CN110541001A

CN110541001A - Gene knock-out method combining precise large-fragment gene deletion with stop codon insertion

Info

Publication number: CN110541001A
Application number: CN201910890379.0A
Authority: CN
Inventors: 赵培; 康雅虹; 罗莹
Original assignee: Fujian Shang Yuan Biological Science And Technology Co Ltd
Current assignee: Fujian Shang Yuan Biological Science And Technology Co Ltd
Priority date: 2019-09-20
Filing date: 2019-09-20
Publication date: 2019-12-06

Abstract

The invention belongs to the technical field of gene editing of genetic engineering, and particularly relates to a high-efficiency gene knock-out method, namely a gene knock-out method combining precise large-fragment gene deletion with stop codon insertion. The invention aims to solve the problems of high difficulty and long period of knockout of long fragments in the current gene precise knockout. Firstly, determining that a 5 ' sgRNA target site is positioned near a start codon (within 100 bp), a 3 ' sgRNA target site is positioned at any position between a 5 ' sgRNA target site and a stop codon, the editing efficiency score of the sgRNA target site is high, and the off-target effect is close to 0; secondly, the 5 'and 3' end points of the deleted sequence are determined to be positioned in the 5 'sgRNA target sequence and the 3' sgRNA target sequence, and the repair template is provided with a stop codon. And finally, preparing a microinjection DNA mixed solution system by the upstream sgRNA plasmid at the 5 'end, the downstream sgRNA plasmid at the 3' end, the Cas9 plasmid, the co-editing marker plasmid, the reporter gene plasmid and the repair template, injecting the microinjection DNA mixed solution system into the hermaphrodite nematode, counting the gene editing efficiency of the hermaphrodite nematode, and verifying the consistency of the screening function and the whole gene knock-out method.

Description

Gene knock-out method combining precise large-fragment gene deletion with stop codon insertion

Technical Field

The invention belongs to the technical field of gene editing of genetic engineering, and particularly relates to a high-efficiency gene knock-out method, namely a gene knock-out method combining precise large-fragment gene deletion with stop codon insertion.

Background

CRISPR/Cas9 gene editing is one of the current highly efficient gene targeting operation technologies, has the advantages of short period, safety, reliability, low cost and the like, and is very suitable for constructing various animal models.

the gene knockout efficiency obtained by the CRISPR/Cas9 system is very high, and the following two modes exist at present: the first editing mode is as follows: deleting the complete gene sequence from the initiation codon ("ATG") to the termination codon ("TAG") to obtain a whole gene deletion mutant; the second editing mode is as follows: and (3) editing genes by using one sgRNA in a region which is relatively close to the initiation codon, and randomly generating knock-in deletion mutation so as to obtain a frame shift mutant.

the advantage of the first editing approach is that it can be ensured that the resulting mutants are full knockout mutants, since the entire gene sequence is completely deleted (see the entire gene deletion in FIG. 1). The disadvantages are that for the gene with longer coding sequence (from the start codon to the stop codon), for example, the gene with the sequence length of more than 6kb, the efficiency of deleting large fragments is lower, and the screening difficulty is higher. In many cases, suitable sgRNA target sites are not necessarily available for editing at the 5 'end and 3' end of the deleted gene, and thus sgRNA target sites located farther away from the start codon and the stop codon are required, which is inefficient.

The advantage of the second editing approach is that random gene indel mutants can be easily generated with one sgRNA (see random gene deletion in fig. 2). The disadvantages are: (1) random gene indel mutations generated by single sgRNA editing are very short in length (a few nucleotide base pairs) and cannot be easily screened by the change in PCR fragment length when there is no phenotypic change; (2) because the generated insertion deletion mutation is random, the influence on a cDNA sequence cannot be predicted in advance, whether frame shift expression is caused or not can be generated in advance, or a stop codon is generated in advance, so that the gene expression is stopped in advance; (3) whether frameshift expression disrupts the function of the protein is still unknown, and it is not certain whether it is a knockout mutant or not.

in view of the limitation of the second editing method, it is difficult to widely popularize the method of generating gene knockout by frame shift mutation. Therefore, the editing mode of accurate knockout through whole gene deletion is still the most common gene deletion method at present, and the analysis shows that the difficulty of whole gene long fragment knockout is high, and the long period limits the use range of complete gene knockout.

Disclosure of Invention

In view of the above problems in the background art, the present invention aims to provide a gene knock-out method combining precise large-fragment gene deletion with insertion of a stop codon, so as to solve the problems of difficult and long cycle of long-fragment knockout in precise gene knock-out.

To achieve the above object, the inventors provide a gene knock-out method for precise large fragment gene deletion in combination with stop codon insertion (see large fragment deletion stop method in fig. 3), comprising the steps of:

Preparing a Cas9 plasmid, a co-editing marker plasmid, a reporter gene plasmid and hermaphrodite nematodes;

Determining the sequences of the 5 'and 3' sgRNA target sites: the 5 ' sgRNA target site is positioned near the initiation codon (within 100 bp), the 3 ' sgRNA target site is positioned at any position between the 5 ' sgRNA target site and the termination codon, the editing efficiency specificity score of the sgRNA target site is high, and the off-target effect is close to 0;

Determining and constructing a repair template;

constructing an upstream sgRNA plasmid at a 5 'end and a downstream sgRNA plasmid at a 3' end;

Preparing a microinjection DNA mixed solution: mixing the 5 'end upstream sgRNA plasmid and the 3' end downstream sgRNA plasmid, the Cas9 plasmid, the co-editing marker plasmid, the reporter gene plasmid and the repair template to obtain the microinjection DNA mixed solution;

Microinjection: injecting the microinjection DNA mixed solution into gonads of hermaphrodite nematodes to obtain P0 generation nematodes, and culturing to obtain F1 generation nematodes; and screening and verifying the target mutation.

Different from the prior art, the technical scheme at least has the following beneficial effects:

1) When the 5 'end sgRNA target site and the 3' end sgRNA target site are selected, the site with high editing efficiency of the sgRNA target site is preferentially considered, the sgRNA target site which is very close to a start codon and a stop codon is not necessarily required to be selected, the problem that the sgRNA target site which is very close to the start codon or the stop codon (within 30 bp) is low in efficiency is avoided, and in addition, the risk that a non-frame-shift mutation is generated, and a knockout mutant cannot be obtained is also avoided;

2) For a gene with a long coding sequence, all the coding sequences do not need to be deleted, and only the coding sequences with the length of less than 6kb need to be deleted, so that the editing efficiency of gene deletion is higher;

3) Because the sgRNA target site with high editing efficiency specificity fraction and low off-target effect is selected, and the 5 'end point and the 3' end point of the deleted sequence are positioned in the 5 'sgRNA target sequence and the 3' sgRNA target sequence, oligonucleotide chain can be used as a template, no plasmid is required to be constructed as the template, and the cost is greatly reduced;

4) When the gene coding sequence of a larger segment is deleted, a stop codon is inserted at the position after deletion, so that the gene is terminated in advance or mRNA is degraded, and the purpose of knocking out the gene is achieved.

Drawings

FIG. 1 is a schematic diagram of a gene knock-out method using a whole gene deletion method according to the prior art;

FIG. 2 is a schematic diagram of a gene knock-out method using random gene deletion in the background art;

FIG. 3 is a schematic diagram of a gene knock-out method for precise large fragment gene deletion in combination with stop codon insertion according to an embodiment;

FIG. 4 is a diagram showing the editing process of the wah-1 gene complete gene knock-out method in the background art;

FIG. 5 is a schematic diagram of a gene knock-out method for deletion of the wah-1 gene in combination with insertion of a stop codon according to an embodiment of the present invention;

FIG. 6 is a schematic diagram showing the editing of the gsk-3 gene by the whole gene knockout method in the background art;

FIG. 7 is a schematic diagram of a gene knock-out method combining gene deletion of the gsk-3 gene with insertion of a stop codon according to an embodiment of the present invention;

FIG. 8 is a schematic diagram of editing the tat-5 gene complete gene knock-out method in the background art;

FIG. 9 is a schematic diagram of a gene knock-out method combining gene deletion of tat-5 gene with insertion of stop codon according to the embodiment of the present invention.

Detailed Description

The gene knock-out method for the precise deletion of large fragment genes combined with the insertion of stop codons provided by the present invention is described in detail below.

A method for gene knock-out of a precise large fragment gene deletion in combination with a stop codon insertion comprising the steps of:

Determining the target point sequences of the sgRNA at the 5 'end and the 3' end;

Determining and constructing a repair template;

The gene knock-out method combining precise large-fragment gene deletion with stop codon insertion is essentially that two gene editing behaviors of large-fragment gene deletion and stop codon insertion are involved in one gene editing at the same time.

The Cas9 plasmid is a plasmid for expressing Streptococcus pyogenes Cas9 (Cas 9 for short); the co-editing marker plasmid is used for identifying sgRNA plasmids of co-editing sgRNA sites; the reporter gene plasmid refers to Psur-5, sur-5, NLS, GFP plasmid; the recombinant protein is used for identifying a 5 'sgRNA target site sequence, a 3' sgRNA target site sequence, an sgRNA plasmid skeleton for co-editing a target site sequence and a common hermaphrodite nematode for gene editing, nematode lysate is a common buffer solution disclosed in a nematode research laboratory, and the above materials can be directly purchased.

selecting a sgRNA target site with highest specific score of editing efficiency and off-target effect of 0 or close to 0 at the 5 'end near the initiation codon, namely a 5' end sgRNA target site sequence; the 3 'sgRNA target site is positioned at any position between the 5' sgRNA target site and the stop codon, the specific score of the editing efficiency is high, and the off-target effect is close to 0. The levels of the specific scores of the editing efficiency are relatively high and low, the target editing genes are different, the predicted specific scores of the editing efficiency are possibly different, and in the same group of data, the target site corresponding to the highest specific score of the editing efficiency is selected as the corresponding sgRNA target site.

At present, a plurality of programs based on big data algorithm are used for predicting the efficiency and the applicability of sgRNA in gene editing, and in the specific embodiment of the invention, a website (http:// crispr. mit. edu/or http:// crispor. force. net) is adopted to obtain the target site sequences of the sgRNA at the 5 'end and the 3' end. But based on the possible error between the prediction efficiency and the actual efficiency of the prediction software, the invention also combines the sequencing results of PCR and sequencing company for verification. The gene-editing nematode was subjected to PCR using upstream and downstream primers whose binding sites were 500bp from the deleted sequence 300 and then sent to the sequencing company for sequencing.

In the invention, because the sgRNA target sites with high editing efficiency fraction and low off-target effect are preferably selected, and the 5 'end point and the 3' end point of the deleted sequence are positioned in the 5 'sgRNA target sequence and the 3' sgRNA target sequence, the gene editing cost can be greatly reduced by directly adopting an oligonucleotide chain as a template without constructing a plasmid. In a further preferred embodiment of the present invention, the repair template is an oligonucleotide chain.

The present invention is different from available technology in that it has relatively great gene coding sequence eliminated and has inserted stop codon in the position after deletion to result in early gene termination or mRNA degradation and thus gene knock-out. To achieve the above object, a repair template is used which is specifically different from a conventional repair template, and as a further preferred embodiment of the present invention, the repair template comprises a stop codon.

As a further preferred embodiment of the present invention, the stop codon on the repair template is flanked by 5 'upstream and 3' downstream sequences of 35-50bp, respectively, outside the deleted sequence. The template sequences of 35-50bp outside the deleted sequence are also called recombination arms, namely, the stop codon of the repair template and the recombination arms of 35-50bp on both sides in the scheme provided by the invention, and the sequences of the recombination arms must be the same as the sequences of 5 'upstream and 3' downstream outside the deleted sequence.

In a further preferred embodiment of the present invention, the microinjection DNA mixture system includes the following:

Cas9 plasmid, 50 ng/. mu.L;

Co-editing marker plasmid, 50 ng/. mu.L;

5' end upstream sgRNA plasmid, 50 ng/. mu.L;

3' end downstream sgRNA plasmid, 50 ng/. mu.L;

reporter plasmid, 20 ng/. mu.L; and

Repair template, 20 ng/. mu.L.

In addition, the microinjection DNA mixed solution system also contains 20 ng/mu L of template matched with the co-editing marker plasmid.

The co-editing system for screening the target mutation is a ben-164sgRNA co-editing system, and the heterozygosis or homozygosis target editing gene mutation nematode is screened by performing a conventional gene editing experiment.

And (5) sequencing to verify whether the homozygous target gene mutation nematode is correct.

to explain technical contents, structural features, and objects and effects of the technical solutions in detail, the following detailed description is given with reference to the accompanying drawings in conjunction with the embodiments. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present application.

Example 1: method for knocking out whole gene of wah-1 gene

This example provides a method for deleting the entire gene of wah-1 gene from caenorhabditis elegans, hermaphrodite, see FIG. 4. And (3) screening the wah-1 gene by adopting an accurate all-gene deletion (knockout) method and using a co-editing system to carry out all-gene knockout and editing on the nematode, and further obtaining the editing efficiency of the method. The sequence of the wah-1 gene can be downloaded from the website of wormbase (http:// www.wormbase.org /).

(1) Selecting a 5' efficient sgRNA target site near an initiation codon ("ATG") and determining the sequence of the sgRNA target site. Searching sgRNA at the 5 'end near the initiation codon ("ATG") in an sgRNA efficiency prediction website (such as http:// crispor. for. net/or http:// crispr. mit. edu /), selecting sgRNA target sites (attached table I) with high editing efficiency scores and low off-target effect, wherein the scores are high and indicate that the sg is predicted to have high editing efficiency, and in the embodiment, obtaining an efficient sgRNA target sequence at the 5' end near the initiation codon ("ATG") as follows:

wah-1-Sg1 (shown as SEQ ID NO. 1)

(2) Selecting a high-efficiency sgRNA target site near a stop codon and determining the sequence of the sgRNA target site. Searching sgRNA near the stop codon in an sgRNA efficiency prediction website (such as http:// crispor. for. net/or http:// crispr. mit. edu /), selecting an sgRNA target site (attached table one) with high editing efficiency score and low off-target effect, and obtaining an efficient sgRNA target sequence near the stop codon, namely:

wah-1-Sg 2: (as shown in SEQ ID NO. 2)

Wherein the target site PAM sequence is bolded and double underlined.

(3) Determination of Whole Gene knockout repair template sequences

The repair template sequence of the whole gene deletion method has no coding sequence and only contains a promoter and a 3 ' UTR, and the repair template comprises template sequences of 35-50bp at the 5 ' upstream and the 3 ' downstream outside the deletion sequence, so that the sequence of the repair template of the whole gene deletion of wah-1 is determined as follows (-representing a deleted part), and is synthesized by a synthesis company.

wah-1-oligo1: ataatccttcatttcaggtagaatagacggaaatcatcagaaggacaaaa-agatttagatttttagggttaatatatttaatttttttatttttttattt (shown as SEQ ID NO. 3)

(4) constructing sgRNA plasmid: the sgRNA target DNA sequence with 20bp upstream length of 5' of the PAM sequence is constructed into pU6 sgRNA plasmid by a conventional molecular biology method to respectively obtain pU6 plasmid pU6 plasmid wah-1-sg1 plasmid and wah-1-sg2 plasmid. The construction steps of sgRNA plasmid are referred to the technical scheme provided in chinese patent application 201811491730.0.

(5) microinjection

the upstream pU6 at the 5 'end edited by the target gene, 50 ng/mu L of the wah-1-sg1 plasmid, and the downstream pU6 at the 3' end, 50 ng/mu L of the wah-1-sg2 plasmid, 120 ng/mu L of the repair template wah-1-oligo, 50 ng/mu L of the co-editing marker plasmid required by a co-editing system, 20 ng/mu L of the reporter gene plasmid and 50 ng/mu L of the Cas9 plasmid are mixed into a micro-injection DNA mixed solution system, the mixed solution system is injected into the gonad of hermaphrodite to obtain P0 generation nematode, and the P1 generation nematode is obtained by culturing and oviposition.

(6) Screening for mutations of interest

And (3) starting a conventional gene editing experiment by using a ben-164sgRNA co-editing system, and screening heterozygous or homozygous target editing gene mutation nematodes. The specific operation steps are as follows:

a) preparing materials: preparing a Cas9 plasmid, a sgRNA co-editing system plasmid for specifically recognizing a ben-164sgRNA target site sequence (5'-TCAAATCGGAGCCAAGTTCTGGG-3'), a sgRNA plasmid for specifically recognizing a target editing site, a reporter gene plasmid, a repair template required by target gene editing, hermaphrodite nematodes, a common nematode culture plate and a nematode culture plate with 14 mu M benomyl concentration for later use;

b) Preparing a DNA mixed solution: mixing the Cas9 plasmid, the sgRNA plasmid for specifically recognizing the target site of the ben-164sgRNA, the sgRNA plasmid for specifically recognizing the target editing site, the reporter gene plasmid and a repair template required by target gene editing to obtain a DNA mixed solution;

c) Microinjection: injecting the DNA mixed solution into gonads of hermaphrodite nematodes to obtain P0 generation nematodes, and then culturing the P0 generation nematodes in nematode culture plates with the concentration of 14 mu M benomyl to obtain F1 generation nematodes;

d) Co-edited F1 generation nematodes were picked: selecting nematodes with edited ben-164sgRNA target sites from the F1 generation nematodes, wherein the nematodes have good growth and free movement and have movement tracks such as sinusoidal curves. Respectively placing the F1 nematodes with edited phenotype in a single plate in a common agar culture plate for culture and oviposition, and separating to 200 plates at least to obtain F2 generation nematodes;

e) plates of F1 generation co-editing nematodes were screened for mutations in the gene of interest: cracking the F2 generation nematodes growing to L4 or above with nematode lysate to obtain F2 generation nematode template DNA, screening nematodes with target gene mutation by adopting a PCR amplification or enzyme digestion method, and finding an F1 generation nematode flat plate with target gene editing and ben-164sgRNA target site co-editing;

f) Removal of nematodes with the ben-164sgRNA target site edited: selecting 8-16F 2 generations of nematodes from the flat plate of the F1 generation co-editing nematodes with target gene mutation, dividing a single plate into nematode culture flat plates with the concentration of 14 mu M benomyl, and screening nematode flat plates without co-editing mutation by PCR when the F3 generation grows to the L4 period, namely the whole plate nematode phenotype is body paralysis, shortness and incoordination of movement;

g) Screening for homozygous target-edited nematodes: and (3) preparing the nematodes in the nematode plates without the co-editing mutation into DNA templates, and screening the nematode plates with homozygous target gene mutation by a molecular biological method.

(7) Sequencing to verify the mutation of interest

Sequencing to verify whether the target editing nematode is correct: the editing nematodes are subjected to conventional PCR operation by using upstream and downstream primers which are located at a binding position at a distance of 300-500bp from the deleted sequence, and are sent to a sequencing company for sequencing.

(8) Efficiency of Gene editing

The inventor verifies whether the caenorhabditis elegans with accurate gene editing is obtained by PCR screening, sequencing verification and other identification modes. In the editing experiment of the wah-1 gene complete gene deletion method (total knock-out 9253bp), 146F 1 nematodes are screened by the inventor, 13F 1 obtained by screening by a PCR method have potential gene editing, and sequencing verification shows that all the F1 are non-precise editing, so that 1 precisely knocked-out editing nematode is obtained, the editing efficiency is 8.90%, and the precise editing efficiency is 0.7%. Meanwhile, the inventor finds that after the gene is completely knocked out, the nematode strain has sterile phenotype, namely, offspring is not generated.

Example 2: gene knock-out method combining precise large-fragment gene deletion of wah-1 gene with insertion of stop codon

This example provides a method of gene knock-out using caenorhabditis elegans for the precise large fragment gene deletion of the wah-1 gene in combination with the insertion of a stop codon, see FIG. 5.

And (3) screening the gene-editing nematodes with the wah-1 gene deleted and terminated accurately in large fragment by a co-editing system by adopting a gene knock-out method combining the accurate large fragment gene deletion with the insertion of a termination codon, and further obtaining the editing efficiency of the method. The sequence of the wah-1 gene can be downloaded from the website of wormbase (http:// www.wormbase.org /).

(1) Selecting efficient sgRNA target site near 5' end and determining sgRNA target site sequence

According to the gene knock-out method of the precise large-fragment gene deletion combined with the insertion of the stop codon, the sgRNA target sequences at the 5 'end and the 3' end do not necessarily comprise or are very close to the start codon or the stop codon, the sgRNA near the 5 'end is searched in a sgRNA efficiency prediction website (such as http:// crispor.force.net/or http:// crispr.mit.edu /), sgRNA target sites with high editing efficiency fraction and low off-target effect are selected (shown in a table I), so that an efficient sgRNA target sequence near the 5' end is obtained, and in order to reduce variables, the selected sgRNA is better compared with the embodiment 1, the 5 'end sgRNA is the same as the 5' end efficient sgRNA target sequence near the start codon ("ATG") in the embodiment 1, namely:

wah-1-Sg1 (shown as SEQ ID NO. 1)

wherein the target site PAM sequence is bolded and double underlined.

(2) Selecting a high-efficiency sgRNA target site near a 3' end and determining the sequence of the sgRNA target site

The sgRNA efficiency prediction website (such as http:// crispor. for. net/or http:// crispr. mit. edu /) is used to select a 3 'sgRNA target site with high editing efficiency fraction and low off-target effect between a 5' sgRNA target site and a stop codon and determine the sequence of the sgRNA target site. In order to reduce the variation better, the comparison with example 5 is performed, the selected sgRNA at the 3 'end is the same as the prediction efficiency score of the sgRNA target sequence with high efficiency at the 3' end near the stop codon in example 1, so as to obtain a sgRNA target sequence with high efficiency at the 3 'end (attached table one), at this time, the sgRNA target sequence at the 3' end is not very close to the stop codon, but the knockout range is controlled to be about 1.5kb, so as to achieve the purpose of saving the cost, and obtain the sgRNA target sequence, that is:

wah-1-Sg3 (shown as SEQ ID NO. 4)

wherein the target site PAM sequence is bolded and double underlined.

(3) determining the repair template sequence with the stop codon, selecting a proper deletion sequence according to the position of the sgRNA target sequence, and determining the position of the precise deletion sequence, wherein the 5 'end point and the 3' end point of the deleted sequence are positioned in the 5 'sgRNA target sequence and the 3' sgRNA target sequence. Meanwhile, because the sgRNA target sequence at the 3 'end is not very close to the position of the termination codon in the deleted sequence, the' CCG 'is mutated into the termination codon' TAG 'by frame shift at the position of the deleted sequence, and simultaneously frame shift mutation is generated, so that a plurality of termination codons are also generated at the downstream of the 3' end of the termination codon, and the purpose of terminating protein expression in advance is achieved. The repair template comprises template sequences of 35-50bp at the upstream 5 'and downstream 3' positions outside the deleted sequence, so that the obtained repair template sequence inserted by the deletion of the wah-1 precise large-fragment gene and the stop codon is as follows (-representing the knocked-out part):

wah-1-oligo2 (shown as SEQ ID NO. 5)

Wherein the start and stop codons of the repair template are bold and single underlined.

(4) constructing sgRNA plasmid: the sgRNA target sequence with the upstream length of 20bp of the PAM sequence 3' is constructed into pU6 sgRNA plasmid by a conventional molecular biology method, and pU6 plasmid wah-1-sg3 is obtained again. The construction steps of sgRNA plasmid are referred to the technical scheme provided in chinese patent application 201811491730.0.

(5) microinjection

The upstream pU6 at the 5 'end edited by the target gene in example 1, 50 ng/muL of the wah-1-sg1 plasmid, 50 ng/muL of the downstream pU6 at the 3' end in this example, 50 ng/muL of the wah-1-sg3 plasmid, 220 ng/muL of the repair template wah-1-oligo, 50 ng/muL of the co-editing marker plasmid required by the co-editing system, 20 ng/muL of the reporter gene plasmid and 50 ng/muL of the Cas9 plasmid are mixed into a micro-injection DNA mixed solution system, injected into the gonad of hermaphrodite nematode to obtain P0 generation nematode, cultured and laid eggs to obtain F1 generation nematode.

(6) Screening for mutations of interest

And (3) starting a conventional gene editing experiment by using a ben-164sgRNA co-editing system, and screening heterozygous or homozygous target editing gene mutation nematodes. The specific procedure of gene editing in the ben-164sgRNA co-editing system was the same as in example 1.

(7) Sequencing to verify the mutation of interest

(8) Efficiency of Gene editing

The inventor verifies whether the precise gene editing nematode is obtained or not by the same identification modes such as PCR screening, sequencing verification and the like. In the wah-1 gene knockout termination method, because the sgRNA target sequence at the 3 'end is not very close to the position of the stop codon in the deleted sequence, and the deleted sequence is controlled to be about 1.5kb in order to achieve the effect of saving cost, in this embodiment, "CCG" is mutated into the stop codon "TAG" by frame shifting the position of the deleted sequence, so that a plurality of stop codons are also generated at the downstream of the 3' end of the stop codon, so that the gene is completely knocked out, and the protein expression is terminated in advance. In the embodiment, only 1593bp is knocked out, 7660bp is knocked out less than 9253bp knocked out by the whole gene, and residual base only expresses an oligonucleotide peptide or does not express any protein due to mRNA degradation. The offspring of 131F 1 nematodes are screened, PCR verification is carried out, 32F 1 with potential gene editing are obtained, and 7 positive numbers are subjected to sequencing verification, and all the positive numbers are accurate editing. The editing efficiency is 24.43%, and the accurate editing efficiency is about 24.43% according to the accurate editing proportion obtained by sequencing.

in the implementation process of the invention, the homozygous mutant obtained by screening by using the gene knock-out method combining precise large-fragment gene deletion with terminator insertion is also sterile phenotype (namely, offspring can not be generated), and is consistent with the phenotype of the whole-gene knock-out and editing nematode strain obtained in the embodiment 1, and the function proves that the gene knock-out method combining precise large-fragment gene deletion with terminator insertion can achieve the effect consistent with whole-gene knock-out. However, the knockout method of precise large fragment deletion combined with terminator insertion has the advantages of high speed, high cost performance and high success rate compared with the whole gene knockout method.

Example 3: method for knocking out gsk-3 gene in whole

This example provides a method for deleting the entire gsk-3 gene from caenorhabditis elegans, both hermaphrodite and caenorhabditis elegans, see FIG. 6. And (3) screening the gsk-3 gene by adopting an accurate whole gene deletion (knockout) method and using a co-editing system to carry out whole gene knockout and editing on nematodes, and further obtaining the editing efficiency of the method. The sequence of the gsk-3 gene can be downloaded from the website of wormbase (http:// www.wormbase.org /).

(1) Selecting a 5' efficient sgRNA target site near an initiation codon ("ATG") and determining the sequence of the sgRNA target site. Searching sgRNA at the 5 'end near the initiation codon ("ATG") in an sgRNA efficiency prediction website (such as http:// crispor. for. net/or http:// crispr. mit. edu /), selecting sgRNA target sites (attached table I) with high editing efficiency scores and low off-target effect, wherein the scores are high, the sgRNA target sites show high sg prediction efficiency, and in the embodiment, the sequences of the sgRNA targets with high efficiency at the 5' end near the initiation codon ("ATG") are obtained as follows:

gsk-3-Sg1 (shown as SEQ ID NO. 6)

Wherein the target site PAM sequence is bolded and double underlined.

gsk-3-Sg2 (shown as SEQ ID NO. 7)

Wherein the target site PAM sequence is bolded and double underlined.

(3) Determination of Whole Gene knockout repair template sequences

the repair template sequence of the whole gene deletion method has no coding sequence and only contains a promoter and a 3 ' UTR, and the repair template comprises a template sequence of 35-50bp at the upstream of the 5 ' end and the downstream of the 3 ' end outside the deletion sequence, so that the sequence of the repair template of the gsk-3 whole gene deletion is determined as follows (-representing a deleted part), and is synthesized by a synthesis company.

gsk-3-oligo1: tacacacacacacacaagaatcaaatcaatcagtagtgtggtgtg-acttcttttttttattttaatattggttctgaattttctctcgaat (shown as SEQ ID NO. 8)

(4) constructing sgRNA plasmid: the sgRNA target sequence with 20bp upstream length of 5' of the PAM sequence is constructed into pU6 sgRNA plasmid by a conventional molecular biology method to respectively obtain pU6, gsk-3-sg1 plasmid pU6, gsk-3-sg2 plasmid. The construction steps of sgRNA plasmid are referred to the technical scheme provided in chinese patent application 201811491730.0.

(5) Microinjection

the upstream pU6 at the 5 'end edited by the target gene, gsk-3-sg1 plasmid 50 ng/muL, the downstream pU6 at the 3' end, gsk-3-sg2 plasmid 50 ng/muL, repair template gsk-3-oligo120ng muL, co-editing marker plasmid 50 ng/muL required by a co-editing system, reporter gene plasmid 20 ng/muL and Cas9 plasmid 50 ng/muL are mixed into a micro-injection DNA mixed solution system, and injected into the gonad of male and female nematodes to obtain P0 generation nematodes, and cultured to lay eggs to obtain F1 generation nematodes.

(6) screening for mutations of interest

(7) Sequencing to verify the mutation of interest

(8) efficiency of Gene editing

The inventor verifies whether the caenorhabditis elegans with accurate gene editing is obtained by PCR screening, sequencing verification and other identification modes. Editing by a gsk-3 gene whole gene deletion method (knocking out 5304bp together), screening 288F 1 nematodes in total, obtaining only 2 positive numbers through PCR screening and sequencing verification statistical results, and finding that 1 is accurate editing and 1 is inaccurate editing through sequencing verification. This example resulted in an editing efficiency of 0.69% and an accurate editing efficiency of 0.35%. Meanwhile, after the gene is completely knocked out, the nematode strain has sterile phenotype, namely, offspring is not generated.

Example 4: gene knock-out method combining precise large-fragment gene deletion of gsk-3 gene with insertion of stop codon

this example provides a gene knock-out method for the precise large fragment gene deletion in which the gsk-3 gene was knocked out by C.elegans, in combination with the insertion of a stop codon, see FIG. 7.

the gene knock-out method combining precise large-fragment gene deletion with stop codon insertion is adopted, and the co-editing system is used for screening gene-editing nematodes with the precise large-fragment deletion termination of the gsk-3 gene, so that the editing efficiency of the method is further obtained. The sequence of the gsk-3 gene can be downloaded from the website of wormbase (http:// www.wormbase.org /).

According to the gene knock-out method of the precise large-fragment gene deletion combined with the stop codon insertion, the sgRNA target sequences at the 5 'end and the 3' end do not necessarily comprise or are very close to the start codon or the stop codon, the sgRNA near the 5 'end is searched in a sgRNA efficiency prediction website (such as http:// crispor.force.net/or http:// crispr.mit.edu /), sgRNA target sites with high editing efficiency fraction and low off-target effect are selected (shown in a table I), so that an efficient sgRNA target sequence near the 5' end is obtained, in order to reduce variables, the sgRNA is better compared with the embodiment 3, the selected 5 'end sgRNA is the same as the 5' end efficient sgRNA target sequence near the start codon ("ATG") in the embodiment 3, namely:

gsk-3-Sg1 (shown as SEQ ID NO. 6)

Wherein the target site PAM sequence is bolded and double underlined.

The sgRNA efficiency prediction website (such as http:// crispor. for. net/or http:// crispr. mit. edu /) is used to select a 3 'sgRNA target site with high editing efficiency fraction and low off-target effect between a 5' sgRNA target site and a stop codon and determine the sequence of the sgRNA target site. In order to reduce the variation better, the comparison with the embodiment 3 is performed, the selected sgRNA at the 3 'end is the same as the efficient sgRNA target sequence prediction efficiency score of the 3' end near the stop codon in the embodiment 3, so as to obtain the efficient sgRNA target sequence at the 3 'end (attached table one), at this time, the sgRNA target sequence at the 3' end is not very close to the stop codon, but the knockout range is controlled to be about 1.5kb, so as to achieve the purposes of saving the cost, improving the editing efficiency and reducing the editing time, so as to obtain the sgRNA target sequence, that is:

gsk-3-Sg3 (shown as SEQ ID NO. 9)

Wherein the target site PAM sequence is bolded and double underlined.

(3) Determination of repair template sequence with stop codon

And selecting a proper deletion sequence according to the position of the sgRNA target sequence, and determining the position of the precise deletion sequence, wherein the 5 'end point and the 3' end point of the deleted sequence are positioned in the 5 'sgRNA target sequence and the 3' sgRNA target sequence. Meanwhile, as the sgRNA target sequence at the 3 ' end is not very close to the position of the stop codon in the deleted sequence, the codon TGG is mutated into TGA at the position of the deleted sequence to form a stop codon, the protein expression is stopped in advance, and the repair template comprises template sequences of 35-50bp at the 5 ' upstream and the 3 ' downstream outside the deleted sequence, so that the obtained gsk-3 precise large fragment gene is deleted and combined with the repair template sequence inserted by the stop codon as follows (-representing a knockout part):

gsk-3-oligo2 (shown as SEQ ID NO. 10)

(4) Constructing sgRNA plasmid: the sgRNA target sequence with the upstream length of 20bp of the PAM sequence 5' is constructed into pU6 sgRNA plasmid by a conventional molecular biology method, and pU6, gsk-3-sg3 plasmid is obtained again. The construction steps of sgRNA plasmid are referred to the technical scheme provided in chinese patent application 201811491730.0.

(5) Microinjection

The upstream pU6 at the 5 'end edited by the target gene in the example 3, 50 ng/muL of gsk-3-sg1 plasmid, 50 ng/muL of downstream pU6 at the 3' end in the example, 50 ng/muL of gsk-3-sg3 plasmid, 220ng muL of repair template gsk-3-oligo, 50 ng/muL of co-editing marker plasmid required by a co-editing system, 20 ng/muL of reporter gene plasmid and 50 ng/muL of Cas9 plasmid are mixed into a micro-injection DNA mixed solution system, injected into the gonad of hermaphrodite nematodes to obtain P0 nematodes, cultured and laid eggs to obtain F1 nematodes.

(6) Screening for mutations of interest

(7) sequencing to verify the mutation of interest

(8) Efficiency of Gene editing

The inventor verifies whether the precise gene editing nematode is obtained or not by the same identification modes such as PCR screening, sequencing verification and the like. In the gsk-3 gene knockout termination method, because the sgRNA target sequence of 3 'is not very close to the position of the stop codon in the deletion sequence, and the deletion sequence is controlled to be about 1.5kb in order to achieve the effect of saving cost, the first codon in the downstream of the deletion sequence 3' is mutated from TGG to the stop codon TGA in the embodiment, so as to generate the stop codon, thereby causing frame shift mutation, terminating protein expression in advance, or degrading mRNA.

In this example, only 1175bp knockout was performed, 4129bp knockout was performed less than 5304bp knockout of the whole gene, and the remaining bases expressed only oligo-amino acid peptide or no protein due to mRNA degradation. The offspring of 151F 1 nematodes were screened, PCR verified to obtain 3F 1 with potential gene editing, and both mutants were sequence verified, 1 for non-exact editing and 2 for exact editing. The editing efficiency is 2%, and the accurate editing efficiency is about 1.3%.

in the implementation process of the invention, the homozygous mutant obtained by screening by using the gene knock-out method combining precise large-fragment gene deletion with terminator insertion is also sterile phenotype (namely, offspring can not be generated), and is consistent with the phenotype of the whole-gene knock-out and editing nematode strain obtained in the embodiment 1, and the screening function proves that the gene knock-out method combining precise large-fragment gene deletion with terminator insertion can achieve the effect consistent with whole-gene knock-out. However, the knockout method of precise large fragment deletion combined with terminator insertion has the advantages of high speed, high cost performance and high success rate compared with the whole gene knockout method.

Example 5: tat-5 gene complete gene knock-out method

this example provides a method for deleting the tat-5 gene from caenorhabditis elegans, hermaphrodite, as shown in FIG. 8. And (3) screening tat-5 gene full-gene knockout and editing nematodes by adopting an accurate full-gene deletion method and a co-editing system, and further obtaining the editing efficiency of the method. the sequence of the tat-5 gene can be downloaded from the website of wormbase (http:// www.wormbase.org /).

(1) Selecting a 5' efficient sgRNA target site near an initiation codon ("ATG") and determining the sequence of the sgRNA target site. Searching sgRNA at the 5 'end near the initiation codon ("ATG") in an sgRNA efficiency prediction website (such as http:// crispor. for. net/or http:// crispr. mit. edu /), selecting sgRNA target sites with high editing efficiency scores and low off-target effect (attached table I), wherein the scores are high and indicate that the off-target effect is low, and in the embodiment, obtaining the efficient sgRNA target sequences at the 5' end near the initiation codon ("ATG") as follows:

tat-5-Sg1 (shown as SEQ ID NO. 11)

Wherein the target site PAM sequence is bolded and double underlined.

tat-5-Sg2 (shown as SEQ ID NO. 12)

Wherein the target site PAM sequence is bolded and double underlined.

(3) determination of Whole Gene knockout repair template sequences

The whole gene deletion method has no coding sequence in the repair template sequence, only a promoter and a 3 ' UTR, and the repair template comprises template sequences of 35-50bp at the 5 ' upstream and the 3 ' downstream outside the deletion sequence, so that the tat-5 whole gene deletion repair template sequence is determined as follows (-representing a deleted part), and is synthesized by a synthesis company.

tat-5-oligo1: gggctcattttgaaaattttaatggttgactgatacctggatcac-gaattaatttattcgaaatgagggaaattatgatttaaaaaaaaa (shown as SEQ ID NO. 13)

(4) Constructing sgRNA plasmid: the sgRNA target sequence with 20bp upstream length of 5' of the PAM sequence is constructed into pU6 sgRNA plasmid by a conventional molecular biology method to respectively obtain pU6 tat-5-sg1 plasmid pU6 and tat-5-sg2 plasmid. The construction steps of sgRNA plasmid are referred to the technical scheme provided in chinese patent application 201811491730.0.

(5) microinjection

Mixing the upstream pU6 at the 5 'end edited by the target gene, tat-5-sg1 plasmid 50 ng/muL and the downstream pU6 at the 3' end, tat-5-sg2 plasmid 50 ng/muL, repair template tat-5-oligo120 ng/muL, co-editing marker plasmid 50 ng/muL required by a co-editing system, reporter gene plasmid 20 ng/muL and Cas9 plasmid 50 ng/muL into a micro-injection DNA mixed solution system, injecting the mixed solution system into the gonad of hermaphrodite nematodes to obtain P0 nematodes, culturing and laying eggs to obtain F1 nematodes;

(6) screening for mutations of interest

(7) Sequencing to verify the mutation of interest

(8) Efficiency of Gene editing

The inventor verifies whether the caenorhabditis elegans with accurate gene editing is obtained by PCR screening, sequencing verification and other identification modes. In the offspring edited by the tat-5 gene complete gene deletion method (7370 bp total knockout), 240F 1 nematodes are screened by a PCR method, 2F 1 obtained by the screening by the PCR method have potential gene edits, and sequencing verification shows that 1 is a non-precise edit and 1 is a precise knockout edit, so that the editing efficiency is 0.83 percent and the precise editing efficiency is 0.42 percent. In the screening process, the inventor finds that after the gene is completely knocked out, the nematode strain has sterile phenotype, namely, offspring is not generated.

Example 6: gene knock-out method combining precise large-fragment gene deletion of tat-5 gene with insertion of stop codon

This example provides a gene knock-out method using caenorhabditis elegans for the precise large fragment gene deletion of tat-5 gene in combination with the insertion of stop codon, see FIG. 9.

The gene knock-out method combining precise large-fragment gene deletion with stop codon insertion is adopted, and the co-editing system is used for screening the gene-editing nematodes with the tat-5 gene precise large-fragment deletion being stopped, so that the editing efficiency of the method is further obtained. the sequence of the tat-5 gene can be downloaded from the website of wormbase (http:// www.wormbase.org /).

According to the gene knock-out method of the precise large-fragment gene deletion combined with the insertion of the stop codon, the sgRNA target sequences at the 5 'end and the 3' end do not necessarily comprise or are very close to the start codon or the stop codon, the sgRNA near the 5 'end is searched in an sgRNA efficiency prediction website (such as http:// crispor.tefor. net/or http:// crispr.mit. edu /), sgRNA target sites with high editing efficiency fraction and low off-target effect are selected (attached table I), so that an efficient sgRNA target sequence near the 5' end is obtained, and in order to reduce variables, the selected sgRNA is better compared with the embodiment 5, and the 5 'end sgRNA is the same as the 5' end efficient sgRNA target sequence near the start codon ("ATG") in the embodiment 5, namely:

tat-5-Sg1 (shown as SEQ ID NO. 11)

wherein the target site PAM sequence is bolded and double underlined.

The sgRNA efficiency prediction website (such as http:// crispor. for. net/or http:// crispr. mit. edu /) is used to select a 3 'sgRNA target site with high editing efficiency fraction and low off-target effect between a 5' sgRNA target site and a stop codon and determine the sequence of the sgRNA target site. In order to reduce the variation better, the comparison with example 5 is performed, the selected sgRNA at the 3 'end is the same as the prediction efficiency score of the sgRNA target sequence with high efficiency at the 3' end near the stop codon in example 5, so as to obtain a sgRNA target sequence with high efficiency at the 3 'end (attached table one), at this time, the sgRNA target sequence at the 3' end is not very close to the stop codon, but the knockout range is controlled to be about 1.5kb, so as to achieve the purpose of saving the cost, and obtain the sgRNA target sequence, that is:

tat-5-Sg3:(SEQ ID NO.14)

Wherein the target site PAM sequence is bolded and double underlined.

(3) determination of repair template sequence with stop codon

And selecting a proper deletion sequence according to the position of the sgRNA target sequence, and determining the position of the precise deletion sequence, wherein the 5 'end point and the 3' end point of the deleted sequence are positioned in the 5 'sgRNA target sequence and the 3' sgRNA target sequence. Because the sgRNA target sequence of 3 'is not very close to the position of the stop codon in the deleted sequence, the position of the deleted sequence is shifted, the first codon' TGG 'after the deleted sequence is mutated into the stop codon' TGA ', so that a plurality of stop codons are generated at the downstream of the stop codon 3', the gene is completely knocked out, and the protein expression is stopped in advance. The repair template comprises template sequences of 35-50bp at the upstream 5 'and downstream 3' outside the deleted sequence, so that the obtained repair template sequence of the tat-5 precise large fragment gene deletion combined with the stop codon insertion is as follows (-representing the knockout part):

tat-5-oligo2 (shown as SEQ ID NO. 15)

(4) constructing sgRNA plasmid: the sgRNA target sequence with 20bp upstream length of the 5' end of the PAM sequence is constructed into pU6 sgRNA plasmid by a conventional molecular biology method, and pU6 tat-5-sg3 plasmid is obtained again. The construction steps of sgRNA plasmid are referred to the technical scheme provided in chinese patent application 201811491730.0.

(5) microinjection

in the embodiment, upstream pU6 at the 5 'end edited by the target gene, tat-5-sg1 plasmid 50 ng/muL, downstream pU6 at the 3' end, tat-5-sg3 plasmid 50 ng/muL, repair template tat-5-oligo220 ng/muL, co-editing marker plasmid 50 ng/muL required by a co-editing system, reporter gene plasmid 20 ng/muL and Cas9 plasmid 50 ng/muL are mixed into a micro-injection DNA mixed solution system, the mixed solution system is injected into gonads of hermaphrodite nematodes to obtain P0 nematodes, and the P1 nematodes are cultured to lay eggs.

(6) screening for mutations of interest

(7) Sequencing to verify the mutation of interest

Sequencing to verify whether the homozygous target editing nematodes are correct: the editing nematodes are subjected to conventional PCR operation by using upstream and downstream primers which are located at a binding position at a distance of 300-500bp from the deleted sequence, and are sent to a sequencing company for sequencing.

(8) Efficiency of Gene editing

the inventor verifies whether accurate gene editing nematodes are obtained or not through the same identification modes such as PCR screening, sequencing verification and the like, and in the tat-5 gene accurate large fragment knockout termination method, because the 3 'sgRNA target sequence is not very close to the position of a termination codon in a deleted sequence, the first codon at the downstream of the 3' end of the deleted sequence is mutated from 'TGG' to 'TGA' to form the termination codon and generate frame shift mutation, so that the tat-5 gene is completely knocked out, and the protein expression is terminated in advance. Only 1657bp is knocked out, 5713bp is knocked out less than 7370bp knocked out by the whole gene, and residual base only expresses oligoamino acid peptide or does not express protein because mRNA is degraded. The offspring of 144F 1 nematodes were screened, PCR verified to obtain 25F 1 with potential gene editing, and all potential editing nematodes were sequenced and verified to obtain 8 completely correct edits with editing efficiency of 17.36% and accurate editing efficiency of about 5.56%.

in the implementation process of the invention, the homozygous mutant obtained by screening by using the gene knock-out method combining precise large-fragment gene deletion with terminator insertion is also sterile phenotype (namely, offspring cannot be generated), and is consistent with the phenotype of the whole-gene knock-out and editing nematode plant obtained in example 5, and the screening function proves that the gene knock-out method combining precise large-fragment gene deletion with terminator insertion can achieve the effect consistent with whole-gene knock-out, however, the knock-out method combining precise large-fragment gene deletion with terminator insertion has the advantages of high speed, high cost performance and high success rate compared with the whole-gene knock-out method.

According to the invention, three gene knockouts, namely wah-1, gsk-3 and tat-5, are taken as examples, the gene knockout editing is carried out by adopting a knockout method of full gene knockout and accurate large fragment deletion combined with terminator insertion, and the obtained gene editing efficiency data is shown in the attached table II, so that an 'editing method of accurate gene deletion combined with stop codon insertion', namely a knockout termination method, can be obtained.

A first attached table: sgRNA target site sequence

And B, attaching a table II: gene editing efficiency comparison of full gene knockout and gene knockout by large fragment deletion termination method

It should be noted that, although the above embodiments have been described herein, the invention is not limited thereto. Therefore, based on the innovative concepts of the present invention, the technical solutions of the present invention can be directly or indirectly applied to other related technical fields by making changes and modifications to the embodiments described herein, or by using equivalent structures or equivalent processes performed in the content of the present specification and the attached drawings, which are included in the scope of the present invention.

the biological sequence list related in the invention is as follows:

sequence listing

<110> Fujian Shangyuan Biotechnology Co., Ltd

<120> Gene knock-out method combining precise large fragment Gene deletion with stop codon insertion

<130> 2019

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Caenorhabditis elegans (C. elegans)

<400> 1

aaaatgctgt tgcgagctgt tgg 23

<210> 2

<211> 23

<212> DNA

<213> Caenorhabditis elegans (C. elegans)

<400> 2

cccactttat gatccagtga aaa 23

<210> 3

<211> 100

<212> DNA

<213> Artificial sequence (Artificial)

<400> 3

ataatccttc atttcaggta gaatagacgg aaatcatcag aaggacaaaa agatttagat 60

ttttagggtt aatatattta atttttttat ttttttattt 100

<210> 4

<211> 23

<212> DNA

<213> Caenorhabditis elegans (C. elegans)

<400> 4

ccacaccagt atacattcca aaa 23

<210> 5

<211> 106

<212> DNA

<213> Artificial sequence (Artificial)

<400> 5

ggtagaatag acggaaatca tcagaaggac aaaaatgctg ttgcgagctg tttagggctc 60

ccttgactgg acattcttca gccgatcgca cacaaaatct gctcac 106

<210> 6

<211> 23

<212> DNA

<213> Caenorhabditis elegans (C. elegans)

<400> 6

ctatcgtgct cgctgaaaag cgg 23

<210> 7

<211> 23

<212> DNA

<213> Caenorhabditis elegans (C. elegans)

<400> 7

cggtgatgtg gctggcccat cgg 23

<210> 8

<211> 91

<212> DNA

<213> Artificial sequence (Artificial)

<400> 8

tacacacaca cacacaagaa tcaaatcaat cagtagtgtg gtgtgacttc ttttttttat 60

tttaatattg gttctgaatt ttctctcgaa t 91

<210> 9

<211> 23

<212> DNA

<213> Caenorhabditis elegans (C. elegans)

<400> 9

gatcagaaag tgattggaaa tgg 23

<210> 10

<211> 93

<212> DNA

<213> Artificial sequence (Artificial)

<400> 10

tgtggtgtga tgaataagca gttactatcg tgctcgctga aaagctgaat cattcggagt 60

ggtattcctt gccaaactct ctacaacaaa tga 93

<210> 11

<211> 23

<212> DNA

<213> Caenorhabditis elegans (C. elegans)

<400> 11

gactgatacc tggatcacat ggg 23

<210> 12

<211> 23

<212> DNA

<213> Caenorhabditis elegans (C. elegans)

<400> 12

ccaagctacg cgaaagtcaa ctg 23

<210> 13

<211> 90

<212> DNA

<213> Artificial sequence (Artificial)

<400> 13

gggctcattt tgaaaatttt aatggttgac tgatacctgg atcacgaatt aatttattcg 60

aaatgaggga aattatgatt taaaaaaaaa 90

<210> 14

<211> 23

<212> DNA

<213> Caenorhabditis elegans (C. elegans)

<400> 14

aatcacttac tggggaccac tgg 23

<210> 15

<211> 93

<212> DNA

<213> Artificial sequence (Artificial)

<400> 15

ctcattttga aaattttaat ggttgactga tacctggatc acatgtgaga tttgtgctca 60

caataactct tattcgagaa gctttcgatg act 93

Claims

1. A method for gene knock-out by combining precise large-fragment gene deletion with stop codon insertion, which is characterized by comprising the following steps:

Determining and constructing a repair template;

microinjection: injecting the microinjection DNA mixed solution into gonads of hermaphrodite nematodes to obtain P0 generation nematodes, and culturing to obtain F1 generation nematodes; and

And screening and verifying the target mutation.

2. The gene knock-out method of claim 1, wherein the determined 5 'and 3' sgRNA target site sequences comprise the steps of:

Searching sgRNA target sites within 100bp near the initiation codon from a sgRNA efficiency prediction website; selecting a sgRNA target site with high editing efficiency specificity fraction and low off-target effect to obtain a 5' end sgRNA target site sequence;

searching sgRNA target sites with high specific scores of editing efficiency and low off-target effect between a 5' sgRNA target site sequence and a stop codon from a sgRNA efficiency prediction website; and obtaining the 3' sgRNA target site sequence.

3. The gene knock-out method of claim 1, wherein the 5 'and 3' ends of the precisely large-fragment gene deletion sequences are located in the 5 'sgRNA target sequence and the 3' sgRNA target sequence, respectively.

4. The gene knock-out method of claim 1, wherein the repair template is an oligonucleotide chain.

5. The method of claim 4, wherein the repair template comprises a stop codon.

6. The gene knock-out method of claim 4, wherein the stop codon on the repair template is flanked by sequences of 35-50bp 5 'upstream and 3' downstream, respectively, outside the deletion sequence of the precise large fragment gene.

7. The gene knock-out method of claim 1, wherein the microinjection DNA mixture system comprises the following:

Cas9 plasmid, 50 ng/. mu.L;

Co-editing marker plasmid, 50 ng/. mu.L;

5' end upstream sgRNA plasmid, 50 ng/. mu.L;

3' end downstream sgRNA plasmid, 50 ng/. mu.L;

reporter plasmid, 20 ng/. mu.L; and

Repair template, 20 ng/. mu.L.