CN109517845A

CN109517845A - A kind of CRISPR single base repair system and its application

Info

Publication number: CN109517845A
Application number: CN201811284549.2A
Authority: CN
Inventors: 胡争; 周灿权; 樊惟文; 麦庆云
Original assignee: First Affiliated Hospital of Sun Yat Sen University
Current assignee: First Affiliated Hospital of Sun Yat Sen University
Priority date: 2018-10-30
Filing date: 2018-10-30
Publication date: 2019-03-26

Abstract

The invention discloses a kind of CRISPR single base repair systems, carrier for expression of eukaryon including sgRNA and Cas9 can be expressed, and the single-stranded oligonucleotide as donor template, wherein, the base sequence of the single-stranded oligonucleotide and to need the base sequence between the base of single base two sides the 30th~60 repaired almost the same, difference is, in the donor template, base corresponding with the single base for needing to repair is the base of unmutated wild type, and needs the side for the single base repaired that nonsense mutation has occurred.The invention also discloses application of the CRISPR single base repair system in the drug that beta Thalassemia disease caused by beta globin genes CD17A → T point mutation is treated in preparation.Both CRISPR/Cas expression plasmid and donor are transfected into cell jointly in the present invention, the specific seamless directional transformation for inducing gene mutation site in 17 thalassemia of β in 293TT cell, it is precisely treated to the gene editing based on single-gene point mutation disease is carried out, there is important clinical value.

Description

A kind of CRISPR single base repair system and its application

Technical field

The present invention relates to gene editing technical field, especially a kind of CRISPR single base repair system and its treating Application in 17 thalassemia genetic disease of β caused by single-gene point mutation.

Background technique

Beta Thalassemia disease (β poor) is to constitute hemoglobin caused by mutation or missing due to beta globin genes The peptide chain of globin synthesis of HbA (a2 β 2) is reduced or cannot be synthesized, and a is caused to synthesize unbalance caused one kind often dye with β peptide chain Colour solid recessive hereditary disease.β poor gene it is often most commonly seen with point mutation, CD17 (A → T) point mutation of beta globin genes is most One of relevant point mutation of to β the poor disease early reported.

At present can be by lifelong treatment of blood transfusion thalassemia, however most infant is the active treatment the case where Under it is dead still before adult.Another treatment method but is found and to match by marrow or hematopoietic stem cell transplantation Allosome contributor is extremely difficult, and costly.The genetic diagnosis technology that can only be moved ahead at present by embryo implantation passes through tire Youngster's cord blood cells technique of gene detection screens normal embryo or fetus to block the propagation of poor Disease-causing gene.With gene The appearance and development of editing technique, how using gene editing technology to gene mutation type genetic disease carry out prevention with Treatment is Disease Clinical treatment mode emerging at present.

From the U.S. in 2011 take the lead in propose " accurate medicine of marching toward " proposal after, Chinese accurate medicine also constantly forward It promotes." accurate gene editing " is the core of gene editing technology, and the precisely important embodiment of medicine.Carry out based on spy The gene editing of specific gene mutation associated diseases is precisely treated, and obtaining more accurate efficient gene editing is future disease The innovation direction for the treatment of.Since 2012 emerge, be greatly promoted gene editing in a variety of diseases includes CRISPR technology The therapeutic effect of malignant tumour and genetic disease obtains extensive clinical application, such: US National in 2016 Health research has approved the T cell that immune system is extracted out of cancer patient body, carries out base to T cell using CRISPR Because of modification, and in patient body by defeated time of the T cell after gene modification, it is thin that the T cell after gene modification will target destroyed tumor Born of the same parents；In May, 2018, NATURE magazine ran treat the case for curing an example Patient leukemic by CAR-T；In China, It has approved for the first time in October, 2016 and carries out human clinical trial using CRISPR, controlled to treat chemotherapy, radiotherapy and other therapies Treat invalid Metastatic Nsclc patient etc..It has been reported and treats thalassemia using CRISPR: passing through utilization Gene editing tool CRISPR fine specificity repairs patient's body cell beta globin genes (hemoglobin subunit Beta, HBB) dcc gene, then the somatic induction by gene editing and after repairing finally is implanted at multipotential stem cell In vivo, so that corresponding functional red blood cell is divided and be divided into, to treat and alleviate β-patients with thalassemia symptom.Mesh Before, for the gene therapy of β type thalassemia, it is thin from induction type multipotential stem cell (iPS) and Hematopoietic Stem to set about object Born of the same parents (HSC) are transitioned into human embryos, directly block the vertical transmission of the genetic disease.

There is within 2015 document report in the world for the first time using CRISPR/Cas9 gene editing technology to inseminating extremely Mankind's 3PN fertilized eggs carry out HBB gene editor reparation, observe that CRISPR/Cas9 reaches target gene cutting efficiency in Human embryo To 51.9%, but simultaneously, discovery is missed the target obviously.2017, the author utilize again single base editing system (APOBEC1) and Nuclear transfer technology realizes single base editor in human embryos for the first time, successfully to leading to β-thalassemia one kind Single nucleotide mutation -28 mutation are corrected.This single base editing system by CRISPR-Cas9 variant and cytimidine Deaminase is constituted, and is pointing directly at the correct position DNA by being oriented to RNA, is replaced guanine (C) with thymidine (T).Gene is repaired Multiple efficiency only only has 23%, and obtaining embryo after repairing is still chimera, and the blastomere being repaired also only has 20%, It is difficult to realize to cure completely.On the other hand, this method can only realize the exchange of A/T and C/G at present, can not carry out any four The mutual replacement of base, therefore this type is invalid to β 17 (A → T).In addition to this, there is also higher off-target rates for this method. Above several features will greatly limit use of the technology in gene editing treatment beta Thalassemia.

Based on the above, the author, on the basis of early period, the genome editing frame based on CRISPR/Cas9 utilizes amino The degeneracy and codon optimization of acid, design have synthesized the new efficient donor-precisely repaired in modification type recovery template (ssODN) nonsense mutation is introduced on, that is, the base being mutated can't cause the change of corresponding amino acid, it can with high efficiency and Precision selective introduces monoallelic and diallele sequence changes, and is greatly promoted the raising accurately repaired.Technology is former Reason is described below:

CRISPR/Cas9 gene editing system is derived from the bacterial adaptation immune system of micrococcus scarlatinae, by core The guide RNA (sgRNA) of sour enzyme Cas9 and 20bp is formed.The specificity cutting of CRISPR/Cas9 is mediated by sgRNA, SgRNA has NGG protospacer-adjacent by RNA-DNA base pair complementarity, with neighbouring on genomic DNA The site of motif (PAM) sequence combines, and Cas9 enzyme is oriented to target site.This simple mesh carried out by may be programmed sgRNA Mark navigation, makes CRISPR/Cas9 system be different from technology (such as Zinc finger nuclease or activating transcription factor sample effect core of early stage Sour enzyme (TALENs), both technologies require the assembling of complicated DNA binding protein structural domain to carry out locus specificity volume Volume).Cas9 needs PAM and sgRNA and combines and could introduce double-strand break (DSB) in specific position, this double-strand break Occur at the 3bp of the upstream PAM.In most cases, these DSBs pass through non-homologous end joining (NHEJ) approach reparation, Lead to non-specific insertion, missing or other mutation, commonly referred to as ' indels '.This is easy to read in the opening of target gene Frame, which generates mutation, causes codon to terminate translation or erroneous translation in advance, to achieve the purpose that gene knockout.However, NHEJ reparation does not allow to introduce specific sequence and changes, and causes a disease for maintaining normal gene necessary to normal life function to be mutated For the accurate gene therapy of this type and it is not suitable for.

Specific sequence is generated to change, for example, be introduced into pathogenic mutation or correct the mutation in patient-derived cell system, Same source orientation reparation (HDR) must be used, this is a kind of unique cell DNA reparation approach.Accomplish this point, it is most common Method be the DNA recovery template for introducing a modification simultaneously, such as single-stranded oligonucleotide (ssODN), wherein including and DSB The homologous both ends flanking sequence in surrounding genes group region and expected sequence variation.Single stranded DNA is often as " donor Template " is widely used in during gene editing, it can be achieved that fixed point is repaired and DNA fragmentation is knocked in, research shows that length As homology arm there is the reparation of higher fixed point and segment to knock in efficiency for the ssDNA of 70-100bp, is easier to screening and is pinpointed The mutant that editor and segment are knocked in.In mammalian cells, HDR is relatively rare, and genome edits generation by CRISPR Double-strand break (double-strand break, DSBs) is mainly repaired by NHEJ, but cell cycle regulating, NHEJ component inhibit Or it introduces recovery template and the frequency of HDR can be improved.However, genome editor's event needed for being generated by HDR, it is also desirable to logical SgRNA after preventing cutting is crossed to be targeted again in conjunction with come the accuracy that improves editor, and this point in the research of early stage not Directly solve.The editor of these " inaccuracy " is from CRISPR/Cas9 complex to the volume again in previous edited site Volume, cause to reappear target site, until they are sufficiently modified (as shown in Figure 1).

SsDNA donor (is included in cell experiment and embryo's microinjection etc.) in multiple experimental systems and is proved There is powerful fixed point remediation efficiency.The energy that ODN resists nuclease degradation can be greatly improved in the part thio-modification of terminal nucleotide Power, without carrying out thio-modification to entire ODN, though thio oligonucleotide can be with the RNA or DNA fragmentation of complementary strand Hybridization forms stable duplex structure, but studies have shown that comparing the variation discovery of its Tm value, the stability of this double-strand is conciliate Chain temperature (Tm) has certain reduction compared with the double-strand of corresponding normal oligonucleotides, in addition, G 3139 is usually to normal Cell has mild toxicity effect.

Summary of the invention

Based on the above issues, a kind of energy is provided it is an object of the invention to overcome above-mentioned the deficiencies in the prior art place Efficiently accurately treat the CRISPR single base repair system of 17 thalassemia genetic disease of β caused by single-gene point mutation.

To achieve the above object, the technical solution that the present invention takes includes the following aspects:

In the first aspect, the present invention provides a kind of CRISPR single base repair systems, including can express sgRNA and The carrier for expression of eukaryon of Cas9, and the single-stranded oligonucleotide as donor template, wherein the alkali of the single-stranded oligonucleotide Basic sequence and to need the base sequence between the base of single base two sides the 30th~60 repaired almost the same, difference is, In the donor template, base corresponding with the single base for needing to repair is the base of unmutated wild type, and needs to repair Nonsense mutation has occurred in the side of multiple single base.

It should be noted that the recoverable mutation of CRISPR single base repair system of the invention, including but not limited to Single base, can also repair the situation of 2 adjacent base simultaneous mutations, even 3 or 4 or more bases it is prominent Become, including being replaced mutually between four kinds of bases, those skilled in the art are as needed adjusted correspondingly i.e. this system Can, progress creative labor is not needed to this can be realized.

Preferably, the both ends of the single-stranded oligonucleotide at least 1 base has thio-modification；It is highly preferred that described The both ends of single-stranded oligonucleotide have 2 bases to have thio-modification.It should be noted that as needed, it can be to single-stranded few core 3 or more the bases at the both ends of thuja acid carry out thio-modification.

Preferably, the length of the single-stranded oligonucleotide is 70~100bp；It is highly preferred that the length of single-stranded oligonucleotide For 100bp.There is higher fixed point to repair and knock in efficiency with segment, be easier to screening and obtain fixed point editor and piece for this system as a result, The mutant that section is knocked in.

Preferably, the single base for needing to repair is the base T in CD17A → T of pathogenic mutation beta globin genes.

Preferably, the base sequence of the sgRNA is encoded as shown in SEQ ID NO.1 or SEQ ID NO.2, the list The base sequence of chain oligonucleotides is as shown in SEQ ID NO.3 or SEQ ID NO.4.It is highly preferred that encoding the sgRNA's Base sequence as shown in SEQ ID NO.2, the base sequence of the single-stranded oligonucleotide as shown in SEQ ID NO.3, at this point, The integration efficiency highest of system can more efficiently repair the mutation of single base.

Preferably, the carrier for expression of eukaryon is PX330.It should be noted that the carrier for expression of eukaryon packet in the present invention Include but be not limited to PX330, can also be other plasmids, if the plasmid can steadily be expressed in eukaryocyte sgRNA and Cas9.

In the second aspect, the present invention provides above-mentioned repair systems treats beta globin genes CD17 A → T point in preparation Application in the drug of beta Thalassemia disease caused by being mutated.

In the third aspect, the present invention provides it is a kind of with treating β caused by beta globin genes CD17A → T point mutation The drug of middle sea anemia, above-mentioned repair system is contained in the drug.

In conclusion the invention has the benefit that

The present invention utilizes degenerate (or the degeneracy of amino acid by the target sequence that CRISPR/Cas9 is targeted Property), nonsense mutation (blocking base blocks base) is introduced into HDR-ssDNA recovery template, it can be largely On prevent unwelcome editor again, achieve the purpose that seamless reparation；In the present invention by CRISPR/Cas expression plasmid and Both donor are transfected into cell jointly, (CD17A of beta globin genes have occurred relative to 293T cell in 293TT cell → T point mutation) in specific induction 17 thalassemia of β gene mutation site seamless directional transformation, development is based on The gene editing of single-gene point mutation disease is precisely treated, and has important clinical value.

Detailed description of the invention

Fig. 1 is the gene repair schematic diagram after the double-strand break that CRISPR/Cas9 is mediated；Wherein, exist CRISPR/Cas9 mediate double-strand break (1) after, most of genes by error-prone NHEJ approach reparation, will cause with Machine gene mutation (2)；In 1~10% case, introduces homologous dna recovery template and the expection of HDR (3) offer is provided Sequence changes；However, only in rare cases, this sequence variation is accurately (i.e. not by additional CRISPR/ Cas9 is edited destroyed again) (4)；In most of DSB reparation, CRISPR/Cas9 complex will be reappeared and will be integrated to Target position (5), and cause additional indels (6)；

Fig. 2 is that blocking (blocking) base of the introducing nonsense mutation on donor carries out the ideograph of seamless reparation, Wherein, B --- CRISPR/Cas-blocking mutation (blocks mutation), is located at sgRNA targeting in HDR recovery template Sequence in, with reduce integration repair after cutting again；M --- mutation related with Disease-causing gene mutation repair, equally In HDR recovery template, to introduce the purpose needed mutation；

Fig. 3 is the modification ideograph of ssDNA donor, wherein * represents thio-modification, and the two of ssDNA are shown in figure End carries out the thio-modification of 2 bases；

Fig. 4 is to take normal person in clinical sample (homozygous without mutation), the poor patient in 17 ground light-duty β (heterozygous mutant) and again The blood DNA of the poor patient in 17 ground type β (homozygous mutation) carries out the result figure of sanger sequencing, specifies β 17 and sports A → T cause Disease, wherein due to being sequenced since antisense chain direction, T → A is shown as in peak figure；

Fig. 5 is the design principle according to Fig. 2, and sgRNA is designed near mutational site, normal 293WT cell is pinpointed prominent Become the sequence design ideograph of abnormal homozygous mutant β 17-293TT cell, wherein in first sequence in small box Arrow indicate intended mutation；Nonsense mutation is introduced on big box instruction donor in Article 2 sequence, simultaneously It can produce the restriction enzyme site KspAI not having originally, it can be quick by this restriction enzyme site after the donor integration of improvement Whether identification is integrated, and whether introduces blocking base in genome sequence and carried out seamless reparation；Article 2 sequence Small box in big box in column indicates that blocking base, the blocking base can be integrated to avoid donor and be repaired Afterwards by same sgRNA targets identification again；Arrow in small box in Article 3 sequence indicates the mutation alkali being successfully introduced into Base.

Fig. 6 is extract total cellular genome after CRISPR/Cas9 plasmid and donor-ssDNA cotransfection 293TT cell DNA carry out Sanger sequencing result figure, in order to verify CRISPR/Cas9 plasmid knife dissection and donor whether Integration, wherein WT is represented without transfection CRISPR/Cas9 plasmid；SgRNA1 and sgRNA2 is respectively represented in 17 mutational site β Two sgRNA nearby designed；Donor1 and donor2 respectively represent sense chain for HBB gene positive-sense strand and Antisense chain, sense chain are remaining sequence and HBB gene positive-sense strand in addition to intended mutation and nonsense mutation Sequence is completely the same, and antisense chain is remaining sequence and HBB gene in addition to intended mutation and nonsense mutation Sense strand sequence reverse complemental, the length of the two are 100bp；Neg control is only to transfect CRISPR plasmid, is not transfected donor-ssDNA.The small box in the left side is represented introduces the mutation of β 17, A → T on the genome in 293TT cell；The small box in the right Represent the nonsense mutation base introduced, G → T；

Fig. 7 is extract total cellular genome after CRISPR/Cas9 plasmid and donor-ssDNA cotransfection 293TT cell Electrophoresis result figure after DNA carries out the target fragment that PCR amplification includes mutation, after carrying out digestion experiment, wherein T7E1 digestion The cutting efficiency of experimental identification knife (i.e. CRISPR/Cas9 plasmid), KspAI digestion experimental identification donor-ssDNA integration Efficiency, two groups of digestion experiment controls are to test with a batch, and template quantity is consistent；

Fig. 8 is to carry out gray analysis by glue figure to Fig. 7, the result figure of efficiency value calculated after quantization, wherein The calculation formula of editorial efficiency are as follows: gene modification%=100 × [1-(1-fraction cleaved) 1/2]； T7E1 digesting efficiency --- the efficiency of reflection knife targeting cutting；KspAI digesting efficiency --- when donor is integrated into target position When setting, it can be identified and be cut by this enzyme；The integration efficiency of Donor --- calculation formula is integration efficiency=(kspAI digestion effect Rate/T7E1 digesting efficiency) × 100%, this efficiency represents integration and repairs the efficiency for introducing mutation；

Fig. 9 is that edited cell kind monoclonal cell is picked out monoclonal cell, carries out PCR mesh after extracting DNA The result figure that sanger is sequenced after standard film section further identifies whether donor integrates reparation, wherein the small box in the left side represents It introduces β 17 on the genome of 293TT cell to be mutated, A → T；The small box in the right represents the nonsense mutation base introduced, G → T.

Specific embodiment

The invention discloses the CRISPR plasmid construction methods of the pathogenic point mutation for 17 thalassemia of β, and The scheme of single base mutation donor is efficiently accurately repaired in design, and combines the two efficiently specifically to 17 thalassemia of β The method that the common monogenic inheritance disease of this mankind carries out gene repair treatment.The present invention is directed to β 17- thalassemia This single-gene point mutation autosomal recessive hereditary diseases constructs gene mutation site in corresponding targeting 17 thalassemia of β CRISPR/Cas expression plasmid, while using 5 ' and 3 ' hold 2 base thio-modifications ssDNA (single-stranded oligonucleotide), and Wherein amino acid degeneracy principle is being utilized to introduce the nonsense mutation for blocking and editing again, is synthesizing donor (i.e. donor mould Plate), both CRISPR/Cas expression plasmid and donor are transfected into cell jointly, it is specific in 293TT cell to lure The seamless directional transformation for leading gene mutation site in 17 thalassemia of β, to gene of the development based on single-gene point mutation disease Editor's precisely treatment, has important clinical value.

In some embodiments, the present invention is by utilizing amino acid in the target sequence that CRISPR/Cas9 is targeted Degenerate (or degeneracy) introduces nonsense mutation (blocking base blocks base) into HDR-ssDNA recovery template, Unwelcome editor again (Fig. 2) can be largely prevented, achievees the purpose that seamless reparation.

In some embodiments, present invention employs the ssODN to 5 ' and 3 ' end, 2 bases progress thio-modifications, (it is repaired Ideograph is adornd referring to Fig. 3), it is observed in an experiment has reached optimal fixed point edit effect.The utilization of the method and research master Cell line or animal embryo are concentrated on, the utilization in human embryonic cell is rarely reported.Oligonucleotides end section is thio The method of modification had not only overcome the shortcomings that complete thio-modification, but also significantly improved the stability of oligonucleotides, was to improve nucleic acid The good method of one of therapeutic effect.

In some embodiments, the present invention utilizes CRISPR/Cas9 technology and modification type ssDNA, compiles again in conjunction with blocking Normal 293TT cell line is transformed into β 17 and dashed forward by the amino acid degeneracy nonsense mutation collected using normal 293TT cell as model Modification 293TT, the method for establishing efficiently beta Thalassemia disease caused by accurately targeted therapy gene mutation.

In order to achieve the object of the present invention, the technical solution that the present invention takes includes:

1) DNA sequence dna that is directed to of the present invention are as follows: HBB poor gene base sequence (ncbi database HGNC:4827 or GRCh38.p12,GCF_000001405.38)；It is online using CRISPR Design (http://crispr.mit.edu/) SgRNA design tool designs the sgRNA near pathogenic mutation point for 17 mutational site β, and is filtered out by cell experiment The optimal sgRNA of effect；

2) carrier for expression of eukaryon for constructing CRISPR/Cas9 after selecting insertion point, can clone sgRNA and Cas9 Ensure that base sequence is correct onto carrier for expression of eukaryon PX330, and through sequencing；

It 3) will include the sequence of normal HBB gene and related nonsense mutation base, interception according to selected sgRNA The base sequence of 100bp or so carries out 5 ' and 3 ' the 2 base thio-modifications in end as donor, gives technology company and is closed At purifying；

4) present invention utilizes CRISPR/Cas9 combined modification type donor and nonsense mutation, provides specificity and induces corresponding β The method of the high-efficiency precision certainly point mutation of 17- thalassemia pathogenic sites, wherein the specificity refers to causes a disease just for β 17 The specificity in site targets the CRISPR/Cas9 and corresponding donor in pathogenic mutation site, is only capable of the induction HBB- of specificity The other types disease cause mutations such as HBB- β 41-42 and normal cell are made in the reparation of 17 disease cause mutation of β without editor's treatment With.

To better illustrate the object, technical solutions and advantages of the present invention, below in conjunction with the drawings and specific embodiments pair The present invention is described further.Unless otherwise instructed, the concentration of reagent is mass concentration in the present invention.

Embodiment 1

A kind of embodiment of CRISPR single base repair system, preparation method are as follows in the present invention:

Design of primers used in the present embodiment use the online design of primers tool of Primer3 Plus (http: // Www.primer3plus.com/cgi-bin/dev/primer3plus.cgi it) completes；Had by Suzhou Jin Weizhi biotechnology The synthesis of limit company, the thio-modification type donor-ssDNA of integration are synthesized by Suzhou Jin Weizhi Biotechnology Co., Ltd；Identification Whether knife (i.e. CRISPR/Cas9 plasmid) cuts used engineering enzyme T7E1 enzyme, is purchased from NEW ENGLAND BIOLAB (article No. #M0302S), the engineering enzyme KspAI enzyme that identification donor integration is repaired, is purchased from NEW ENGLAND BIOLAB (article No. For #R0105V).Sanger sequencing commission Sangon Biotech (Shanghai) Co., Ltd.) limited liability company's completion, according to present invention The sequence of people's design carries out plasmid construction by Suzhou Jin Weizhi Biotechnology Co., Ltd completion etc..

1, normal person in clinical sample (homozygous without mutation), the poor patient in 17 ground light-duty β (heterozygous mutant) and heavy type β are taken The blood DNA of the poor patient in 17 ground (homozygous mutation) carries out sanger sequencing, specifies β 17 and sports A → T and causes a disease, the sequencing of three Peak figure is referring to fig. 4.

Normal person (homozygous without mutation), the poor patient in 17 ground light-duty β (heterozygous mutant) and heavy type β are taken using blood taking needle The blood sample of the poor patient in 17 ground (homozygous mutation), and use full formula gold DNA extraction agent box (article No.: #M10122), foundation Operating instruction extracts the DNA in blood.

By ncbi database, the upstream and downstream sequence of 17 catastrophe point of β is found, is set in the online primer of Primer3 Plus Tool web site (http://www.primer3plus.com/cgi-bin/dev/primer3plus.cgi) design primer is counted, The upstream and downstream segment of targeted mutagenesis point is expanded, PCR product serves Hai Shenggong biotech company and carries out Sanger sequencing, specifies β 17 Characteristics of Mutation are the point mutation of A → T single base.Primer sequence are as follows:

primer-F:GCAATTTGTACTGATGGTATGG(SEQ ID NO.5)

primer-R:ATAACAGCATCAGGAGTGGAC(SEQ ID NO.6)

Resulting sequencing sequence are as follows: (overstriking and the base for having underscore to identify is mutating alkali yl)

2, sgRNA is designed according to the design principle of Fig. 2, near the mutational site of the sequence obtained by sequencing, designs and selects 2 optimal sgRNA construct CRISPR plasmid accordingly.

The sequence selected are as follows:

SgRNA1:

CACGTTCACCTTGCCCCACAgttttagagctagaaatagcaagttaaaataaggctagtccgttatca acttgaaaaagtggca ccgagtcggtgc(SEQ ID NO.1)

sgRNA2:

CCTGTGGGGCAAGGTGAACGgttttagagctagaaatagcaagttaaaataaggctagtccgttatca acttgaaaaagtggc accgagtcggtgc(SEQ ID NO.2)

Wherein, capitalization is sgRNA sequence, i.e., the sequence in conjunction with target DNA, lowercase part is scaffold, That is the secondary structure region that sgRNA plays a role.

The expression vector establishment method of CRISPR/Cas9 completes building with reference to the construction method in quotation, by Cas9 sequence It is cloned on expression vector PX330 with sgRNA sequence, constructs the eukaryotic expression plasmid of CRISPR/Cas9, building is completed Afterwards, determining carrier construction sequence is compared correctly without mutation by conventional be sequenced, picks out right-on clone and is expanded simultaneously Extract plasmid.

3, according to the design principle of Fig. 2, design synthesis pinpoints the donor sequence of seamless mutation and synthesizes.

The 100bp base sequence near 17 catastrophe point of β is intercepted, introduces 17 pathogenic mutation of β (underscore) and nonsense wherein Mutation (italic and with underscore), and thio-modification (shown in *) is carried out at both ends, sequence is as follows:

Donor1:

Donor2:

Above-mentioned sequence submits the synthesis of Suzhou Jin Weizhi Biotechnology Co., Ltd.Utilize the mono- alkali of the CRISPR of the present embodiment The ideograph that base repair system repairs CD17A → T of pathogenic mutation beta globin genes is as shown in Figure 5.

Embodiment 2 identifies whether the dissection of CRISPR/Cas9 plasmid knife and donor are integrated

Identification method: CRISPR/Cas9 plasmid and donor-ssDNA cotransfection 293TT cell prepared by embodiment 1 Afterwards, extract total cellular genomic DNA carry out Sanger sequencing, with verify CRISPR/Cas9 plasmid knife dissection and Whether donor integrates.

The specific operation method is as follows:

(1) cell culture

293TT cell line is with the DMEM complete medium containing 10% serum in 37 DEG C, 5%CO₂It is cultivated in incubator. After pancreatin digestion when cell fusion degree reaches 90% with 0.25%, is terminated and digested with DMEM complete medium, be inoculated into 6 In orifice plate, continue culture 24 hours.

(2) plasmid transfection

After 24 hours, confirmation cell is adherent good, and cell fusion degree reaches 80%, can be transfected.Every hole transfection The donor-ssDNA of 2ug CRISPR/Cas9 plasmid and 100pmol uses the X-tremeGENE HP of Roche company DNA Transfection Reagent transfection reagent requires to be transfected to specifications, and the cell after transfection continues 37 DEG C, 5%CO₂It is cultivated in incubator.

(3) genome DNA extraction

After transfection 48 hours, routine uses 0.25% trypsin digestion cell, collects cell into centrifuge tube, room temperature item 300g is centrifuged 5 minutes under part, and PBS washed once, and 300g is centrifuged 5 minutes under normal temperature condition.Use full formula gold DNA extraction agent The reagent component of box (Quan Shijin Bioisystech Co., Ltd, article No.: EE101-01), extracts cytogene in accordance with the following methods Group DNA:

100ul cell pyrolysis liquid LB2 is added, mixes well, suspension cell, 20ul RnaseA and 20 ul is added Proteinase K is vortexed and mixes in sample, is incubated at room temperature 2min.

The BB2 reagent of 500ul combination DNA is added, is vortexed 5 seconds immediately, is incubated at room temperature 10min.

Whole solution is added in centrifugal column, 12000 × g is centrifuged 30 seconds, discards efflux.

It is added 500ul solution clean buffer2 (CB2), 12000 × g is centrifuged 30 seconds, discards efflux.Then it repeats Once.

It is added 500ul solution wash buffer2 (WB2), 12000 × g is centrifuged 30 seconds, discards efflux.Then it repeats Once.

12000 × g is centrifuged 2 minutes, completely removes remaining WB2.

Centrifugal column is placed in a clean centrifuge tube, the deionization of 50ul preheating (60-70 DEG C) is added in the center of column Water (PH > 7) is stored at room temperature 1 minute, and 12000 × g is centrifuged 1 minute, eluted dna.Measure DNA concentration.

(4) design of primer

Using the primer for the upstream and downstream segment for expanding targeted mutagenesis point before, across target spot, (product length is excellent at primer both ends Choosing~500bp, and target spot apart from two sections of primer distance should difference 50bp or more, so as in agarose gel electrophoresis Two small fragments that digestion is opened can effectively be distinguished).PCR product serves Hai Shenggong biotech company and carries out Sanger sequencing, Amplimer is consistent with sequencing primer, sequence are as follows:

Primer-F:GCAATTTGTACTGATGGTATGG (SEQ ID NO.5),

primer-R:ATAACAGCATCAGGAGTGGAC(SEQ ID NO.6)。

(5) PCR reacts

Using the genomic DNA of said extracted as template, PCR reaction is carried out with above-mentioned primer.The high-fidelity that this experiment uses Archaeal dna polymerase is Beijing Quan Shijin Biotechnology Co., LtdPCR SuperMix (article No.: AS111- 02)。

PCR reaction system:

PCR reaction condition: 94 DEG C, 2-5min；94 DEG C, 30sec, 50-60 DEG C, 30sec, 72 DEG C, 1-2kb/min, 30- 35cycles；72 DEG C, 5-10min.

PCR after the reaction was completed, takes a small amount of PCR product to carry out agarose gel electrophoresis, according to electrophoresis result preliminary judgement Whether the concentration and stripe size of PCR product are correct etc..

(6) T7 Endonuclease I digestion experiment and polyacrylate hydrogel electrophoresis

The T7 Endonuclease I and matched 10 × NEB Buffer 2 that this experiment uses are purchased from New England Biolabs company (article No.: M0302S).Operating procedure is as follows:

200ng purified pcr product is taken to be reacted as follows:

Reaction system:

Annealing conditions:

95℃	5min
		95-85℃	-2℃/sec
85-25℃	-0.1℃/sec
		4℃	hold

After the completion of annealing reaction, 1 μ L of T7 Endonuclease I is added at this time, and after concussion mixes, 37 DEG C are incubated for 20 Minute completes cutting, and 2 μ L 0.25M EDTA solution are added and terminate endonuclease reaction.After the reaction was completed, using 2% Ago-Gel Carry out electrophoresis.

(7) integration identification kspAI digestion experiment and polyacrylate hydrogel electrophoresis

The kspAI enzyme and matched 10 × NEB Buffer that this experiment uses are public purchased from New England Biolabs It takes charge of (article No.: R0105V).Operating procedure is as follows:

200ng purified pcr product is taken to be reacted as follows:

Reaction system:

After mixing, 37 DEG C of incubation completion in 1 hour cuttings are added 2 μ L 0.25M EDTA solution and terminate endonuclease reaction.Reaction After the completion, electrophoresis is carried out using 2% Ago-Gel.

Qualification result: as can be seen from figures 6 to 8, WT is represented without transfection CRISPR/Cas9 plasmid；SgRNA1 and sgRNA2 points Two sgRNA that Dai Biao not be designed near 17 mutational site β；Donor1 and donor2 are respectively represented relative to HBB gene just Sense chain and antisense chain for adopted chain, wherein sense chain be in addition to intended mutation and nonsense mutation, Remaining sequence and HBB gene sense strand sequence are completely the same, and wherein antisense chain is except intended mutation and nothing Justice mutation is outer, remaining sequence and HBB gene sense strand sequence reverse complemental, the length of the two is 100bp；neg control Only to transfect CRISPR plasmid, donor-ssDNA is not transfected.After plasmid and ssDNA are transfected into cell, what plasmid expression came out The CRISPR/Cas9 system for targeting 17 mutational site HBB β, can rapidly identify 17 mutational site sequence of HBB β, performance is cut The effect of cutting.Cell increases the homologous efficiency for repairing HDR when having external source ssDNA as recovery template after cutting, thus Reach seamless reparation, while the mutating alkali yl sequence that primer needs, show in sequencing peak figure, be shown as 17 mutational site β and The set peak in nonsense mutation site, as shown by the arrows in Figure 6.Then occur without phenomenon in WT group and neg control group.

Meanwhile it is real by digestion is carried out after target fragment of the cell genomic dna of the extracting progress PCR amplification comprising mutation It tests, wherein the cutting efficiency of T7E1 digestion experimental identification knife, the effect of KspAI digestion experimental identification donor-ssDNA integration Rate, two groups of digestion experiment controls are to test with a batch, and template quantity is consistent.As a result as shown in fig. 7, can observe experimental group There is T7E1 enzyme and KspAI enzyme in (gRNA1+donor1, gRNA1+donor2, gRNA2+donor1, gRNA2+donor2) Digestion band, and then only there is T7E1 digestion band in neg control (rotor does not transfect donor), does not occur KspAI enzyme Cut band, i.e. donor unconformity.

Agarose gel electrophoresis results (referring to Fig. 7) display, above-mentioned PCR product can be cut by T7 Endonuclease I It is disconnected, there is small one and large one two band, illustrates that CRISPR/Cas9 successfully cuts HBB gene sequence in the cell；Above-mentioned PCR Product can be cut off by kspAI, small one and large one two band occurred, illustrated that CRISPR/Cas9 successfully cuts HBB gene into the cell Afterwards, the donor-ssDNA of modification has been integrated into target site.

Calculated by gray value of the Image J software to band, can estimate kspAI cutting efficiency, by its with T7E1 digesting efficiency is compared, and can calculate the integration efficiency for obtaining donor, as a result as shown in Figure 8.

The rite-directed mutagenesis compliance test result of the CRISPR single base repair system of the invention of embodiment 3

Identification method: go out the 293TT of the mutation of β 17 and nonsense mutation by selecting the further evaluation and screening of monoclonal cell Cell line；Specifically, the group of cells after 48h is transfected in Example 2, with 0.25% trypsin digestion and is blown and beaten respectively At individual cells, and cell is suspended in spare in the DMEM culture solution of 10% fetal calf serum.

Cell suspension is made into the dilution of gradient multiple, every group of cell is close with the gradient of every 50,100,200 cells of ware respectively Degree is inoculated with respectively in the ware of 37 DEG C of pre-temperature culture solutions containing 10mL, and is gently rotated, and so that cell is uniformly dispersed, is finally made culture hole In contain up to 1 cell.Set 37 DEG C of 5%CO₂And it is cultivated 2~3 weeks in the cell incubator of saturated humidity.

Often observation, when occurring macroscopic clone in culture dish, amplification is passaged to cell quantity and reaches 500,000 A/hole collects a part of cell by preceding method and extracts cell DNA, by sending raw work bioengineering after preceding method PCR amplification The sequencing of (Shanghai) limited liability company.

Qualification result: as shown in figure 9, monoclonal cell sequencing data is shown, by the method success in normal 293TT The mutation of β 17 is introduced in cell and nonsense mutation shows to obtain 17 saltant type 293TT cell line of β using embodiment 1 Single base repair system with the successful use of efficient directed mutagenesis method.

Finally, it should be noted that the above embodiments are merely illustrative of the technical solutions of the present invention rather than to the present invention The limitation of protection scope, although the invention is described in detail with reference to the preferred embodiments, those skilled in the art are answered Work as understanding, it can be with modification or equivalent replacement of the technical solution of the present invention are made, without departing from the reality of technical solution of the present invention Matter and range.

<110>No.1 Hospital Affiliated to Zhongshan Univ.

<120>a kind of CRISPR single base repair system and its application

<130> 2018

<160> 7

<170> PatentIn version 3.5

<210> 1

<211> 96

<212> DNA

<213>artificial sequence

<400> 1

cacgttcacc ttgccccaca gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgc 96

<210> 2

<211> 96

<212> DNA

<213>artificial sequence

<400> 2

cctgtggggc aaggtgaacg gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgc 96

<210> 3

<211> 100

<212> DNA

<213>artificial sequence

<400> 3

caccatggtg catctgactc ctgaggagaa gtctgccgtt actgccctgt ggggctaggt 60

taacgtggat gaagttggtg gtgaggccct gggcaggttg 100

<210> 4

<211> 100

<212> DNA

<213>artificial sequence

<400> 4

caacctgccc agggcctcac caccaacttc atccacgtta acctagcccc acagggcagt 60

aacggcagac ttctcctcag gagtcagatg caccatggtg 100

<210> 5

<211> 22

<212> DNA

<213>artificial sequence

<400> 5

gcaatttgta ctgatggtat gg 22

<210> 6

<211> 21

<212> DNA

<213>artificial sequence

<400> 6

ataacagcat caggagtgga c 21

<210> 7

<211> 578

<212> DNA

<213>homo sapiens

<400> 7

gcaatttgta ctgatggtat ggggccaaga gatatatctt agagggaggg ctgagggttt 60

gaagtccaac tcctaagcca gtgccagaag agccaaggac aggtacggct gtcatcactt 120

agacctcacc ctgtggagcc acaccctagg gttggccaat ctactcccag gagcagggag 180

ggcaggagcc agggctgggc ataaaagtca gggcagagcc atctattgct tacatttgct 240

tctgacacaa ctgtgttcac tagcaacctc aaacagacac catggtgcat ctgactcctg 300

aggagaagtc tgccgttact gccctgtggg gcaaggtgaa cgtggatgaa gttggtggtg 360

aggccctggg caggttggta tcaaggttac aagacaggtt taaggagacc aatagaaact 420

gggcatgtgg agacagagaa gactcttggg tttctgatag gcactgactc tctctgccta 480

ttggtctatt ttcccaccct taggctgctg gtggtctacc cttggaccca gaggttcttt 540

gagtcctttg gggatctgtc cactcctgat gctgttat 578

Claims

1. a kind of CRISPR single base repair system, which is characterized in that the eukaryotic expression including that can express sgRNA and Cas9 carries Body, and the single-stranded oligonucleotide as donor template, wherein

The base sequence of the single-stranded oligonucleotide and to need the alkali between the base of single base two sides the 30th~60 repaired Basic sequence is almost the same, and difference is, in the donor template, base corresponding with the single base for needing to repair is unmutated The base of wild type, and need the side for the single base repaired that nonsense mutation has occurred.

2. repair system according to claim 1, which is characterized in that at least 1, the both ends of the single-stranded oligonucleotide Base has thio-modification.

3. repair system according to claim 2, which is characterized in that there are 2 bases at the both ends of the single-stranded oligonucleotide With thio-modification.

4. repair system according to claim 1, which is characterized in that the length of the single-stranded oligonucleotide be 70~ 100bp。

5. repair system according to claim 1, which is characterized in that the single base for needing to repair is pathogenic mutation β Base T in CD17A → T of globin gene.

6. repair system according to claim 5, which is characterized in that encode the base sequence such as SEQ ID of the sgRNA Shown in NO.1 or SEQ ID NO.2, the base sequence of the single-stranded oligonucleotide such as SEQ ID NO.3 or SEQ ID NO.4 institute Show.

7. repair system according to claim 5, which is characterized in that the carrier for expression of eukaryon is PX330.

8. the described in any item repair systems of claim 1~7 cause in preparation treatment beta globin genes CD17A → T point mutation Beta Thalassemia disease drug in application.

9. a kind of drug for treating beta Thalassemia disease caused by beta globin genes CD17A → T point mutation, which is characterized in that Containing such as the described in any item repair systems of claim 5~7 in the drug.