260

cgtcacctcc aacaccaaca tgtgcgccgt gattgacggg aactcaacga ccttcgaaca 1320

ccagcagccg ttgcaagacc ggatgttcaa atttgaactc acccgccgtc tggatcatga 1380

ctttgggaag gtcaccaagc aggaagtcaa agactttttc cggtgggcaa aggatcacgt 1440

ggttgaggtg gagcatgaat tctacgtcaa aaagggtgga gccaagaaaa gacccgcccc 1500

cagtgacgca gatataagtg agcccaaacg ggtgcgcgag tcagttgcgc agccatcgac 1560

gtcagacgcg gaagcttcga tcaactacgc agacaggtac caaaacaaat gttctcgtca 1620

cgtgggcatg aatctgatgc tgtttccctg cagacaatgc gagagaatga atcagaattc 1680

aaatatctgc ttcactcacg gacagaaaga ctgtttagag tgctttcccg tgtcagaatc 1740

tcaacccgtt tctgtcgtca aaaaggcgta tcagaaactg tgctacattc atcatatcat 1800

gggaaaggtg cgacgctt gcactgcctg cgatctggtc aatgtggatt tggatgactg 1860

catctttgaa caataa 1876

<210> 14

<211> 1191

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 14

ttgttcaaag atgcagtcat ccaaatccac attgaccaga tcgcaggcag tgcaagcgtc 60

tggcaccttt cccatgatat gatgaatgta gcacagtttc tgatacgcct ttttgacgac 120

agaaacgggt tgagattctg acacgggaaa gcactctaaa cagtctttct gtccgtgagt 180

gaagcagata tttgaattct gattcattct ctcgcattgt ctgcagggaa acagcatcag 240

attcatgccc acgtgacgag aacatttgtt ttggtagcgg tctgcgtagt tgatcgaagc 300

ttccgcgtct gacgtcgatg gctgcgcaac tgactcgcgc acccgtttgg gctcacttat 360

atctgcgtca ctgggggcgg gtcttttctt ggctccaccc tttttgacgt agaattcatg 420

ctccacctca accacgtgat cctttgccca ccggaaaaag tctttgactt cctgcttggt 480

gaccttccca aagtcatgat cgacggcg ggtgagttca aatttgaaca tccggtcttg 540

caacggctgc tggtgttcga aggtcgttga gttcccgtca atcacggcgc acatgttggt 600

gttggaggtg acgatcacgg gagtcgggtc tatctgggcc gaggacttgc atttctggtc 660

cacgcgcacc ttgcttcctc cgagaatggc tttggccgac tccacgacct tggcggtcat 720

cttcccctcc tcccaccaga tcaccatctt gtcgacacag tcgttgaagg gaaagttctc 780

attggtccag tttacgcacc cgtagaaggg cacagtgtgg gctatggcct ccgcgatgtt 840

ggtcttcccg gtagttgcag gcccaaacag ccagatggtg ttcctcttgc cgaacttttt 900

cgtggcccat cccagaaaga cggaagccgc atattgggga tcgtacccgt ttagttccaa 960

aattttataa atccgattgc tggaaatgtc ctccacgggc tgctggccca ccaggtagtc 1020

gggggcggtt ttagtcaggc tcataatctt tcccgcattg tccaaggcag ccttgatttg 1080

ggaccgcgag ttggaggccg cattgaagga gatgtatgag gcctggtcct cctggatcca 1140

ctgcttctcc gaggtaatcc ccttgtccac gagccacccg accagctcca t 1191

<210> 15

<211> 141

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 15

aataaacgat aacgccgttg gtggcgtgag gcatgtaaaa ggttacatca ttatcttgtt 60

cgccatccgg ttggtataaa tagacgttca tgttggtttt tgtttcagtt gcaagttggc 120

tgcggcgcgc gcagcacctt t 141

<210> 16

<211> 556

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 16

ccctaaaatg ggcaaacatt gcaagcagca aacagcaaac acacagccct ccctgcctgc 60

tgaccttgga gctggggcag aggtcagaga cctctctggg cccatgccac ctccaacatc 120

cactcgaccc cttggaattt cggtggagag gagcagaggt tgtcctggcg tggtttaggt 180

agtgtgagag gggaatgact cctttcggta agtgcagtgg aagctgtaca ctgcccaggc 240

aaagcgtccg ggcagcgtag gcgggcgact cagatcccag ccagtggact tagcccctgt 300

ttgctcctcc gataactggg gtgaccttgg ttaatattca ccagcagcct cccccgttgc 360

ccctctggat ccactgctta aatacggacg aggacactcg agggccctgt ctcctcagct 420

tcaggcacca ccactgacct gggacagtga atccggacat cgattctaag gtaaatataa 480

aatttttaag tgtataattt gttaaactac tgattctaat tgtttctctc ttttagattc 540

caacctttgg aactga 556

<210> 17

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 17

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 18

<400> 18

000

<210> 19

<400> 19

000

<210> 20

<400> 20

000

<210> 21

<400> 21

000

<210> 22

<400> 22

000

<210> 23

<400> 23

000

<210> 24

<400> 24

000

<210> 25

<400> 25

000

<210> 26

<400> 26

000

<210> 27

<400> 27

000

<210> 28

<400> 28

000

<210> 29

<400> 29

000

<210> 30

<400> 30

000

<210> 31

<400> 31

000

<210> 32

<400> 32

000

<210> 33

<400> 33

000

<210> 34

<400> 34

000

<210> 35

<400> 35

000

<210> 36

<400> 36

000

<210> 37

<400> 37

000

<210> 38

<400> 38

000

<210> 39

<400> 39

000

<210> 40

<400> 40

000

<210> 41

<400> 41

000

<210> 42

<400> 42

000

<210> 43

<400> 43

000

<210> 44

<400> 44

000

<210> 45

<211> 6

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 45

ggttga 6

<210> 46

<211> 4

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 46

agtt 4

<210> 47

<211> 6

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 47

ggttgg 6

<210> 48

<211> 6

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 48

agttgg 6

<210> 49

<211> 6

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 49

agttga 6

<210> 50

<211> 6

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 50

rrttrr 6

<210> 51

<211> 141

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 51

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60

gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca 120

actccatcac taggggttcc t 141

<210> 52

<211> 130

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 52

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60

ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120

aggggttcct 130

<210> 53

<211> 3123

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 53

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggaaacc cgggcgtgcc 60

cgggcgcctc agtgagcgag cgagcgcgca gagagggagt ggccaactcc atcactaggg 120

gttcctgaac agagaaacag gagaatatgg gccaaacagg atatctgtgg taagcagttc 180

ctgccccggc tcagggccaa gaacagttgg aacagcagaa tatgggccaa acaggatatc 240

tgtggtaagc agttcctgcc ccggctcagg gccaagaaca gatggtcccc agatgcggtc 300

ccgccctcag cagtttctag agaaccatca gatgtttcca gggtgcccca aggacctgaa 360

atgaccctgt gccttatttg aactaaccaa tcagttcgct tctcgcttct gttcgcgcgc 420

ttctgctccc cgagctctat ataagcagag ctcgtttagt gaaccgtcag atcgcctgga 480

gacgccatcc acgctgtttt gacttccata gaaggccgcc accatggaag acgccaaaaa 540

cataaagaaa ggcccggcgc cattctatcc gctggaagat ggaaccgctg gagagcaact 600

gcataaggct atgaagagat acgccctggt tcctggaaca attgctttta cagatgcaca 660

tatcgaggtg gacatcactt acgctgagta cttcgaaatg tccgttcggt tggcagaagc 720

tatgaaacga tatgggctga atacaaatca cagaatcgtc gtatgcagtg aaaactctct 780

tcaattcttt atgccggtgt tgggcgcgtt atttatcgga gttgcagttg cgcccgcgaa 840

cgacatttat aatgaacgtg aattgctcaa cagtatgggc atttcgcagc ctaccgtggt 900

gttcgtttcc aaaaaggggt tgcaaaaaat tttgaacgtg caaaaaaagc tcccaatcat 960

ccaaaaaatt attatcatgg attctaaaac ggattaccag ggatttcagt cgatgtacac 1020

gttcgtcaca tctcatctac ctcccggttt taatgaatac gattttgtgc cagagtcctt 1080

cgatagggac aagacaattg cactgatcat gaactcctct ggatctactg gtctgcctaa 1140

aggtgtcgct ctgcctcata gaactgcctg cgtgagattc tcgcatgcca gagatcctat 1200

ttttggcaat caaatcattc cggatactgc gattttaagt gttgttccat tccatcacgg 1260

ttttggaatg tttactacac tcggatattt gatatgtgga tttcgagtcg tcttaatgta 1320

tagatttgaa gaagagctgt ttctgaggag ccttcaggat tacaagattc aaagtgcgct 1380

gctggtgcca accctattct ccttcttcgc caaaagcact ctgattgaca aatacgattt 1440

atctaattta cacgaaattg cttctggtgg cgctcccctc tctaaggaag tcggggaagc 1500

ggttgccaag aggttccatc tgccaggtat caggcaagga tatgggctca ctgagactac 1560

atcagctatt ctgattacac ccgaggggga tgataaaccg ggcgcggtcg gtaaagttgt 1620

tccatttttt gaagcgaagg ttgtggatct ggataccggg aaaacgctgg gcgttaatca 1680

aagaggcgaa ctgtgtgtga gaggtcctat gattatgtcc ggttatgtaa acaatccgga 1740

agcgaccaac gccttgattg acaaggatgg atggctacat tctggagaca tagcttactg 1800

ggacgaagac gaacacttct tcatcgttga ccgcctgaag tctctgatta agtacaaagg 1860

ctatcaggtg gctcccgctg aattggaatc catcttgctc caacacccca acatcttcga 1920

cgcaggtgtc gcaggtcttc ccgacgatga cgccggtgaa cttcccgccg ccgttgttgt 1980

tttggagcac ggaaagacga tgacggaaaa agagatcgtg gattacgtcg ccagtcaagt 2040

aacaaccgcg aaaaagttgc gcggaggagt tgtgtttgtg gacgaagtac cgaaaggtct 2100

taccggaaaa ctcgacgcaa gaaaaatcag agagatcctc ataaaggcca agaagggcgg 2160

aaagatcgcc gtgtaagagc atcttaccgc catttattcc catatttgtt ctgtttttct 2220

tgatttgggt atacatttaa atgttaataa aacaaaatgg tggggcaatc atttacattt 2280

ttagggatat gtaattacta gttcaggtgt attgccacaa gacaaacatg ttaagaaact 2340

ttcccgttat ttacgctctg ttcctgttaa tcaacctctg gattacaaaa tttgtgaaag 2400

attgactgat attcttaact atgttgctcc ttttacgctg tgtggatatg ctgctttata 2460

gcctctgtat ctagctattg cttcccgtac ggctttcgtt ttctcctcct tgtataaatc 2520

ctggttgctg tctcttttag aggagttgtg gcccgttgtc cgtcaacgtg gcgtggtgtg 2580

ctctgtgttt gctgacgcaa cccccactgg ctggggcatt gccaccacct gtcaactcct 2640

ttctgggact ttcgctttcc ccctcccgat cgccacggca gaactcatcg ccgcctgcct 2700

tgcccgctgc tggacagggg ctaggttgct gggcactgat aattccgtgg tgttgtctgt 2760

gccttctagt tgccagccat ctgttgtttg cccctccccc gtgccttcct tgaccctgga 2820

aggtgccact cccactgtcc tttcctaata aaatgaggaa attgcatcgc attgtctgag 2880

taggtgtcat tctattctgg ggggtggggt ggggcaggac agcaaggggg aggattggga 2940

agacaatagc aggcatgctg gggatgcggt gggctctatg gcaggaaccc ctagtgatgg 3000

agttggccac tccctctctg cgcgctcgct cgctcactga ggccgggcga ccaaaggtcg 3060

cccgacgccc gggctttgcc cgggcggcct cagtgagcga gcgagcgcgc agctgcctgc 3120

agg 3123

<210> 54

<211> 3117

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 54

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60

gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca 120

actccatcac taggggttcc tgaacagaga aacaggaa tatgggccaa acaggatatc 180

tgtggtaagc agttcctgcc ccggctcagg gccaagaaca gttggaacag cagaatatgg 240

gccaaacagg atatctgtgg taagcagttc ctgccccggc tcagggccaa gaacagatgg 300

tccccagatg cggtcccgcc ctcagcagtt tctagagaac catcagatgt ttccagggtg 360

ccccaaggac ctgaaatgac cctgtgcctt atttgaacta accaatcagt tcgcttctcg 420

cttctgttcg cgcgcttctg ctccccgagc tctatataag cagagctcgt ttagtgaacc 480

gtcagatcgc ctggagacgc catccacgct gttttgactt ccatagaagg ccgccaccat 540

ggaagacgcc aaaaacataa agaaaggccc ggcgccattc tatccgctgg aagatggaac 600

cgctggagag caactgcata aggctatgaa gagatacgcc ctggttcctg gaacaattgc 660

ttttacagat gcacatatcg aggtggacat cacttacgct gagtacttcg aaatgtccgt 720

tcggttggca gaagctatga aacgatatgg gctgaataca aatcacagaa tcgtcgtatg 780

cagtgaaaac tctcttcaat tctttatgcc ggtgttgggc gcgttattta tcggagttgc 840

agttgcgccc gcgaacgaca tttataatga acgtgaattg ctcaacagta tgggcatttc 900

gcagcctacc gtggtgttcg tttccaaaaa ggggttgcaa aaaattttga acgtgcaaaa 960

aaagctccca atcatccaaa aaattattat catggattct aaaacggatt accagggatt 1020

tcagtcgatg tacacgttcg tcacatctca tctacctccc ggttttaatg aatacgattt 1080

tgtgccagag tccttcgata gggacaagac aattgcactg atcatgaact cctctggatc 1140

tactggtctg cctaaaggtg tcgctctgcc tcatagaact gcctgcgtga gattctcgca 1200

tgccagagat cctatttttg gcaatcaaat cattccggat actgcgattt taagtgttgt 1260

tccattccat cacggttttg gaatgtttac tacactcgga tatttgatat gtggatttcg 1320

agtcgtctta atgtatagat ttgaagaaga gctgtttctg aggagccttc aggattacaa 1380

gattcaaagt gcgctgctgg tgccaaccct attctccttc ttcgccaaaa gcactctgat 1440

tgacaaatac gatttatcta atttacacga aattgcttct ggtggcgctc ccctctctaa 1500

ggaagtcggg gaagcggttg ccaagaggtt ccatctgcca ggtatcaggc aaggatatgg 1560

gctcactgag actacatcag ctattctgat tacacccgag ggggatgata aaccgggcgc 1620

ggtcggtaaa gttgttccat tttttgaagc gaaggttgtg gatctggata ccgggaaaac 1680

gctgggcgtt aatcaaagag gcgaactgtg tgtgagaggt cctatgatta tgtccggtta 1740

tgtaaacaat ccggaagcga ccaacgcctt gattgacaag gatggatggc tacattctgg 1800

agacatagct tactgggacg aagacgaaca cttcttcatc gttgaccgcc tgaagtctct 1860

gattaagtac aaaggctatc aggtggctcc cgctgaattg gaatccatct tgctccaaca 1920

ccccaacatc ttcgacgcag gtgtcgcagg tcttcccgac gatgacgccg gtgaacttcc 1980

cgccgccgtt gttgttttgg agcacggaaa gacgatgacg gaaaaagaga tcgtggatta 2040

cgtcgccagt caagtaacaa ccgcgaaaaa gttgcgcgga ggagttgtgt ttgtggacga 2100

agtaccgaaa ggtcttaccg gaaaactcga cgcaagaaaa atcagagaga tcctcataaa 2160

ggccaagaag ggcggaaaga tcgccgtgta agagcatctt accgccattt attcccatat 2220

ttgttctgtt tttcttgatt tgggtataca tttaaatgtt aataaaacaa aatggtgggg 2280

caatcattta catttttagg gatatgtaat tactagttca ggtgtattgc cacaagacaa 2340

acatgttaag aaactttccc gttatttacg ctctgttcct gttaatcaac ctctggatta 2400

caaaatttgt gaaagattga ctgatattct taactatgtt gctcctttta cgctgtgtgg 2460

atatgctgct ttatagcctc tgtatctagc tattgcttcc cgtacggctt tcgttttctc 2520

ctccttgtat aaatcctggt tgctgtctct tttagaggag ttgtggcccg ttgtccgtca 2580

acgtggcgtg gtgtgctctg tgtttgctga cgcaaccccc actggctggg gcattgccac 2640

cacctgtcaa ctcctttctg ggactttcgc tttccccctc ccgatcgcca cggcagaact 2700

catcgccgcc tgccttgccc gctgctggac aggggctagg ttgctgggca ctgataattc 2760

cgtggtgttg tctgtgcctt ctagttgcca gccatctgtt gtttgcccct cccccgtgcc 2820

ttccttgacc ctggaaggtg ccactcccac tgtcctttcc taataaaatg aggaaattgc 2880

atcgcattgt ctgagtaggt gtcattctat tctggggggt ggggtggggc aggacagcaa 2940

gggggaggat tgggaagaca atagcaggca tgctggggat gcggtggggct ctatggcagg 3000

aacccctagt gatggagttg gccactccct ctctgcgcgc tcgctcgctc actgaggccg 3060

cccgggaaac ccgggcgtgc gcctcagtga gcgagcgagc gcgcagctgc ctgcagg 3117

<210> 55

<211> 2841

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 55

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggaaacc cgggcgtgcc 60

cgggcgcctc agtgagcgag cgagcgcgca gagagggagt ggccaactcc atcactaggg 120

gttcctgaac agagaaacag gagaatatgg gccaaacagg atatctgtgg taagcagttc 180

ctgccccggc tcagggccaa gaacagttgg aacagcagaa tatgggccaa acaggatatc 240

tgtggtaagc agttcctgcc ccggctcagg gccaagaaca gatggtcccc agatgcggtc 300

ccgccctcag cagtttctag agaaccatca gatgtttcca gggtgcccca aggacctgaa 360

atgaccctgt gccttatttg aactaaccaa tcagttcgct tctcgcttct gttcgcgcgc 420

ttctgctccc cgagctctat ataagcagag ctcgtttagt gaaccgtcag atcgcctgga 480

gacgccatcc acgctgtttt gacttccata gaaggccgcc accatgatca tggccgagag 540

ccctggcctg atcaccatct gcctgctggg ctacctgctg agcgccgagt gcaccgtgtt 600

cctggaccac gagaacgcca acaagatcct gaaccggccc aagagataca acagcggcaa 660

gctggaggag ttcgtgcagg gcaacctgga gagggagtgc atggaggaga agtgcagctt 720

cgaggaggcc agggaagtgt tcgagaacac cgagcggacc accgagttct ggaagcagta 780

cgtggacggc gaccagtgcg agagcaaccc ttgcctgaac ggcggcagct gcaaggacga 840

catcaacagc tacgagtgct ggtgcccttt cggcttcgag ggcaagaact gcgagctgga 900

cgtgacctgc aacatcaaga acggccgctg cgagcagttc tgcaagaaca gcgccgacaa 960

caaagtggtg tgtagctgca ccgagggcta cagactggcc gagaaccaga agagctgcga 1020

gcccgccgtg cccttcccct gcggcagagt gagcgtgtcc cagaccagca agctgaccag 1080

agccgagacc gtgttccccg acgtggacta cgtgaatagc accgaggccg agaccatcct 1140

ggacaacatc acccagagca cccagtcctt caacgacttc accaagttg tgggcggcga 1200

ggacgccaag cccggccagt tcccctggca ggtggtgctg aacggcaaag tggatgcctt 1260

ctgcggcggc agcatcgtga acgagaagtg gatcgtgaca gccgcccact gcgtggagac 1320

cggcgtgaag atcaccgtgg tggccggcga acacaatatc gaggagaccg agcacaccga 1380

gcagaagcgg aacgtcatcc ggattatccc ccaccacaac tacaacgccg ccatcaacaa 1440

gtacaaccac gacatcgccc tgctggagct ggacgagcct ctggtgctga atagctacgt 1500

gacccccatc tgcatcgccg acaaggagta caccaacatc ttcctgaagt tcggcagcgg 1560

ctacgtgtcc ggctggggca gagtgttcca caagggcaga agcgccctgg tgctgcagta 1620

cctgagagtg cccctggtgg acagagccac ctgcctgttg agcaccaagt tcaccatcta 1680

caacaacatg ttctgcgccg gcttccacga gggcggcaga gacagctgcc agggcgacag 1740

cggcggaccc cacgtgaccg aagtggaggg caccagcttc ctgaccggca tcatcagctg 1800

gggcgaggag tgcgccatga agggcaagta cggcatctac accaaagtga gccggtacgt 1860

gaactggatc aaggagaaaa ccaagctgac ctgagagcat cttaccgcca tttattccca 1920

tatttgttct gtttttcttg atttgggtat acatttaaat gttaataaaa caaaatggtg 1980

gggcaatcat ttacattttt agggatatgt aattactagt tcaggtgtat tgccacaaga 2040

caaacatgtt aagaaacttt cccgttattt acgctctgtt cctgttaatc aacctctgga 2100

ttacaaaatt tgtgaaagat tgactgatat tcttaactat gttgctcctt ttacgctgtg 2160

tggatatgct gctttatagc ctctgtatct agctattgct tcccgtacgg ctttcgtttt 2220

ctcctccttg tataaatcct ggttgctgtc tcttttagag gagttgtggc ccgttgtccg 2280

tcaacgtggc gtggtgtgct ctgtgtttgc tgacgcaacc cccactggct ggggcattgc 2340

caccacctgt caactccttt ctgggacttt cgctttcccc ctcccgatcg ccacggcaga 2400

actcatcgcc gcctgccttg cccgctgctg gacaggggct aggttgctgg gcactgataa 2460

ttccgtggtg ttgtctgtgc cttctagttg ccagccatct gttgtttgcc cctcccccgt 2520

gccttccttg accctggaag gtgccactcc cactgtcctt tcctaataaa atgaggaaat 2580

tgcatcgcat tgtctgagta ggtgtcattc tattctgggg ggtggggtgg ggcaggacag 2640

caagggggag gattgggaag acaatagcag gcatgctggg gatgcggtgg gctctatggc 2700

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 2760

ccgggcgacc aaaggtcgcc cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc 2820

gagcgcgcag ctgcctgcag g 2841

<210> 56

<211> 2835

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 56

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60

gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca 120

actccatcac taggggttcc tgaacagaga aacaggaa tatgggccaa acaggatatc 180

tgtggtaagc agttcctgcc ccggctcagg gccaagaaca gttggaacag cagaatatgg 240

gccaaacagg atatctgtgg taagcagttc ctgccccggc tcagggccaa gaacagatgg 300

tccccagatg cggtcccgcc ctcagcagtt tctagagaac catcagatgt ttccagggtg 360

ccccaaggac ctgaaatgac cctgtgcctt atttgaacta accaatcagt tcgcttctcg 420

cttctgttcg cgcgcttctg ctccccgagc tctatataag cagagctcgt ttagtgaacc 480

gtcagatcgc ctggagacgc catccacgct gttttgactt ccatagaagg ccgccaccat 540

gatcatggcc gagagccctg gcctgatcac catctgcctg ctgggctacc tgctgagcgc 600

cgagtgcacc gtgttcctgg accacgagaa cgccaacaag atcctgaacc ggcccaagag 660

atacaacagc ggcaagctgg aggagttcgt gcagggcaac ctggagaggg agtgcatgga 720

ggagaagtgc agcttcgagg aggccaggga agtgttcgag aacaccgagc ggaccaccga 780

gttctggaag cagtacgtgg acggcgacca gtgcgagagc aacccttgcc tgaacggcgg 840

cagctgcaag gacgacatca acagctacga gtgctggtgc cctttcggct tcgagggcaa 900

gaactgcgag ctggacgtga cctgcaacat caagaacggc cgctgcgagc agttctgcaa 960

gaacagcgcc gacaacaaag tggtgtgtag ctgcaccgag ggctacagac tggccgagaa 1020

ccagaagagc tgcgagcccg ccgtgccctt cccctgcggc agagtgagcg tgtcccagac 1080

cagcaagctg accagagccg agaccgtgtt ccccgacgtg gactacgtga atagcaccga 1140

ggccgagacc atcctggaca acatcaccca gagcaccag tccttcaacg acttcaccag 1200

agttgtgggc ggcgaggacg ccaagcccgg ccagttcccc tggcaggtgg tgctgaacgg 1260

caaagtggat gccttctgcg gcggcagcat cgtgaacgag aagtggatcg tgacagccgc 1320

ccactgcgtg gagaccggcg tgaagatcac cgtggtggcc ggcgaacaca atatcgagga 1380

gaccgagcac accgagcaga agcggaacgt catccggatt atcccccacc acaactacaa 1440

cgccgccatc aacaagtaca accacgacat cgccctgctg gagctggacg agcctctggt 1500

gctgaatagc tacgtgaccc ccatctgcat cgccgacaag gagtacacca acatcttcct 1560

gaagttcggc agcggctacg tgtccggctg gggcagagtg ttccacaagg gcagaagcgc 1620

cctggtgctg cagtacctga gagtgcccct ggtggacaga gccacctgcc tgttgagcac 1680

caagttcacc atctacaaca acatgttctg cgccggcttc cacgagggcg gcagagacag 1740

ctgccagggc gacagcggcg gaccccacgt gaccgaagtg gagggcacca gcttcctgac 1800

cggcatcatc agctggggcg aggagtgcgc catgaagggc aagtacggca tctacaccaa 1860

agtgagccgg tacgtgaact ggatcaagga gaaaaccaag ctgacctgag agcatcttac 1920

cgccatttat tcccatattt gttctgtttt tcttgatttg ggtatacatt taaatgttaa 1980

taaaacaaaa tggtggggca atcatttaca tttttaggga tatgtaatta ctagttcagg 2040

tgtattgcca caagacaaac atgttaagaa actttcccgt tatttacgct ctgttcctgt 2100

taatcaacct ctggattaca aaatttgtga aagattgact gatattctta actatgttgc 2160

tccttttacg ctgtgtggat atgctgcttt atagcctctg tatctagcta ttgcttcccg 2220

tacggctttc gttttctcct ccttgtataa atcctggttg ctgtctcttt tagaggagtt 2280

gtggcccgtt gtccgtcaac gtggcgtggt gtgctctgtg tttgctgacg caacccccac 2340

tggctggggc attgccacca cctgtcaact cctttctggg actttcgctt tccccctccc 2400

gatcgccacg gcagaactca tcgccgcctg ccttgcccgc tgctggacag gggctaggtt 2460

gctgggcact gataattccg tggtgttgtc tgtgccttct agttgccagc catctgttgt 2520

ttgcccctcc cccgtgcctt ccttgaccct ggaaggtgcc actcccactg tcctttccta 2580

ataaaatgag gaaattgcat cgcattgtct gagtaggtgt cattctattc tggggggtgg 2640

ggtggggcag gacagcaagg gggaggattg ggaagacaat agcaggcatg ctggggatgc 2700

ggtgggctct atggcaggaa cccctagtga tggagttggc cactccctct ctgcgcgctc 2760

gctcgctcac tgaggccgcc cgggaaaccc gggcgtgcgc ctcagtgagc gagcgagcgc 2820

gcagctgcct gcagg 2835

<210> 57

<211> 3912

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 57

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggaaacc cgggcgtgcc 60

cgggcgcctc agtgagcgag cgagcgcgca gagagggagt ggccaactcc atcactaggg 120

gttcctggct cagaggctca gaggcacaca ggagtttctg ggctcaccct gcccccttcc 180

aacccctcag ttcccatcct ccagcagctg tttgtgtgct gcctctgaag tccacactga 240

acaaacttca gcctactcat gtccctaaaa tgggcaaaca ttgcaagcag caaacagcaa 300

acacacagcc ctccctgcct gctgaccttg gagctggggc agaggtcaga gacctctctg 360

ggcccatgcc acctccaaca tccactcgac cccttggaat ttcggtggag aggagcagag 420

gttgtcctgg cgtggtttag gtagtgtgag agggtccggg ttcaaaacca cttgctgggt 480

ggggagtcgt cagtaagtgg ctatgccccg accccgaagc ctgtttcccc atctgtacaa 540

tggaaatgat aaagacgccc atctgatagg gtttttgtgg caaataaaca tttggttttt 600

ttgttttgtt ttgttttgtt ttttgagatg gaggtttgct ctgtcgccca ggctggagtg 660

cagtgacaca atctcatctc accacaacct tcccctgcct cagcctccca agtagctggg 720

attacaagca tgtgccacca cacctggcta attttctatt tttagtagag acgggtttct 780

ccatgttggt cagcctcagc ctcccaagta actgggatta caggcctgtg ccaccacacc 840

cggctaattt tttctatttt tgacagggac ggggtttcac catgttggtc aggctggtct 900

agaggtaccg gatcttgcta ccagtggaac agccactaag gattctgcag tgagagcaga 960

gggccagcta agtggtactc tcccagagac tgtctgactc acgccacccc ctccaccttg 1020

gacacaggac gctgtggttt ctgagccagg tacaatgact cctttcggta agtgcagtgg 1080

aagctgtaca ctgcccaggc aaagcgtccg ggcagcgtag gcgggcgact cagatcccag 1140

ccagtggact tagcccctgt ttgctcctcc gataactggg gtgaccttgg ttaatattca 1200

ccagcagcct cccccgttgc ccctctggat ccactgctta aatacggacg aggacagggc 1260

cctgtctcct cagcttcagg caccaccact gacctgggac agtgccgcca ccatggaaga 1320

cgccaaaaac ataaagaaag gcccggcgcc attctatccg ctggaagatg gaaccgctgg 1380

agagcaactg cataaggcta tgaagata cgccctggtt cctggaacaa ttgcttttac 1440

agatgcacat atcgaggtgg acatcactta cgctgagtac ttcgaaatgt ccgttcggtt 1500

ggcagaagct atgaaacgat atgggctgaa tacaaatcac agaatcgtcg tatgcagtga 1560

aaactctctt caattcttta tgccggtgtt gggcgcgtta tttatcggag ttgcagttgc 1620

gcccgcgaac gacatttata atgaacgtga attgctcaac agtatgggca tttcgcagcc 1680

taccgtggtg ttcgtttcca aaaaggggtt gcaaaaaatt ttgaacgtgc aaaaaaagct 1740

cccaatcatc caaaaaatta ttatcatgga ttctaaaacg gattaccagg gatttcagtc 1800

gatgtacacg ttcgtcacat ctcatctacc tcccggtttt aatgaatacg attttgtgcc 1860

agagtccttc gatagggaca agacaattgc actgatcatg aactcctctg gatctactgg 1920

tctgcctaaa ggtgtcgctc tgcctcatag aactgcctgc gtgagattct cgcatgccag 1980

agatcctatt tttggcaatc aaatcattcc ggatactgcg attttaagtg ttgttccatt 2040

ccatcacggt tttggaatgt ttactacact cggatatttg atatgtggat ttcgagtcgt 2100

cttaatgtat agatttgaag aagagctgtt tctgaggagc cttcaggatt acaagattca 2160

aagtgcgctg ctggtgccaa ccctattctc cttcttcgcc aaaagcactc tgattgacaa 2220

atacgattta tctaatttac acgaaattgc ttctggtggc gctcccctct ctaaggaagt 2280

cggggaagcg gttgccaaga ggttccatct gccaggtatc aggcaaggat atgggctcac 2340

tgagactaca tcagctattc tgattacacc cgagggggat gataaaccgg gcgcggtcgg 2400

taaagttgtt ccattttttg aagcgaaggt tgtggatctg gataccggga aaacgctggg 2460

cgttaatcaa agaggcgaac tgtgtgtgag aggtcctatg attatgtccg gttatgtaaa 2520

caatccggaa gcgaccaacg ccttgattga caaggatgga tggctacatt ctggagacat 2580

agcttactgg gacgaagacg aacacttctt catcgttgac cgcctgaagt ctctgattaa 2640

gtacaaaggc tatcaggtgg ctcccgctga attggaatcc atcttgctcc aacaccccaa 2700

catcttcgac gcaggtgtcg caggtcttcc cgacgatgac gccggtgaac ttcccgccgc 2760

cgttgttgtt ttggagcacg gaaagacgat gacggaaaaa gagatcgtgg attacgtcgc 2820

cagtcaagta acaaccgcga aaaagttgcg cggagggagtt gtgtttgtgg acgaagtacc 2880

gaaaggtctt acggaaaac tcgacgcaag aaaaatcaga gagatcctca taaaggccaa 2940

gaagggcgga aagatcgccg tgtaagagca tcttaccgcc atttattccc atatttgttc 3000

tgtttttctt gatttgggta tacatttaaa tgttaataaa acaaaatggt ggggcaatca 3060

tttacatttt tagggatatg taattactag ttcaggtgta ttgccacaag acaaacatgt 3120

taagaaactt tcccgttatt tacgctctgt tcctgttaat caacctctgg attacaaaat 3180

ttgtgaaaga ttgactgata ttcttaacta tgttgctcct tttacgctgt gtggatatgc 3240

tgctttatag cctctgtatc tagctattgc ttcccgtacg gctttcgttt tctcctcctt 3300

gtataaatcc tggttgctgt ctcttttaga ggagttgtgg cccgttgtcc gtcaacgtgg 3360

cgtggtgtgc tctgtgtttg ctgacgcaac ccccactggc tggggcattg ccaccacctg 3420

tcaactcctt tctgggactt tcgctttccc cctcccgatc gccacggcag aactcatcgc 3480

cgcctgcctt gcccgctgct ggacaggggc taggttgctg ggcactgata attccgtggt 3540

gttgtctgtg ccttctagtt gccagccatc tgttgtttgc ccctcccccg tgccttcctt 3600

gaccctggaa ggtgccactc ccactgtcct ttcctaataa aatgaggaaa ttgcatcgca 3660

ttgtctgagt aggtgtcatt ctattctggg gggtggggtg gggcaggaca gcaaggggga 3720

ggattgggaa gacaatagca ggcatgctgg ggatgcggtg ggctctatgg caggaacccc 3780

tagtgatgga gttggccact ccctctctgc gcgctcgctc gctcactgag gccgggcgac 3840

caaaggtcgc ccgacgcccg ggctttgccc gggcggcctc agtgagcgag cgagcgcgca 3900

gctgcctgca gg 3912

<210> 58

<211> 3906

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 58

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60

gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca 120

actccatcac taggggttcc tggctcagag gctcagaggc acacaggagt ttctgggctc 180

accctgcccc cttccaaccc ctcagttccc atcctccagc agctgtttgt gtgctgcctc 240

tgaagtccac actgaacaaa cttcagccta ctcatgtccc taaaatgggc aaacattgca 300

agcagcaaac agcaaacaca cagccctccc tgcctgctga ccttggagct ggggcagagg 360

tcagagacct ctctgggccc atgccacctc caacatccac tcgacccctt ggaatttcgg 420

tggagaggag cagaggttgt cctggcgtgg tttaggtagt gtgagagggt ccgggttcaa 480

aaccacttgc tgggtgggga gtcgtcagta agtggctatg ccccgacccc gaagcctgtt 540

tccccatctg tacaatggaa atgataaaga cgcccatctg atagggtttt tgtggcaaat 600

aaacatttgg tttttttgtt ttgttttgtt ttgttttttg agatggaggt ttgctctgtc 660

gcccaggctg gagtgcagtg acacaatctc atctcaccac aaccttcccc tgcctcagcc 720

tcccaagtag ctgggattac aagcatgtgc caccacacct ggctaatttt ctatttttag 780

tagagacggg tttctccatg ttggtcagcc tcagcctccc aagtaactgg gattacaggc 840

ctgtgccacc acacccggct aattttttct atttttgaca gggacggggt ttcaccatgt 900

tggtcaggct ggtctagagg taccggatct tgctaccagt ggaacagcca ctaaggattc 960

tgcagtgaga gcagagggcc agctaagtgg tactctccca gagactgtct gactcacgcc 1020

accccctcca ccttggacac aggacgctgt ggtttctgag ccaggtacaa tgactccttt 1080

cggtaagtgc agtggaagct gtacactgcc caggcaaagc gtccgggcag cgtaggcggg 1140

cgactcagat cccagccagt ggacttagcc cctgtttgct cctccgataa ctggggtgac 1200

cttggttaat attcaccagc agcctccccc gttgcccctc tggatccact gcttaaatac 1260

ggacgaggac agggccctgt ctcctcagct tcaggcacca ccactgacct gggacagtgc 1320

cgccaccatg gaagacgcca aaaacataaa gaaaggcccg gcgccattct atccgctgga 1380

agatggaacc gctggagagc aactgcataa ggctatgaag agatacgccc tggttcctgg 1440

aacaattgct tttacagatg cacatatcga ggtggacatc acttacgctg agtacttcga 1500

aatgtccgtt cggttggcag aagctatgaa acgatatggg ctgaatacaa atcacagaat 1560

cgtcgtatgc agtgaaaact ctcttcaatt ctttatgccg gtgttgggcg cgttatttat 1620

cggagttgca gttgcgcccg cgaacgacat ttataatgaa cgtgaattgc tcaacagtat 1680

gggcatttcg cagcctaccg tggtgttcgt ttccaaaaag gggttgcaaa aaattttgaa 1740

cgtgcaaaaa aagctcccaa tcatccaaaa aattattatc atggattcta aaacggatta 1800

ccagggattt cagtcgatgt acacgttcgt cacatctcat ctacctcccg gttttaatga 1860

atacgatttt gtgccagagt ccttcgatag ggacaagaca attgcactga tcatgaactc 1920

ctctggatct actggtctgc ctaaaggtgt cgctctgcct catagaactg cctgcgtgag 1980

attctcgcat gccagagatc ctatttttgg caatcaaatc attccggata ctgcgatttt 2040

aagtgttgtt ccattccatc acggttttgg aatgtttact acactcggat atttgatatg 2100

tggatttcga gtcgtcttaa tgtatagatt tgaagaagag ctgtttctga ggagccttca 2160

ggattacaag attcaaagtg cgctgctggt gccaacccta ttctccttct tcgccaaaag 2220

cactctgatt gacaaatacg atttatctaa tttacacgaa attgcttctg gtggcgctcc 2280

cctctctaag gaagtcgggg aagcggttgc caagaggttc catctgccag gtatcaggca 2340

aggatatggg ctcactgaga ctacatcagc tattctgatt acacccgagg gggatgataa 2400

accgggcgcg gtcggtaaag ttgttccatt ttttgaagcg aaggttgtgg atctggatac 2460

cgggaaaacg ctgggcgtta atcaaagagg cgaactgtgt gtgagaggtc ctatgattat 2520

gtccggttat gtaaacaatc cggaagcgac caacgccttg attgacaagg atggatggct 2580

acattctgga gacatagctt actgggacga agacgaacac ttcttcatcg ttgaccgcct 2640

gaagtctctg attaagtaca aaggctatca ggtggctccc gctgaattgg aatccatctt 2700

gctccaacac cccaacatct tcgacgcagg tgtcgcaggt cttcccgacg atgacgccgg 2760

tgaacttccc gccgccgttg ttgttttgga gcacggaaag acgatgacgg aaaaagagat 2820

cgtggattac gtcgccagtc aagtaacaac cgcgaaaaag ttgcgcggag gagttgtgtt 2880

tgtggacgaa gtaccgaaag gtcttaccgg aaaactcgac gcaagaaaaa tcagagagat 2940

cctcataaag gccaagaagg gcggaaagat cgccgtgtaa gagcatctta ccgccattta 3000

ttcccatatt tgttctgttt ttcttgattt gggtatacat ttaaatgtta ataaaacaaa 3060

atggtggggc aatcatttac atttttaggg atatgtaatt actagttcag gtgtattgcc 3120

acaagacaaa catgttaaga aactttcccg ttatttacgc tctgttcctg ttaatcaacc 3180

tctggattac aaaatttgtg aaagattgac tgatattctt aactatgttg ctccttttac 3240

gctgtgtgga tatgctgctt tatagcctct gtatctagct attgcttccc gtacggcttt 3300

cgttttctcc tccttgtata aatcctggtt gctgtctctt ttagaggagt tgtggcccgt 3360

tgtccgtcaa cgtggcgtgg tgtgctctgt gtttgctgac gcaaccccca ctggctgggg 3420

cattgccacc acctgtcaac tcctttctgg gactttcgct ttccccctcc cgatcgccac 3480

ggcagaactc atcgccgcct gccttgcccg ctgctggaca ggggctaggt tgctgggcac 3540

tgataattcc gtggtgttgt ctgtgccttc tagttgccag ccatctgttg tttgcccctc 3600

ccccgtgcct tccttgaccc tggaaggtgc cactcccact gtcctttcct aataaaatga 3660

ggaaattgca tcgcattgtc tgagtaggtg tcattctatt ctggggggtg gggtggggca 3720

ggacagcaag ggggaggatt gggaagacaa tagcaggcat gctggggatg cggtgggctc 3780

tatggcagga acccctagtg atggagttgg ccactccctc tctgcgcgct cgctcgctca 3840

ctgaggccgc ccgggaaacc cgggcgtgcg cctcagtgag cgagcgagcg cgcagctgcc 3900

tgcagg 3906

<210> 59

<211> 3630

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 59

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggaaacc cgggcgtgcc 60

cgggcgcctc agtgagcgag cgagcgcgca gagagggagt ggccaactcc atcactaggg 120

gttcctggct cagaggctca gaggcacaca ggagtttctg ggctcaccct gcccccttcc 180

aacccctcag ttcccatcct ccagcagctg tttgtgtgct gcctctgaag tccacactga 240

acaaacttca gcctactcat gtccctaaaa tgggcaaaca ttgcaagcag caaacagcaa 300

acacacagcc ctccctgcct gctgaccttg gagctggggc agaggtcaga gacctctctg 360

ggcccatgcc acctccaaca tccactcgac cccttggaat ttcggtggag aggagcagag 420

gttgtcctgg cgtggtttag gtagtgtgag agggtccggg ttcaaaacca cttgctgggt 480

ggggagtcgt cagtaagtgg ctatgccccg accccgaagc ctgtttcccc atctgtacaa 540

tggaaatgat aaagacgccc atctgatagg gtttttgtgg caaataaaca tttggttttt 600

ttgttttgtt ttgttttgtt ttttgagatg gaggtttgct ctgtcgccca ggctggagtg 660

cagtgacaca atctcatctc accacaacct tcccctgcct cagcctccca agtagctggg 720

attacaagca tgtgccacca cacctggcta attttctatt tttagtagag acgggtttct 780

ccatgttggt cagcctcagc ctcccaagta actgggatta caggcctgtg ccaccacacc 840

cggctaattt tttctatttt tgacagggac ggggtttcac catgttggtc aggctggtct 900

agaggtaccg gatcttgcta ccagtggaac agccactaag gattctgcag tgagagcaga 960

gggccagcta agtggtactc tcccagagac tgtctgactc acgccacccc ctccaccttg 1020

gacacaggac gctgtggttt ctgagccagg tacaatgact cctttcggta agtgcagtgg 1080

aagctgtaca ctgcccaggc aaagcgtccg ggcagcgtag gcgggcgact cagatcccag 1140

ccagtggact tagcccctgt ttgctcctcc gataactggg gtgaccttgg ttaatattca 1200

ccagcagcct cccccgttgc ccctctggat ccactgctta aatacggacg aggacagggc 1260

cctgtctcct cagcttcagg caccaccact gacctgggac agtgccgcca ccatgatcat 1320

ggccgagagc cctggcctga tcaccatctg cctgctgggc tacctgctga gcgccgagtg 1380

caccgtgttc ctggaccacg agaacgccaa caagatcctg aaccggccca agagatacaa 1440

cagcggcaag ctggagagt tcgtgcaggg caacctggag agggagtgca tggaggagaa 1500

gtgcagcttc gaggaggcca gggaagtgtt cgagaacacc gagcggacca ccgagttctg 1560

gaagcagtac gtggacggcg accagtgcga gagcaaccct tgcctgaacg gcggcagctg 1620

caaggacgac atcaacagct acgagtgctg gtgccctttc ggcttcgagg gcaagaactg 1680

cgagctggac gtgacctgca acatcaagaa cggccgctgc gagcagttct gcaagaacag 1740

cgccgacaac aaagtggtgt gtagctgcac cgagggctac agactggccg agaaccagaa 1800

gagctgcgag cccgccgtgc ccttcccctg cggcagagtg agcgtgtccc agaccagcaa 1860

gctgaccaga gccgagaccg tgttccccga cgtggactac gtgaatagca ccgaggccga 1920

gaccatcctg gacaacatca cccagagcac ccagtccttc aacgacttca cccagttgt 1980

gggcggcgag gacgccaagc ccggccagtt cccctggcag gtggtgctga acggcaaagt 2040

ggatgccttc tgcggcggca gcatcgtgaa cgagaagtgg atcgtgacag ccgcccactg 2100

cgtggagacc ggcgtgaaga tcaccgtggt ggccggcgaa cacaatatcg aggagaccga 2160

gcacaccgag cagaagcgga acgtcatccg gattatcccc caccacaact acaacgccgc 2220

catcaacaag tacaaccacg acatcgccct gctggagctg gacgagcctc tggtgctgaa 2280

tagctacgtg acccccatct gcatcgccga caaggagtac accaacatct tcctgaagtt 2340

cggcagcggc tacgtgtccg gctggggcag agtgttccac aagggcagaa gcgccctggt 2400

gctgcagtac ctgagagtgc ccctggtgga cagagccacc tgcctgttga gcaccaagtt 2460

caccatctac aacaacatgt tctgcgccgg cttccacgag ggcggcagag acagctgcca 2520

gggcgacagc ggcggacccc acgtgaccga agtggagggc accagcttcc tgaccggcat 2580

catcagctgg ggcgaggagt gcgccatgaa gggcaagtac ggcatctaca ccaaagtgag 2640

ccggtacgtg aactggatca aggagaaaac caagctgacc tgagagcatc ttaccgccat 2700

ttattcccat atttgttctg tttttcttga tttgggtata catttaaatg ttaataaaac 2760

aaaatggtgg ggcaatcatt tacattttta gggatatgta attactagtt caggtgtatt 2820

gccacaagac aaacatgtta agaaactttc ccgttattta cgctctgttc ctgttaatca 2880

acctctggat tacaaaattt gtgaaagatt gactgatatt cttaactatg ttgctccttt 2940

tacgctgtgt ggatatgctg ctttatagcc tctgtatcta gctattgctt cccgtacggc 3000

tttcgttttc tcctccttgt ataaatcctg gttgctgtct cttttagagg agttgtggcc 3060

cgttgtccgt caacgtggcg tggtgtgctc tgtgtttgct gacgcaaccc ccactggctg 3120

gggcattgcc accacctgtc aactcctttc tgggactttc gctttccccc tcccgatcgc 3180

cacggcagaa ctcatcgccg cctgccttgc ccgctgctgg acaggggcta ggttgctggg 3240

cactgataat tccgtggtgt tgtctgtgcc ttctagttgc cagccatctg ttgtttgccc 3300

ctcccccgtg ccttccttga ccctggaagg tgccactccc actgtccttt cctaataaaa 3360

tgaggaaatt gcatcgcatt gtctgagtag gtgtcattct attctggggg gtggggtggg 3420

gcaggacagc aagggggagg attgggaaga caatagcagg catgctgggg atgcggtggg 3480

ctctatggca ggaaccccta gtgatggagt tggccactcc ctctctgcgc gctcgctcgc 3540

tcactgaggc cgggcgacca aaggtcgccc gacgcccggg ctttgcccgg gcggcctcag 3600

tgagcgagcg agcgcgcagc tgcctgcagg 3630

<210> 60

<211> 3624

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 60

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60

gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca 120

actccatcac taggggttcc tggctcagag gctcagaggc acacaggagt ttctgggctc 180

accctgcccc cttccaaccc ctcagttccc atcctccagc agctgtttgt gtgctgcctc 240

tgaagtccac actgaacaaa cttcagccta ctcatgtccc taaaatgggc aaacattgca 300

agcagcaaac agcaaacaca cagccctccc tgcctgctga ccttggagct ggggcagagg 360

tcagagacct ctctgggccc atgccacctc caacatccac tcgacccctt ggaatttcgg 420

tggagaggag cagaggttgt cctggcgtgg tttaggtagt gtgagagggt ccgggttcaa 480

aaccacttgc tgggtgggga gtcgtcagta agtggctatg ccccgacccc gaagcctgtt 540

tccccatctg tacaatggaa atgataaaga cgcccatctg atagggtttt tgtggcaaat 600

aaacatttgg tttttttgtt ttgttttgtt ttgttttttg agatggaggt ttgctctgtc 660

gcccaggctg gagtgcagtg acacaatctc atctcaccac aaccttcccc tgcctcagcc 720

tcccaagtag ctgggattac aagcatgtgc caccacacct ggctaatttt ctatttttag 780

tagagacggg tttctccatg ttggtcagcc tcagcctccc aagtaactgg gattacaggc 840

ctgtgccacc acacccggct aattttttct atttttgaca gggacggggt ttcaccatgt 900

tggtcaggct ggtctagagg taccggatct tgctaccagt ggaacagcca ctaaggattc 960

tgcagtgaga gcagagggcc agctaagtgg tactctccca gagactgtct gactcacgcc 1020

accccctcca ccttggacac aggacgctgt ggtttctgag ccaggtacaa tgactccttt 1080

cggtaagtgc agtggaagct gtacactgcc caggcaaagc gtccgggcag cgtaggcggg 1140

cgactcagat cccagccagt ggacttagcc cctgtttgct cctccgataa ctggggtgac 1200

cttggttaat attcaccagc agcctccccc gttgcccctc tggatccact gcttaaatac 1260

ggacgaggac agggccctgt ctcctcagct tcaggcacca ccactgacct gggacagtgc 1320

cgccaccatg atcatggccg agagccctgg cctgatcacc atctgcctgc tgggctacct 1380

gctgagcgcc gagtgcaccg tgttcctgga ccacgagaac gccaacaaga tcctgaaccg 1440

gcccaagaga tacaacagcg gcaagctgga ggagttcgtg cagggcaacc tggagaggga 1500

gtgcatggag gagaagtgca gcttcgagga ggccagggaa gtgttcgaga acaccgagcg 1560

gaccaccgag ttctggaagc agtacgtgga cggcgaccag tgcgagagca acccttgcct 1620

gaacggcggc agctgcaagg acgacatcaa cagctacgag tgctggtgcc ctttcggctt 1680

cgagggcaag aactgcgagc tggacgtgac ctgcaacatc aagaacggcc gctgcgagca 1740

gttctgcaag aacagcgccg acaacaaagt ggtgtgtagc tgcaccgagg gctacagact 1800

ggccgagaac cagaagagct gcgagcccgc cgtgcccttc ccctgcggca gagtgagcgt 1860

gtcccagacc agcaagctga cgagccga gaccgtgttc cccgacgtgg actacgtgaa 1920

tagcaccgag gccgagacca tcctggacaa catcacccag agcacccagt ccttcaacga 1980

cttcaccaga gttgtgggcg gcgaggacgc caagcccggc cagttcccct ggcaggtggt 2040

gctgaacggc aaagtggatg ccttctgcgg cggcagcatc gtgaacgaga agtggatcgt 2100

gacagccgcc cactgcgtgg agaccggcgt gaagatcacc gtggtggccg gcgaacacaa 2160

tatcgaggag accgagcaca ccgagcagaa gcggaacgtc atccggatta tcccccacca 2220

caactacaac gccgccatca acaagtacaa ccacgacatc gccctgctgg agctggacga 2280

gcctctggtg ctgaatagct acgtgacccc catctgcatc gccgacaagg agtacaccaa 2340

catcttcctg aagttcggca gcggctacgt gtccggctgg ggcagagtgt tccacaaggg 2400

cagaagcgcc ctggtgctgc agtacctgag agtgcccctg gtggacagag ccacctgcct 2460

gttgagcacc aagttcacca tctacaacaa catgttctgc gccggcttcc acgagggcgg 2520

cagagacagc tgccagggcg acagcggcgg accccacgtg accgaagtgg agggcaccag 2580

cttcctgacc ggcatcatca gctggggcga ggagtgcgcc atgaagggca agtacggcat 2640

ctacaccaaa gtgagccggt acgtgaactg gatcaaggag aaaaccaagc tgacctgaga 2700

gcatcttacc gccatttatt cccatatttg ttctgttttt cttgatttgg gtatacattt 2760

aaatgttaat aaaacaaaat ggtggggcaa tcatttacat ttttagggat atgtaattac 2820

tagttcaggt gtattgccac aagacaaaca tgttaagaaa ctttcccgtt atttacgctc 2880

tgttcctgtt aatcaacctc tggattacaa aatttgtgaa agattgactg atattcttaa 2940

ctatgttgct ccttttacgc tgtgtggata tgctgcttta tagcctctgt atctagctat 3000

tgcttcccgt acggctttcg ttttctcctc cttgtataaa tcctggttgc tgtctctttt 3060

agaggagttg tggcccgttg tccgtcaacg tggcgtggtg tgctctgtgt ttgctgacgc 3120

aacccccact ggctggggca ttgccaccac ctgtcaactc ctttctggga ctttcgcttt 3180

ccccctcccg atcgccacgg cagaactcat cgccgcctgc cttgcccgct gctggacagg 3240

ggctaggttg ctgggcactg ataattccgt ggtgttgtct gtgccttcta gttgccagcc 3300

atctgttgtt tgcccctccc ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt 3360

cctttcctaa taaaatgagg aaattgcatc gcattgtctg agtaggtgtc attctattct 3420

ggggggtggg gtggggcagg acagcaaggg ggaggattgg gaagacaata gcaggcatgc 3480

tggggatgcg gtgggctcta tggcaggaac ccctagtgat ggagttggcc actccctctc 3540

tgcgcgctcg ctcgctcact gaggccgccc gggaaacccg ggcgtgcgcc tcagtgagcg 3600

agcgagcgcg cagctgcctg cagg 3624

<210> 61

<211> 4257

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 61

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60

gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca 120

actccatcac taggggttcc ttgtagttaa tgattaaccc gccatgctac ttatctacgt 180

agccatgctc tagagcggcc gcacgcgtag atcttcaata ttggccatta gccatattat 240

tcattggtta tatagcataa atcaatattg gctattggcc attgcatacg ttgtatctat 300

atcataatat gtacatttat attggctcat gtccaatatg accgccatgt tggcattgat 360

tattgactag ttattaatag taatcaatta cggggtcatt agttcatagc ccatatatgg 420

agttccgcgt tacataactt acggtaaatg gcccgcctgg ctgaccgccc aacgaccccc 480

gcccattgac gtcaataatg acgtatgttc ccatagtaac gccaataggg actttccatt 540

gacgtcaatg ggtggagtat ttacggtaaa ctgcccactt ggcagtacat caagtgtatc 600

atatgccaag tccgccccct attgacgtca atgacggtaa atggcccgcc tggcattatg 660

cccagtacat gaccttacgg gactttccta cttggcagta catctacgta ttagtcatcg 720

ctattaccat ggtcgaggtg agccccacgt tctgcttcac tctccccatc tcccccccct 780

ccccaccccc aattttgtat ttatttattt tttaattatt ttgtgcagcg atgggggcgg 840

gggggggggg ggggcgcgcg ccaggcgggg cggggcgggg cgaggggcgg ggcggggcga 900

ggcggagagg tgcggcggca gccaatcaga gcggcgcgct ccgaaagttt ccttttatgg 960

cgaggcggcg gcggcggcgg ccctataaaa agcgaagcgc gcggcgggcg ggagtcgctg 1020

cgacgctgcc ttcgccccgt gccccgctcc gccgccgcct cgcgccgccc gccccggctc 1080

tgactgaccg cgttactccc acaggtgagc gggcgggacg gcccttctcc tccgggctgt 1140

aattagcgct tggtttaatg acggcttgtt tcttttctgt ggctgcgtga aagccttgag 1200

gggctccggg agggcccttt gtgcgggggg gagcggctcg gggggtgcgt gcgtgtgtgt 1260

gtgcgtgggg agcgccgcgt gcggcccgcg ctgcccggcg gctgtgagcg ctgcgggcgc 1320

ggcgcggggc tttgtgcgct ccgcagtgtg cgcgagggga gcgcggccgg gggcggtgcc 1380

ccgcggtgcg gggggggctg cgaggggaac aaaggctgcg tgcggggtgt gtgcgtgggg 1440

gggtgagcag ggggtgtggg cgcggcggtc gggctgtaac ccccccctgc acccccctcc 1500

ccgagttgct gagcacggcc cggcttcggg tgcggggctc cgtacggggc gtggcgcggg 1560

gctcgccgtg ccgggcgggg ggtggcggca ggtgggggtg ccgggcgggg cggggccgcc 1620

tcgggccggg gagggctcgg gggaggggcg cggcggcccc cggagcgccg gcggctgtcg 1680

aggcgcggcg agccgcagcc attgcctttt atggtaatcg tgcgagaggg cgcagggact 1740

tcctttgtcc caaatctgtg cggagccgaa atctgggagg cgccgccgca ccccctctag 1800

cgggcgcggg gcgaagcggt gcggcgccgg caggaaggaa atgggcgggg agggccttcg 1860

tgcgtcgccg cgccgccgtc cccttctccc tctccagcct cggggctgtc cgcgggggga 1920

cggctgcctt cgggggggac ggggcagggc ggggttcggc ttctggcgtg tgaccggcgg 1980

ctctagagcc tctgctaacc atgttttagc cttcttcttt ttcctacagc tcctgggcaa 2040

cgtgctggtt attgtgctgt ctcatcattt gtcgacagaa ttcctcgaag atccgaaggg 2100

gttcaagctt ggcattccgg tactgttggt aaagccacca tggaagacgc caaaaacata 2160

aagaaaggcc cggcgccatt ctatccgctg gaagatggaa ccgctggaga gcaactgcat 2220

aaggctatga agagatacgc cctggttcct ggaacaattg cttttacaga tgcacatatc 2280

gaggtggaca tcacttacgc tgagtacttc gaaatgtccg ttcggttggc agaagctatg 2340

aaacgatatg ggctgaatac aaatcacaga atcgtcgtat gcagtgaaaa ctctcttcaa 2400

ttctttatgc cggtgttggg cgcgttattt atcggagttg cagttgcgcc cgcgaacgac 2460

atttataatg aacgtgaatt gctcaacagt atgggcattt cgcagcctac cgtggtgttc 2520

gtttccaaaa aggggttgca aaaaattttg aacgtgcaaa aaaagctccc aatcatccaa 2580

aaaattatta tcatggattc taaaacggat taccagggat ttcagtcgat gtacacgttc 2640

gtcacatctc atctacctcc cggttttaat gaatacgatt ttgtgccaga gtccttcgat 2700

agggacaaga caattgcact gatcatgaac tcctctggat ctactggtct gcctaaaggt 2760

gtcgctctgc ctcatagaac tgcctgcgtg agattctcgc atgccagaga tcctattttt 2820

ggcaatcaaa tcattccgga tactgcgatt ttaagtgttg ttccattcca tcacggtttt 2880

ggaatgttta ctacactcgg atatttgata tgtggatttc gagtcgtctt aatgtataga 2940

tttgaagaag agctgtttct gaggagcctt caggattaca agattcaaag tgcgctgctg 3000

gtgccaaccc tattctcctt cttcgccaaa agcactctga ttgacaaata cgatttatct 3060

aatttacacg aaattgcttc tggtggcgct cccctctcta aggaagtcgg ggaagcggtt 3120

gccaagaggt tccatctgcc aggtatcagg caaggatatg ggctcactga gactacatca 3180

gctattctga ttacacccga gggggatgat aaaccgggcg cggtcggtaa agttgttcca 3240

ttttttgaag cgaaggttgt ggatctggat accgggaaaa cgctgggcgt taatcaaaga 3300

ggcgaactgt gtgtgagagg tcctatgatt atgtccggtt atgtaaacaa tccggaagcg 3360

accaacgcct tgattgacaa ggatggatgg ctacattctg gagacatagc ttactgggac 3420

gaagacgaac acttcttcat cgttgaccgc ctgaagtctc tgattaagta caaaggctat 3480

caggtggctc ccgctgaatt ggaatccatc ttgctccaac accccaacat cttcgacgca 3540

ggtgtcgcag gtcttcccga cgatgacgcc ggtgaacttc ccgccgccgt tgttgttttg 3600

gagcacggaa agacgatgac ggaaaaagag atcgtggatt acgtcgccag tcaagtaaca 3660

accgcgaaaa agttgcgcgg aggagttgtg tttgtggacg aagtaccgaa aggtcttacc 3720

ggaaaactcg acgcaagaaa aatcagagag atcctcataa aggccaagaa gggcggaaag 3780

atcgccgtgt aattctagag tcggggcggc cggccgcttc gagcagacat gataagatac 3840

attgatgagt ttggacaaac cacaactaga atgcagtgaa aaaaatgctt tatttgtgaa 3900

atttgtgatg ctattgcttt atttgtaacc attataagct gcaataaaca agttaacaac 3960

aacaattgca ttcattttat gtttcaggtt cagggggagg tgtgggaggt tttttaaagc 4020

aagtaaaacc tctacaaatg tggtaaaatc gataagtgcg gaccgagcgg ccgctctaga 4080

gcatggctac gtagataagt agcatggcgg gttaatcatt aactacacct gcaggcagct 4140

gcgcgctcgc tcgctcactg aggccgcccg ggcgtcgggc gacctttggt cgcccggcct 4200

cagtgagcga gcgagcgcgc agagagggag tggccaactc catcactagg ggttcct 4257

<210> 62

<211> 2510

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 62

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60

gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca 120

actccatcac taggggttcc ttgtagttaa tgattaaccc gccatgctac ttatctacgt 180

agccatgctc tagagcggcc gcgctagccc ctaaaatggg caaacattgc aagcagcaaa 240

cagcaaacac acagccctcc ctgcctgctg accttggagc tggggcagag gtcagagacc 300

tctctgggcc catgccacct ccaacatcca ctcgacccct tggaatttcg gtggagagga 360

gcagaggttg tcctggcgtg gtttaggtag tgtgagaggg gaatgactcc tttcggtaag 420

tgcagtggaa gctgtacact gcccaggcaa agcgtccggg cagcgtaggc gggcgactca 480

gatcccagcc agtggactta gcccctgttt gctcctccga taactggggt gaccttggtt 540

aatattcacc agcagcctcc cccgttgccc ctctggatcc actgcttaaa tacggacgag 600

gacactcgag ggccctgtct cctcagcttc aggcaccacc actgacctgg gacagtgaat 660

ccggacatcg attctaaggt aaatataaaa tttttaagtg tataatttgt taaactactg 720

attctaattg tttctctctt ttagattcca acctttggaa ctgaattcta gaccaccatg 780

cagagggtga acatgatcat ggctgagagc cctggcctga tcaccatctg cctgctgggc 840

tacctgctgt ctgctgagtg cactgtgttc ctggaccatg agaatgccaa caagatcctg 900

aacaggccca agagatacaa ctctggcaag ctggagggagt ttgtgcaggg caacctggag 960

agggagtgca tggaggagaa gtgcagcttt gaggaggcca gggaggtgtt tgagaacact 1020

gagaggacca ctgagttctg gaagcagtat gtggatgggg accagtgtga gagcaacccc 1080

tgcctgaatg ggggcagctg caaggatgac atcaacagct atgagtgctg gtgccccttt 1140

ggctttgagg gcaagaactg tgagctggat gtgacctgca acatcaagaa tggcagatgt 1200

gagcagttct gcaagaactc tgctgacaac aaggtggtgt gcagctgcac tgaggctac 1260

aggctggctg agaaccagaa gagctgtgag cctgctgtgc cattcccatg tggcagagtg 1320

tctgtgagcc agaccagcaa gctgaccagg gctgaggctg tgttccctga tgtggactat 1380

gtgaacagca ctgaggctga aaccatcctg gacaacatca cccagagcac cccagcttc 1440

aatgacttca cccaggtggt ggggggggag gatgccaagc ctggccagtt cccctggcaa 1500

gtggtgctga atggcaaggt ggatgccttc tgtggggggca gcattgtgaa tgagaagtgg 1560

attgtgactg ctgcccactg tgtggagact ggggtgaaga tcactgtggt ggctggggag 1620

cacaacattg aggagactga gcacactgag cagaagagga atgtgatcag gatcatcccc 1680

caccacaact acaatgctgc catcaacaag tacaaccatg acattgccct gctggagctg 1740

gatgagcccc tggtgctgaa cagctatgtg acccccatct gcattgctga caaggagtac 1800

accaacatct tcctgaagtt tggctctggc tatgtgtctg gctggggcag ggtgttccac 1860

aagggcaggt ctgccctggt gctgcagtac ctgagggtgc ccctggtgga cagggccacc 1920

tgcctgagga gcaccaagtt caccatctac aacaacatgt tctgtgctgg cttccatgag 1980

gggggcaggg acagctgcca gggggactct gggggccccc atgtgactga ggtggagggc 2040

accagcttcc tgactggcat catcagctgg ggggaggagt gtgccatgaa gggcaagtat 2100

ggcatctaca ccaaagtctc cagatatgtg aactggatca aggagaagac caagctgacc 2160

taatgactcc atggttcgaa tgctttattt gtgaaatttg tgatgctatt gctttatttg 2220

taaccattat aagctgcaat aaacaagtta acaacaacaa ttgcattcat tttatgtttc 2280

aggttcaggg ggaggtgtgg gaggtttttt aaaactagtg cggccgctct agagcatggc 2340

tacgtagata agtagcatgg cgggttaatc attaactaca aggaacccct agtgatggag 2400

ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 2460

cgacgcccgg gcggcctcag tgagcgagcg agcgcgcagc tgcctgcagg 2510

<210> 63

<211> 126

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 63

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggaaacc cgggcgtgcc 60

cgggcgcctc agtgagcgag cgagcgcgca gagagggagt ggccaactcc atcactaggg 120

gttcct 126

<210> 64

<211> 120

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 64

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgcccggga aacccgggcg tgcgcctcag tgagcgagcg agcgcgcagc tgcctgcagg 120

<210> 65

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 65

gcgcgctcgc tcgctcactg aggccgcccg ggcgtcgggc gacctttggt cgcccggcct 60

cagtgagcga gcgagcgcgc 80

<210> 66

<211> 141

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 66

aataaacgat aacgccgttg gtggcgtgag gcatgtaaaa ggttacatca ttatcttgtt 60

cgccatccgg ttggtataaa tagacgttca tgttggtttt tgtttcagtt gcaagttggc 120

tgcggcgcgc gcagcacctt t 141

<210> 67

<211> 1876

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 67

cgcagccacc atggcggggt tttacgagat tgtgattaag gtccccagcg accttgacga 60

gcatctgccc ggcatttctg acagctttgt gaactgggtg gccgagaagg aatgggagtt 120

gccgccagat tctgacatgg atctgaatct gattgagcag gcacccctga ccgtggccga 180

gaagctgcag cgcgactttc tgacggaatg gcgccgtgtg agtaaggccc cggaggccct 240

tttctttgtg caatttgaga agggagagag ctacttccac atgcacgtgc tcgtggaaac 300

caccggggtg aaatccatgg ttttgggacg tttcctgagt cagattcgcg aaaaactgat 360

tcagagaatt taccgcggga tcgagccgac tttgccaaac tggttcgcgg tcacaaagac 420

cagaaatggc gccggaggcg ggaacaaggt ggtggatgag tgctacatcc ccaattactt 480

gctccccaaa acccagcctg agctccagtg ggcgtggact aatatggaac agtatttaag 540

cgcctgtttg aatctcacgg agcgtaaacg gttggtggcg cagcatctga cgcacgtgtc 600

gcagacgcag gagcagaaca aagagaatca gaatcccaat tctgatgcgc cggtgatcag 660

atcaaaaact tcagccaggt acatggagct ggtcgggtgg ctcgtggaca aggggattac 720

ctcggagaag cagtggatcc aggaggacca ggcctcatac atctccttca atgcggcctc 780

caactcgcgg tcccaaatca aggctgcctt ggacaatgcg ggaaagatta tgagcctgac 840

taaaaccgcc cccgactacc tggtgggcca gcagcccgtg gaggacatt ccagcaatcg 900

gatttataaa attttggaac taaacgggta cgatccccaa tatgcggctt ccgtctttct 960

gggatgggcc acgaaaaagt tcggcaagag gaacaccatc tggctgtttg ggcctgcaac 1020

taccgggaag accaacatcg cggaggccat agcccacact gtgcccttct acgggtgcgt 1080

aaactggacc aatgagaact ttcccttcaa cgactgtgtc gacaagatgg tgatctggtg 1140

ggaggagggg aagatgaccg ccaaggtcgt ggagtcggcc aaagccattc tcggaggaag 1200

caaggtgcgc gtggaccaga aatgcaagtc ctcggcccag atagacccga ctcccgtgat 1260

cgtcacctcc aacaccaaca tgtgcgccgt gattgacggg aactcaacga ccttcgaaca 1320

ccagcagccg ttgcaagacc ggatgttcaa atttgaactc acccgccgtc tggatcatga 1380

ctttgggaag gtcaccaagc aggaagtcaa agactttttc cggtgggcaa aggatcacgt 1440

ggttgaggtg gagcatgaat tctacgtcaa aaagggtgga gccaagaaaa gacccgcccc 1500

cagtgacgca gatataagtg agcccaaacg ggtgcgcgag tcagttgcgc agccatcgac 1560

gtcagacgcg gaagcttcga tcaactacgc agacaggtac caaaacaaat gttctcgtca 1620

cgtgggcatg aatctgatgc tgtttccctg cagacaatgc gagagaatga atcagaattc 1680

aaatatctgc ttcactcacg gacagaaaga ctgtttagag tgctttcccg tgtcagaatc 1740

tcaacccgtt tctgtcgtca aaaaggcgta tcagaaactg tgctacattc atcatatcat 1800

gggaaaggtg cgacgctt gcactgcctg cgatctggtc aatgtggatt tggatgactg 1860

catctttgaa caataa 1876

<210> 68

<211> 129

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 68

atcatggaga taattaaaat gataaccatc tcgcaaataa ataagtattt tactgttttc 60

gtaacagttt tgtaataaaa aaacctataa atattccgga ttattcatac cgtcccacca 120

tcgggcgcg 129

<210> 69

<211> 1203

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 69

gccgccacca tggagttggt gggctggctc gtggacaaag gcattacttc ggaaaagcag 60

tggattcagg aggatcaggc atcttacatc tcattcaacg ctgccagtaa ctcgaggtcc 120

cagatcaagg cagcgctgga caacgcggga aagattatga gtctgaccaa aactgctcca 180

gactacctcg ttggtcagca accggtggaa gatatctcca gcaacaggat ctacaagatt 240

ctggagctca acggctacga ccctcaatac gctgcctcag tgttcttggg ttgggccacc 300

aagaaattcg gcaagagaaa cactatctgg ctgttcggcc ccgctaccac tggaaagaca 360

aacatcgcag aagcgattgc tcacacggtg ccattctacg gctgcgtcaa ctggacaaac 420

gagaacttcc cgttcaacga ctgtgtcgat aagatggtta tctggtggga ggaaggaaag 480

atgacggcca aagtggtcga aagcgccaag gcaattctgg gtggctctaa agtgcgcgtc 540

gaccagaagt gcaaatcttc agctcaaatc gatcctaccc ccgttattgt gacatcaaac 600

acgaacatgt gtgccgtgat cgacggaaac agtacaacgt tcgaacacca gcaacctctc 660

caggatcgta tgttcaagtt cgagctcacc cgccgtttgg accatgattt cggcaaggtc 720

actaaacaag aggttaagga cttcttccgc tgggctaaag atcacgttgt ggaggttgaa 780

catgagttct acgtcaagaa aggaggtgct aagaaacgtc cagccccgtc ggacgcagat 840

atctccgaac ctaagagggt gagagagtcg gtcgcacagc caagcacttc tgacgcagaa 900

gcttccatta actacgcaga taggtaccaa aacaagtgca gcagacacgt gggtatgaac 960

ttgatgctgt tcccatgccg ccagtgtgag cgtatgaacc aaaactctaa catctgtttc 1020

acacatggcc agaaggactg cctcgaatgt ttccctgtgt cagagagtca gcccgtctca 1080

gtcgttaaga aagcttacca aaagttgtgc tacatccacc atattatggg taaagtccct 1140

gatgcctgta ccgcttgtga tctggtcaac gtggatttgg acgactgtat tttcgagcaa 1200

taa 1203

<210> 70

<211> 388

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 70

gaacagagaa acaggagaat atgggccaaa caggatatct gtggtaagca gttcctgccc 60

cggctcaggg ccaagaacag ttggaacagc agaatatggg ccaaacagga tatctgtggt 120

aagcagttcc tgccccggct cagggccaag aacagatggt ccccagatgc ggtcccgccc 180

tcagcagttt ctagagaacc atcagatgtt tccagggtgc cccaaggacc tgaaatgacc 240

ctgtgcctta tttgaactaa ccaatcagtt cgcttctcgc ttctgttcgc gcgcttctgc 300

tccccgagct ctatataagc agagctcgtt tagtgaaccg tcagatcgcc tggagacgcc 360

atccacgctg ttttgacttc catagaag 388

<210> 71

<211> 1662

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 71

gccgccacca tggaagacgc caaaaacata aagaaaggcc cggcgccatt ctatccgctg 60

gaagatggaa ccgctggaga gcaactgcat aaggctatga agagatacgc cctggttcct 120

ggaacaattg cttttacaga tgcacatatc gaggtggaca tcacttacgc tgagtacttc 180

gaaatgtccg ttcggttggc agaagctatg aaacgatatg ggctgaatac aaatcacaga 240

atcgtcgtat gcagtgaaaa ctctcttcaa ttctttatgc cggtgttggg cgcgttattt 300

atcggagttg cagttgcgcc cgcgaacgac atttataatg aacgtgaatt gctcaacagt 360

atgggcattt cgcagcctac cgtggtgttc gtttccaaaa aggggttgca aaaaattttg 420

aacgtgcaaa aaaagctccc aatcatccaa aaaattatta tcatggattc taaaacggat 480

taccagggat ttcagtcgat gtacacgttc gtcacatctc atctacctcc cggttttaat 540

gaatacgatt ttgtgccaga gtccttcgat agggacaaga caattgcact gatcatgaac 600

tcctctggat ctactggtct gcctaaaggt gtcgctctgc ctcatagaac tgcctgcgtg 660

agattctcgc atgccagaga tcctattttt ggcaatcaaa tcattccgga tactgcgatt 720

ttaagtgttg ttccattcca tcacggtttt ggaatgttta ctacactcgg atatttgata 780

tgtggatttc gagtcgtctt aatgtataga tttgaagaag agctgtttct gaggagcctt 840

caggattaca agattcaaag tgcgctgctg gtgccaaccc tattctcctt cttcgccaaa 900

agcactctga ttgacaaata cgatttatct aatttacacg aaattgcttc tggtggcgct 960

cccctctcta aggaagtcgg ggaagcggtt gccaagaggt tccatctgcc aggtatcagg 1020

caaggatatg ggctcactga gactacatca gctattctga ttacacccga gggggatgat 1080

aaaccgggcg cggtcggtaa agttgttcca ttttttgaag cgaaggttgt ggatctggat 1140

accgggaaaa cgctgggcgt taatcaaaga ggcgaactgt gtgtgagagg tcctatgatt 1200

atgtccggtt atgtaaacaa tccggaagcg accaacgcct tgattgacaa ggatggatgg 1260

ctacattctg gagacatagc ttactgggac gaagacgaac acttcttcat cgttgaccgc 1320

ctgaagtctc tgattaagta caaaggctat caggtggctc ccgctgaatt ggaatccatc 1380

ttgctccaac accccaacat cttcgacgca ggtgtcgcag gtcttcccga cgatgacgcc 1440

ggtgaacttc ccgccgccgt tgttgttttg gagcacggaa agacgatgac ggaaaaagag 1500

atcgtggatt acgtcgccag tcaagtaaca accgcgaaaa agttgcgcgg aggagttgtg 1560

tttgtggacg aagtaccgaa aggtcttacc ggaaaactcg acgcaagaaa aatcagagag 1620

atcctcataa aggccaagaa gggcggaaag atcgccgtgt aa 1662

<210> 72

<211> 581

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 72

gagcatctta ccgccattta ttcccatatt tgttctgttt ttcttgattt gggtatacat 60

ttaaatgtta ataaaacaaa atggtggggc aatcatttac atttttaggg atatgtaatt 120

actagttcag gtgtattgcc acaagacaaa catgttaaga aactttcccg ttatttacgc 180

tctgttcctg ttaatcaacc tctggattac aaaatttgtg aaagattgac tgatattctt 240

aactatgttg ctccttttac gctgtgtgga tatgctgctt tatagcctct gtatctagct 300

attgcttccc gtacggcttt cgttttctcc tccttgtata aatcctggtt gctgtctctt 360

ttagaggagt tgtggcccgt tgtccgtcaa cgtggcgtgg tgtgctctgt gtttgctgac 420

gcaaccccca ctggctgggg cattgccacc acctgtcaac tcctttctgg gactttcgct 480

ttccccctcc cgatcgccac ggcagaactc atcgccgcct gccttgcccg ctgctggaca 540

ggggctaggt tgctgggcac tgataattcc gtggtgttgt c 581

<210> 73

<211> 225

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 73

tgtgccttct agttgccagc catctgttgt ttgcccctcc cccgtgcctt ccttgaccct 60

ggaaggtgcc actcccactg tcctttccta ataaaatgag gaaattgcat cgcattgtct 120

gagtaggtgt cattctattc tggggggtgg ggtggggcag gacagcaagg gggaggattg 180

ggaagacaat agcaggcatg ctggggatgc ggtgggctct atggc 225

<210> 74

<211> 1177

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 74

ggctcagagg ctcagaggca cacaggagtt tctgggctca ccctgccccc ttccaacccc 60

tcagttccca tcctccagca gctgtttgtg tgctgcctct gaagtccaca ctgaacaaac 120

ttcagcctac tcatgtccct aaaatgggca aacattgcaa gcagcaaaca gcaaacacac 180

agccctccct gcctgctgac cttggagctg gggcagaggt cagagacctc tctgggccca 240

tgccacctcc aacatccact cgaccccttg gaatttcggt ggagaggagc agaggttgtc 300

ctggcgtggt ttaggtagtg tgagagggtc cgggttcaaa accacttgct gggtggggag 360

tcgtcagtaa gtggctatgc cccgaccccg aagcctgttt ccccatctgt acaatggaaa 420

tgataaagac gcccatctga tagggttttt gtggcaaata aacatttggt ttttttgttt 480

tgttttgttt tgttttttga gatggaggtt tgctctgtcg cccaggctgg agtgcagtga 540

cacaatctca tctcaccaca accttcccct gcctcagcct cccaagtagc tgggattaca 600

agcatgtgcc accacacctg gctaattttc tatttttagt agagacgggt ttctccatgt 660

tggtcagcct cagcctccca agtaactggg attacaggcc tgtgccacca cacccggcta 720

attttttcta tttttgacag ggacggggtt tcaccatgtt ggtcaggctg gtctagaggt 780

accggatctt gctaccagtg gaacagccac taaggattct gcagtgagag cagaggcca 840

gctaagtggt actctcccag agactgtctg actcacgcca ccccctccac cttggacaca 900

ggacgctgtg gtttctgagc caggtacaat gactcctttc ggtaagtgca gtggaagctg 960

tacactgccc aggcaaagcg tccgggcagc gtaggcgggc gactcagatc ccagccagtg 1020

gacttagccc ctgtttgctc ctccgataac tggggtgacc ttggttaata ttcaccagca 1080

gcctcccccg ttgcccctct ggatccactg cttaaatacg gacgaggaca gggccctgtc 1140

tcctcagctt caggcaccac cactgacctg ggacagt 1177

<210> 75

<400> 75

000

<210> 76

<400> 76

000

<210> 77

<400> 77

000

<210> 78

<400> 78

000

<210> 79

<400> 79

000

<210> 80

<400> 80

000

<210> 81

<400> 81

000

<210> 82

<400> 82

000

<210> 83

<400> 83

000

<210> 84

<400> 84

000

<210> 85

<400> 85

000

<210> 86

<400> 86

000

<210> 87

<400> 87

000

<210> 88

<400> 88

000

<210> 89

<400> 89

000

<210> 90

<400> 90

000

<210> 91

<400> 91

000

<210> 92

<400> 92

000

<210> 93

<400> 93

000

<210> 94

<400> 94

000

<210> 95

<400> 95

000

<210> 96

<400> 96

000

<210> 97

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 97

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 98

<211> 72

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 98

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacggc ctcagtgagc 60

aagcgagcgc gc 72

<210> 99

<211> 122

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 99

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgggcgacc aaaggtcgcc cgacggcctc agtgagcgag cgagcgcgca gctgcctgca 120

gg 122

<210> 100

<211> 130

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 100

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgggcgacc aaaggtcgcc cgacgcccgg gcggcctcag tgagcgagcg agcgcgcagc 120

tgcctgcagg 130

<210> 101

<211> 70

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 101

gcgcgctcgc tcgctcactg aggccgcccg ggaaacccgg gcgtgcgcct cagtgagcga 60

gcgagcgcgc 70

<210> 102

<211> 70

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 102

gcgcgctcgc tcgctcactg aggcgcacgc ccgggtttcc cgggcggcct cagtgagcga 60

gcgagcgcgc 70

<210> 103

<211> 72

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 103

gcgcgctcgc tcgctcactg aggccgtcgg gcgacctttg gtcgcccggc ctcagtgagc 60

gagcgagcgc gc 72

<210> 104

<211> 72

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 104

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacggc ctcagtgagc 60

gagcgagcgc gc 72

<210> 105

<211> 72

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 105

gcgcgctcgc tcgctcactg aggccgcccg ggcaaagccc gggcgtcggc ctcagtgagc 60

gagcgagcgc gc 72

<210> 106

<211> 72

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 106

gcgcgctcgc tcgctcactg aggccgacgc ccgggctttg cccgggcggc ctcagtgagc 60

gagcgagcgc gc 72

<210> 107

<211> 83

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 107

gcgcgctcgc tcgctcactg aggccgcccg ggcaaagccc gggcgtcggg ctttgcccgg 60

cctcagtgag cgagcgagcg cgc 83

<210> 108

<211> 83

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 108

gcgcgctcgc tcgctcactg aggccgggca aagcccgacg cccgggcttt gcccgggcgg 60

cctcagtgag cgagcgagcg cgc 83

<210> 109

<211> 77

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 109

gcgcgctcgc tcgctcactg aggccgaaac gtcgggcgac ctttggtcgc ccggcctcag 60

tgagcgagcg agcgcgc 77

<210> 110

<211> 77

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 110

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacgtt tcggcctcag 60

tgagcgagcg agcgcgc 77

<210> 111

<211> 51

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 111

gcgcgctcgc tcgctcactg aggcaaagcc tcagtgagcg agcgagcgcg c 51

<210> 112

<211> 51

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 112

gcgcgctcgc tcgctcactg aggctttgcc tcagtgagcg agcgagcgcg c 51

<210> 113

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 113

gcgcgctcgc tcgctcactg aggccgcccg ggcgtcgggc gacctttggt cgcccggcct 60

cagtgagcga gcgagcgcgc 80

<210> 114

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 114

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 115

<211> 79

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 115

gcgcgctcgc tcgctcactg aggcgcccgg gcgtcgggcg acctttggtc gcccggcctc 60

agtgagcgag cgagcgcgc 79

<210> 116

<211> 79

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 116

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacgcc cgggcgcctc 60

agtgagcgag cgagcgcgc 79

<210> 117

<211> 89

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 117

gcgcgctcgc tcgctcactg aggccgcccg ggcaaagccc gggcgtcggg cgactttgtc 60

gcccggcctc agtgagcgag cgagcgcgc 89

<210> 118

<211> 89

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 118

gcgcgctcgc tcgctcactg aggccgggcg acaaagtcgc ccgacgcccg ggctttgccc 60

gggcggcctc agtgagcgag cgagcgcgc 89

<210> 119

<211> 87

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 119

gcgcgctcgc tcgctcactg aggccgcccg ggcaaagccc gggcgtcggg cgattttcgc 60

ccggcctcag tgagcgagcg agcgcgc 87

<210> 120

<211> 87

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 120

gcgcgctcgc tcgctcactg aggccgggcg aaaatcgccc gacgcccggg ctttgcccgg 60

gcggcctcag tgagcgagcg agcgcgc 87

<210> 121

<211> 85

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 121

gcgcgctcgc tcgctcactg aggccgcccg ggcaaagccc gggcgtcggg cgtttcgccc 60

ggcctcagtg agcgagcgag cgcgc 85

<210> 122

<211> 85

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 122

gcgcgctcgc tcgctcactg aggccgggcg aaacgcccga cgcccgggct ttgcccgggc 60

ggcctcagtg agcgagcgag cgcgc 85

<210> 123

<211> 89

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 123

gcgcgctcgc tcgctcactg aggccgcccg ggaaacccgg gcgtcgggcg acctttggtc 60

gcccggcctc agtgagcgag cgagcgcgc 89

<210> 124

<211> 89

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 124

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacgcc cgggtttccc 60

gggcggcctc agtgagcgag cgagcgcgc 89

<210> 125

<211> 87

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 125

gcgcgctcgc tcgctcactg aggccgcccg gaaaccgggc gtcgggcgac ctttggtcgc 60

ccggcctcag tgagcgagcg agcgcgc 87

<210> 126

<211> 87

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 126

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacgcc cggtttccgg 60

gcggcctcag tgagcgagcg agcgcgc 87

<210> 127

<211> 85

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 127

gcgcgctcgc tcgctcactg aggccgcccg aaacgggcgt cgggcgacct ttggtcgccc 60

ggcctcagtg agcgagcgag cgcgc 85

<210> 128

<211> 85

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 128

gcgcgctcgc tcgctcactg aggccggggcg accaaaggtc gcccgacgcc cgtttcgggc 60

ggcctcagtg agcgagcgag cgcgc 85

<210> 129

<211> 83

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 129

gcgcgctcgc tcgctcactg aggccgccca aagggcgtcg ggcgaccttt ggtcgcccgg 60

cctcagtgag cgagcgagcg cgc 83

<210> 130

<211> 83

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 130

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacgcc ctttgggcgg 60

cctcagtgag cgagcgagcg cgc 83

<210> 131

<211> 81

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 131

gcgcgctcgc tcgctcactg aggccgccaa aggcgtcggg cgacctttgg tcgcccggcc 60

tcagtgagcg agcgagcgcg c 81

<210> 132

<211> 81

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 132

gcgcgctcgc tcgctcactg aggccggggcg accaaaggtc gcccgacgcc tttggcggcc 60

tcagtgagcg agcgagcgcg c 81

<210> 133

<211> 79

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 133

gcgcgctcgc tcgctcactg aggccgcaaa gcgtcgggcg acctttggtc gcccggcctc 60

agtgagcgag cgagcgcgc 79

<210> 134

<211> 79

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 134

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacgct ttgcggcctc 60

agtgagcgag cgagcgcgc 79

<210> 135

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 135

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgaagcc cgggctgcct 60

cagtgagcga gcgagcgcgc 80

<210> 136

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 136

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacacc cgggtggcct 60

cagtgagcga gcgagcgcgc 80

<210> 137

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 137

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacgac cggtcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 138

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 138

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacgca cgtgcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 139

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 139

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacgcc atggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 140

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 140

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgaagac cggtctgcct 60

cagtgagcga gcgagcgcgc 80

<210> 141

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 141

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacaca cgtgtggcct 60

cagtgagcga gcgagcgcgc 80

<210> 142

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 142

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacgac atgtcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 143

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 143

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgaagca cgtgctgcct 60

cagtgagcga gcgagcgcgc 80

<210> 144

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 144

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgaaacc cgggttgcct 60

cagtgagcga gcgagcgcgc 80

<210> 145

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 145

gcgcgctcgc tcgctcactg aggccggggcg accaaaggtc gcccgaagcc atggctgcct 60

cagtgagcga gcgagcgcgc 80

<210> 146

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 146

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacaac cggttggcct 60

cagtgagcga gcgagcgcgc 80

<210> 147

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 147

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacacc atggtggcct 60

cagtgagcga gcgagcgcgc 80

<210> 148

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 148

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacgaa cgttcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 149

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 149

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacgca attgcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 150

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 150

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgaaaac cggtttgcct 60

cagtgagcga gcgagcgcgc 80

<210> 151

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 151

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgaagaa cgttctgcct 60

cagtgagcga gcgagcgcgc 80

<210> 152

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 152

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgaagca attgctgcct 60

cagtgagcga gcgagcgcgc 80

<210> 153

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 153

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacaaa cgtttggcct 60

cagtgagcga gcgagcgcgc 80

<210> 154

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 154

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacgaa atttcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 155

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 155

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgaagca attgctgcct 60

cagtgagcga gcgagcgcgc 80

<210> 156

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 156

gcgcgctcgc tcgctcactg aggccggggcg accaaaggtc gcccgaaacc atggttgcct 60

cagtgagcga gcgagcgcgc 80

<210> 157

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 157

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacaac atgttggcct 60

cagtgagcga gcgagcgcgc 80

<210> 158

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 158

gcgcgctcgc tcgctcactg aggccggggcg accaaaggtc gcccgaagac atgtctgcct 60

cagtgagcga gcgagcgcgc 80

<210> 159

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 159

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacaca attgtggcct 60

cagtgagcga gcgagcgcgc 80

<210> 160

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 160

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgaaaaa cgttttgcct 60

cagtgagcga gcgagcgcgc 80

<210> 161

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 161

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgaaaac atgtttgcct 60

cagtgagcga gcgagcgcgc 80

<210> 162

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 162

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgaaaca attgttgcct 60

cagtgagcga gcgagcgcgc 80

<210> 163

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 163

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgaagaa atttctgcct 60

cagtgagcga gcgagcgcgc 80

<210> 164

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 164

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacaaa attttggcct 60

cagtgagcga gcgagcgcgc 80

<210> 165

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 165

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgaaaaa atttttgcct 60

cagtgagcga gcgagcgcgc 80

<210> 166

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 166

gcgcgctcgc tcgctcgctg aggccgggcg accaaaggtc gcccgacgcc cgggcggcct 60

cagcgagcga gcgagcgcgc 80

<210> 167

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 167

gcgcgctcgc tcgctcaatg aggccgggcg accaaaggtc gcccgacgcc cgggcggcct 60

cattgagcga gcgagcgcgc 80

<210> 168

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 168

gcgcgctcgc tcgctcaccg aggccgggcg accaaaggtc gcccgacgcc cgggcggcct 60

cggtgagcga gcgagcgcgc 80

<210> 169

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 169

gcgcgctcgc tcgctcacta aggccgggcg accaaaggtc gcccgacgcc cgggcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 170

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 170

gcgcgctcgc tcgctcactg gggccgggcg accaaaggtc gcccgacgcc cgggcggccc 60

cagtgagcga gcgagcgcgc 80

<210> 171

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 171

gcgcgctcgc tcgctcactg aagccgggcg accaaaggtc gcccgacgcc cgggcggctt 60

cagtgagcga gcgagcgcgc 80

<210> 172

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 172

gcgcgctcgc tcgctcactg agaccgggcg accaaaggtc gcccgacgcc cgggcggtct 60

cagtgagcga gcgagcgcgc 80

<210> 173

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 173

gcgcgctcgc tcgctcgatg aggccgggcg accaaaggtc gcccgacgcc cgggcggcct 60

catcgagcga gcgagcgcgc 80

<210> 174

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 174

gcgcgctcgc tcgctcgcgg aggccgggcg accaaaggtc gcccgacgcc cgggcggcct 60

ccgcgagcga gcgagcgcgc 80

<210> 175

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 175

gcgcgctcgc tcgctcgcta aggccgggcg accaaaggtc gcccgacgcc cgggcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 176

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 176

gcgcgctcgc tcgctcgctg gggccgggcg accaaaggtc gcccgacgcc cgggcggccc 60

cagcgagcga gcgagcgcgc 80

<210> 177

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 177

gcgcgctcgc tcgctcgctg aagccgggcg accaaaggtc gcccgacgcc cgggcggctt 60

cagcgagcga gcgagcgcgc 80

<210> 178

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 178

gcgcgctcgc tcgctcgctg agaccgggcg accaaaggtc gcccgacgcc cgggcggtct 60

cagcgagcga gcgagcgcgc 80

<210> 179

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 179

gcgcgctcgc tcgctcgagg aggccgggcg accaaaggtc gcccgacgcc cgggcggcct 60

cctcgagcga gcgagcgcgc 80

<210> 180

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 180

gcgcgctcgc tcgctcgata aggccgggcg accaaaggtc gcccgacgcc cgggcggcct 60

tatcgagcga gcgagcgcgc 80

<210> 181

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 181

gcgcgctcgc tcgctcgatg gggccgggcg accaaaggtc gcccgacgcc cgggcggcct 60

catcgagcga gcgagcgcgc 80

<210> 182

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 182

gcgcgctcgc tcgctcgatg aagccgggcg accaaaggtc gcccgacgcc cgggcggctt 60

catcgagcga gcgagcgcgc 80

<210> 183

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 183

gcgcgctcgc tcgctcgatg agaccgggcg accaaaggtc gcccgacgcc cgggcggtct 60

catcgagcga gcgagcgcgc 80

<210> 184

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 184

gcgcgctcgc tcgctcgaga aggccgggcg accaaaggtc gcccgacgcc cgggcggcct 60

tctcgagcga gcgagcgcgc 80

<210> 185

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 185

gcgcgctcgc tcgctcgagg gggccggggcg accaaaggtc gcccgacgcc cgggcggccc 60

cctcgagcga gcgagcgcgc 80

<210> 186

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 186

gcgcgctcgc tcgctcgagg aagccgggcg accaaaggtc gcccgacgcc cgggcggctt 60

cctcgagcga gcgagcgcgc 80

<210> 187

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 187

gcgcgctcgc tcgctcgagg gggccggggcg accaaaggtc gcccgacgcc cgggcggccc 60

cctcgagcga gcgagcgcgc 80

<210> 188

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 188

gcgcgctcgc tcgctcgagg aagccgggcg accaaaggtc gcccgacgcc cgggcggctt 60

cctcgagcga gcgagcgcgc 80

<210> 189

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 189

gcgcgctcgc tcgctcgagg agaccgggcg accaaaggtc gcccgacgcc cgggcggtct 60

cctcgagcga gcgagcgcgc 80

<210> 190

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 190

gcgcgctcgc tcgctcgaga gggccgggcg accaaaggtc gcccgacgcc cgggcggccc 60

tctcgagcga gcgagcgcgc 80

<210> 191

<400> 191

000

<210> 192

<400> 192

000

<210> 193

<400> 193

000

<210> 194

<400> 194

000

<210> 195

<400> 195

000

<210> 196

<400> 196

000

<210> 197

<400> 197

000

<210> 198

<400> 198

000

<210> 199

<400> 199

000

<210> 200

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 200

gcgcgctcgc tcgctcgaga aagccgggcg accaaaggtc gcccgacgcc cgggcggctt 60

tctcgagcga gcgagcgcgc 80

<210> 201

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 201

gcgcgctcgc tcgctcgaga agaccgggcg accaaaggtc gcccgacgcc cgggcggcct 60

tctcgagcga gcgagcgcgc 80

<210> 202

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 202

gcgcgctcgc tcgctcgaga gagccgggcg accaaaggtc gcccgacgcc cgggcggctc 60

tctcgagcga gcgagcgcgc 80

<210> 203

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 203

gcgcgctcgc tcgctcgaga ggaccgggcg accaaaggtc gcccgacgcc cgggcggtcc 60

tctcgagcga gcgagcgcgc 80

<210> 204

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 204

gcgcgctcgc tcgctcgaga gaaccgggcg accaaaggtc gcccgacgcc cgggcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 205

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 205

gcgcgctcgc tcgctcaaga gaaccgggcg accaaaggtc gcccgacgcc cgggcggttc 60

tcttgagcga gcgagcgcgc 80

<210> 206

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 206

gcgcgctcgc tcgctcacga gaaccgggcg accaaaggtc gcccgacgcc cgggcggttc 60

tcgtgagcga gcgagcgcgc 80

<210> 207

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 207

gcgcgctcgc tcgctcacta gaaccgggcg accaaaggtc gcccgacgcc cgggcggttc 60

tagtgagcga gcgagcgcgc 80

<210> 208

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 208

gcgcgctcgc tcgctcactg gaaccgggcg accaaaggtc gcccgacgcc cgggcggttc 60

cagtgagcga gcgagcgcgc 80

<210> 209

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 209

gcgcgctcgc tcgctcactg aaaccgggcg accaaaggtc gcccgacgcc cgggcggttt 60

cagtgagcga gcgagcgcgc 80

<210> 210

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 210

gcgcgctcgc tcgctcgcgg gggccgggcg accaaaggtc gcccgacgcc cgggcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 211

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 211

gcgcgctcgc tcgctcaata aaaccgggcg accaaaggtc gcccgacgcc cgggcggttt 60

tattgagcga gcgagcgcgc 80

<210> 212

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 212

gcgcgctcgc tcgctcactg aggccaggcg accaaaggtc gcctgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 213

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 213

gcgcgctcgc tcgctcactg aggccgagcg accaaaggtc gctcgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 214

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 214

gcgcgctcgc tcgctcactg aggccggacg accaaaggtc gtccgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 215

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 215

gcgcgctcgc tcgctcactg aggccgggag accaaaggtc tcccgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 216

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 216

gcgcgctcgc tcgctcactg aggccgggca accaaaggtt gcccgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 217

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 217

gcgcgctcgc tcgctcactg aggccgggcg gccaaaggcc gcccgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 218

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 218

gcgcgctcgc tcgctcactg aggccgggcg aacaaagttc gcccgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 219

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 219

gcgcgctcgc tcgctcactg aggccgggcg acaaaatgtc gcccgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 220

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 220

gcgcgctcgc tcgctcactg aggccaagcg accaaaggtc gcttgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 221

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 221

gcgcgctcgc tcgctcactg aggccaaacg accaaaggtc gtttgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 222

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 222

gcgcgctcgc tcgctcactg aggccaaaag accaaaggtc ttttgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 223

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 223

gcgcgctcgc tcgctcactg aggccaaaaa accaaaggtt ttttgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 224

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 224

gcgcgctcgc tcgctcactg aggccaaaaa gccaaaggct ttttgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 225

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 225

gcgcgctcgc tcgctcactg aggccaaaaa gacaaagtct ttttgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 226

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 226

gcgcgctcgc tcgctcactg aggccaaaaa gaaaaattct ttttgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 227

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 227

gcgcgctcgc tcgctcactg aggccaaaaa aaaaaatttt ttttgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 228

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 228

gcgcgctcgc tcgctcactg aggccgaaaa aaaaaatttt tttcgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 229

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 229

gcgcgctcgc tcgctcactg aggccggaaa gaaaaattct ttccgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 230

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 230

gcgcgctcgc tcgctcactg aggccgggaa gaaaaattct tcccgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 231

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 231

gcgcgctcgc tcgctcactg aggccggggca gaaaaattct gcccgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 232

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 232

gcgcgctcgc tcgctcactg aggccgggcg gaaaaattcc gcccgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 233

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 233

gcgcgctcgc tcgctcactg aggccgggcg aaaaaatttc gcccgacgcc cgggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 234

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 234

gcgcgctcgc tcgctcactg aggccaggcg accaaaggtc gcctgacacc cgggtggcct 60

cagtgagcga gcgagcgcgc 80

<210> 235

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 235

gcgcgctcgc tcgctcactg aggccaggcg accaaaggtc gcctgacgcc atggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 236

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 236

gcgcgctcgc tcgctcactg aggccaggcg accaaaggtc gcctgacgac atgtcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 237

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 237

gcgcgctcgc tcgctcactg aggccaggcg accaaaggtc gcctgacgaa cgttcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 238

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 238

gcgcgctcgc tcgctcactg aggccaggcg accaaaggtc gcctgaagca attgctgcct 60

cagtgagcga gcgagcgcgc 80

<210> 239

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 239

gcgcgctcgc tcgctcactg aggccgggcg gccaaaggcc gcccgacacc cgggtggcct 60

cagtgagcga gcgagcgcgc 80

<210> 240

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 240

gcgcgctcgc tcgctcactg aggccgggcg gccaaaggcc gcccgacgcc atggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 241

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 241

gcgcgctcgc tcgctcactg aggccgggcg gccaaaggcc gcccgacgac atgtcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 242

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 242

gcgcgctcgc tcgctcactg aggccgggcg gccaaaggcc gcccgacgaa cgttcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 243

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 243

gcgcgctcgc tcgctcactg aggccgggcg gccaaaggcc gcccgaagca attgctgcct 60

cagtgagcga gcgagcgcgc 80

<210> 244

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 244

gcgcgctcgc tcgctcactg aggccgggcg acaaaatgtc gcccgacacc cgggtggcct 60

cagtgagcga gcgagcgcgc 80

<210> 245

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 245

gcgcgctcgc tcgctcactg aggccgggcg acaaaatgtc gcccgacgcc atggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 246

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 246

gcgcgctcgc tcgctcactg aggccgggcg acaaaatgtc gcccgacgac atgtcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 247

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 247

gcgcgctcgc tcgctcactg aggccgggcg acaaaatgtc gcccgacgaa cgttcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 248

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 248

gcgcgctcgc tcgctcactg aggccgggcg acaaaatgtc gcccgaagca attgctgcct 60

cagtgagcga gcgagcgcgc 80

<210> 249

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 249

gcgcgctcgc tcgctcactg aggccaaaag accaaaggtc ttttgacacc cgggtggcct 60

cagtgagcga gcgagcgcgc 80

<210> 250

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 250

gcgcgctcgc tcgctcactg aggccaaaag accaaaggtc ttttgacgcc atggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 251

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 251

gcgcgctcgc tcgctcactg aggccaaaag accaaaggtc ttttgacgac atgtcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 252

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 252

gcgcgctcgc tcgctcactg aggccaaaag accaaaggtc ttttgacgaa cgttcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 253

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 253

gcgcgctcgc tcgctcactg aggccaaaag accaaaggtc ttttgaagca attgctgcct 60

cagtgagcga gcgagcgcgc 80

<210> 254

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 254

gcgcgctcgc tcgctcactg aggccaaaaa aaaaaatttt ttttgacacc cgggtggcct 60

cagtgagcga gcgagcgcgc 80

<210> 255

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 255

gcgcgctcgc tcgctcactg aggccaaaaa aaaaaatttt ttttgacgcc atggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 256

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 256

gcgcgctcgc tcgctcactg aggccaaaaa aaaaaatttt ttttgacgac atgtcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 257

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 257

gcgcgctcgc tcgctcactg aggccaaaaa aaaaaatttt ttttgacgaa cgttcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 258

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 258

gcgcgctcgc tcgctcactg aggccaaaaa aaaaaatttt ttttgaagca attgctgcct 60

cagtgagcga gcgagcgcgc 80

<210> 259

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 259

gcgcgctcgc tcgctcactg aggccggggca gaaaaattct gcccgacacc cgggtggcct 60

cagtgagcga gcgagcgcgc 80

<210> 260

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 260

gcgcgctcgc tcgctcactg aggccggggca gaaaaattct gcccgacgcc atggcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 261

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 261

gcgcgctcgc tcgctcactg aggccggggca gaaaaattct gcccgacgac atgtcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 262

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 262

gcgcgctcgc tcgctcactg aggccggggca gaaaaattct gcccgacgaa cgttcggcct 60

cagtgagcga gcgagcgcgc 80

<210> 263

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 263

gcgcgctcgc tcgctcactg aggccgggca gaaaaattct gcccgaagca attgctgcct 60

cagtgagcga gcgagcgcgc 80

<210> 264

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 264

gcgcgctcgc tcgctcacta aggccaggcg accaaaggtc gcctgacgcc cgggcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 265

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 265

gcgcgctcgc tcgctcacta aggccgggcg gccaaaggcc gcccgacgcc cgggcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 266

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 266

gcgcgctcgc tcgctcacta aggccgggcg acaaaatgtc gcccgacgcc cgggcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 267

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 267

gcgcgctcgc tcgctcacta aggccaaaag accaaaggtc ttttgacgcc cgggcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 268

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 268

gcgcgctcgc tcgctcacta aggccaaaaa aaaaaatttt ttttgacgcc cgggcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 269

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 269

gcgcgctcgc tcgctcacta aggccgggca gaaaaattct gcccgacgcc cgggcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 270

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 270

gcgcgctcgc tcgctcgatg gggccaggcg accaaaggtc gcctgacgcc cgggcggcct 60

catcgagcga gcgagcgcgc 80

<210> 271

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 271

gcgcgctcgc tcgctcgatg gggccggggcg gccaaaggcc gcccgacgcc cgggcggcct 60

catcgagcga gcgagcgcgc 80

<210> 272

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 272

gcgcgctcgc tcgctcgatg gggccggggcg acaaaatgtc gcccgacgcc cgggcggcct 60

catcgagcga gcgagcgcgc 80

<210> 273

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 273

gcgcgctcgc tcgctcgatg gggccaaaag accaaaggtc ttttgacgcc cgggcggcct 60

catcgagcga gcgagcgcgc 80

<210> 274

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 274

gcgcgctcgc tcgctcgatg gggccaaaaa aaaaaatttt ttttgacgcc cgggcggcct 60

catcgagcga gcgagcgcgc 80

<210> 275

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 275

gcgcgctcgc tcgctcgatg gggccgggca gaaaaattct gcccgacgcc cgggcggcct 60

catcgagcga gcgagcgcgc 80

<210> 276

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 276

gcgcgctcgc tcgctcgaga gaaccaggcg accaaaggtc gcctgacgcc cgggcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 277

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 277

gcgcgctcgc tcgctcgaga gaaccgggcg gccaaaggcc gcccgacgcc cgggcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 278

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 278

gcgcgctcgc tcgctcgaga gaaccgggcg acaaaatgtc gcccgacgcc cgggcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 279

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 279

gcgcgctcgc tcgctcgaga gaaccaaaag accaaaggtc ttttgacgcc cgggcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 280

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 280

gcgcgctcgc tcgctcgaga gaaccaaaaa aaaaaatttt ttttgacgcc cgggcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 281

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 281

gcgcgctcgc tcgctcgaga gaaccgggca gaaaaattct gcccgacgcc cgggcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 282

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 282

gcgcgctcgc tcgctcgcgg gggccaggcg accaaaggtc gcctgacgcc cgggcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 283

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 283

gcgcgctcgc tcgctcgcgg gggccgggcg gccaaaggcc gcccgacgcc cgggcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 284

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 284

gcgcgctcgc tcgctcgcgg gggccgggcg acaaaatgtc gcccgacgcc cgggcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 285

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 285

gcgcgctcgc tcgctcgcgg gggccaaaag accaaaggtc ttttgacgcc cgggcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 286

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 286

gcgcgctcgc tcgctcgcgg gggccaaaaa aaaaaatttt ttttgacgcc cgggcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 287

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 287

gcgcgctcgc tcgctcgcgg gggccgggca gaaaaattct gcccgacgcc cgggcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 288

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 288

gcgcgctcgc tcgctcaata aaaccaggcg accaaaggtc gcctgacgcc cgggcggttt 60

tattgagcga gcgagcgcgc 80

<210> 289

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 289

gcgcgctcgc tcgctcaata aaaccgggcg gccaaaggcc gcccgacgcc cgggcggttt 60

tattgagcga gcgagcgcgc 80

<210> 290

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 290

gcgcgctcgc tcgctcaata aaaccgggcg acaaaatgtc gcccgacgcc cgggcggttt 60

tattgagcga gcgagcgcgc 80

<210> 291

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 291

gcgcgctcgc tcgctcaata aaaccaaaag accaaaggtc ttttgacgcc cgggcggttt 60

tattgagcga gcgagcgcgc 80

<210> 292

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 292

gcgcgctcgc tcgctcaata aaaccaaaaa aaaaaatttt ttttgacgcc cgggcggttt 60

tattgagcga gcgagcgcgc 80

<210> 293

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 293

gcgcgctcgc tcgctcaata aaaccgggca gaaaaattct gcccgacgcc cgggcggttt 60

tattgagcga gcgagcgcgc 80

<210> 294

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 294

gcgcgctcgc tcgctcacta aggccgggcg accaaaggtc gcccgacacc cgggtggcct 60

tagtgagcga gcgagcgcgc 80

<210> 295

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 295

gcgcgctcgc tcgctcacta aggccgggcg accaaaggtc gcccgacgcc atggcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 296

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 296

gcgcgctcgc tcgctcacta aggccgggcg accaaaggtc gcccgacgac atgtcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 297

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 297

gcgcgctcgc tcgctcacta aggccgggcg accaaaggtc gcccgacgaa cgttcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 298

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 298

gcgcgctcgc tcgctcacta aggccgggcg accaaaggtc gcccgaagca attgctgcct 60

tagtgagcga gcgagcgcgc 80

<210> 299

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 299

gcgcgctcgc tcgctcgatg gggccgggcg accaaaggtc gcccgacacc cgggtggcct 60

catcgagcga gcgagcgcgc 80

<210> 300

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 300

gcgcgctcgc tcgctcgatg gggccgggcg accaaaggtc gcccgacgcc atggcggcct 60

catcgagcga gcgagcgcgc 80

<210> 301

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 301

gcgcgctcgc tcgctcgatg gggccgggcg accaaaggtc gcccgacgac atgtcggcct 60

catcgagcga gcgagcgcgc 80

<210> 302

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 302

gcgcgctcgc tcgctcgatg gggccggggcg accaaaggtc gcccgacgaa cgttcggcct 60

catcgagcga gcgagcgcgc 80

<210> 303

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 303

gcgcgctcgc tcgctcgatg gggccgggcg accaaaggtc gcccgaagca attgctgcct 60

catcgagcga gcgagcgcgc 80

<210> 304

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 304

gcgcgctcgc tcgctcgaga gaaccgggcg accaaaggtc gcccgacacc cgggtggttc 60

tctcgagcga gcgagcgcgc 80

<210> 305

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 305

gcgcgctcgc tcgctcgaga gaaccgggcg accaaaggtc gcccgacgcc atggcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 306

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 306

gcgcgctcgc tcgctcgaga gaaccgggcg accaaaggtc gcccgacgac atgtcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 307

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 307

gcgcgctcgc tcgctcgaga gaaccgggcg accaaaggtc gcccgacgaa cgttcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 308

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 308

gcgcgctcgc tcgctcgaga gaaccgggcg accaaaggtc gcccgaagca attgctgttc 60

tctcgagcga gcgagcgcgc 80

<210> 309

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 309

gcgcgctcgc tcgctcgcgg gggccgggcg accaaaggtc gcccgacacc cgggtggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 310

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 310

gcgcgctcgc tcgctcgcgg gggccgggcg accaaaggtc gcccgacgcc atggcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 311

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 311

gcgcgctcgc tcgctcgcgg gggccgggcg accaaaggtc gcccgacgac atgtcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 312

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 312

gcgcgctcgc tcgctcgcgg gggccgggcg accaaaggtc gcccgacgaa cgttcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 313

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 313

gcgcgctcgc tcgctcgcgg gggccgggcg accaaaggtc gcccgaagca attgctgccc 60

ccgcgagcga gcgagcgcgc 80

<210> 314

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 314

gcgcgctcgc tcgctcaata aaaccgggcg accaaaggtc gcccgacacc cgggtggttt 60

tattgagcga gcgagcgcgc 80

<210> 315

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 315

gcgcgctcgc tcgctcaata aaaccgggcg accaaaggtc gcccgacgcc atggcggttt 60

tattgagcga gcgagcgcgc 80

<210> 316

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 316

gcgcgctcgc tcgctcaata aaaccgggcg accaaaggtc gcccgacgac atgtcggttt 60

tattgagcga gcgagcgcgc 80

<210> 317

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 317

gcgcgctcgc tcgctcaata aaaccgggcg accaaaggtc gcccgacgaa cgttcggttt 60

tattgagcga gcgagcgcgc 80

<210> 318

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 318

gcgcgctcgc tcgctcaata aaaccgggcg accaaaggtc gcccgaagca attgctgttt 60

tattgagcga gcgagcgcgc 80

<210> 319

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 319

gcgcgctcgc tcgctcacta aggccaggcg accaaaggtc gcctgacacc cgggtggcct 60

tagtgagcga gcgagcgcgc 80

<210> 320

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 320

gcgcgctcgc tcgctcacta aggccaggcg accaaaggtc gcctgacgcc atggcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 321

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 321

gcgcgctcgc tcgctcacta aggccaggcg accaaaggtc gcctgacgac atgtcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 322

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 322

gcgcgctcgc tcgctcacta aggccaggcg accaaaggtc gcctgacgaa cgttcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 323

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 323

gcgcgctcgc tcgctcacta aggccaggcg accaaaggtc gcctgaagca attgctgcct 60

tagtgagcga gcgagcgcgc 80

<210> 324

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 324

gcgcgctcgc tcgctcacta aggccgggcg gccaaaggcc gcccgacacc cgggtggcct 60

tagtgagcga gcgagcgcgc 80

<210> 325

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 325

gcgcgctcgc tcgctcacta aggccgggcg gccaaaggcc gcccgacgcc atggcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 326

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 326

gcgcgctcgc tcgctcacta aggccggggcg gccaaaggcc gcccgacgac atgtcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 327

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 327

gcgcgctcgc tcgctcacta aggccgggcg gccaaaggcc gcccgacgaa cgttcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 328

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 328

gcgcgctcgc tcgctcacta aggccgggcg gccaaaggcc gcccgaagca attgctgcct 60

tagtgagcga gcgagcgcgc 80

<210> 329

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 329

gcgcgctcgc tcgctcacta aggccgggcg acaaaatgtc gcccgacacc cgggtggcct 60

tagtgagcga gcgagcgcgc 80

<210> 330

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 330

gcgcgctcgc tcgctcacta aggccgggcg acaaaatgtc gcccgacgcc atggcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 331

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 331

gcgcgctcgc tcgctcacta aggccggggcg acaaaatgtc gcccgacgac atgtcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 332

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 332

gcgcgctcgc tcgctcacta aggccgggcg acaaaatgtc gcccgacgaa cgttcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 333

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 333

gcgcgctcgc tcgctcacta aggccgggcg acaaaatgtc gcccgaagca attgctgcct 60

tagtgagcga gcgagcgcgc 80

<210> 334

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 334

gcgcgctcgc tcgctcacta aggccaaaag accaaaggtc ttttgacacc cgggtggcct 60

tagtgagcga gcgagcgcgc 80

<210> 335

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 335

gcgcgctcgc tcgctcacta aggccaaaag accaaaggtc ttttgacgcc atggcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 336

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 336

gcgcgctcgc tcgctcacta aggccaaaag accaaaggtc ttttgacgac atgtcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 337

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 337

gcgcgctcgc tcgctcacta aggccaaaag accaaaggtc ttttgacgaa cgttcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 338

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 338

gcgcgctcgc tcgctcacta aggccaaaag accaaaggtc ttttgaagca attgctgcct 60

tagtgagcga gcgagcgcgc 80

<210> 339

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 339

gcgcgctcgc tcgctcacta aggccaaaaa aaaaaatttt ttttgacacc cgggtggcct 60

tagtgagcga gcgagcgcgc 80

<210> 340

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 340

gcgcgctcgc tcgctcacta aggccaaaaa aaaaaatttt ttttgacgcc atggcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 341

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 341

gcgcgctcgc tcgctcacta aggccaaaaa aaaaaatttt ttttgacgac atgtcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 342

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 342

gcgcgctcgc tcgctcacta aggccaaaaa aaaaaatttt ttttgacgaa cgttcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 343

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 343

gcgcgctcgc tcgctcacta aggccaaaaa aaaaaatttt ttttgaagca attgctgcct 60

tagtgagcga gcgagcgcgc 80

<210> 344

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 344

gcgcgctcgc tcgctcacta aggccggggca gaaaaattct gcccgacacc cgggtggcct 60

tagtgagcga gcgagcgcgc 80

<210> 345

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 345

gcgcgctcgc tcgctcacta aggccggggca gaaaaattct gcccgacgcc atggcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 346

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 346

gcgcgctcgc tcgctcacta aggccgggca gaaaaattct gcccgacgac atgtcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 347

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 347

gcgcgctcgc tcgctcacta aggccgggca gaaaaattct gcccgacgaa cgttcggcct 60

tagtgagcga gcgagcgcgc 80

<210> 348

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 348

gcgcgctcgc tcgctcacta aggccgggca gaaaaattct gcccgaagca attgctgcct 60

tagtgagcga gcgagcgcgc 80

<210> 349

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 349

gcgcgctcgc tcgctcgatg gggccaggcg accaaaggtc gcctgacacc cgggtggcct 60

catcgagcga gcgagcgcgc 80

<210> 350

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 350

gcgcgctcgc tcgctcgatg gggccaggcg accaaaggtc gcctgacgcc atggcggcct 60

catcgagcga gcgagcgcgc 80

<210> 351

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 351

gcgcgctcgc tcgctcgatg gggccaggcg accaaaggtc gcctgacgac atgtcggcct 60

catcgagcga gcgagcgcgc 80

<210> 352

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 352

gcgcgctcgc tcgctcgatg gggccaggcg accaaaggtc gcctgacgaa cgttcggcct 60

catcgagcga gcgagcgcgc 80

<210> 353

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 353

gcgcgctcgc tcgctcgatg gggccaggcg accaaaggtc gcctgaagca attgctgcct 60

catcgagcga gcgagcgcgc 80

<210> 354

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 354

gcgcgctcgc tcgctcgatg gggccgggcg gccaaaggcc gcccgacacc cgggtggcct 60

catcgagcga gcgagcgcgc 80

<210> 355

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 355

gcgcgctcgc tcgctcgatg gggccgggcg gccaaaggcc gcccgacgcc atggcggcct 60

catcgagcga gcgagcgcgc 80

<210> 356

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 356

gcgcgctcgc tcgctcgatg gggccgggcg gccaaaggcc gcccgacgac atgtcggcct 60

catcgagcga gcgagcgcgc 80

<210> 357

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 357

gcgcgctcgc tcgctcgatg gggccgggcg gccaaaggcc gcccgacgaa cgttcggcct 60

catcgagcga gcgagcgcgc 80

<210> 358

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 358

gcgcgctcgc tcgctcgatg gggccgggcg gccaaaggcc gcccgaagca attgctgcct 60

catcgagcga gcgagcgcgc 80

<210> 359

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 359

gcgcgctcgc tcgctcgatg gggccgggcg acaaaatgtc gcccgacacc cgggtggcct 60

catcgagcga gcgagcgcgc 80

<210> 360

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 360

gcgcgctcgc tcgctcgatg gggccggggcg acaaaatgtc gcccgacgcc atggcggcct 60

catcgagcga gcgagcgcgc 80

<210> 361

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 361

gcgcgctcgc tcgctcgatg gggccggggcg acaaaatgtc gcccgacgac atgtcggcct 60

catcgagcga gcgagcgcgc 80

<210> 362

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 362

gcgcgctcgc tcgctcgatg gggccgggcg acaaaatgtc gcccgacgaa cgttcggcct 60

catcgagcga gcgagcgcgc 80

<210> 363

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 363

gcgcgctcgc tcgctcgatg gggccgggcg acaaaatgtc gcccgaagca attgctgcct 60

catcgagcga gcgagcgcgc 80

<210> 364

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 364

gcgcgctcgc tcgctcgatg gggccaaaag accaaaggtc ttttgacacc cgggtggcct 60

catcgagcga gcgagcgcgc 80

<210> 365

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 365

gcgcgctcgc tcgctcgatg gggccaaaag accaaaggtc ttttgacgcc atggcggcct 60

catcgagcga gcgagcgcgc 80

<210> 366

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 366

gcgcgctcgc tcgctcgatg gggccaaaag accaaaggtc ttttgacgac atgtcggcct 60

catcgagcga gcgagcgcgc 80

<210> 367

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 367

gcgcgctcgc tcgctcgatg gggccaaaag accaaaggtc ttttgacgaa cgttcggcct 60

catcgagcga gcgagcgcgc 80

<210> 368

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 368

gcgcgctcgc tcgctcgatg gggccaaaag accaaaggtc ttttgaagca attgctgcct 60

catcgagcga gcgagcgcgc 80

<210> 369

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 369

gcgcgctcgc tcgctcgatg gggccaaaaa aaaaaatttt ttttgacacc cgggtggcct 60

catcgagcga gcgagcgcgc 80

<210> 370

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 370

gcgcgctcgc tcgctcgatg gggccaaaaa aaaaaatttt ttttgacgcc atggcggcct 60

catcgagcga gcgagcgcgc 80

<210> 371

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 371

gcgcgctcgc tcgctcgatg gggccaaaaa aaaaaatttt ttttgacgac atgtcggcct 60

catcgagcga gcgagcgcgc 80

<210> 372

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 372

gcgcgctcgc tcgctcgatg gggccaaaaa aaaaaatttt ttttgacgaa cgttcggcct 60

catcgagcga gcgagcgcgc 80

<210> 373

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 373

gcgcgctcgc tcgctcgatg gggccaaaaa aaaaaatttt ttttgaagca attgctgcct 60

catcgagcga gcgagcgcgc 80

<210> 374

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 374

gcgcgctcgc tcgctcgatg gggccggggca gaaaaattct gcccgacacc cgggtggcct 60

catcgagcga gcgagcgcgc 80

<210> 375

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 375

gcgcgctcgc tcgctcgatg gggccggggca gaaaaattct gcccgacgcc atggcggcct 60

catcgagcga gcgagcgcgc 80

<210> 376

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 376

gcgcgctcgc tcgctcgatg gggccggggca gaaaaattct gcccgacgac atgtcggcct 60

catcgagcga gcgagcgcgc 80

<210> 377

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 377

gcgcgctcgc tcgctcgatg gggccgggca gaaaaattct gcccgacgaa cgttcggcct 60

catcgagcga gcgagcgcgc 80

<210> 378

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 378

gcgcgctcgc tcgctcgatg gggccgggca gaaaaattct gcccgaagca attgctgcct 60

catcgagcga gcgagcgcgc 80

<210> 379

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 379

gcgcgctcgc tcgctcgaga gaaccaggcg accaaaggtc gcctgacacc cgggtggttc 60

tctcgagcga gcgagcgcgc 80

<210> 380

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 380

gcgcgctcgc tcgctcgaga gaaccaggcg accaaaggtc gcctgacgcc atggcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 381

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 381

gcgcgctcgc tcgctcgaga gaaccaggcg accaaaggtc gcctgacgac atgtcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 382

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 382

gcgcgctcgc tcgctcgaga gaaccaggcg accaaaggtc gcctgacgaa cgttcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 383

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 383

gcgcgctcgc tcgctcgaga gaaccaggcg accaaaggtc gcctgaagca attgctgttc 60

tctcgagcga gcgagcgcgc 80

<210> 384

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 384

gcgcgctcgc tcgctcgaga gaaccgggcg gccaaaggcc gcccgacacc cgggtggttc 60

tctcgagcga gcgagcgcgc 80

<210> 385

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 385

gcgcgctcgc tcgctcgaga gaaccgggcg gccaaaggcc gcccgacgcc atggcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 386

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 386

gcgcgctcgc tcgctcgaga gaaccgggcg gccaaaggcc gcccgacgac atgtcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 387

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 387

gcgcgctcgc tcgctcgaga gaaccgggcg gccaaaggcc gcccgacgaa cgttcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 388

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 388

gcgcgctcgc tcgctcgaga gaaccgggcg gccaaaggcc gcccgaagca attgctgttc 60

tctcgagcga gcgagcgcgc 80

<210> 389

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 389

gcgcgctcgc tcgctcgaga gaaccgggcg acaaaatgtc gcccgacacc cgggtggttc 60

tctcgagcga gcgagcgcgc 80

<210> 390

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 390

gcgcgctcgc tcgctcgaga gaaccgggcg acaaaatgtc gcccgacgcc atggcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 391

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 391

gcgcgctcgc tcgctcgaga gaaccgggcg acaaaatgtc gcccgacgac atgtcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 392

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 392

gcgcgctcgc tcgctcgaga gaaccgggcg acaaaatgtc gcccgacgaa cgttcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 393

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 393

gcgcgctcgc tcgctcgaga gaaccgggcg acaaaatgtc gcccgaagca attgctgttc 60

tctcgagcga gcgagcgcgc 80

<210> 394

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 394

gcgcgctcgc tcgctcgaga gaaccaaaag accaaaggtc ttttgacacc cgggtggttc 60

tctcgagcga gcgagcgcgc 80

<210> 395

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 395

gcgcgctcgc tcgctcgaga gaaccaaaag accaaaggtc ttttgacgcc atggcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 396

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 396

gcgcgctcgc tcgctcgaga gaaccaaaag accaaaggtc ttttgacgac atgtcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 397

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 397

gcgcgctcgc tcgctcgaga gaaccaaaag accaaaggtc ttttgacgaa cgttcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 398

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 398

gcgcgctcgc tcgctcgaga gaaccaaaag accaaaggtc ttttgaagca attgctgttc 60

tctcgagcga gcgagcgcgc 80

<210> 399

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 399

gcgcgctcgc tcgctcgaga gaaccaaaaa aaaaaatttt ttttgacacc cgggtggttc 60

tctcgagcga gcgagcgcgc 80

<210> 400

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 400

gcgcgctcgc tcgctcgaga gaaccaaaaa aaaaaatttt ttttgacgcc atggcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 401

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 401

gcgcgctcgc tcgctcgaga gaaccaaaaa aaaaaatttt ttttgacgac atgtcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 402

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 402

gcgcgctcgc tcgctcgaga gaaccaaaaa aaaaaatttt ttttgacgaa cgttcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 403

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 403

gcgcgctcgc tcgctcgaga gaaccaaaaa aaaaaatttt ttttgaagca attgctgttc 60

tctcgagcga gcgagcgcgc 80

<210> 404

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 404

gcgcgctcgc tcgctcgaga gaaccgggca gaaaaattct gcccgacacc cgggtggttc 60

tctcgagcga gcgagcgcgc 80

<210> 405

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 405

gcgcgctcgc tcgctcgaga gaaccgggca gaaaaattct gcccgacgcc atggcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 406

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 406

gcgcgctcgc tcgctcgaga gaaccgggca gaaaaattct gcccgacgac atgtcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 407

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 407

gcgcgctcgc tcgctcgaga gaaccgggca gaaaaattct gcccgacgaa cgttcggttc 60

tctcgagcga gcgagcgcgc 80

<210> 408

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 408

gcgcgctcgc tcgctcgaga gaaccgggca gaaaaattct gcccgaagca attgctgttc 60

tctcgagcga gcgagcgcgc 80

<210> 409

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 409

gcgcgctcgc tcgctcgcgg gggccaggcg accaaaggtc gcctgacacc cgggtggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 410

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 410

gcgcgctcgc tcgctcgcgg gggccaggcg accaaaggtc gcctgacgcc atggcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 411

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 411

gcgcgctcgc tcgctcgcgg gggccaggcg accaaaggtc gcctgacgac atgtcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 412

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 412

gcgcgctcgc tcgctcgcgg gggccaggcg accaaaggtc gcctgacgaa cgttcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 413

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 413

gcgcgctcgc tcgctcgcgg gggccaggcg accaaaggtc gcctgaagca attgctgccc 60

ccgcgagcga gcgagcgcgc 80

<210> 414

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 414

gcgcgctcgc tcgctcgcgg gggccgggcg gccaaaggcc gcccgacacc cgggtggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 415

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 415

gcgcgctcgc tcgctcgcgg gggccgggcg gccaaaggcc gcccgacgcc atggcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 416

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 416

gcgcgctcgc tcgctcgcgg gggccggggcg gccaaaggcc gcccgacgac atgtcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 417

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 417

gcgcgctcgc tcgctcgcgg gggccggggcg gccaaaggcc gcccgacgaa cgttcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 418

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 418

gcgcgctcgc tcgctcgcgg gggccgggcg gccaaaggcc gcccgaagca attgctgccc 60

ccgcgagcga gcgagcgcgc 80

<210> 419

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 419

gcgcgctcgc tcgctcgcgg gggccgggcg acaaaatgtc gcccgacacc cgggtggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 420

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 420

gcgcgctcgc tcgctcgcgg gggccgggcg acaaaatgtc gcccgacgcc atggcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 421

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 421

gcgcgctcgc tcgctcgcgg gggccgggcg acaaaatgtc gcccgacgac atgtcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 422

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 422

gcgcgctcgc tcgctcgcgg gggccgggcg acaaaatgtc gcccgacgaa cgttcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 423

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 423

gcgcgctcgc tcgctcgcgg gggccgggcg acaaaatgtc gcccgaagca attgctgccc 60

ccgcgagcga gcgagcgcgc 80

<210> 424

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 424

gcgcgctcgc tcgctcgcgg gggccaaaag accaaaggtc ttttgacacc cgggtggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 425

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 425

gcgcgctcgc tcgctcgcgg gggccaaaag accaaaggtc ttttgacgcc atggcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 426

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 426

gcgcgctcgc tcgctcgcgg gggccaaaag accaaaggtc ttttgacgac atgtcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 427

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 427

gcgcgctcgc tcgctcgcgg gggccaaaag accaaaggtc ttttgacgaa cgttcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 428

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 428

gcgcgctcgc tcgctcgcgg gggccaaaag accaaaggtc ttttgaagca attgctgccc 60

ccgcgagcga gcgagcgcgc 80

<210> 429

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 429

gcgcgctcgc tcgctcgcgg gggccaaaaa aaaaaatttt ttttgacacc cgggtggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 430

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 430

gcgcgctcgc tcgctcgcgg gggccaaaaa aaaaaatttt ttttgacgcc atggcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 431

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 431

gcgcgctcgc tcgctcgcgg gggccaaaaa aaaaaatttt ttttgacgac atgtcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 432

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 432

gcgcgctcgc tcgctcgcgg gggccaaaaa aaaaaatttt ttttgacgaa cgttcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 433

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 433

gcgcgctcgc tcgctcgcgg gggccaaaaa aaaaaatttt ttttgaagca attgctgccc 60

ccgcgagcga gcgagcgcgc 80

<210> 434

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 434

gcgcgctcgc tcgctcgcgg gggccggggca gaaaaattct gcccgacacc cgggtggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 435

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 435

gcgcgctcgc tcgctcgcgg gggccgggca gaaaaattct gcccgacgcc atggcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 436

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 436

gcgcgctcgc tcgctcgcgg gggccgggca gaaaaattct gcccgacgac atgtcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 437

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 437

gcgcgctcgc tcgctcgcgg gggccgggca gaaaaattct gcccgacgaa cgttcggccc 60

ccgcgagcga gcgagcgcgc 80

<210> 438

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 438

gcgcgctcgc tcgctcgcgg gggccgggca gaaaaattct gcccgaagca attgctgccc 60

ccgcgagcga gcgagcgcgc 80

<210> 439

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 439

gcgcgctcgc tcgctcaata aaaccaggcg accaaaggtc gcctgacacc cgggtggttt 60

tattgagcga gcgagcgcgc 80

<210> 440

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 440

gcgcgctcgc tcgctcaata aaaccaggcg accaaaggtc gcctgacgcc atggcggttt 60

tattgagcga gcgagcgcgc 80

<210> 441

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 441

gcgcgctcgc tcgctcaata aaaccaggcg accaaaggtc gcctgacgac atgtcggttt 60

tattgagcga gcgagcgcgc 80

<210> 442

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 442

gcgcgctcgc tcgctcaata aaaccaggcg accaaaggtc gcctgacgaa cgttcggttt 60

tattgagcga gcgagcgcgc 80

<210> 443

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 443

gcgcgctcgc tcgctcaata aaaccaggcg accaaaggtc gcctgaagca attgctgttt 60

tattgagcga gcgagcgcgc 80

<210> 444

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 444

gcgcgctcgc tcgctcaata aaaccgggcg gccaaaggcc gcccgacacc cgggtggttt 60

tattgagcga gcgagcgcgc 80

<210> 445

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 445

gcgcgctcgc tcgctcaata aaaccgggcg gccaaaggcc gcccgacgcc atggcggttt 60

tattgagcga gcgagcgcgc 80

<210> 446

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 446

gcgcgctcgc tcgctcaata aaaccgggcg gccaaaggcc gcccgacgac atgtcggttt 60

tattgagcga gcgagcgcgc 80

<210> 447

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 447

gcgcgctcgc tcgctcaata aaaccgggcg gccaaaggcc gcccgacgaa cgttcggttt 60

tattgagcga gcgagcgcgc 80

<210> 448

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 448

gcgcgctcgc tcgctcaata aaaccgggcg gccaaaggcc gcccgaagca attgctgttt 60

tattgagcga gcgagcgcgc 80

<210> 449

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 449

gcgcgctcgc tcgctcaata aaaccgggcg acaaaatgtc gcccgacacc cgggtggttt 60

tattgagcga gcgagcgcgc 80

<210> 450

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 450

gcgcgctcgc tcgctcaata aaaccgggcg acaaaatgtc gcccgacgcc atggcggttt 60

tattgagcga gcgagcgcgc 80

<210> 451

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 451

gcgcgctcgc tcgctcaata aaaccgggcg acaaaatgtc gcccgacgac atgtcggttt 60

tattgagcga gcgagcgcgc 80

<210> 452

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 452

gcgcgctcgc tcgctcaata aaaccgggcg acaaaatgtc gcccgacgaa cgttcggttt 60

tattgagcga gcgagcgcgc 80

<210> 453

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 453

gcgcgctcgc tcgctcaata aaaccgggcg acaaaatgtc gcccgaagca attgctgttt 60

tattgagcga gcgagcgcgc 80

<210> 454

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 454

gcgcgctcgc tcgctcaata aaaccaaaag accaaaggtc ttttgacacc cgggtggttt 60

tattgagcga gcgagcgcgc 80

<210> 455

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 455

gcgcgctcgc tcgctcaata aaaccaaaag accaaaggtc ttttgacgcc atggcggttt 60

tattgagcga gcgagcgcgc 80

<210> 456

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 456

gcgcgctcgc tcgctcaata aaaccaaaag accaaaggtc ttttgacgac atgtcggttt 60

tattgagcga gcgagcgcgc 80

<210> 457

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 457

gcgcgctcgc tcgctcaata aaaccaaaag accaaaggtc ttttgacgaa cgttcggttt 60

tattgagcga gcgagcgcgc 80

<210> 458

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 458

gcgcgctcgc tcgctcaata aaaccaaaag accaaaggtc ttttgaagca attgctgttt 60

tattgagcga gcgagcgcgc 80

<210> 459

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 459

gcgcgctcgc tcgctcaata aaaccaaaaa aaaaaatttt ttttgacacc cgggtggttt 60

tattgagcga gcgagcgcgc 80

<210> 460

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 460

gcgcgctcgc tcgctcaata aaaccaaaaa aaaaaatttt ttttgacgcc atggcggttt 60

tattgagcga gcgagcgcgc 80

<210> 461

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 461

gcgcgctcgc tcgctcaata aaaccaaaaa aaaaaatttt ttttgacgac atgtcggttt 60

tattgagcga gcgagcgcgc 80

<210> 462

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 462

gcgcgctcgc tcgctcaata aaaccaaaaa aaaaaatttt ttttgacgaa cgttcggttt 60

tattgagcga gcgagcgcgc 80

<210> 463

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 463

gcgcgctcgc tcgctcaata aaaccaaaaa aaaaaatttt ttttgaagca attgctgttt 60

tattgagcga gcgagcgcgc 80

<210> 464

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 464

gcgcgctcgc tcgctcaata aaaccgggca gaaaaattct gcccgacacc cgggtggttt 60

tattgagcga gcgagcgcgc 80

<210> 465

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 465

gcgcgctcgc tcgctcaata aaaccgggca gaaaaattct gcccgacgcc atggcggttt 60

tattgagcga gcgagcgcgc 80

<210> 466

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 466

gcgcgctcgc tcgctcaata aaaccgggca gaaaaattct gcccgacgac atgtcggttt 60

tattgagcga gcgagcgcgc 80

<210> 467

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 467

gcgcgctcgc tcgctcaata aaaccgggca gaaaaattct gcccgacgaa cgttcggttt 60

tattgagcga gcgagcgcgc 80

<210> 468

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 468

gcgcgctcgc tcgctcaata aaaccgggca gaaaaattct gcccgaagca attgctgttt 60

tattgagcga gcgagcgcgc 80

<210> 469

<211> 120

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 469

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

cgcacgcccg ggtttcccgg gcggcctcag tgagcgagcg agcgcgcagc tgcctgcagg 120

<210> 470

<211> 122

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 470

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgacgcccg ggctttgccc gggcggcctc agtgagcgag cgagcgcgca gctgcctgca 120

gg 122

<210> 471

<211> 129

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 471

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgggcgacc aaaggtcgcc cgacgcccgg gcgcctcagt gagcgagcga gcgcgcagct 120

gcctgcagg 129

<210> 472

<211> 101

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 472

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ctttgcctca gtgagcgagc gagcgcgcag ctgcctgcag g 101

<210> 473

<211> 139

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 473

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgggcgaca aagtcgcccg acgcccgggc tttgcccggg cggcctcagt gagcgagcga 120

gcgcgcagct gcctgcagg 139

<210> 474

<211> 137

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 474

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgggcgaaa atcgcccgac gcccgggctt tgcccgggcg gcctcagtga gcgagcgagc 120

gcgcagctgc ctgcagg 137

<210> 475

<211> 135

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 475

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgggcgaaa cgcccgacgc ccgggctttg cccgggcggc ctcagtgagc gagcgagcgc 120

gcagctgcct gcagg 135

<210> 476

<211> 133

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 476

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgggcaaag cccgacgccc gggctttgcc cgggcggcct cagtgagcga gcgagcgcgc 120

agctgcctgc agg 133

<210> 477

<211> 139

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 477

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgggcgacc aaaggtcgcc cgacgcccgg gtttcccggg cggcctcagt gagcgagcga 120

gcgcgcagct gcctgcagg 139

<210> 478

<211> 137

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 478

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgggcgacc aaaggtcgcc cgacgcccgg tttccgggcg gcctcagtga gcgagcgagc 120

gcgcagctgc ctgcagg 137

<210> 479

<211> 135

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 479

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgggcgacc aaaggtcgcc cgacgcccgt ttcgggcggc ctcagtgagc gagcgagcgc 120

gcagctgcct gcagg 135

<210> 480

<211> 133

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 480

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgggcgacc aaaggtcgcc cgacgccctt tgggcggcct cagtgagcga gcgagcgcgc 120

agctgcctgc agg 133

<210> 481

<211> 131

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 481

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgggcgacc aaaggtcgcc cgacgccttt ggcggcctca gtgagcgagc gagcgcgcag 120

ctgcctgcag g 131

<210> 482

<211> 129

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 482

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgggcgacc aaaggtcgcc cgacgctttg cggcctcagt gagcgagcga gcgcgcagct 120

gcctgcagg 129

<210> 483

<211> 127

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 483

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgggcgacc aaaggtcgcc cgacgtttcg gcctcagtga gcgagcgagc gcgcagctgc 120

ctgcagg 127

<210> 484

<211> 120

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 484

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggaaacc cgggcgtgcg 60

cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact aggggttcct 120

<210> 485

<211> 122

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 485

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgt cgggcgacct ttggtcgccc 60

ggcctcagtg agcgagcgag cgcgcagaga gggagtggcc aactccatca ctaggggttc 120

ct 122

<210> 486

<211> 122

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 486

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60

ggcctcagtg agcgagcgag cgcgcagaga gggagtggcc aactccatca ctaggggttc 120

ct 122

<210> 487

<211> 129

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 487

cctgcaggca gctgcgcgct cgctcgctca ctgaggcgcc cgggcgtcgg gcgacctttg 60

gtcgcccggc ctcagtgagc gagcgagcgc gcagagaggg agtggccaac tccatcacta 120

ggggttcct 129

<210> 488

<211> 101

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 488

cctgcaggca gctgcgcgct cgctcgctca ctgaggcaaa gcctcagtga gcgagcgagc 60

gcgcagagag ggagtggcca actccatcac taggggttcc t 101

<210> 489

<211> 139

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 489

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60

gggcgacttt gtcgcccggc ctcagtgagc gagcgagcgc gcagagaggg agtggccaac 120

tccatcacta ggggttcct 139

<210> 490

<211> 137

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 490

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60

gggcgatttt cgcccggcct cagtgagcga gcgagcgcgc agagagggag tggccaactc 120

catcactagg ggttcct 137

<210> 491

<211> 135

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 491

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60

gggcgtttcg cccggcctca gtgagcgagc gagcgcgcag agagggagtg gccaactcca 120

tcactagggg ttcct 135

<210> 492

<211> 133

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 492

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60

gggctttgcc cggcctcagt gagcgagcga gcgcgcagag agggagtggc caactccatc 120

actaggggtt cct 133

<210> 493

<211> 139

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 493

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggaaacc cgggcgtcgg 60

gcgacctttg gtcgcccggc ctcagtgagc gagcgagcgc gcagagaggg agtggccaac 120

tccatcacta ggggttcct 139

<210> 494

<211> 137

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 494

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccggaaaccg ggcgtcgggc 60

gacctttggt cgcccggcct cagtgagcga gcgagcgcgc agagagggag tggccaactc 120

catcactagg ggttcct 137

<210> 495

<211> 135

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 495

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgaaacggg cgtcgggcga 60

cctttggtcg cccggcctca gtgagcgagc gagcgcgcag agagggagtg gccaactcca 120

tcactagggg ttcct 135

<210> 496

<211> 133

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 496

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccaaagggcg tcgggcgacc 60

tttggtcgcc cggcctcagt gagcgagcga gcgcgcagag agggagtggc caactccatc 120

actaggggtt cct 133

<210> 497

<211> 131

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 497

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc caaaggcgtc gggcgacctt 60

tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca actccatcac 120

taggggttcct 131

<210> 498

<211> 129

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 498

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc aaagcgtcgg gcgacctttg 60

gtcgcccggc ctcagtgagc gagcgagcgc gcagagaggg agtggccaac tccatcacta 120

ggggttcct 129

<210> 499

<211> 127

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 499

cctgcaggca gctgcgcgct cgctcgctca ctgaggccga aacgtcgggc gacctttggt 60

cgcccggcct cagtgagcga gcgagcgcgc agagagggag tggccaactc catcactagg 120

ggttcct 127

<210> 500

<211> 43

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 500

gcccgctggt ttccagcggg ctgcgggccc gaaacggggcc cgc 43

<210> 501

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 501

cgggcccgtg cgggcccaaa gggcccgc 28

<210> 502

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 502

gcccgggcac gcccgggttt cccgggcg 28

<210> 503

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 503

cgtgcgggcc caaagggccc gc 22

<210> 504

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 504

cgggcgacca aaggtcgccc g 21

<210> 505

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 505

cgcccgggct ttgcccggggc 20

<210> 506

<211> 42

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 506

cgggcgacca aaggtcgccc gacgcccggg ctttgcccgg gc 42

<210> 507

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 507

cgggcgacca aaggtcgccc g 21

<210> 508

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 508

cgcccgggct ttgcccggggc 20

<210> 509

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 509

cgggcgacca aaggtcgccc gacgcccggg cggc 34

<210> 510

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 510

cgggcgacca aaggtcgccc g 21

<210> 511

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 511

cgcccgggct ttgcccggggc 20

<210> 512

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 512

cggggcccga cgcccgggct ttgcccggggc 30

<210> 513

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 513

cgggcgacca aaggtcgccc g 21

<210> 514

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 514

cgcccgggct ttgcccggggc 20

<210> 515

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 515

cgggcccgac gcccggggctt tgcccggggc 29

<210> 516

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 516

cgggcgacca aaggtcgccc g 21

<210> 517

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 517

cgcccgggct ttgcccggggc 20

<210> 518

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 518

gcccgggcaa agcccgggcg 20

<210> 519

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 519

cgggcgacct ttggtcgccc g 21

<210> 520

<211> 42

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 520

gcccgggcaa agcccgggcg tcgggcgacc tttggtcgcc cg 42

<210> 521

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 521

gcccgggcaa agcccgggcg 20

<210> 522

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 522

cgggcgacct ttggtcgccc g 21

<210> 523

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 523

gcccgggcaa agcccgggcg 20

<210> 524

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 524

cgggcgacct ttggtcgccc g 21

<210> 525

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 525

gccgcccggg cgacgggcga cctttggtcg cccg 34

<210> 526

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 526

gcccgggcaa agcccgggcg 20

<210> 527

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 527

cgggcgacct ttggtcgccc g 21

<210> 528

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 528

gcccgggcgt cgggcgacct ttggtcgccc g 31

<210> 529

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 529

cgggcgacct ttggtcgccc g 21

<210> 530

<400> 530

000

<210> 531

<211> 16

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 531

gcgcgctcgc tcgctc 16

<210> 532

<211> 8

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 532

actgaggc 8

<210> 533

<400> 533

000

<210> 534

<400> 534

000

<210> 535

<211> 8

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 535

gcctcagt 8

<210> 536

<211> 16

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 536

gagcgagcga gcgcgc 16

<210> 537

<400> 537

000

<210> 538

<211> 165

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 538

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgcccgggc aaagcccggg cgtcgggcga cctttggtcg cccggcctca gtgagcgagc 120

gagcgcgcag agagggagtg gccaactcca tcactagggg ttcct 165

<210> 539

<211> 140

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 539

cccctagtga tggagttggc cactccctct ctgcgcgctc gctcgctcac tgaggccgcc 60

cgggcaaagc ccgggcgtcg ggcgaccttt ggtcgcccgg cctcagtgag cgagcgagcg 120

cgcagagaga tcactagggg 140

<210> 540

<211> 91

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 540

gcgcgctcgc tcgctcactg aggccgcccg ggcaaagccc gggcgtcggg cgacctttgg 60

tcgcccggcc tcagtgagcg agcgagcgcg c 91

<210> 541

<211> 91

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 541

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacgcc cgggctttgc 60

ccgggcggcc tcagtgagcg agcgagcgcg c 91

<210> 542

<211> 8

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 542

ttaattaa 8

<210> 543

<211> 80

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 543

cgcgcgagcg agcgagtgac tccggcccgc tggtttccag cgggctgcgg gcccgccgga 60

gtcactcgct cgctcgcgcg 80

<210> 544

<211> 52

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 544

gcgcgctcgc tcgctcactg aggcctttgc ctcagtgagc gagcgagcgc gc 52

<210> 545

<211> 79

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 545

gcgcgctcgc tcgctcactg aggcgcccgg gcgtcgggcg acctttggtc gcccggcctc 60

agtgagcgag cgagcgcgc 79

<210> 546

<211> 77

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 546

gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc gcccgacgtt tcggcctcag 60

tgagcgagcg agcgcgc 77

<210> 547

<211> 77

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 547

gcgcgctcgc tcgctcactg aggccgaaac gtcgggcgac ctttggtcgc ccggcctcag 60

tgagcgagcg agcgcgc 77

<210> 548

<400> 548

000

<210> 549

<400> 549

000

<210> 550

<400> 550

000

<210> 551

<400> 551

000

<210> 552

<400> 552

000

<210> 553

<400> 553

000

<210> 554

<400> 554

000

<210> 555

<400> 555

000

<210> 556

<400> 556

000

<210> 557

<400> 557

000

<210> 558

<211> 312

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 558

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

1 5 10 15

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

20 25 30

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

35 40 45

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ala

50 55 60

Pro Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

65 70 75 80

Asn Gly Tyr Glu Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

85 90 95

Gln Lys Arg Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

100 105 110

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

115 120 125

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

130 135 140

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

145 150 155 160

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

165 170 175

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

180 185 190

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

195 200 205

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

210 215 220

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

225 230 235 240

Glu Val Lys Glu Phe Phe Arg Trp Ala Gln Asp His Val Thr Glu Val

245 250 255

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Asn Lys Arg Pro Ala

260 265 270

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

275 280 285

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

290 295 300

Asp Leu Ala Arg Gly Gln Pro Leu

305 310

<210> 559

<211> 312

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 559

Met Glu Leu Val Gly Trp Leu Val Asp Lys Gly Ile Thr Ser Glu Lys

1 5 10 15

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

20 25 30

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

35 40 45

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Gln Gln

50 55 60

Pro Val Glu Asp Ile Ser Ser Asn Arg Ile Tyr Lys Ile Leu Glu Leu

65 70 75 80

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

85 90 95

Thr Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

100 105 110

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Thr Val Pro

115 120 125

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

130 135 140

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

145 150 155 160

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

165 170 175

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

180 185 190

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

195 200 205

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

210 215 220

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

225 230 235 240

Glu Val Lys Asp Phe Phe Arg Trp Ala Lys Asp His Val Val Glu Val

245 250 255

Glu His Glu Phe Tyr Val Lys Lys Gly Gly Ala Lys Lys Arg Pro Ala

260 265 270

Pro Ser Asp Ala Asp Ile Ser Glu Pro Lys Arg Val Arg Glu Ser Val

275 280 285

Ala Gln Pro Ser Thr Ser Asp Ala Glu Ala Ser Ile Asn Tyr Ala Asp

290 295 300

Arg Leu Ala Arg Gly His Ser Leu

305 310

<210> 560

<211> 311

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 560

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

1 5 10 15

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

20 25 30

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

35 40 45

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Ser Asn

50 55 60

Pro Pro Glu Asp Ile Thr Lys Asn Arg Ile Tyr Gln Ile Leu Glu Leu

65 70 75 80

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

85 90 95

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

100 105 110

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

115 120 125

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

130 135 140

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

145 150 155 160

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

165 170 175

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Glu Pro Thr Pro Val

180 185 190

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

195 200 205

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Glu Phe

210 215 220

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

225 230 235 240

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Asp Val

245 250 255

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Lys Lys Arg Pro Ala

260 265 270

Ser Asn Asp Ala Asp Val Ser Glu Pro Lys Arg Glu Cys Thr Ser Leu

275 280 285

Ala Gln Pro Thr Thr Ser Asp Ala Glu Ala Pro Ala Asp Tyr Ala Asp

290 295 300

Leu Ala Arg Gly Gln Pro Phe

305 310

<210> 561

<211> 311

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 561

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

1 5 10 15

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

20 25 30

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

35 40 45

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Ser Asn

50 55 60

Pro Pro Glu Asp Ile Thr Lys Asn Arg Ile Tyr Gln Ile Leu Glu Leu

65 70 75 80

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

85 90 95

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

100 105 110

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

115 120 125

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

130 135 140

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

145 150 155 160

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

165 170 175

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Glu Pro Thr Pro Val

180 185 190

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

195 200 205

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

210 215 220

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

225 230 235 240

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Asp Val

245 250 255

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Lys Lys Arg Pro Ala

260 265 270

Ser Asn Asp Ala Asp Val Ser Glu Pro Lys Arg Gln Cys Thr Ser Leu

275 280 285

Ala Gln Pro Thr Thr Ser Asp Ala Glu Ala Pro Ala Asp Tyr Ala Asp

290 295 300

Leu Ala Arg Gly Gln Pro Phe

305 310

<210> 562

<211> 311

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 562

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

1 5 10 15

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

20 25 30

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

35 40 45

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Gln Asn

50 55 60

Pro Pro Glu Asp Ile Ser Ser Asn Arg Ile Tyr Arg Ile Leu Glu Met

65 70 75 80

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

85 90 95

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

100 105 110

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

115 120 125

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

130 135 140

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

145 150 155 160

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

165 170 175

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

180 185 190

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

195 200 205

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

210 215 220

Glu Leu Thr Lys Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

225 230 235 240

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

245 250 255

Thr His Glu Phe Tyr Val Arg Lys Gly Gly Ala Arg Lys Arg Pro Ala

260 265 270

Pro Asn Asp Ala Asp Ile Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

275 280 285

Ala Gln Pro Ser Thr Ser Asp Ala Glu Ala Pro Val Asp Tyr Ala Asp

290 295 300

Leu Ala Arg Gly Gln Pro Leu

305 310

<210> 563

<211> 329

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 563

Met Ala Leu Val Asn Trp Leu Val Glu His Gly Ile Thr Ser Glu Lys

1 5 10 15

Gln Trp Ile Gln Glu Asn Gln Glu Ser Tyr Leu Ser Phe Asn Ser Thr

20 25 30

Gly Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Thr Lys

35 40 45

Ile Met Ser Leu Thr Lys Ser Ala Val Asp Tyr Leu Val Gly Ser Ser

50 55 60

Val Pro Glu Asp Ile Ser Lys Asn Arg Ile Trp Gln Ile Phe Glu Met

65 70 75 80

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Ile Leu Tyr Gly Trp Cys

85 90 95

Gln Arg Ser Phe Asn Lys Arg Asn Thr Val Trp Leu Tyr Gly Pro Ala

100 105 110

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Thr Val Pro

115 120 125

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

130 135 140

Cys Val Asp Lys Met Leu Ile Trp Trp Glu Glu Gly Lys Met Thr Asn

145 150 155 160

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

165 170 175

Val Asp Gln Lys Cys Lys Ser Ser Val Gln Ile Asp Ser Thr Pro Val

180 185 190

Ile Val Thr Ser Asn Thr Asn Met Cys Val Val Val Asp Gly Asn Ser

195 200 205

Thr Thr Phe Glu His Gln Gln Pro Leu Glu Asp Arg Met Phe Lys Phe

210 215 220

Glu Leu Thr Lys Arg Leu Pro Pro Asp Phe Gly Lys Ile Thr Lys Gln

225 230 235 240

Glu Val Lys Asp Phe Phe Ala Trp Ala Lys Val Asn Gln Val Pro Val

245 250 255

Thr His Glu Phe Lys Val Pro Arg Glu Leu Ala Gly Thr Lys Gly Ala

260 265 270

Glu Lys Ser Leu Lys Arg Pro Leu Gly Asp Val Thr Asn Thr Ser Tyr

275 280 285

Lys Ser Leu Glu Lys Arg Ala Arg Leu Ser Phe Val Pro Glu Thr Pro

290 295 300

Arg Ser Ser Asp Val Thr Val Asp Pro Ala Pro Leu Arg Pro Leu Asn

305 310 315 320

Trp Asn Ser Leu Val Gly Pro Ser Trp

325

<210> 564

<211> 312

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 564

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

1 5 10 15

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

20 25 30

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

35 40 45

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ala

50 55 60

Pro Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

65 70 75 80

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

85 90 95

Gln Lys Arg Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

100 105 110

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

115 120 125

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

130 135 140

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

145 150 155 160

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

165 170 175

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

180 185 190

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

195 200 205

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

210 215 220

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

225 230 235 240

Glu Val Lys Glu Phe Phe Arg Trp Ala Gln Asp His Val Thr Glu Val

245 250 255

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Asn Lys Arg Pro Ala

260 265 270

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

275 280 285

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

290 295 300

Asp Leu Ala Arg Gly Gln Pro Leu

305 310

<210> 565

<211> 312

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 565

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

1 5 10 15

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

20 25 30

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

35 40 45

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ser

50 55 60

Leu Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

65 70 75 80

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

85 90 95

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

100 105 110

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

115 120 125

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

130 135 140

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

145 150 155 160

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

165 170 175

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

180 185 190

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

195 200 205

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

210 215 220

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

225 230 235 240

Glu Val Lys Glu Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

245 250 255

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Ser Lys Arg Pro Ala

260 265 270

Pro Asp Asp Ala Asp Ile Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

275 280 285

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

290 295 300

Asp Leu Ala Arg Gly Gln Pro Leu

305 310

<210> 566

<211> 312

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 566

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

1 5 10 15

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

20 25 30

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

35 40 45

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ser

50 55 60

Leu Pro Ala Asp Ile Thr Gln Asn Arg Ile Tyr Arg Ile Leu Ala Leu

65 70 75 80

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

85 90 95

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

100 105 110

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

115 120 125

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

130 135 140

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

145 150 155 160

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

165 170 175

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

180 185 190

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

195 200 205

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

210 215 220

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

225 230 235 240

Glu Val Lys Glu Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

245 250 255

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Ser Lys Arg Pro Ala

260 265 270

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

275 280 285

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

290 295 300

Asp Leu Ala Arg Gly Gln Pro Leu

305 310

<210> 567

<211> 311

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<220>

<221> Modified amino acid

<222> (63)..(63)

<223> Any amino acid

<220>

<221> Modified amino acid

<222> (290)..(290)

<223> Any amino acid

<400> 567

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

1 5 10 15

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

20 25 30

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

35 40 45

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Xaa Ser

50 55 60

Pro Pro Glu Asp Ile Ser Thr Asn Arg Ile Tyr Arg Ile Leu Ala Leu

65 70 75 80

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

85 90 95

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

100 105 110

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

115 120 125

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

130 135 140

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

145 150 155 160

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

165 170 175

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

180 185 190

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

195 200 205

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

210 215 220

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

225 230 235 240

Glu Val Lys Glu Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

245 250 255

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Lys Lys Arg Pro Ala

260 265 270

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

275 280 285

Ala Xaa Pro Ser Thr Ser Asp Ala Glu Ala Pro Val Asp Phe Ala Asp

290 295 300

Leu Ala Arg Gly Gln Pro Leu

305 310

<210> 568

<211> 399

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 568

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

1 5 10 15

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

20 25 30

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

35 40 45

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ala

50 55 60

Pro Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

65 70 75 80

Asn Gly Tyr Glu Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

85 90 95

Gln Lys Arg Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

100 105 110

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

115 120 125

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

130 135 140

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

145 150 155 160

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

165 170 175

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

180 185 190

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

195 200 205

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

210 215 220

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

225 230 235 240

Glu Val Lys Glu Phe Phe Arg Trp Ala Gln Asp His Val Thr Glu Val

245 250 255

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Asn Lys Arg Pro Ala

260 265 270

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

275 280 285

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

290 295 300

Asp Arg Tyr Gln Asn Lys Cys Ser Arg His Ala Gly Met Leu Gln Met

305 310 315 320

Leu Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Asn Phe Asn Ile

325 330 335

Cys Phe Thr His Gly Thr Arg Asp Cys Ser Glu Cys Phe Pro Gly Val

340 345 350

Ser Glu Ser Gln Pro Val Val Arg Lys Arg Thr Tyr Arg Lys Leu Cys

355 360 365

Ala Ile His His Leu Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser Ala

370 375 380

Cys Asp Leu Val Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln

385 390 395

<210> 569

<211> 397

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 569

Met Glu Leu Val Gly Trp Leu Val Asp Lys Gly Ile Thr Ser Glu Lys

1 5 10 15

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

20 25 30

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

35 40 45

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Gln Gln

50 55 60

Pro Val Glu Asp Ile Ser Ser Asn Arg Ile Tyr Lys Ile Leu Glu Leu

65 70 75 80

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

85 90 95

Thr Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

100 105 110

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Thr Val Pro

115 120 125

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

130 135 140

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

145 150 155 160

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

165 170 175

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

180 185 190

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

195 200 205

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

210 215 220

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

225 230 235 240

Glu Val Lys Asp Phe Phe Arg Trp Ala Lys Asp His Val Val Glu Val

245 250 255

Glu His Glu Phe Tyr Val Lys Lys Gly Gly Ala Lys Lys Arg Pro Ala

260 265 270

Pro Ser Asp Ala Asp Ile Ser Glu Pro Lys Arg Val Arg Glu Ser Val

275 280 285

Ala Gln Pro Ser Thr Ser Asp Ala Glu Ala Ser Ile Asn Tyr Ala Asp

290 295 300

Arg Tyr Gln Asn Lys Cys Ser Arg His Val Gly Met Asn Leu Met Leu

305 310 315 320

Phe Pro Cys Arg Gln Cys Glu Arg Met Asn Gln Asn Ser Asn Ile Cys

325 330 335

Phe Thr His Gly Gln Lys Asp Cys Leu Glu Cys Phe Pro Val Ser Glu

340 345 350

Ser Gln Pro Val Ser Val Val Lys Lys Ala Tyr Gln Lys Leu Cys Tyr

355 360 365

Ile His His Ile Met Gly Lys Val Pro Asp Ala Cys Thr Ala Cys Asp

370 375 380

Leu Val Asn Val Asp Leu Asp Asp Cys Ile Phe Glu Gln

385 390 395

<210> 570

<211> 400

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 570

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

1 5 10 15

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

20 25 30

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

35 40 45

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Ser Asn

50 55 60

Pro Pro Glu Asp Ile Thr Lys Asn Arg Ile Tyr Gln Ile Leu Glu Leu

65 70 75 80

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

85 90 95

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

100 105 110

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

115 120 125

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

130 135 140

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

145 150 155 160

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

165 170 175

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Glu Pro Thr Pro Val

180 185 190

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

195 200 205

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Glu Phe

210 215 220

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

225 230 235 240

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Asp Val

245 250 255

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Lys Lys Arg Pro Ala

260 265 270

Ser Asn Asp Ala Asp Val Ser Glu Pro Lys Arg Glu Cys Thr Ser Leu

275 280 285

Ala Gln Pro Thr Thr Ser Asp Ala Glu Ala Pro Ala Asp Tyr Ala Asp

290 295 300

Arg Tyr Gln Asn Lys Cys Ser Arg His Val Gly Met Asn Leu Met Leu

305 310 315 320

Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Ile Ser Asn Val Cys

325 330 335

Phe Thr His Gly Gln Arg Asp Cys Gly Glu Cys Phe Pro Gly Met Ser

340 345 350

Glu Ser Gln Pro Val Ser Val Val Lys Lys Lys Thr Tyr Gln Lys Leu

355 360 365

Cys Pro Ile His His Ile Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser

370 375 380

Ala Cys Asp Leu Ala Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln

385 390 395 400

<210> 571

<211> 400

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 571

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

1 5 10 15

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

20 25 30

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

35 40 45

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Ser Asn

50 55 60

Pro Pro Glu Asp Ile Thr Lys Asn Arg Ile Tyr Gln Ile Leu Glu Leu

65 70 75 80

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

85 90 95

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

100 105 110

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

115 120 125

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

130 135 140

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

145 150 155 160

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

165 170 175

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Glu Pro Thr Pro Val

180 185 190

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

195 200 205

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

210 215 220

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

225 230 235 240

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Asp Val

245 250 255

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Lys Lys Arg Pro Ala

260 265 270

Ser Asn Asp Ala Asp Val Ser Glu Pro Lys Arg Gln Cys Thr Ser Leu

275 280 285

Ala Gln Pro Thr Thr Ser Asp Ala Glu Ala Pro Ala Asp Tyr Ala Asp

290 295 300

Arg Tyr Gln Asn Lys Cys Ser Arg His Val Gly Met Asn Leu Met Leu

305 310 315 320

Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Ile Ser Asn Val Cys

325 330 335

Phe Thr His Gly Gln Arg Asp Cys Gly Glu Cys Phe Pro Gly Met Ser

340 345 350

Glu Ser Gln Pro Val Ser Val Val Lys Lys Lys Thr Tyr Gln Lys Leu

355 360 365

Cys Pro Ile His His Ile Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser

370 375 380

Ala Cys Asp Leu Ala Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln

385 390 395 400

<210> 572

<211> 399

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 572

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

1 5 10 15

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

20 25 30

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

35 40 45

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Gln Asn

50 55 60

Pro Pro Glu Asp Ile Ser Ser Asn Arg Ile Tyr Arg Ile Leu Glu Met

65 70 75 80

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

85 90 95

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

100 105 110

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

115 120 125

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

130 135 140

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

145 150 155 160

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

165 170 175

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

180 185 190

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

195 200 205

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

210 215 220

Glu Leu Thr Lys Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

225 230 235 240

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

245 250 255

Thr His Glu Phe Tyr Val Arg Lys Gly Gly Ala Arg Lys Arg Pro Ala

260 265 270

Pro Asn Asp Ala Asp Ile Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

275 280 285

Ala Gln Pro Ser Thr Ser Asp Ala Glu Ala Pro Val Asp Tyr Ala Asp

290 295 300

Arg Tyr Gln Asn Lys Cys Ser Arg His Val Gly Met Asn Leu Met Leu

305 310 315 320

Phe Pro Cys Arg Gln Cys Glu Arg Met Asn Gln Asn Val Asp Ile Cys

325 330 335

Phe Thr His Gly Val Met Asp Cys Ala Glu Cys Phe Pro Val Ser Glu

340 345 350

Ser Gln Pro Val Ser Val Val Arg Lys Arg Thr Tyr Gln Lys Leu Cys

355 360 365

Pro Ile His His Ile Met Gly Arg Ala Pro Glu Val Ala Cys Ser Ala

370 375 380

Cys Glu Leu Ala Asn Val Asp Leu Asp Asp Cys Asp Met Glu Gln

385 390 395

<210> 573

<211> 390

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 573

Met Ala Leu Val Asn Trp Leu Val Glu His Gly Ile Thr Ser Glu Lys

1 5 10 15

Gln Trp Ile Gln Glu Asn Gln Glu Ser Tyr Leu Ser Phe Asn Ser Thr

20 25 30

Gly Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Thr Lys

35 40 45

Ile Met Ser Leu Thr Lys Ser Ala Val Asp Tyr Leu Val Gly Ser Ser

50 55 60

Val Pro Glu Asp Ile Ser Lys Asn Arg Ile Trp Gln Ile Phe Glu Met

65 70 75 80

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Ile Leu Tyr Gly Trp Cys

85 90 95

Gln Arg Ser Phe Asn Lys Arg Asn Thr Val Trp Leu Tyr Gly Pro Ala

100 105 110

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Thr Val Pro

115 120 125

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

130 135 140

Cys Val Asp Lys Met Leu Ile Trp Trp Glu Glu Gly Lys Met Thr Asn

145 150 155 160

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

165 170 175

Val Asp Gln Lys Cys Lys Ser Ser Val Gln Ile Asp Ser Thr Pro Val

180 185 190

Ile Val Thr Ser Asn Thr Asn Met Cys Val Val Val Asp Gly Asn Ser

195 200 205

Thr Thr Phe Glu His Gln Gln Pro Leu Glu Asp Arg Met Phe Lys Phe

210 215 220

Glu Leu Thr Lys Arg Leu Pro Pro Asp Phe Gly Lys Ile Thr Lys Gln

225 230 235 240

Glu Val Lys Asp Phe Phe Ala Trp Ala Lys Val Asn Gln Val Pro Val

245 250 255

Thr His Glu Phe Lys Val Pro Arg Glu Leu Ala Gly Thr Lys Gly Ala

260 265 270

Glu Lys Ser Leu Lys Arg Pro Leu Gly Asp Val Thr Asn Thr Ser Tyr

275 280 285

Lys Ser Leu Glu Lys Arg Ala Arg Leu Ser Phe Val Pro Glu Thr Pro

290 295 300

Arg Ser Ser Asp Val Thr Val Asp Pro Ala Pro Leu Arg Pro Leu Asn

305 310 315 320

Trp Asn Ser Arg Tyr Asp Cys Lys Cys Asp Tyr His Ala Gln Phe Asp

325 330 335

Asn Ile Ser Asn Lys Cys Asp Glu Cys Glu Tyr Leu Asn Arg Gly Lys

340 345 350

Asn Gly Cys Ile Cys His Asn Val Thr His Cys Gln Ile Cys His Gly

355 360 365

Ile Pro Pro Trp Glu Lys Glu Asn Leu Ser Asp Phe Gly Asp Phe Asp

370 375 380

Asp Ala Asn Lys Glu Gln

385 390

<210> 574

<211> 399

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 574

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

1 5 10 15

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

20 25 30

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

35 40 45

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ala

50 55 60

Pro Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

65 70 75 80

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

85 90 95

Gln Lys Arg Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

100 105 110

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

115 120 125

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

130 135 140

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

145 150 155 160

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

165 170 175

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

180 185 190

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

195 200 205

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

210 215 220

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

225 230 235 240

Glu Val Lys Glu Phe Phe Arg Trp Ala Gln Asp His Val Thr Glu Val

245 250 255

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Asn Lys Arg Pro Ala

260 265 270

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

275 280 285

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

290 295 300

Asp Arg Tyr Gln Asn Lys Cys Ser Arg His Ala Gly Met Leu Gln Met

305 310 315 320

Leu Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Asn Phe Asn Ile

325 330 335

Cys Phe Thr His Gly Thr Arg Asp Cys Ser Glu Cys Phe Pro Gly Val

340 345 350

Ser Glu Ser Gln Pro Val Val Arg Lys Arg Thr Tyr Arg Lys Leu Cys

355 360 365

Ala Ile His His Leu Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser Ala

370 375 380

Cys Asp Leu Val Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln

385 390 395

<210> 575

<211> 399

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 575

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

1 5 10 15

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

20 25 30

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

35 40 45

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ser

50 55 60

Leu Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

65 70 75 80

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

85 90 95

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

100 105 110

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

115 120 125

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

130 135 140

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

145 150 155 160

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

165 170 175

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

180 185 190

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

195 200 205

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

210 215 220

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

225 230 235 240

Glu Val Lys Glu Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

245 250 255

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Ser Lys Arg Pro Ala

260 265 270

Pro Asp Asp Ala Asp Ile Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

275 280 285

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

290 295 300

Asp Arg Tyr Gln Asn Lys Cys Ser Arg His Ala Gly Met Ile Gln Met

305 310 315 320

Leu Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Asn Phe Asn Ile

325 330 335

Cys Phe Thr His Gly Val Arg Asp Cys Leu Glu Cys Phe Pro Gly Val

340 345 350

Ser Glu Ser Gln Pro Val Val Arg Lys Lys Thr Tyr Arg Lys Leu Cys

355 360 365

Ala Ile His His Leu Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser Ala

370 375 380

Cys Asp Leu Val Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln

385 390 395

<210> 576

<211> 399

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 576

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

1 5 10 15

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

20 25 30

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

35 40 45

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ser

50 55 60

Leu Pro Ala Asp Ile Thr Gln Asn Arg Ile Tyr Arg Ile Leu Ala Leu

65 70 75 80

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

85 90 95

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

100 105 110

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

115 120 125

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

130 135 140

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

145 150 155 160

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

165 170 175

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

180 185 190

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

195 200 205

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

210 215 220

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

225 230 235 240

Glu Val Lys Glu Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

245 250 255

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Ser Lys Arg Pro Ala

260 265 270

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

275 280 285

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

290 295 300

Asp Arg Tyr Gln Asn Lys Cys Ser Arg His Ala Gly Met Leu Gln Met

305 310 315 320

Leu Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Asn Phe Asn Ile

325 330 335

Cys Phe Thr His Gly Val Arg Asp Cys Ser Glu Cys Phe Pro Gly Val

340 345 350

Ser Glu Ser Gln Pro Val Val Arg Lys Arg Thr Tyr Arg Lys Leu Cys

355 360 365

Ala Ile His His Leu Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser Ala

370 375 380

Cys Asp Leu Val Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln

385 390 395

<210> 577

<211> 398

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<220>

<221> Modified amino acid

<222> (63)..(63)

<223> Any amino acid

<220>

<221> Modified amino acid

<222> (317)..(317)

<223> Any amino acid

<220>

<221> Modified amino acid

<222> (333)..(333)

<223> Any amino acid

<220>

<221> Modified amino acid

<222> (341)..(341)

<223> Any amino acid

<220>

<221> Modified amino acid

<222> (345)..(345)

<223> Any amino acid

<220>

<221> Modified amino acid

<222> (356)..(356)

<223> Any amino acid

<220>

<221> Modified amino acid

<222> (364)..(364)

<223> Any amino acid

<220>

<221> Modified amino acid

<222> (368)..(368)

<223> Any amino acid

<400> 577

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

1 5 10 15

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

20 25 30

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

35 40 45

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Xaa Ser

50 55 60

Pro Pro Glu Asp Ile Ser Thr Asn Arg Ile Tyr Arg Ile Leu Ala Leu

65 70 75 80

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

85 90 95

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

100 105 110

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

115 120 125

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

130 135 140

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

145 150 155 160

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

165 170 175

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

180 185 190

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

195 200 205

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

210 215 220

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

225 230 235 240

Glu Val Lys Glu Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

245 250 255

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Lys Lys Arg Pro Ala

260 265 270

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

275 280 285

Ala Asp Pro Ser Thr Ser Asp Ala Glu Ala Pro Val Asp Phe Ala Asp

290 295 300

Arg Tyr Gln Asn Lys Cys Ser Arg His Ala Gly Met Xaa Gln Met Leu

305 310 315 320

Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Asn Xaa Asn Ile Cys

325 330 335

Phe Thr His Gly Xaa Arg Asp Cys Xaa Glu Cys Phe Pro Gly Val Ser

340 345 350

Glu Ser Gln Xaa Val Val Arg Lys Arg Thr Tyr Xaa Lys Leu Cys Xaa

355 360 365

Ile His His Leu Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser Ala Cys

370 375 380

Asp Leu Val Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln

385 390 395

<210> 578

<211> 536

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 578

Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp

1 5 10 15

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Ser Trp Val Ala Glu

20 25 30

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile

35 40 45

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu

50 55 60

Val Gln Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

65 70 75 80

Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Leu His Ile Leu Val Glu

85 90 95

Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile

100 105 110

Arg Asp Lys Leu Val Gln Thr Ile Tyr Arg Gly Ile Glu Pro Thr Leu

115 120 125

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

130 135 140

Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

145 150 155 160

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Glu Tyr Ile

165 170 175

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala Gln His

180 185 190

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Leu Asn

195 200 205

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

210 215 220

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

225 230 235 240

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

245 250 255

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

260 265 270

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ala

275 280 285

Pro Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

290 295 300

Asn Gly Tyr Glu Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

305 310 315 320

Gln Lys Arg Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

325 330 335

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

340 345 350

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

355 360 365

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

370 375 380

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

385 390 395 400

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

405 410 415

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

420 425 430

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

435 440 445

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

450 455 460

Glu Val Lys Glu Phe Phe Arg Trp Ala Gln Asp His Val Thr Glu Val

465 470 475 480

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Asn Lys Arg Pro Ala

485 490 495

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

500 505 510

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

515 520 525

Asp Leu Ala Arg Gly Gln Pro Leu

530 535

<210> 579

<211> 536

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 579

Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp

1 5 10 15

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asn Trp Val Ala Glu

20 25 30

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile

35 40 45

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu

50 55 60

Thr Glu Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

65 70 75 80

Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Met His Val Leu Val Glu

85 90 95

Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile

100 105 110

Arg Glu Lys Leu Ile Gln Arg Ile Tyr Arg Gly Ile Glu Pro Thr Leu

115 120 125

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

130 135 140

Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

145 150 155 160

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Gln Tyr Leu

165 170 175

Ser Ala Cys Leu Asn Leu Thr Glu Arg Lys Arg Leu Val Ala Gln His

180 185 190

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Gln Asn

195 200 205

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

210 215 220

Met Glu Leu Val Gly Trp Leu Val Asp Lys Gly Ile Thr Ser Glu Lys

225 230 235 240

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

245 250 255

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

260 265 270

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Gln Gln

275 280 285

Pro Val Glu Asp Ile Ser Ser Asn Arg Ile Tyr Lys Ile Leu Glu Leu

290 295 300

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

305 310 315 320

Thr Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

325 330 335

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Thr Val Pro

340 345 350

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

355 360 365

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

370 375 380

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

385 390 395 400

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

405 410 415

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

420 425 430

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

435 440 445

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

450 455 460

Glu Val Lys Asp Phe Phe Arg Trp Ala Lys Asp His Val Val Glu Val

465 470 475 480

Glu His Glu Phe Tyr Val Lys Lys Gly Gly Ala Lys Lys Arg Pro Ala

485 490 495

Pro Ser Asp Ala Asp Ile Ser Glu Pro Lys Arg Val Arg Glu Ser Val

500 505 510

Ala Gln Pro Ser Thr Ser Asp Ala Glu Ala Ser Ile Asn Tyr Ala Asp

515 520 525

Arg Leu Ala Arg Gly His Ser Leu

530 535

<210> 580

<211> 535

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 580

Met Pro Gly Phe Tyr Glu Ile Val Leu Lys Val Pro Ser Asp Leu Asp

1 5 10 15

Glu Arg Leu Pro Gly Ile Ser Asn Ser Phe Val Asn Trp Val Ala Glu

20 25 30

Lys Glu Trp Asp Val Pro Pro Asp Ser Asp Met Asp Pro Asn Leu Ile

35 40 45

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Glu Phe Leu

50 55 60

Val Glu Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

65 70 75 80

Gln Phe Glu Lys Gly Glu Thr Tyr Phe His Leu His Val Leu Ile Glu

85 90 95

Thr Ile Gly Val Lys Ser Met Val Val Gly Arg Tyr Val Ser Gln Ile

100 105 110

Lys Glu Lys Leu Val Thr Arg Ile Tyr Arg Gly Val Glu Pro Gln Leu

115 120 125

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

130 135 140

Asn Lys Val Val Asp Asp Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

145 150 155 160

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Asp Gln Tyr Leu

165 170 175

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala Gln His

180 185 190

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Gln Asn

195 200 205

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

210 215 220

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

225 230 235 240

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

245 250 255

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

260 265 270

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Ser Asn

275 280 285

Pro Pro Glu Asp Ile Thr Lys Asn Arg Ile Tyr Gln Ile Leu Glu Leu

290 295 300

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

305 310 315 320

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

325 330 335

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

340 345 350

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

355 360 365

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

370 375 380

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

385 390 395 400

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Glu Pro Thr Pro Val

405 410 415

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

420 425 430

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Glu Phe

435 440 445

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

450 455 460

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Asp Val

465 470 475 480

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Lys Lys Arg Pro Ala

485 490 495

Ser Asn Asp Ala Asp Val Ser Glu Pro Lys Arg Glu Cys Thr Ser Leu

500 505 510

Ala Gln Pro Thr Thr Ser Asp Ala Glu Ala Pro Ala Asp Tyr Ala Asp

515 520 525

Leu Ala Arg Gly Gln Pro Phe

530 535

<210> 581

<211> 535

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 581

Met Pro Gly Phe Tyr Glu Ile Val Leu Lys Val Pro Ser Asp Leu Asp

1 5 10 15

Glu His Leu Pro Gly Ile Ser Asn Ser Phe Val Asn Trp Val Ala Glu

20 25 30

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Pro Asn Leu Ile

35 40 45

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Glu Phe Leu

50 55 60

Val Glu Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

65 70 75 80

Gln Phe Glu Lys Gly Glu Thr Tyr Phe His Leu His Val Leu Ile Glu

85 90 95

Thr Ile Gly Val Lys Ser Met Val Val Gly Arg Tyr Val Ser Gln Ile

100 105 110

Lys Glu Lys Leu Val Thr Arg Ile Tyr Arg Gly Val Glu Pro Gln Leu

115 120 125

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

130 135 140

Asn Lys Val Val Asp Asp Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

145 150 155 160

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Asp Gln Tyr Leu

165 170 175

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala Gln His

180 185 190

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Gln Asn

195 200 205

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

210 215 220

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

225 230 235 240

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

245 250 255

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

260 265 270

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Ser Asn

275 280 285

Pro Pro Glu Asp Ile Thr Lys Asn Arg Ile Tyr Gln Ile Leu Glu Leu

290 295 300

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

305 310 315 320

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

325 330 335

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

340 345 350

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

355 360 365

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

370 375 380

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

385 390 395 400

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Glu Pro Thr Pro Val

405 410 415

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

420 425 430

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

435 440 445

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

450 455 460

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Asp Val

465 470 475 480

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Lys Lys Arg Pro Ala

485 490 495

Ser Asn Asp Ala Asp Val Ser Glu Pro Lys Arg Gln Cys Thr Ser Leu

500 505 510

Ala Gln Pro Thr Thr Ser Asp Ala Glu Ala Pro Ala Asp Tyr Ala Asp

515 520 525

Leu Ala Arg Gly Gln Pro Phe

530 535

<210> 582

<211> 535

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 582

Met Pro Gly Phe Tyr Glu Ile Val Leu Lys Val Pro Ser Asp Leu Asp

1 5 10 15

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Ser Trp Val Ala Glu

20 25 30

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile

35 40 45

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Glu Phe Leu

50 55 60

Val Glu Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

65 70 75 80

Gln Phe Glu Lys Gly Asp Ser Tyr Phe His Leu His Ile Leu Val Glu

85 90 95

Thr Val Gly Val Lys Ser Met Val Val Gly Arg Tyr Val Ser Gln Ile

100 105 110

Lys Glu Lys Leu Val Thr Arg Ile Tyr Arg Gly Val Glu Pro Gln Leu

115 120 125

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

130 135 140

Asn Lys Val Val Asp Asp Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

145 150 155 160

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Asp Gln Tyr Ile

165 170 175

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala Gln His

180 185 190

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Gln Asn

195 200 205

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

210 215 220

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

225 230 235 240

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

245 250 255

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

260 265 270

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Gln Asn

275 280 285

Pro Pro Glu Asp Ile Ser Ser Asn Arg Ile Tyr Arg Ile Leu Glu Met

290 295 300

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

305 310 315 320

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

325 330 335

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

340 345 350

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

355 360 365

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

370 375 380

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

385 390 395 400

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

405 410 415

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

420 425 430

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

435 440 445

Glu Leu Thr Lys Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

450 455 460

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

465 470 475 480

Thr His Glu Phe Tyr Val Arg Lys Gly Gly Ala Arg Lys Arg Pro Ala

485 490 495

Pro Asn Asp Ala Asp Ile Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

500 505 510

Ala Gln Pro Ser Thr Ser Asp Ala Glu Ala Pro Val Asp Tyr Ala Asp

515 520 525

Leu Ala Arg Gly Gln Pro Leu

530 535

<210> 583

<211> 549

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 583

Met Ala Thr Phe Tyr Glu Val Ile Val Arg Val Pro Phe Asp Val Glu

1 5 10 15

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asp Trp Val Thr Gly

20 25 30

Gln Ile Trp Glu Leu Pro Pro Glu Ser Asp Leu Asn Leu Thr Leu Val

35 40 45

Glu Gln Pro Gln Leu Thr Val Ala Asp Arg Ile Arg Arg Val Phe Leu

50 55 60

Tyr Glu Trp Asn Lys Phe Ser Lys Gln Glu Ser Lys Phe Phe Val Gln

65 70 75 80

Phe Glu Lys Gly Ser Glu Tyr Phe His Leu His Thr Leu Val Glu Thr

85 90 95

Ser Gly Ile Ser Ser Met Val Leu Gly Arg Tyr Val Ser Gln Ile Arg

100 105 110

Ala Gln Leu Val Lys Val Val Phe Gln Gly Ile Glu Pro Gln Ile Asn

115 120 125

Asp Trp Val Ala Ile Thr Lys Val Lys Lys Gly Gly Ala Asn Lys Val

130 135 140

Val Asp Ser Gly Tyr Ile Pro Ala Tyr Leu Leu Pro Lys Val Gln Pro

145 150 155 160

Glu Leu Gln Trp Ala Trp Thr Asn Leu Asp Glu Tyr Lys Leu Ala Ala

165 170 175

Leu Asn Leu Glu Glu Arg Lys Arg Leu Val Ala Gln Phe Leu Ala Glu

180 185 190

Ser Ser Gln Arg Ser Gln Glu Ala Ala Ser Gln Arg Glu Phe Ser Ala

195 200 205

Asp Pro Val Ile Lys Ser Lys Thr Ser Gln Lys Tyr Met Ala Leu Val

210 215 220

Asn Trp Leu Val Glu His Gly Ile Thr Ser Glu Lys Gln Trp Ile Gln

225 230 235 240

Glu Asn Gln Glu Ser Tyr Leu Ser Phe Asn Ser Thr Gly Asn Ser Arg

245 250 255

Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Thr Lys Ile Met Ser Leu

260 265 270

Thr Lys Ser Ala Val Asp Tyr Leu Val Gly Ser Ser Val Pro Glu Asp

275 280 285

Ile Ser Lys Asn Arg Ile Trp Gln Ile Phe Glu Met Asn Gly Tyr Asp

290 295 300

Pro Ala Tyr Ala Gly Ser Ile Leu Tyr Gly Trp Cys Gln Arg Ser Phe

305 310 315 320

Asn Lys Arg Asn Thr Val Trp Leu Tyr Gly Pro Ala Thr Thr Gly Lys

325 330 335

Thr Asn Ile Ala Glu Ala Ile Ala His Thr Val Pro Phe Tyr Gly Cys

340 345 350

Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp Cys Val Asp Lys

355 360 365

Met Leu Ile Trp Trp Glu Glu Gly Lys Met Thr Asn Lys Val Val Glu

370 375 380

Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg Val Asp Gln Lys

385 390 395 400

Cys Lys Ser Ser Val Gln Ile Asp Ser Thr Pro Val Ile Val Thr Ser

405 410 415

Asn Thr Asn Met Cys Val Val Val Asp Gly Asn Ser Thr Thr Phe Glu

420 425 430

His Gln Gln Pro Leu Glu Asp Arg Met Phe Lys Phe Glu Leu Thr Lys

435 440 445

Arg Leu Pro Pro Asp Phe Gly Lys Ile Thr Lys Gln Glu Val Lys Asp

450 455 460

Phe Phe Ala Trp Ala Lys Val Asn Gln Val Pro Val Thr His Glu Phe

465 470 475 480

Lys Val Pro Arg Glu Leu Ala Gly Thr Lys Gly Ala Glu Lys Ser Leu

485 490 495

Lys Arg Pro Leu Gly Asp Val Thr Asn Thr Ser Tyr Lys Ser Leu Glu

500 505 510

Lys Arg Ala Arg Leu Ser Phe Val Pro Glu Thr Pro Arg Ser Ser Asp

515 520 525

Val Thr Val Asp Pro Ala Pro Leu Arg Pro Leu Asn Trp Asn Ser Leu

530 535 540

Val Gly Pro Ser Trp

545

<210> 584

<211> 536

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 584

Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp

1 5 10 15

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asn Trp Val Ala Glu

20 25 30

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile

35 40 45

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu

50 55 60

Val Gln Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

65 70 75 80

Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Leu His Ile Leu Val Glu

85 90 95

Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile

100 105 110

Arg Asp Lys Leu Val Gln Thr Ile Tyr Arg Gly Ile Glu Pro Thr Leu

115 120 125

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

130 135 140

Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

145 150 155 160

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Glu Tyr Ile

165 170 175

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala His Asp

180 185 190

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Leu Asn

195 200 205

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

210 215 220

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

225 230 235 240

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

245 250 255

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

260 265 270

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ala

275 280 285

Pro Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

290 295 300

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

305 310 315 320

Gln Lys Arg Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

325 330 335

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

340 345 350

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

355 360 365

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

370 375 380

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

385 390 395 400

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

405 410 415

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

420 425 430

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

435 440 445

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

450 455 460

Glu Val Lys Glu Phe Phe Arg Trp Ala Gln Asp His Val Thr Glu Val

465 470 475 480

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Asn Lys Arg Pro Ala

485 490 495

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

500 505 510

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

515 520 525

Asp Leu Ala Arg Gly Gln Pro Leu

530 535

<210> 585

<211> 536

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 585

Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp

1 5 10 15

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asn Trp Val Ala Glu

20 25 30

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile

35 40 45

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu

50 55 60

Val Gln Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

65 70 75 80

Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Leu His Val Leu Val Glu

85 90 95

Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile

100 105 110

Arg Glu Lys Leu Val Gln Thr Ile Tyr Arg Gly Val Glu Pro Thr Leu

115 120 125

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

130 135 140

Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

145 150 155 160

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Glu Tyr Ile

165 170 175

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala Gln His

180 185 190

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Leu Asn

195 200 205

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

210 215 220

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

225 230 235 240

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

245 250 255

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

260 265 270

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ser

275 280 285

Leu Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

290 295 300

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

305 310 315 320

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

325 330 335

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

340 345 350

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

355 360 365

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

370 375 380

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

385 390 395 400

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

405 410 415

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

420 425 430

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

435 440 445

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

450 455 460

Glu Val Lys Glu Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

465 470 475 480

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Ser Lys Arg Pro Ala

485 490 495

Pro Asp Asp Ala Asp Ile Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

500 505 510

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

515 520 525

Asp Leu Ala Arg Gly Gln Pro Leu

530 535

<210> 586

<211> 538

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 586

Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp

1 5 10 15

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asn Trp Val Ala Glu

20 25 30

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Arg Asn Leu Ile

35 40 45

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu

50 55 60

Val Gln Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

65 70 75 80

Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Leu His Val Leu Val Glu

85 90 95

Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile

100 105 110

Arg Glu Lys Leu Gly Pro Asp His Leu Pro Ala Gly Ser Ser Pro Thr

115 120 125

Leu Pro Asn Trp Phe Ala Val Thr Lys Asp Ala Val Met Ala Pro Ala

130 135 140

Gly Gly Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu

145 150 155 160

Pro Lys Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Glu

165 170 175

Tyr Ile Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala

180 185 190

Gln His Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn

195 200 205

Leu Asn Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala

210 215 220

Arg Tyr Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser

225 230 235 240

Glu Lys Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn

245 250 255

Ala Ala Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala

260 265 270

Gly Lys Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly

275 280 285

Pro Ser Leu Pro Ala Asp Ile Thr Gln Asn Arg Ile Tyr Arg Ile Leu

290 295 300

Ala Leu Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly

305 310 315 320

Trp Ala Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly

325 330 335

Pro Ala Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala

340 345 350

Val Pro Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe

355 360 365

Asn Asp Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met

370 375 380

Thr Ala Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys

385 390 395 400

Val Arg Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr

405 410 415

Pro Val Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly

420 425 430

Asn Ser Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe

435 440 445

Lys Phe Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr

450 455 460

Lys Gln Glu Val Lys Glu Phe Phe Arg Trp Ala Ser Asp His Val Thr

465 470 475 480

Glu Val Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Ser Lys Arg

485 490 495

Pro Ala Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro

500 505 510

Ser Val Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp

515 520 525

Phe Ala Asp Leu Ala Arg Gly Gln Pro Leu

530 535

<210> 587

<211> 623

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 587

Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp

1 5 10 15

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Ser Trp Val Ala Glu

20 25 30

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile

35 40 45

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu

50 55 60

Val Gln Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

65 70 75 80

Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Leu His Ile Leu Val Glu

85 90 95

Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile

100 105 110

Arg Asp Lys Leu Val Gln Thr Ile Tyr Arg Gly Ile Glu Pro Thr Leu

115 120 125

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

130 135 140

Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

145 150 155 160

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Glu Tyr Ile

165 170 175

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala Gln His

180 185 190

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Leu Asn

195 200 205

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

210 215 220

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

225 230 235 240

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

245 250 255

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

260 265 270

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ala

275 280 285

Pro Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

290 295 300

Asn Gly Tyr Glu Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

305 310 315 320

Gln Lys Arg Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

325 330 335

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

340 345 350

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

355 360 365

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

370 375 380

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

385 390 395 400

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

405 410 415

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

420 425 430

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

435 440 445

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

450 455 460

Glu Val Lys Glu Phe Phe Arg Trp Ala Gln Asp His Val Thr Glu Val

465 470 475 480

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Asn Lys Arg Pro Ala

485 490 495

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

500 505 510

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

515 520 525

Asp Arg Tyr Gln Asn Lys Cys Ser Arg His Ala Gly Met Leu Gln Met

530 535 540

Leu Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Asn Phe Asn Ile

545 550 555 560

Cys Phe Thr His Gly Thr Arg Asp Cys Ser Glu Cys Phe Pro Gly Val

565 570 575

Ser Glu Ser Gln Pro Val Val Arg Lys Arg Thr Tyr Arg Lys Leu Cys

580 585 590

Ala Ile His His Leu Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser Ala

595 600 605

Cys Asp Leu Val Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln

610 615 620

<210> 588

<211> 621

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 588

Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp

1 5 10 15

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asn Trp Val Ala Glu

20 25 30

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile

35 40 45

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu

50 55 60

Thr Glu Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

65 70 75 80

Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Met His Val Leu Val Glu

85 90 95

Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile

100 105 110

Arg Glu Lys Leu Ile Gln Arg Ile Tyr Arg Gly Ile Glu Pro Thr Leu

115 120 125

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

130 135 140

Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

145 150 155 160

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Gln Tyr Leu

165 170 175

Ser Ala Cys Leu Asn Leu Thr Glu Arg Lys Arg Leu Val Ala Gln His

180 185 190

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Gln Asn

195 200 205

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

210 215 220

Met Glu Leu Val Gly Trp Leu Val Asp Lys Gly Ile Thr Ser Glu Lys

225 230 235 240

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

245 250 255

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

260 265 270

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Gln Gln

275 280 285

Pro Val Glu Asp Ile Ser Ser Asn Arg Ile Tyr Lys Ile Leu Glu Leu

290 295 300

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

305 310 315 320

Thr Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

325 330 335

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Thr Val Pro

340 345 350

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

355 360 365

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

370 375 380

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

385 390 395 400

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

405 410 415

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

420 425 430

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

435 440 445

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

450 455 460

Glu Val Lys Asp Phe Phe Arg Trp Ala Lys Asp His Val Val Glu Val

465 470 475 480

Glu His Glu Phe Tyr Val Lys Lys Gly Gly Ala Lys Lys Arg Pro Ala

485 490 495

Pro Ser Asp Ala Asp Ile Ser Glu Pro Lys Arg Val Arg Glu Ser Val

500 505 510

Ala Gln Pro Ser Thr Ser Asp Ala Glu Ala Ser Ile Asn Tyr Ala Asp

515 520 525

Arg Tyr Gln Asn Lys Cys Ser Arg His Val Gly Met Asn Leu Met Leu

530 535 540

Phe Pro Cys Arg Gln Cys Glu Arg Met Asn Gln Asn Ser Asn Ile Cys

545 550 555 560

Phe Thr His Gly Gln Lys Asp Cys Leu Glu Cys Phe Pro Val Ser Glu

565 570 575

Ser Gln Pro Val Ser Val Val Lys Lys Ala Tyr Gln Lys Leu Cys Tyr

580 585 590

Ile His His Ile Met Gly Lys Val Pro Asp Ala Cys Thr Ala Cys Asp

595 600 605

Leu Val Asn Val Asp Leu Asp Asp Cys Ile Phe Glu Gln

610 615 620

<210> 589

<211> 624

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 589

Met Pro Gly Phe Tyr Glu Ile Val Leu Lys Val Pro Ser Asp Leu Asp

1 5 10 15

Glu Arg Leu Pro Gly Ile Ser Asn Ser Phe Val Asn Trp Val Ala Glu

20 25 30

Lys Glu Trp Asp Val Pro Pro Asp Ser Asp Met Asp Pro Asn Leu Ile

35 40 45

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Glu Phe Leu

50 55 60

Val Glu Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

65 70 75 80

Gln Phe Glu Lys Gly Glu Thr Tyr Phe His Leu His Val Leu Ile Glu

85 90 95

Thr Ile Gly Val Lys Ser Met Val Val Gly Arg Tyr Val Ser Gln Ile

100 105 110

Lys Glu Lys Leu Val Thr Arg Ile Tyr Arg Gly Val Glu Pro Gln Leu

115 120 125

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

130 135 140

Asn Lys Val Val Asp Asp Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

145 150 155 160

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Asp Gln Tyr Leu

165 170 175

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala Gln His

180 185 190

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Gln Asn

195 200 205

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

210 215 220

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

225 230 235 240

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

245 250 255

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

260 265 270

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Ser Asn

275 280 285

Pro Pro Glu Asp Ile Thr Lys Asn Arg Ile Tyr Gln Ile Leu Glu Leu

290 295 300

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

305 310 315 320

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

325 330 335

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

340 345 350

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

355 360 365

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

370 375 380

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

385 390 395 400

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Glu Pro Thr Pro Val

405 410 415

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

420 425 430

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Glu Phe

435 440 445

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

450 455 460

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Asp Val

465 470 475 480

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Lys Lys Arg Pro Ala

485 490 495

Ser Asn Asp Ala Asp Val Ser Glu Pro Lys Arg Glu Cys Thr Ser Leu

500 505 510

Ala Gln Pro Thr Thr Ser Asp Ala Glu Ala Pro Ala Asp Tyr Ala Asp

515 520 525

Arg Tyr Gln Asn Lys Cys Ser Arg His Val Gly Met Asn Leu Met Leu

530 535 540

Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Ile Ser Asn Val Cys

545 550 555 560

Phe Thr His Gly Gln Arg Asp Cys Gly Glu Cys Phe Pro Gly Met Ser

565 570 575

Glu Ser Gln Pro Val Ser Val Val Lys Lys Lys Thr Tyr Gln Lys Leu

580 585 590

Cys Pro Ile His His Ile Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser

595 600 605

Ala Cys Asp Leu Ala Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln

610 615 620

<210> 590

<211> 624

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 590

Met Pro Gly Phe Tyr Glu Ile Val Leu Lys Val Pro Ser Asp Leu Asp

1 5 10 15

Glu His Leu Pro Gly Ile Ser Asn Ser Phe Val Asn Trp Val Ala Glu

20 25 30

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Pro Asn Leu Ile

35 40 45

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Glu Phe Leu

50 55 60

Val Glu Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

65 70 75 80

Gln Phe Glu Lys Gly Glu Thr Tyr Phe His Leu His Val Leu Ile Glu

85 90 95

Thr Ile Gly Val Lys Ser Met Val Val Gly Arg Tyr Val Ser Gln Ile

100 105 110

Lys Glu Lys Leu Val Thr Arg Ile Tyr Arg Gly Val Glu Pro Gln Leu

115 120 125

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

130 135 140

Asn Lys Val Val Asp Asp Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

145 150 155 160

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Asp Gln Tyr Leu

165 170 175

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala Gln His

180 185 190

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Gln Asn

195 200 205

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

210 215 220

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

225 230 235 240

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

245 250 255

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

260 265 270

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Ser Asn

275 280 285

Pro Pro Glu Asp Ile Thr Lys Asn Arg Ile Tyr Gln Ile Leu Glu Leu

290 295 300

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

305 310 315 320

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

325 330 335

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

340 345 350

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

355 360 365

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

370 375 380

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

385 390 395 400

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Glu Pro Thr Pro Val

405 410 415

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

420 425 430

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

435 440 445

Glu Leu Thr Arg Arg Leu Asp His Asp Phe Gly Lys Val Thr Lys Gln

450 455 460

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Asp Val

465 470 475 480

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Lys Lys Arg Pro Ala

485 490 495

Ser Asn Asp Ala Asp Val Ser Glu Pro Lys Arg Gln Cys Thr Ser Leu

500 505 510

Ala Gln Pro Thr Thr Ser Asp Ala Glu Ala Pro Ala Asp Tyr Ala Asp

515 520 525

Arg Tyr Gln Asn Lys Cys Ser Arg His Val Gly Met Asn Leu Met Leu

530 535 540

Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Ile Ser Asn Val Cys

545 550 555 560

Phe Thr His Gly Gln Arg Asp Cys Gly Glu Cys Phe Pro Gly Met Ser

565 570 575

Glu Ser Gln Pro Val Ser Val Val Lys Lys Lys Thr Tyr Gln Lys Leu

580 585 590

Cys Pro Ile His His Ile Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser

595 600 605

Ala Cys Asp Leu Ala Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln

610 615 620

<210> 591

<211> 623

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 591

Met Pro Gly Phe Tyr Glu Ile Val Leu Lys Val Pro Ser Asp Leu Asp

1 5 10 15

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Ser Trp Val Ala Glu

20 25 30

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile

35 40 45

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Glu Phe Leu

50 55 60

Val Glu Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

65 70 75 80

Gln Phe Glu Lys Gly Asp Ser Tyr Phe His Leu His Ile Leu Val Glu

85 90 95

Thr Val Gly Val Lys Ser Met Val Val Gly Arg Tyr Val Ser Gln Ile

100 105 110

Lys Glu Lys Leu Val Thr Arg Ile Tyr Arg Gly Val Glu Pro Gln Leu

115 120 125

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

130 135 140

Asn Lys Val Val Asp Asp Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

145 150 155 160

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Asp Gln Tyr Ile

165 170 175

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala Gln His

180 185 190

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Gln Asn

195 200 205

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

210 215 220

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

225 230 235 240

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

245 250 255

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Ser Lys

260 265 270

Ile Met Ser Leu Thr Lys Thr Ala Pro Asp Tyr Leu Val Gly Gln Asn

275 280 285

Pro Pro Glu Asp Ile Ser Ser Asn Arg Ile Tyr Arg Ile Leu Glu Met

290 295 300

Asn Gly Tyr Asp Pro Gln Tyr Ala Ala Ser Val Phe Leu Gly Trp Ala

305 310 315 320

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

325 330 335

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

340 345 350

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

355 360 365

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

370 375 380

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

385 390 395 400

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

405 410 415

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

420 425 430

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

435 440 445

Glu Leu Thr Lys Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

450 455 460

Glu Val Lys Asp Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

465 470 475 480

Thr His Glu Phe Tyr Val Arg Lys Gly Gly Ala Arg Lys Arg Pro Ala

485 490 495

Pro Asn Asp Ala Asp Ile Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

500 505 510

Ala Gln Pro Ser Thr Ser Asp Ala Glu Ala Pro Val Asp Tyr Ala Asp

515 520 525

Arg Tyr Gln Asn Lys Cys Ser Arg His Val Gly Met Asn Leu Met Leu

530 535 540

Phe Pro Cys Arg Gln Cys Glu Arg Met Asn Gln Asn Val Asp Ile Cys

545 550 555 560

Phe Thr His Gly Val Met Asp Cys Ala Glu Cys Phe Pro Val Ser Glu

565 570 575

Ser Gln Pro Val Ser Val Val Arg Lys Arg Thr Tyr Gln Lys Leu Cys

580 585 590

Pro Ile His His Ile Met Gly Arg Ala Pro Glu Val Ala Cys Ser Ala

595 600 605

Cys Glu Leu Ala Asn Val Asp Leu Asp Asp Cys Asp Met Glu Gln

610 615 620

<210> 592

<211> 610

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 592

Met Ala Thr Phe Tyr Glu Val Ile Val Arg Val Pro Phe Asp Val Glu

1 5 10 15

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asp Trp Val Thr Gly

20 25 30

Gln Ile Trp Glu Leu Pro Pro Glu Ser Asp Leu Asn Leu Thr Leu Val

35 40 45

Glu Gln Pro Gln Leu Thr Val Ala Asp Arg Ile Arg Arg Val Phe Leu

50 55 60

Tyr Glu Trp Asn Lys Phe Ser Lys Gln Glu Ser Lys Phe Phe Val Gln

65 70 75 80

Phe Glu Lys Gly Ser Glu Tyr Phe His Leu His Thr Leu Val Glu Thr

85 90 95

Ser Gly Ile Ser Ser Met Val Leu Gly Arg Tyr Val Ser Gln Ile Arg

100 105 110

Ala Gln Leu Val Lys Val Val Phe Gln Gly Ile Glu Pro Gln Ile Asn

115 120 125

Asp Trp Val Ala Ile Thr Lys Val Lys Lys Gly Gly Ala Asn Lys Val

130 135 140

Val Asp Ser Gly Tyr Ile Pro Ala Tyr Leu Leu Pro Lys Val Gln Pro

145 150 155 160

Glu Leu Gln Trp Ala Trp Thr Asn Leu Asp Glu Tyr Lys Leu Ala Ala

165 170 175

Leu Asn Leu Glu Glu Arg Lys Arg Leu Val Ala Gln Phe Leu Ala Glu

180 185 190

Ser Ser Gln Arg Ser Gln Glu Ala Ala Ser Gln Arg Glu Phe Ser Ala

195 200 205

Asp Pro Val Ile Lys Ser Lys Thr Ser Gln Lys Tyr Met Ala Leu Val

210 215 220

Asn Trp Leu Val Glu His Gly Ile Thr Ser Glu Lys Gln Trp Ile Gln

225 230 235 240

Glu Asn Gln Glu Ser Tyr Leu Ser Phe Asn Ser Thr Gly Asn Ser Arg

245 250 255

Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Thr Lys Ile Met Ser Leu

260 265 270

Thr Lys Ser Ala Val Asp Tyr Leu Val Gly Ser Ser Val Pro Glu Asp

275 280 285

Ile Ser Lys Asn Arg Ile Trp Gln Ile Phe Glu Met Asn Gly Tyr Asp

290 295 300

Pro Ala Tyr Ala Gly Ser Ile Leu Tyr Gly Trp Cys Gln Arg Ser Phe

305 310 315 320

Asn Lys Arg Asn Thr Val Trp Leu Tyr Gly Pro Ala Thr Thr Gly Lys

325 330 335

Thr Asn Ile Ala Glu Ala Ile Ala His Thr Val Pro Phe Tyr Gly Cys

340 345 350

Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp Cys Val Asp Lys

355 360 365

Met Leu Ile Trp Trp Glu Glu Gly Lys Met Thr Asn Lys Val Val Glu

370 375 380

Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg Val Asp Gln Lys

385 390 395 400

Cys Lys Ser Ser Val Gln Ile Asp Ser Thr Pro Val Ile Val Thr Ser

405 410 415

Asn Thr Asn Met Cys Val Val Val Asp Gly Asn Ser Thr Thr Phe Glu

420 425 430

His Gln Gln Pro Leu Glu Asp Arg Met Phe Lys Phe Glu Leu Thr Lys

435 440 445

Arg Leu Pro Pro Asp Phe Gly Lys Ile Thr Lys Gln Glu Val Lys Asp

450 455 460

Phe Phe Ala Trp Ala Lys Val Asn Gln Val Pro Val Thr His Glu Phe

465 470 475 480

Lys Val Pro Arg Glu Leu Ala Gly Thr Lys Gly Ala Glu Lys Ser Leu

485 490 495

Lys Arg Pro Leu Gly Asp Val Thr Asn Thr Ser Tyr Lys Ser Leu Glu

500 505 510

Lys Arg Ala Arg Leu Ser Phe Val Pro Glu Thr Pro Arg Ser Ser Asp

515 520 525

Val Thr Val Asp Pro Ala Pro Leu Arg Pro Leu Asn Trp Asn Ser Arg

530 535 540

Tyr Asp Cys Lys Cys Asp Tyr His Ala Gln Phe Asp Asn Ile Ser Asn

545 550 555 560

Lys Cys Asp Glu Cys Glu Tyr Leu Asn Arg Gly Lys Asn Gly Cys Ile

565 570 575

Cys His Asn Val Thr His Cys Gln Ile Cys His Gly Ile Pro Pro Trp

580 585 590

Glu Lys Glu Asn Leu Ser Asp Phe Gly Asp Phe Asp Asp Ala Asn Lys

595 600 605

Glu Gln

610

<210> 593

<211> 623

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 593

Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp

1 5 10 15

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asn Trp Val Ala Glu

20 25 30

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile

35 40 45

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu

50 55 60

Val Gln Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

65 70 75 80

Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Leu His Ile Leu Val Glu

85 90 95

Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile

100 105 110

Arg Asp Lys Leu Val Gln Thr Ile Tyr Arg Gly Ile Glu Pro Thr Leu

115 120 125

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

130 135 140

Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

145 150 155 160

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Glu Tyr Ile

165 170 175

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala His Asp

180 185 190

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Leu Asn

195 200 205

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

210 215 220

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

225 230 235 240

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

245 250 255

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

260 265 270

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ala

275 280 285

Pro Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

290 295 300

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

305 310 315 320

Gln Lys Arg Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

325 330 335

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

340 345 350

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

355 360 365

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

370 375 380

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

385 390 395 400

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

405 410 415

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

420 425 430

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

435 440 445

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

450 455 460

Glu Val Lys Glu Phe Phe Arg Trp Ala Gln Asp His Val Thr Glu Val

465 470 475 480

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Asn Lys Arg Pro Ala

485 490 495

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

500 505 510

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

515 520 525

Asp Arg Tyr Gln Asn Lys Cys Ser Arg His Ala Gly Met Leu Gln Met

530 535 540

Leu Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Asn Phe Asn Ile

545 550 555 560

Cys Phe Thr His Gly Thr Arg Asp Cys Ser Glu Cys Phe Pro Gly Val

565 570 575

Ser Glu Ser Gln Pro Val Val Arg Lys Arg Thr Tyr Arg Lys Leu Cys

580 585 590

Ala Ile His His Leu Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser Ala

595 600 605

Cys Asp Leu Val Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln

610 615 620

<210> 594

<211> 623

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 594

Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp

1 5 10 15

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asn Trp Val Ala Glu

20 25 30

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Leu Asn Leu Ile

35 40 45

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu

50 55 60

Val Gln Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

65 70 75 80

Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Leu His Val Leu Val Glu

85 90 95

Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile

100 105 110

Arg Glu Lys Leu Val Gln Thr Ile Tyr Arg Gly Val Glu Pro Thr Leu

115 120 125

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

130 135 140

Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

145 150 155 160

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Glu Tyr Ile

165 170 175

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala Gln His

180 185 190

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Leu Asn

195 200 205

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

210 215 220

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

225 230 235 240

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

245 250 255

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

260 265 270

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Pro Ser

275 280 285

Leu Pro Ala Asp Ile Lys Thr Asn Arg Ile Tyr Arg Ile Leu Glu Leu

290 295 300

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

305 310 315 320

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

325 330 335

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

340 345 350

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

355 360 365

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

370 375 380

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

385 390 395 400

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

405 410 415

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

420 425 430

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

435 440 445

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

450 455 460

Glu Val Lys Glu Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

465 470 475 480

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Ser Lys Arg Pro Ala

485 490 495

Pro Asp Asp Ala Asp Ile Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

500 505 510

Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp Phe Ala

515 520 525

Asp Arg Tyr Gln Asn Lys Cys Ser Arg His Ala Gly Met Ile Gln Met

530 535 540

Leu Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Asn Phe Asn Ile

545 550 555 560

Cys Phe Thr His Gly Val Arg Asp Cys Leu Glu Cys Phe Pro Gly Val

565 570 575

Ser Glu Ser Gln Pro Val Val Arg Lys Lys Thr Tyr Arg Lys Leu Cys

580 585 590

Ala Ile His His Leu Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser Ala

595 600 605

Cys Asp Leu Val Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln

610 615 620

<210> 595

<211> 625

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<400> 595

Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp

1 5 10 15

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asn Trp Val Ala Glu

20 25 30

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Arg Asn Leu Ile

35 40 45

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu

50 55 60

Val Gln Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

65 70 75 80

Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Leu His Val Leu Val Glu

85 90 95

Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile

100 105 110

Arg Glu Lys Leu Gly Pro Asp His Leu Pro Ala Gly Ser Ser Pro Thr

115 120 125

Leu Pro Asn Trp Phe Ala Val Thr Lys Asp Ala Val Met Ala Pro Ala

130 135 140

Gly Gly Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu

145 150 155 160

Pro Lys Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Glu

165 170 175

Tyr Ile Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala

180 185 190

Gln His Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn

195 200 205

Leu Asn Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala

210 215 220

Arg Tyr Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser

225 230 235 240

Glu Lys Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn

245 250 255

Ala Ala Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala

260 265 270

Gly Lys Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly

275 280 285

Pro Ser Leu Pro Ala Asp Ile Thr Gln Asn Arg Ile Tyr Arg Ile Leu

290 295 300

Ala Leu Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly

305 310 315 320

Trp Ala Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly

325 330 335

Pro Ala Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala

340 345 350

Val Pro Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe

355 360 365

Asn Asp Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met

370 375 380

Thr Ala Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys

385 390 395 400

Val Arg Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr

405 410 415

Pro Val Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly

420 425 430

Asn Ser Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe

435 440 445

Lys Phe Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr

450 455 460

Lys Gln Glu Val Lys Glu Phe Phe Arg Trp Ala Ser Asp His Val Thr

465 470 475 480

Glu Val Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Ser Lys Arg

485 490 495

Pro Ala Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro

500 505 510

Ser Val Ala Asp Pro Ser Thr Ser Asp Ala Glu Gly Ala Pro Val Asp

515 520 525

Phe Ala Asp Arg Tyr Gln Asn Lys Cys Ser Arg His Ala Gly Met Leu

530 535 540

Gln Met Leu Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Asn Phe

545 550 555 560

Asn Ile Cys Phe Thr His Gly Val Arg Asp Cys Ser Glu Cys Phe Pro

565 570 575

Gly Val Ser Glu Ser Gln Pro Val Val Arg Lys Arg Thr Tyr Arg Lys

580 585 590

Leu Cys Ala Ile His His Leu Leu Gly Arg Ala Pro Glu Ile Ala Cys

595 600 605

Ser Ala Cys Asp Leu Val Asn Val Asp Leu Asp Asp Cys Val Ser Glu

610 615 620

Gln

625

<210> 596

<211> 622

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polypeptide

<220>

<221> Modified amino acid

<222> (118)..(119)

<223> Any amino acid

<220>

<221> Modified amino acid

<222> (287)..(287)

<223> Any amino acid

<220>

<221> Modified amino acid

<222> (541)..(541)

<223> Any amino acid

<220>

<221> Modified amino acid

<222> (557)..(557)

<223> Any amino acid

<220>

<221> Modified amino acid

<222> (565)..(565)

<223> Any amino acid

<220>

<221> Modified amino acid

<222> (569)..(569)

<223> Any amino acid

<220>

<221> Modified amino acid

<222> (580)..(580)

<223> Any amino acid

<220>

<221> Modified amino acid

<222> (588)..(588)

<223> Any amino acid

<220>

<221> Modified amino acid

<222> (592)..(592)

<223> Any amino acid

<400> 596

Met Pro Gly Phe Tyr Glu Ile Val Ile Lys Val Pro Ser Asp Leu Asp

1 5 10 15

Glu His Leu Pro Gly Ile Ser Asp Ser Phe Val Asn Trp Val Ala Glu

20 25 30

Lys Glu Trp Glu Leu Pro Pro Asp Ser Asp Met Asp Arg Asn Leu Ile

35 40 45

Glu Gln Ala Pro Leu Thr Val Ala Glu Lys Leu Gln Arg Asp Phe Leu

50 55 60

Val Gln Trp Arg Arg Val Ser Lys Ala Pro Glu Ala Leu Phe Phe Val

65 70 75 80

Gln Phe Glu Lys Gly Glu Ser Tyr Phe His Leu His Val Leu Val Glu

85 90 95

Thr Thr Gly Val Lys Ser Met Val Leu Gly Arg Phe Leu Ser Gln Ile

100 105 110

Arg Glu Lys Leu Val Xaa Xaa Ile Tyr Arg Gly Ile Glu Pro Thr Leu

115 120 125

Pro Asn Trp Phe Ala Val Thr Lys Thr Arg Asn Gly Ala Gly Gly Gly

130 135 140

Asn Lys Val Val Asp Glu Cys Tyr Ile Pro Asn Tyr Leu Leu Pro Lys

145 150 155 160

Thr Gln Pro Glu Leu Gln Trp Ala Trp Thr Asn Met Glu Glu Tyr Ile

165 170 175

Ser Ala Cys Leu Asn Leu Ala Glu Arg Lys Arg Leu Val Ala Gln His

180 185 190

Leu Thr His Val Ser Gln Thr Gln Glu Gln Asn Lys Glu Asn Leu Asn

195 200 205

Pro Asn Ser Asp Ala Pro Val Ile Arg Ser Lys Thr Ser Ala Arg Tyr

210 215 220

Met Glu Leu Val Gly Trp Leu Val Asp Arg Gly Ile Thr Ser Glu Lys

225 230 235 240

Gln Trp Ile Gln Glu Asp Gln Ala Ser Tyr Ile Ser Phe Asn Ala Ala

245 250 255

Ser Asn Ser Arg Ser Gln Ile Lys Ala Ala Leu Asp Asn Ala Gly Lys

260 265 270

Ile Met Ala Leu Thr Lys Ser Ala Pro Asp Tyr Leu Val Gly Xaa Ser

275 280 285

Pro Pro Glu Asp Ile Ser Thr Asn Arg Ile Tyr Arg Ile Leu Ala Leu

290 295 300

Asn Gly Tyr Asp Pro Ala Tyr Ala Gly Ser Val Phe Leu Gly Trp Ala

305 310 315 320

Gln Lys Lys Phe Gly Lys Arg Asn Thr Ile Trp Leu Phe Gly Pro Ala

325 330 335

Thr Thr Gly Lys Thr Asn Ile Ala Glu Ala Ile Ala His Ala Val Pro

340 345 350

Phe Tyr Gly Cys Val Asn Trp Thr Asn Glu Asn Phe Pro Phe Asn Asp

355 360 365

Cys Val Asp Lys Met Val Ile Trp Trp Glu Glu Gly Lys Met Thr Ala

370 375 380

Lys Val Val Glu Ser Ala Lys Ala Ile Leu Gly Gly Ser Lys Val Arg

385 390 395 400

Val Asp Gln Lys Cys Lys Ser Ser Ala Gln Ile Asp Pro Thr Pro Val

405 410 415

Ile Val Thr Ser Asn Thr Asn Met Cys Ala Val Ile Asp Gly Asn Ser

420 425 430

Thr Thr Phe Glu His Gln Gln Pro Leu Gln Asp Arg Met Phe Lys Phe

435 440 445

Glu Leu Thr Arg Arg Leu Glu His Asp Phe Gly Lys Val Thr Lys Gln

450 455 460

Glu Val Lys Glu Phe Phe Arg Trp Ala Ser Asp His Val Thr Glu Val

465 470 475 480

Ala His Glu Phe Tyr Val Arg Lys Gly Gly Ala Lys Lys Arg Pro Ala

485 490 495

Pro Asp Asp Ala Asp Lys Ser Glu Pro Lys Arg Ala Cys Pro Ser Val

500 505 510

Ala Asp Pro Ser Thr Ser Asp Ala Glu Ala Pro Val Asp Phe Ala Asp

515 520 525

Arg Tyr Gln Asn Lys Cys Ser Arg His Ala Gly Met Xaa Gln Met Leu

530 535 540

Phe Pro Cys Lys Thr Cys Glu Arg Met Asn Gln Asn Xaa Asn Ile Cys

545 550 555 560

Phe Thr His Gly Xaa Arg Asp Cys Xaa Glu Cys Phe Pro Gly Val Ser

565 570 575

Glu Ser Gln Xaa Val Val Arg Lys Arg Thr Tyr Xaa Lys Leu Cys Xaa

580 585 590

Ile His His Leu Leu Gly Arg Ala Pro Glu Ile Ala Cys Ser Ala Cys

595 600 605

Asp Leu Val Asn Val Asp Leu Asp Asp Cys Val Ser Glu Gln

610 615 620

<210> 597

<211> 1530

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 597

atgtccatgg gggcaccgcg gtccctcctc ctggccctgg ctgctggcct ggccgttgcc 60

cgtccgccca acatcgtgct gatctttgcc gacgacctcg gctatgggga cctgggctgc 120

tatgggcacc ccagctctac cactcccaac ctggaccagc tggcggcggg agggctgcgg 180

ttcacagact tctacgtgcc tgtgtctctg tgcacaccct ctagggccgc cctcctgacc 240

ggccggctcc cggttcggat gggcatgtac cctggcgtcc tggtgcccag ctcccggggg 300

ggcctgcccc tggaggaggt gaccgtggcc gaagtcctgg ctgcccgagg ctacctcaca 360

ggaatggccg gcaagtggca ccttggggtg gggcctgagg gggccttcct gcccccccat 420

cagggcttcc atcgatttct aggcatcccg tactcccacg accagggccc ctgccagaac 480

ctgacctgct tcccgccggc cactccttgc gacggtggct gtgaccaggg cctggtcccc 540

atcccactgt tggccaacct gtccgtggag gcgcagcccc cctggctgcc cggactagag 600

gcccgctaca tggctttcgc ccatgacctc atggccgacg cccagcgcca ggatcgcccc 660

ttcttcctgt actatgcctc tcaccacacc cactaccctc agttcagtgg gcagagcttt 720

gcagagcgtt caggccgcgg gccatttggg gactccctga tggagctgga tgcagctgtg 780

gggaccctga tgacagccat aggggacctg gggctgcttg aagagacgct ggtcatcttc 840

actgcagaca atggacctga gaccatgcgt atgtcccgag gcggctgctc cggtctcttg 900

cggtgtggaa agggaacgac ctacgagggc ggtgtccgag agcctgcctt ggccttctgg 960

ccaggtcata tcgctcccgg cgtgacccac gagctggcca gctccctgga cctgctgcct 1020

accctggcag ccctggctgg ggccccactg cccaatgtca ccttggatgg ctttgacctc 1080

agccccctgc tgctgggcac aggcaagagc cctcggcagt ctctcttctt ctacccgtcc 1140

tacccagacg aggtccgtgg ggtttttgct gtgcggactg gaaagtacaa ggctcacttc 1200

ttcacccagg gctctgccca cagtgatacc actgcagacc ctgcctgcca cgcctccagc 1260

tctctgactg ctcatgagcc cccgctgctc tatgacctgt ccaaggaccc tggtgagaac 1320

tacaacctgc tggggggtgt ggccggggcc accccagagg tgctgcaagc cctgaaacag 1380

cttcagctgc tcaaggccca gttagacgca gctgtgacct tcggccccag ccaggtggcc 1440

cggggcgagg accccgccct gcagatctgc tgtcatcctg gctgcacccc ccgcccagct 1500

tgctgccatt gccgatcc ccatgcctga 1530

<210> 598

<211> 1653

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

polynucleotide

<400> 598

atgccgccac cccggaccgg ccgaggcctt ctctggctgg gtctggttct gagctccgtc 60

tgcgtcgccc tcggatccga aacgcaggcc aactcgacca cagatgctct gaacgttctt 120

ctcatcatcg tggatgacct gcgcccctcc ctgggctgtt atggggataa gctggtgagg 180

tccccaaata ttgaccaact ggcatcccac agcctcctct tccagaatgc ctttgcgcag 240

caagcagtgt gcgccccgag ccgcgtttct ttcctcactg gcaggagacc tgacaccacc 300

cgcctgtacg acttcaactc ctactggagg gtgcacgctg gaaacttctc caccatcccc 360

cagtacttca aggagaatgg ctatgtgacc atgtcggtgg gaaaagtctt tcaccctggg 420

atatcttcta accataccga tgattctccg tatagctggt cttttccacc ttatcatcct 480

tcctctgaga agtatgaaaa cactaagaca tgtcgagggc cagatggaga actccatgcc 540

aacctgcttt gccctgtgga tgtgctggat gttcccgagg gcaccttgcc tgacaaacag 600

agcactgagc aagccataca gttgttggaa aagatgaaaa cgtcagccag tcctttcttc 660

ctggccgttg ggtatcataa gccacacatc cccttcagat accccaagga atttcagaag 720

ttgtatccct tggagaacat caccctggcc cccgatcccg aggtccctga tggcctaccc 780

cctgtggcct acaacccctg gatggacatc aggcaacggg aagacgtcca agccttaaac 840

atcagtgtgc cgtatggtcc aattcctgtg gactttcagc ggaaaatccg ccagagctac 900

tttgcctctg tgtcatattt ggatacacag gtcggccgcc tcttgagtgc tttggacgat 960

cttcagctgg ccaacagcac catcattgca tttacctcgg atcatgggtg ggctctaggt 1020

gaacatggag aatgggccaa atacagcaat tttgatgttg ctacccatgt tcccctgata 1080

ttctatgttc ctggaaggac ggcttcactt ccggaggcag gcgagaagct tttcccttac 1140

ctcgaccctt ttgattccgc ctcacagttg atggagccag gcaggcaatc catggacctt 1200

gtggaacttg tgtctctttt tcccacgctg gctggacttg caggactgca ggttccacct 1260

cgctgccccg ttccttcatt tcacgttgag ctgtgcagag aaggcaagaa ccttctgaag 1320

cattttcgat tccgtgactt ggaagaggat ccgtacctcc ctggtaatcc ccgtgaactg 1380

attgcctata gccagtatcc ccggccttca gacatccctc agtggaattc tgacaagccg 1440

agtttaaaag atataaagat catgggctat tccatacgca ccatagacta taggtatact 1500

gtgtgggttg gcttcaatcc tgatgaattt ctagctaact tttctgacat ccatgcaggg 1560

gaactgtatt ttgtggattc tgacccattg caggatcaca atatgtataa tgattcccaa 1620

ggtggagatc ttttccagtt gttgatgcct tga 1653

<210> 599

<211> 16

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 599

gcgcgctcgc tcgctc 16

<210> 600

<211> 8

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 600

actgaggc 8

<210> 601

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 601

cgggcgacca aaggtcgccc ga 22

<210> 602

<211> 10

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 602

cgcccgggcg 10

<210> 603

<211> 8

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 603

gcctcagt 8

<210> 604

<211> 16

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 604

gagcgagcga gcgcgc 16

<210> 605

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 605

gcccgggcgt cgggcgacct ttggtcgccc g 31

<210> 606

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of artificial sequence: synthetic

oligonucleotide

<400> 606

gcccgggcaa agcccgggcg 20

<---

Claims (101)

1. A DNA vector for delivering a polynucleotide sequence derived from a vector polynucleotide, wherein the vector polynucleotide encodes a nucleic acid sequence located between a first inverted terminal repeat (ITR) and a second ITR, wherein at least one of the first ITR and the second ITR contains the sequence a nucleic acid corresponding to a replication protein (Rep) binding site for inducing replication of a DNA vector in a cell in the presence of a single type of Rep protein having at least DNA binding and DNA nicking functionality, wherein the DNA vector is produced by a method comprising: stages: a) incubating a population of cells carrying a vector polynucleotide that lacks viral capsid coding sequences in the presence of said single species of Rep protein, under conditions effective and for a time sufficient to induce production of vector DNA within the cells, the cells containing no sequences , encoding a viral capsid, and no other types of Rep proteins are present, and wherein the cells do not come into contact with a nucleic acid sequence encoding a second Rep protein; And b) collecting and isolating the resulting DNA vector from the cells. 2. DNA vector according to claim 1, characterized in that the only type of Rep protein additionally has helicase, ligase and ATPase functionality. 3. The DNA vector according to claim 1, characterized in that the only type of Rep protein is the AAV Rep protein. 4. DNA vector according to claim 2, characterized in that the only type of Rep protein is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and the Rep protein AAV12. 5. DNA vector according to claim 2, characterized in that the only type of Rep protein is the Rep68 AAV2 protein. 6. DNA vector according to claim 2, characterized in that the only type of Rep protein is the Rep78 AAV2 protein. 7. DNA vector according to claim 6, characterized in that the Rep78 protein is encoded by a mutant Rep78 nucleic acid sequence. 8. DNA vector according to claim 7, characterized in that the mutant nucleic acid sequence Rep78 does not have a functional translation initiation codon for Rep52. 9. The DNA vector according to claim 7, characterized in that the mutant Rep78 nucleic acid sequence encodes a mutant Rep78 protein that contains a mutation at amino acid position 225 of SEQ ID NO: 588. 10. DNA vector according to claim 7, characterized in that the amino acid at position 225 of SEQ ID NO: 588 is mutated to glycine (Gly) or threonine (Thr). 11. The DNA vector of claim 6, wherein the mutant Rep78 nucleic acid sequence encodes a mutant Rep78 protein that contains a sequence having at least 95% sequence identity to SEQ ID NO: 588 and has at least binding functionality DNA and DNA nicking. 12. The DNA vector according to claim 1, characterized in that the first ITR and the second ITR are each an ITR of a parvovirus. 13. DNA vector according to claim 12, characterized in that the parvovirus is a dependovirus. 14. DNA vector according to claim 13, characterized in that the parvovirus is an AAV. 15. The DNA vector according to claim 14, characterized in that the AAV is derived from an AAV serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAV12. 16. DNA vector according to claim 1, characterized in that the DNA vector is a non-viral capsid-free double-stranded DNA vector with covalently closed ends (ccDNA vector). 17. DNA vector according to claim 16, characterized in that the presence of a cccDNA vector isolated from cells can be confirmed by digesting DNA isolated from a cell with a restriction enzyme having a single recognition site on the DNA vector and analyzing the digested DNA -material on a non-denaturing gel to confirm the presence of characteristic bands of linear and continuous DNA compared to linear and discontinuous DNA. 18. A DNA vector for delivering a polynucleotide sequence derived from a vector polynucleotide, wherein the vector polynucleotide encodes a nucleic acid sequence located between two different inverted terminal repeats (ITRs), wherein at least one of the two different ITRs is a functional ITR containing a functional terminal resolution site and a replication protein (Rep) binding site for inducing replication of a vector polynucleotide in a cell and in the presence of a single type of Rep protein having at least DNA-binding and DNA-nicking functionality, wherein the DNA vector is produced by a method, including stages: a) incubating a population of cells carrying a vector polynucleotide that is devoid of viral capsid coding sequences in the presence of a single species of Rep protein, under conditions effective and for a time sufficient to induce production of vector DNA within the cells, wherein the cells do not contain the nucleic acid , encoding Rep52 or Rep40 in cells, wherein no other Rep species is present in the cell, and wherein the cells are not in contact with a nucleic acid sequence encoding a second Rep protein; And b) collection and isolation of vector DNA from cells. 19. A polynucleotide for creating a DNA vector, comprising a nucleic acid sequence encoding a single type of Rep protein amino acid sequence that has at least DNA binding and DNA nicking functionality associated with at least one expression control sequence. 20. The polynucleotide according to claim 19, characterized in that the only type of Rep protein has helicase, ligase and ATPase functionality. 21. The polynucleotide according to claim 19, characterized in that the only type of Rep protein is the AAV Rep protein. 22. The polynucleotide according to claim 21, characterized in that the AAV Rep protein is selected from the group consisting of the AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 protein and the AAV12 Rep protein. 23. The polynucleotide according to claim 21, characterized in that the AAV Rep protein is an AAV2 Rep protein. 24. The polynucleotide according to claim 21, characterized in that the AAV Rep protein is an AAV2 Rep78 protein. 25. The polynucleotide according to claim 24, characterized in that the Rep78 AAV2 protein is encoded by a mutant Rep78 nucleic acid sequence. 26. The polynucleotide according to claim 25, characterized in that the mutant Rep78 nucleic acid sequence does not have a functional translation initiation codon for Rep52. 27. The polynucleotide according to claim 25, characterized in that the Rep78 protein contains a mutation at position 225 of amino acid SEQ ID NO: 588. 28. The polynucleotide according to claim 27, characterized in that amino acid 225 of SEQ ID NO: 588 is mutated to glycine (Gly) or threonine (Thr). 29. The polynucleotide of claim 25, wherein the mutant Rep78 nucleic acid sequence encodes a mutant Rep78 protein that contains a sequence having at least 95% sequence identity to SEQ ID NO: 588 and having at least a DNA binder and DNA -nicking functionality. 30. The polynucleotide of claim 19, wherein at least one expression control sequence encodes a promoter selected from the group consisting of: IE promoter, ΔIE promoter and CMV promoter. 31. The polynucleotide according to claim 19, characterized in that the DNA vector is a non-viral non-capsid double-stranded DNA vector with covalently closed ends (ccDNA vector). 32. The polynucleotide according to claim 31, characterized in that the presence of a cccDNA vector isolated from cells can be confirmed by digestion of DNA isolated from the cell with a restriction enzyme having a single recognition site on the DNA vector and analysis of the digested DNA material on a non-denaturing gel to confirm the presence of characteristic bands of linear and continuous DNA compared to linear and discontinuous DNA. 33. A method for producing a DNA vector, including contacting a cell with: (1) a nucleic acid sequence encoding a single type of replication protein (Rep) having at least DNA binding and DNA nicking functionality, wherein the nucleic acid sequence is linked to at least one expression control sequence, and wherein the cell does not express any other types of Rep protein and does not contact other types of Rep protein; (2) a double-stranded DNA construct containing: expression cassette; the first ITR at the 5' end upstream of the expression cassette; And a second ITR at the 3' end after the expression cassette; And (3) DNA vector collection. 34. The method of claim 33, wherein the only type of Rep protein is the AAV Rep protein. 35. The method according to claim 34, characterized in that the AAV Rep protein is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and the AAV12 Rep protein. 36. The method of claim 34, wherein the AAV Rep protein is an AAV2 Rep68 protein. 37. The method of claim 34, wherein the AAV Rep protein is an AAV2 Rep78 protein. 38. The method according to claim 37, characterized in that the Rep78 AAV2 protein is encoded by a mutant Rep78 nucleic acid sequence. 39. The method of claim 38, wherein the mutant Rep78 nucleic acid sequence does not have a functional translation initiation codon for Rep52. 40. The method of claim 38, wherein the mutant Rep78 nucleic acid sequence encodes a mutant Rep78 protein that contains a mutation at amino acid position 225 of SEQ ID NO: 588. 41. The method of claim 40, wherein amino acid 225 of SEQ ID NO: 588 is mutated to glycine (Gly) or threonine (Thr). 42. The method of claim 38, wherein the mutant Rep78 nucleic acid sequence encodes a mutant Rep78 protein that contains a sequence having at least 95% sequence identity to SEQ ID NO: 588. 43. The method of claim 33, wherein the at least one expression control sequence encodes a promoter selected from the group consisting of: ID promoter, ΔIE promoter and CMV promoter. 44. The method according to claim 33, characterized in that said double-stranded DNA construct is selected from the group consisting of a bacmid, a plasmid, a minicircle and a linear double-stranded DNA molecule. 45. The method of claim 33, wherein the first ITR is a wild-type ITR. 46. The method according to claim 33, characterized in that the first ITR and the second ITR are symmetrical or substantially symmetrical or asymmetrical relative to each other. 47. The method of claim 45, wherein the wild-type ITR contains SEQ ID NO: 51. 48. The method according to claim 33, characterized in that the second ITR is a modified ITR. 49. The method according to claim 48, characterized in that the modified ITR contains SEQ ID NO: 2. 50. The method according to claim 33, characterized in that the first ITR is a modified ITR. 51. The method of claim 50, wherein the modified ITR contains SEQ ID NO: 52. 52. The method of claim 50, wherein the second ITR is a wild-type ITR. 53. The method of claim 52, wherein the wild-type ITR contains SEQ ID NO: 1. 54. The method according to claim 33, characterized in that the first ITR and the second ITR are replication competent. 55. The method of claim 33, wherein at least one of the first ITR and the second ITR contains a nucleic acid sequence corresponding to a Rep protein binding site for inducing replication of the DNA vector in the cell. 56. The method of claim 33, wherein one or both of the first ITR and the second ITR is an AAV ITR. 57. The method according to claim 33, characterized in that the expression cassette contains a cis-regulatory element. 58. The method of claim 57, wherein the cis-regulatory element is selected from the group consisting of a post-transcriptional regulatory element and a BGH poly(A) signal. 59. The method of claim 58, wherein said post-transcriptional regulatory element comprises a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). 60. The method of claim 33, wherein the expression cassette further comprises a promoter selected from the group consisting of a CAG promoter, an AAT promoter, an LP1 promoter and an EF1a promoter. 61. The method of claim 33, wherein said expression cassette contains a nucleic acid sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9. 62. The method according to claim 33, characterized in that said expression cassette additionally contains an exogenous sequence. 63. The method according to claim 62, characterized in that the exogenous sequence contains at least 2000 nucleotides. 64. The method according to claim 62, characterized in that said exogenous sequence encodes a protein. 65. The method of claim 62, wherein the exogenous sequence encodes a protein selected from the group consisting of: a reporter protein, a therapeutic protein, an antigen, a gene-editing protein and a cytotoxic protein. 66. The method according to claim 33, characterized in that the DNA vector has a linear and continuous structure. 67. DNA vector for delivery of a polynucleotide sequence, obtained by the method according to claim 33. 68. Pharmaceutical composition for gene therapy, containing the DNA vector according to claim 67 and an excipient. 69. Kit for obtaining a DNA vector, containing: an expression construct containing at least one restriction site for insertion of at least one nucleic acid sequence or a regulatory switch or both, at least one restriction site located between asymmetric inverted terminal repeats (asymmetric ITRs), in which at least one of the asymmetric ITR contains a functional terminal resolution site and a replication protein (Rep) binding site; and a vector containing a nucleic acid sequence encoding a single type of Rep protein, the vector being suitable for expressing a single type of Rep protein in an insect cell. 70. The kit of claim 69, further comprising a population of insect cells that does not contain viral capsid coding sequences that, in the presence of a single species of Rep protein, can induce production of a DNA vector. 71. A cell for producing a cccDNA vector, comprising a nucleic acid sequence encoding a single species of AAV replication protein (Rep), having at least DNA binding and DNA nicking functionality associated with at least one expression control sequence, wherein the cell does not expresses any type of parvovirus Rep protein and does not interact with other types of Rep protein. 72. The cell of claim 71, wherein the cell further comprises a double-stranded DNA construct containing an expression cassette, a first ITR at the 5' end before the expression cassette and a second ITR at the 3' end after the expression cassette. 73. The cell according to claim 71, characterized in that the cell is an insect cell. 74. The cell of claim 73, wherein the insect cell is selected from the group consisting of an Sf9 cell, an Sf21 cell, a Trichoplusia ni cell, and a High Five cell. 75. The host cell according to claim 74, wherein said insect cell is an Sf9 cell. 76. The cell of claim 74, wherein the insect cell is a High Five cell. 77. The cell according to claim 71, characterized in that the cell is a mammalian cell. 78. The cell of claim 77, wherein the mammalian cell is selected from the group consisting of HEK293, Huh-7, HeLa, HepG2, HeplA, 911, CHO, COS, MeWo, NIH3T3, A549, HT1080, monocytes and mature and immature dendritic cells. 79. The cell of claim 77, wherein the mammalian cell is HEK293. 80. The cell of claim 71, wherein the nucleic acid sequence encoding a single species of AAV Rep protein encodes Rep78 or Rep68. 81. The cell of claim 80, wherein the nucleic acid sequence does not have a functional start codon for Rep52 or Rep40. 82. The cell according to claim 81, characterized in that the nucleic acid sequence encodes the Rep78 protein. 83. The cell according to claim 82, characterized in that the nucleic acid sequence encodes the Rep68 protein. 84. The cell of claim 82, wherein the nucleic acid sequence encodes a mutant Rep78 protein that contains a mutation at amino acid position 225 of SEQ ID NO: 588. 85. The cell of claim 84, wherein amino acid 225 (methionine) of SEQ ID NO: 588 is mutated to glycine (Gly) or threonine (Thr). 86. The cell of claim 84, wherein the nucleic acid sequence further includes one or more modifications at alternative splice sites at the carboxy terminus, preventing the splicing event leading to the production of Rep68, thereby allowing only Rep78 to be produced. 87. The cell of claim 81, wherein the nucleic acid sequence is full-length and contains intact alternative splice sites at the carboxy terminus, resulting in the production of Rep78 and Rep68. 88. The cell of claim 81, wherein the nucleic acid sequence contains a deletion of the carboxy-terminal intronic sequence resulting in only Rep68. 89. The cell of claim 81, wherein the nucleic acid sequence encodes a Rep78 protein that contains a sequence having at least 95% sequence identity to SEQ ID NO: 588 and having at least DNA binding and DNA nicking functionality .