CN109943589A

CN109943589A - A kind of single base mutation method and the system of use

Info

Publication number: CN109943589A
Application number: CN201910232476.0A
Authority: CN
Inventors: 包煜贤
Original assignee: Guangzhou Drum Run Medical Technology Co Ltd
Current assignee: Zhuhai Shutong Medical Technology Co.,Ltd.
Priority date: 2019-03-26
Filing date: 2019-03-26
Publication date: 2019-06-28
Also published as: CN113403342A

Abstract

The present invention relates to a kind of single base mutation method and the systems of use, for the point mutation site design sgRNA for being intended to mutated gene and construct CRISPR/Cpf1 plasmid；The base sequence near the catastrophe point of gene to be mutated into is intercepted, and introduces nonsense mutation in base sequence and synthesizes donor1；The cell that CRISPR/Cpf1 plasmid and donor1 cotransfection contain desire mutated gene is obtained into the cell containing nonsense mutation；Re-sgRNA is designed for the point mutation site of the sequence containing nonsense mutation in the cell containing nonsense mutation and constructs Re-CRISPR/Cpf1 plasmid；It intercepts the base sequence near the catastrophe point of gene to be mutated into and synthesizes donor2；The cell that Re-CRISPR/Cpf1 plasmid and donor2 cotransfection contain nonsense mutation is obtained into the cell containing gene to be mutated into.The present invention can achieve the purpose that seamless reparation.

Description

A kind of single base mutation method and the system of use

Technical field

The invention belongs to CRISPR/Cpf1 field of gene, and in particular to a kind of single base mutation method and use System.

Background technique

Beta Thalassemia disease (β poor) is to constitute hemoglobin caused by mutation or missing due to beta globin genes The peptide chain of globin synthesis of HbA (a2 β 2) is reduced or cannot be synthesized, and a is caused to synthesize unbalance caused one kind often dye with β peptide chain Colour solid recessive hereditary disease.Β poor gene it is often most commonly seen with point mutation, the point mutation of beta globin noncoding region IVS-II-654 (C → T) is one of relevant point mutation of to β the poor disease reported earliest, which can influence mRNA shearing etc. and add Work process accurately cannot carry out forming abnormal mRNA, so as to cause beta Thalassemia.

It is reported that there are about 400,000,000 thalassemia gene carriers in the whole world.In China, which is apt to occur in southern ground The domestic incidence in area, especially Guangdong Province is significantly larger than other provinces.2012 to districts and cities, 21, Guangdong Province totally 14332 household registers Give birth in hospital pregnant woman screening the study found that the poor gene carrying rate in ground be 16.8%, i.e., up to 1/6 reproductive population carries poor base Cause.Every severe the birth of poor infant be up to 100 ten thousand to 300 ten thousand yuan to society and the financial burden of family's bring.At present may be used By lifelong treatment of blood transfusion thalassemia, however most infants are dead still before adult in the case where active treatment It dies.Another treatment method is then but to find the allosome contributor to match very by marrow or hematopoietic stem cell transplantation Difficulty, and it is costly.The genetic diagnosis technology that can only be moved ahead at present by embryo implantation passes through fetal umbilical blood cytogene Detection technique screens normal embryo or fetus to block the propagation of poor Disease-causing gene.With gene editing technology appearance with Development, how to carry out prevention and treatment to gene mutation type genetic disease using gene editing technology is disease emerging at present Sick clinical treatment mode.

After the proposal for taking the lead in proposing " accurate medicine of marching toward " from the U.S. in 2011, Chinese accurate medicine is also constantly to being pushed forward Into." accurate gene editing " is the core of gene editing technology, and the precisely important embodiment of medicine.Carry out based on specificity The gene editing of gene mutation associated diseases is precisely treated, and obtaining more accurate efficient gene editing is future disease treatment Innovation direction.For CRISPR technology since 2012 emerge, it includes pernicious swollen for being greatly promoted gene editing in a variety of diseases The therapeutic effect of tumor and genetic disease obtains extensive clinical application, such: US National health research in 2016 The T cell for extracting immune system out of cancer patient body is had approved, gene modification is carried out to T cell using CRISPR, and In patient body by defeated time of the T cell after gene modification, the T cell after gene modification will target destroyed tumor cell；2018 5 Month, NATURE magazine ran treats the case for curing an example Patient leukemic by CAR-T；In China, in October, 2016 head Secondary have approved carries out human clinical trial using CRISPR, to treat chemotherapy, radiotherapy and the invalid transfer of other therapies treatment Property Patients with Non-small-cell Lung etc..The present invention is caused a disease this monogenic inheritance for HBB-28 thalassemia point mutation of lock nucleic acid enhanced sensitivity Disease tests the high efficiency and practicability of high efficiency gene editor's treatment method.

It has been reported and treats thalassemia using CRISPR: by utilizing gene editing tool CRISPR fine specificity Patient's body cell beta globin genes (hemoglobin subunit beta, HBB) dcc gene is repaired, then by gene editing It with the somatic induction after reparation at multipotential stem cell, is finally implanted into vivo, to divide and be divided into and is corresponding functional Red blood cell, to treat and alleviate β-patients with thalassemia symptom.Currently, being directed to the gene therapy of β type thalassemia, set about Object is transitioned into human embryos from induction type multipotential stem cell (iPS) and candidate stem cell (HSC), directly blocks the heredity The vertical transmission of disease.

Applicants in 2015 are in the world for the first time using CRISPR gene editing technology to the mankind 3PN to inseminate extremely Fertilized eggs carry out HBB gene editor reparation, observe that CRISPR reaches 51.9% to target gene cutting efficiency in Human embryo, but same Shi Faxian misses the target obviously.2017, applicant utilized single base editing system (APOBEC1) and nuclear transfer technology again, the Single base editor is once realized in human embryos, successfully to leading to a kind of single nucleotide mutation-of β-thalassemia 28 mutation are corrected.This single base editing system is made of the variant of CRISPR with cytosine deaminase, passes through guiding RNA is pointing directly at the correct position DNA, replaces guanine (C) with thymidine (T).But gene repair efficiency only only has 23%, And obtaining embryo after repairing is still chimera, and the blastomere being repaired also only has 20%, is difficult to realize and cures completely, and is grasped Make to get up complicated cumbersome.In addition to this, there is also higher off-target rates for this method.Above several features will greatly limit the skill Use of the art in gene editing treatment beta Thalassemia.

Summary of the invention

Based on the above, applicant, on the basis of early period, the genome editing frame based on CRISPR utilizes the letter of amino acid And property and codon optimization, design have synthesized the new efficient donor precisely repaired --- in modification type recovery template (ssODN) Upper introducing nonsense mutation, that is, the base being mutated can't cause the change of corresponding amino acid, it can be with high efficiency and accuracy selection Property introduce monoallelic and diallele sequence and change, be greatly promoted the raising accurately repaired.Technical principle describes such as Under:

CRISPR/Cas gene editing systemic origin in bacterial adaptation immune system, from nuclease Cas and 20bp to Lead RNA (sgRNA) composition.The specificity cutting of CRISPR is mediated by sgRNA, and sgRNA is matched by RNA-DNA base complementrity It is right, there is the site of protospacer-adjacent motif (PAM) sequence to combine with neighbouring on genomic DNA, by Cas enzyme It is oriented to target site.It is this to be navigated by may be programmed the simple target that sgRNA is carried out, so that CRISPR system is different from the technology of early stage (such as Zinc finger nuclease or activating transcription factor sample effect nuclease (TALENs), both technologies require complicated DNA and combine The assembling of protein structure domain carries out locus specificity editor).CRISPR/Cpf1 is a kind of 2 new class V-type CRISPR effect eggs It is white, it is the endonuclease that Jian is cut in conjunction with target DNA specific site under single-stranded guide RNA guidance.With common classics CRISPR/Cas9 is compared, and the single stranded RNA that Cpf1 only needs one section of 42-44 nucleotide to form can recognize and shear DNA, thus Experimental design step is simplified, polygenes editor is more advantageous to；Cpf1 shearing can generate cohesive terminus,cohesive termini, and target gene can be promoted to insert Enter to target site；In addition, Cpf1 can identify the PAM sequence rich in thymidine (T), editor's model of CRISPR can be extended It encloses.The exploitation of CRISPR/Cpf1 is conducive to break through and overcomes some limitations in CRISPR/Cas9 application, therefore is known as The CRISPR genome edit tool of a new generation.The beta globin IVS-II-654 disease cause mutation being directed to reference to present invention research Sequence signature, it is known that catastrophe point nearby have be suitable for using CRISPR/Cpf1 carry out genome editor target site.

CRISPR/Cpf1 albumen needs PAM and sgRNA and combines and could introduce double-strand break (DSB) in specific position. In most cases, these DSBs lead to non-specific insertion, missing by non-homologous end joining (NHEJ) approach reparation Or other mutation, commonly referred to as ' indels '.This is easy to generate to be mutated in the open reading frame of target gene to lead to codon Translation or erroneous translation are terminated in advance, to achieve the purpose that gene knockout.However, NHEJ reparation does not allow to introduce specifically Sequence changes, for maintaining normal gene necessary to normal life function to be mutated for the accurate gene therapy for this type of causing a disease And it is not suitable for.

Specific sequence is generated to change, for example, be introduced into pathogenic mutation or correct the mutation in patient-derived cell system, it must With source orientation reparation (HDR), this is a kind of unique cell DNA reparation approach for palpus use.Accomplish this point, the most common side Method is the DNA recovery template for introducing a modification simultaneously, such as single-stranded oligonucleotide (ssODN), wherein including and base around DSB Because of the homologous both ends flanking sequence in group region and expected sequence variation.Single stranded DNA is often as " donor template " It is widely used in during gene editing, it can be achieved that fixed point is repaired and DNA fragmentation is knocked in, research shows that length is 70-100bp SsDNA as homology arm have higher fixed point repair and segment knock in efficiency, be easier to screening obtain fixed point edit and segment The mutant knocked in.In mammalian cells, HDR is relatively rare, and genome is edited the double-strand break generated by CRISPR (double-strand break, DSBs) is mainly repaired by NHEJ, but cell cycle regulating, NHEJ component inhibit or introduce to repair The frequency of HDR can be improved in multiple template.However, genome editor's event needed for being generated by HDR, it is also desirable to be cut by preventing SgRNA is targeted again in conjunction with come the accuracy that improves editor afterwards, and there is no directly solutions in the research of early stage for this point.This The editor of " inaccuracy " updates previous edited site from CRISPR complex a bit, this will reappear mesh Mark point, until they are sufficiently modified (Fig. 1).We are by utilizing amino acid in the target sequence that CRISPR is targeted Degenerate is introduced into nonsense mutation (blocking base) into HDR-ssDNA recovery template, can largely prevent Unwelcome editor again (Fig. 2), achievees the purpose that seamless reparation.

SsDNA donor (is included in cell experiment and embryo's microinjection etc.) in multiple experimental systems and is proved There is powerful fixed point remediation efficiency.The energy that ODN resists nuclease degradation can be greatly improved in the part thio-modification of terminal nucleotide Power, without carrying out thio-modification to entire ODN, though thio oligonucleotide can be miscellaneous with the RNA or DNA fragmentation of complementary strand Friendship forms stable duplex structure, but studies have shown that compares the variation discovery of its Tm value, the stability and unwinding temperature of this double-strand Degree (Tm) has certain reduction compared with the double-strand of corresponding normal oligonucleotides, in addition, G 3139 is usually to normal cell There is mild toxicity effect.The method of oligonucleotides end section thio-modification had both overcome the disadvantages mentioned above of complete thio-modification, The stability for substantially increasing oligonucleotides again is a good method for improving exonuclease treatment effect.At present we use pair 5 ' and 3 ' 2, end bases carry out the ssODN of thio-modification, observe it in an experiment and have reached optimal fixed point edit effect.This Kind of method with and research be concentrated mainly on cell line or animal embryo, the utilization in human embryonic cell is rarely reported.

Therefore, the present invention is for the normal of this noncoding region point mutation of the thalassemia of HBB-IVS-II-654 point mutation Autosomal recessive hereditary disease constructs the CRISPR/Cpf1 expression plasmid in the mutational site in corresponding targeting thalassemia, together Shi Caiyong 5 ' and 3 ' holds the ssDNA (single-stranded oligonucleotide) of 2 base thio-modifications, and former using amino acid degeneracy wherein Reason introduces the nonsense mutation for blocking and editing again, synthesizes donor, and both CRISPR/Cpf1 expression plasmid and donor is common It is transfected into cell, the gene mutation site in specific induction IVS-II-654 type thalassemia in 293TT cell Seamless directional transformation precisely treats to the gene editing based on single-gene point mutation disease is carried out, has important clinical application Value.

To achieve the above object, the present invention adopts the following technical scheme that:

It is an object of the present invention to provide a kind of single base mutation methods, include the following steps:

(1) sgRNA is designed for the point mutation site for being intended to mutated gene；

(2) sgRNA the and CRISPR/Cpf1 nickase is cloned into building on carrier for expression of eukaryon PX330 has The CRISPR/Cpf1 plasmid of selectively targeted cutting power；

(3) base sequence near the catastrophe point of gene to be mutated into is intercepted, and introduces nothing in the base sequence The base progress thio-modification of justice mutation and 5 ' and 3 ' ends to the base sequence, then synthesizes donor1；

(4) the CRISPR/Cpf1 plasmid and the donor1 cotransfection are contained to the cell for being intended to mutated gene, warp The cell containing nonsense mutation is obtained after colony screening；

(5) for the point mutation site design of the sequence containing nonsense mutation in the cell containing nonsense mutation Re-sgRNA；

(6) Re-sgRNA the and CRISPR/Cpf1 nickase is cloned on carrier for expression of eukaryon PX330 and is constructed Re-CRISPR/Cpf1 plasmid；

(7) base sequence near the catastrophe point of gene to be mutated into is intercepted, and to the 5 ' and 3 ' of the base sequence The base at end carries out thio-modification, then synthesizes donor2；

(8) will described in the Re-CRISPR/Cpf1 plasmid and the donor2 cotransfection containing targeted mutagenesis with And the cell of nonsense mutation, obtain the cell line containing gene to be mutated into.

Preferably, the method is directed to the point mutation of IVS-II-654 type thalassemia.

Preferably, in step (3) and step (7), when carrying out the thio-modification, two bases being held to 5 ' and 3 ' into Row modification.

Preferably, the length of the donor1 and the donor2 are 90bp.

Preferably, the sequence of the sgRNA be aatttctactcttgtagattgggttaaggcaatagcaatat, aatttctactcttgtagatctattgccttaacccagaaatta、aatttctactcttgtagataggcaatagcaata The sequence of tctctgcat, the Re-sgRNA are aatttctactcttgtagatctggtaccttaacccagaaatta.

Preferably, the sequence of the donor1 is

c*c*attctaaagaataacagtgataatttctgggttaaggtaccagcaatatctctgcatataaata The sequence of tttctgcatataaattgtaact*g*a, the donor2 is

c*c*attctaaagaataacagtgataatttctgggttaaggcaatagcaatatctctgcatataaata Tttctgcatataaattgtaact*g*a, wherein * indicates thio-modification.

It is a further object to provide a kind of system for single base mutation, the system include for It is intended to introduce the first system unit of nonsense mutation in mutated gene, and for will be through the base after the first system unit orthomutation Because sporting the second system unit of gene to be mutated into, the first system unit includes CRISPR/Cas9Cpf1 plasmid And donor1, the second system unit include Re-CRISPR/Cas9Cpf1 plasmid and donor2, the donor1's Contain nonsense mutation in base sequence.

Preferably, the base of the nonsense mutation is cc.

Preferably, the induction HBB-IVS-II-654 that the system for single base mutation can be specific is pathogenic prominent The reparation of change.The specificity refers to the specificity just for HBB-IVS-II-654 pathogenic sites, targets its CRISPR/Cpf1 With corresponding donor, it is only capable of the reparation of the induction HBB-IVS-II-654 disease cause mutation of specificity, it is waited to HBB- β 41/42 His type disease cause mutation and normal cell are without editor's therapeutic effect.

Due to the implementation of above technical scheme, the invention has the following advantages over the prior art:

The present invention by introduce nonsense mutation, can be avoided it is repaired after gene order cut again, to improve Cutting efficiency, reduces undershooting-effect, so as to achieve the purpose that seamless reparation, is based on single-gene point mutation disease to carrying out The gene editing of disease is precisely treated, and has important clinical value.

Detailed description of the invention

Fig. 1 is that the gene repair mode after the double-strand break that CRISPR/Cpf1 is mediated illustrates, note: in CRISPR/Cpf1 After the double-strand break (1) of mediation, most of genes cause random gene to be mutated for by error-prone NHEJ approach reparation (2).In the case of~1-10%, introduces homologous dna recovery template the expected sequence of HDR (3) offer is provided and change.So And only in rare cases, this sequence variation is accurately (i.e. not by additional CRISPR/Cpf1 editor institute again Destroy) (4).In most of DSB reparation, CRISPR/Cpf1 complex will be reappeared and will be integrated to target position (5), and Cause additional indels (6).

Fig. 2 is that the blocking base of the introducing nonsense mutation on donor carries out the ideograph of seamless reparation, note: B --- Blocking mutation, in the sequence that sgRNA in HDR recovery template is targeted, to reduce after integration is repaired again Cutting；M --- mutation related with Disease-causing gene mutation repair is similarly positioned in HDR recovery template, to introduce the purpose needed Mutation.

Fig. 3 is the modification ideograph of ssDNA donor, and note: asterisk * represents thio-modification, and upper figure is shown in the two of ssDNA End carries out the thio-modification of 2 bases.

Fig. 4 is to take normal person in clinical sample (homozygous without mutation), the poor patient's (heterozygosis in the ground light-duty HBB-IVS-II-654 Mutation) and heavy type HBB-IVS-II-654 poor patient (homozygous mutation) blood DNA progress sanger sequencing, specify IVS- II-654 disease cause mutation causes a disease for C → T.

Fig. 5 is the design principle according to Fig. 2, and sgRNA is designed near mutational site, normal 293TT cell is pinpointed prominent Become the sequence design ideograph of abnormal homozygous mutant HBB-IVS-II-654-293TT cell, note: the first row and third Frame instruction original object mutant nucleotide sequence (intended mutation) in row sequence is C, the small frame instruction in the second row sequence Be mutated into after IVS-II-654 becomes disease cause mutation T herein, and it is prominent to introduce nonsense on the big frame instruction donor in second sequence Become while can produce the restriction enzyme site KpnI not having originally, this restriction enzyme site can be passed through after the donor integration of improvement Whether Rapid identification is integrated, and whether introduces blocking base in genome sequence and carried out seamless reparation；Second row 2 bases (cc) above small cube under sequence are the blocking base introduced, which can keep away Exempt from after donor integration is repaired by same sgRNA targets identification again.

Fig. 6 is extract total cellular genomic DNA after CRISPR/Cpf1 and donor-ssDNA cotransfection 293TT cell After carrying out the target fragment that PCR amplification includes mutation, the digestion of progress is tested, the wherein cutting of T7E1 digestion experimental identification knife Efficiency, the efficiency of KpnI digestion experimental identification donor-ssDNA integration, two groups of digestion experiment controls are same a batch experiment, and Template quantity is consistent.

Fig. 7 is to carry out gray analysis, efficiency value calculated after quantization, note: the meter of editorial efficiency by the glue figure to Fig. 6 Calculate formula are as follows: %gene modification=100x (1-(1-fraction cleaved) 1/2).T7E1 digestion effect Rate --- the efficiency of reflection knife targeting cutting；KpnI digesting efficiency --- it, can be by this enzyme when donor is integrated into target position It identifies and cuts；The integration efficiency of Donor --- calculation formula be remediation efficiency=integration efficiency=(KpnI digesting efficiency/ T7E1 digesting efficiency) x100%, it is also that the present invention is more paid close attention to that this efficiency, which represents integration and repairs the remediation efficiency for introducing mutation, Efficiency.

Fig. 8 is that edited cell kind monoclonal cell is picked out monoclonal IVS-II-654 saltant type 293TT cell System carries out sanger sequencing after PCR target fragment after extracting DNA, further identifies whether donor integrates reparation, note: covering one The small box of a base represents genome and introduces IVS-II-654 mutation, C → T；The small box for covering two bases, which represents, to be introduced Nonsense mutation base, AT → CC.The small box that a base is covered in the first row sequence, indicates in normal sequence, this The normal base at place is C；The small box that a base is covered in second row sequence indicates to suffer from the clinic of homozygous disease cause mutation In person, disease cause mutation base is T at this；In the third line sequence, indicates after gene editing, cover the small side an of base Frame represents the targeted mutagenesis T of the method for the present invention introducing, and the small box for covering two bases represents the nothing of the method for the present invention introducing Adopted mutating alkali yl, AT → CC.Need to further illustrate: normal base herein is C since monoclonal IVS-II-654 is prominent It is backward sequencing that direction, which is sequenced, in modification 293TT, therefore IVS-II-654 mutation G → A is shown as in sequencing peak figure, according to base Complementary pairing principle corresponds to C → T of positive sequencing, i.e., required targeted mutagenesis；The small box for covering two bases represents The nonsense mutation base of introducing, AT → CC red block represent the nonsense mutation base introduced, TA → GG.

Fig. 9 is, using same research method strategy, only by sgRNA and donor1 replace respectively Re-sgRNA and Donor2 is edited monoclonal IVS-II-654 saltant type 293TT cell line again, it is further mutated back normal The 293TT cell line of wild type, and verified by PCR-sanger sequencing, note: the small box of one base of covering represents It is normal base, T → C that IVS-II-654 mutation repair, which will be introduced,；The small box for covering two bases represents the nonsense introduced Mutating alkali yl reparation is normal wild-type base, CC → AT.Since direction is sequenced in monoclonal IVS-II-654 saltant type 293TT For backward sequencing, therefore IVS-II-654 mutation G → A is shown as in sequencing peak figure；Red block represents the nonsense mutation introduced Base, TA → GG.

Specific embodiment

Below will by specific embodiment, the present invention is further explained, but the protection scope being not intended to restrict the invention. Those skilled in the art can be made improvements to preparation method and using instrument within the scope of the claims, these improvement also should be regarded as Protection scope of the present invention.Therefore, the scope of protection of the patent of the invention shall be subject to the appended claims.

Design of primers used in the present embodiment use the online design of primers tool of Primer3Plus (http: // Www.primer3plus.com/cgi-bin/dev/primer3plus.cgi it) completes；It is limited by Suzhou Jin Weizhi biotechnology Company's synthesis, the thio-modification type donor-ssDNA of integration are synthesized by Suzhou Jin Weizhi Biotechnology Co., Ltd；Identify knife Engineering enzyme T7E1 enzyme used in whether cutting, is purchased from NEW ENGLAND BIOLAB (article No. #M0302S), identifies donor Integrate repair engineering enzyme KpnI enzyme and matched 10 × Buffer purchased from Thermo Scientific company (article No.: FD0524).Sanger sequencing commission Sangon Biotech (Shanghai) Co., Ltd.) limited liability company's completion, according to applicants' design Sequence carries out plasmid construction by Suzhou Jin Weizhi Biotechnology Co., Ltd completion etc..

1, take normal person in clinical sample (homozygous without mutation), light-duty IVS-II-654 poor patient (heterozygous mutant) and Heavy IVS-II-654 poor patient (homozygous mutation) blood DNA carry out sanger sequencing, specify IVS-II-654 and sport C → T causes a disease.

Normal person (homozygous without mutation), the ground light-duty IVS-II-654 poor patient (heterozygous mutant) and again are taken using blood taking needle Type IVS-II-654 poor patient (homozygous mutation) blood sample, and use full formula gold DNA extraction agent box (article No.: # M10122), the DNA in blood is extracted according to operating instruction, as a result sees Fig. 4.

By ncbi database, the upstream and downstream sequence of IVS-II-654 catastrophe point is found, in the online primer of Primer3Plus Design tool website (http://www.primer3plus.com/cgi-bin/dev/primer3plus.cgi) design primer, The upstream and downstream segment of targeted mutagenesis point is expanded, PCR product serves Hai Shenggong biotech company and carries out Sanger sequencing, clear IVS-II-654 Characteristics of Mutation is the point mutation of C → T single base.Primer sequence are as follows:

primer-F:aactttacacagtctgcctagt(SEQ ID NO.1)

primer-R:aagggcctagcttggactca(SEQ ID NO.2)

To heavy IVS-II-654 the blood DNA of poor patient's (homozygous mutation) carries out that resulting sequencing sequence is sequenced are as follows: (the coarse base of writing of mark is mutating alkali yl T)

2, according to the design principle of Fig. 2, gained is sequenced in the blood DNA to normal person (homozygous without mutation), institute is sequenced SgRNA is nearby designed in the mutational site for obtaining sequence, designs and selects 3 optimal sgRNA, constructs CRISPR plasmid accordingly.

The sequence selected are as follows:

Wherein, the thick letter of mark is sequence of the sgRNA sequence in conjunction with target DNA, and not marking thick letter part is scaffold (DR), i.e. the secondary structure region that sgRNA plays a role.

The expression vector establishment method of CRISPR/Cpf1 with reference to quotation (Zhang F.Cell.2015Sep 23.pii: S0092-8674 (15) 01200-3.doi:10.1016/j.cell.2015.09.038.) in construction method complete building, will Cpf1 sequence and sgRNA sequence are cloned on expression vector PX330, construct the eukaryotic expression plasmid of CRISPR/Cpf1, structure After the completion of building, determining carrier construction sequence is compared correctly without mutation by conventional be sequenced, right-on clone is picked out and carries out It expands and extracts plasmid.

3, according to the design principle of Fig. 2, design synthesis pinpoints the donor1 sequence of seamless mutation and synthesizes.

The 90bp base sequence near IVS-II-654 catastrophe point is intercepted, introduces IVS-II-654 pathogenic mutation wherein (mark is thick) and nonsense mutation (capitalization), and thio-modification (shown in *) is carried out at both ends, donor sequence is as follows:

Sequence submits the synthesis of Suzhou Jin Weizhi Biotechnology Co., Ltd.

4, identify whether the dissection of CRISPR/Cpf1 plasmid knife and donor are integrated.

After CRISPR/Cpf1 plasmid and donor1-ssDNA cotransfection 293TT cell, extract total cellular genomic DNA Whether the dissection and donor1 for carrying out Sanger sequence verification CRISPR/Cpf1 plasmid knife are integrated.WT representative does not have Transfect CRISPR/Cpf1 plasmid；SgRNA1, sgRNA2 and sgRNA3 (i.e. 654-g1,654-g2,654-g3) are respectively represented 3 sgRNA that the mutational site IVS-II-654 is nearby designed.After plasmid and ssDNA are transfected into cell, the target of plasmid expression out To the CRISPR/Cpf1 system in the mutational site IVS-II-654, the mutational site IVS-II-654 sequence can be rapidly identified, send out Wave dissection.Cell increases the homologous efficiency for repairing HDR when having external source ssDNA as recovery template after cutting.Together When will extracting cell genomic dna carry out the target fragment that PCR amplification includes mutation after carry out digestion experiment, wherein T7E1 enzyme Conscientiously the cutting efficiency of stationary knife, the efficiency of KpnI digestion experimental identification donor1-ssDNA integration, two groups of digestion experiments are authenticated Control is tests with a batch, and template quantity is consistent.It can observe experimental group (654-g1,654-g2,654-g3) to occur The digestion band of T7E1 enzyme and KpnI enzyme.

Concrete operation method is:

(1) cell culture

293TT cell line is cultivated in 37 DEG C, 5%CO2 incubator with the DMEM complete medium containing 10% serum.To With after 0.25% pancreatin digestion when cell fusion degree reaches 90%, is terminated and digested with DMEM complete medium, be inoculated into 6 orifice plates In, continue culture 24 hours.

(2) plasmid transfection

After 24 hours, confirmation cell is adherent good, and cell fusion degree reaches 80%, can be transfected.Every hole transfects 2ug The donor-ssDNA of CRISPR/Cpf1 plasmid and 100pmol uses the X-tremeGENE HP DNA of Roche company Transfection Reagent transfection reagent requires to be transfected to specifications, and the cell after transfection continues in 37 DEG C, 5% It is cultivated in CO2 incubator.

(3) genome DNA extraction

After transfection 48 hours, routine uses 0.25% trypsin digestion cell, collects cell into centrifuge tube, normal temperature condition Lower 300g is centrifuged 5 minutes, and PBS washed once, and 300g is centrifuged 5 minutes under normal temperature condition.Use full formula gold DNA extraction agent box The reagent component of (Quan Shijin Bioisystech Co., Ltd, article No.: EE101-01), extracts cellular genome in accordance with the following methods DNA:

100ul cell pyrolysis liquid LB2 is added, mixes well, suspension cell, 20ul RnaseA and 20ul is added Proteinase K is vortexed and mixes in sample, is incubated at room temperature 2min.

The BB2 reagent of 500ul combination DNA is added, is vortexed 5 seconds immediately, is incubated at room temperature 10min.

Whole solution is added in centrifugal column, 12000xg is centrifuged 30 seconds, discards efflux.

It is added 500ul solution clean buffer2 (CB2), 12000xg is centrifuged 30 seconds, discards efflux.Then it repeats Once.

It is added 500ul solution wash buffer2 (WB2), 12000xg is centrifuged 30 seconds, discards efflux.Then it repeats Once.

12000xg is centrifuged 2 minutes, completely removes remaining WB2.

Centrifugal column is placed in a clean centrifuge tube, column center be added 50ul preheating (60-70 DEG C) go from Sub- water (PH > 7) is stored at room temperature 1 minute, and 12000xg is centrifuged 1 minute, eluted dna.Measure DNA concentration.

(4) design of primer

Using the primer for the upstream and downstream segment for expanding targeted mutagenesis point before, across target spot, (product length is excellent at primer both ends Choosing~500bp, and target spot apart from two sections of primer distance should difference 50bp or more so as to the energy in agarose gel electrophoresis Effective two small fragments distinguishing digestion and opening).PCR product serves Hai Shenggong biotech company and carries out Sanger sequencing, expands It is consistent with sequencing primer to increase primer, sequence are as follows:

primer-F:aactttacacagtctgcctagt(SEQ ID NO.8)

primer-R:aagggcctagcttggactca(SEQ ID NO.9)

(5) PCR reacts

Using the genomic DNA of said extracted as template, PCR reaction is carried out with above-mentioned primer.The high-fidelity that this experiment uses Archaeal dna polymerase is Beijing Quan Shijin Biotechnology Co., LtdPCR SuperMix (article No.: AS111-02).

PCR reaction system:

PCR reaction condition:

PCR after the reaction was completed, takes a small amount of PCR product to carry out agarose gel electrophoresis, according to electrophoresis result preliminary judgement PCR Whether the concentration and stripe size of product are correct etc..

(6) T7Endonuclease I digestion experiment and agarose gel electrophoresis

The T7Endonuclease I and matched 10 × NEB Buffer 2 that this experiment uses are purchased from New England Biolabs company (article No.: M0302S).Operating procedure is as follows:

200ng purified pcr product is taken to be reacted as follows:

Reaction system:

Annealing conditions:

After the completion of annealing reaction, 1 μ L of T7Endonuclease I is added at this time, and after concussion mixes, 37 DEG C are incubated for 20 points Clock completes cutting, and 2 μ L 0.25M EDTA solution are added and terminate endonuclease reaction.After the reaction was completed, using 2% Ago-Gel into Row electrophoresis.

Agarose gel electrophoresis results show that above-mentioned PCR product can be cut off by T7Endonuclease I, and it is big by one to occur one Small two band (see Fig. 6) illustrates that CRISPR/Cpf1 successfully cuts IVS-II-654 gene order in the cell, passes through ImageJ software calculates the gray value of band, can estimate its cutting efficiency (see Fig. 7).

(7) integration identification KpnI digestion experiment and agarose gel electrophoresis

The KpnI enzyme and matched 10 × Buffer that this experiment uses purchased from Thermo Scientific company (article No.: FD0524).Operating procedure is as follows:

200ng purified pcr product is taken to be reacted as follows:

Reaction system:

10×Buffer 2	2μL
		Purified pcr product	200ng
KpnI	1ul
		H₂O	It mends to 19ul
Total volume	20μL

After mixing, 37 DEG C of incubation completion in 1 hour cuttings are added 2 μ L 0.25M EDTA solution and terminate endonuclease reaction.Reaction After the completion, electrophoresis is carried out using 2% Ago-Gel.

Agarose gel electrophoresis results show that above-mentioned PCR product can be cut off by KpnI, small one and large one two band occur (see Fig. 6), after illustrating that CRISPR/Cpf1 successfully cuts IVS-II-654 gene in the cell, the donor1-ssDNA of modification is whole It has been bonded to target site.Calculated by gray value of the Image J software to band, can estimate KpnI cutting efficiency, it will It is compared with T7E1 digesting efficiency, can calculate the integration efficiency for obtaining donor (see Fig. 7).

5, by select the further evaluation and screening of monoclonal cell go out IVS-II-654 mutation and nonsense mutation 293TT it is thin Born of the same parents system.

Monoclonal cell sequencing data is shown, introduces IVS-II- in normal 293TT cell by the method success 654 mutation and nonsense mutation, to obtain IVS-II-654 saltant type 293TT cell line.Show efficient directed mutagenesis method Successful use.

Group of cells after taking transfection 48h, respectively with 0.25% trypsin digestion and piping and druming is at individual cells, and handle Cell is suspended in spare in the DMEM culture solution of 10% fetal calf serum.

Cell suspension is made into the dilution of gradient multiple, every group of cell is close with the gradient of every 50,100,200 cells of ware respectively Degree is inoculated with respectively in the ware of 37 DEG C of pre-temperature culture solutions containing 10mL, and is gently rotated, and so that cell is uniformly dispersed, is finally made culture hole In contain up to 1 cell.It sets in 37 DEG C of 5%CO2 and the cell incubator of saturated humidity and cultivates 2~3 weeks.

Often observation, when occurring macroscopic clone in culture dish, amplification is passaged to cell quantity and reaches 500,000 A/hole collects a part of cell by preceding method and extracts cell DNA, by sending raw work bioengineering after preceding method PCR amplification The sequencing of (Shanghai) limited liability company.

6, according to Fig. 2 design principle, step 5 extract cell DNA sequencing obtained by sequence mutational site near set SgRNA is counted, 1 optimal sgRNA is designed, constructs Re-CRISPR/Cpf1 plasmid accordingly, 654-293TT cell mutation is returned Normal wild type 293TT cell.

According to afore-mentioned test as a result, selecting the sgRNA sequence opposite with 654-g2 are as follows:

7, according to the design principle of Fig. 2, design synthesis pinpoints the donor2 sequence of seamless mutation and synthesizes.

The 90bp base sequence near IVS-II-654 catastrophe point is intercepted, introduces repair IVS-II-654 mutation wherein (mark boldface type) and nonsense mutation (capitalization), and thio-modification (shown in *) is carried out at both ends, donor sequence is as follows:

Sequence submits the synthesis of Suzhou Jin Weizhi Biotechnology Co., Ltd.

8, it will be edited as the 293TT monoclonal cell of 654 mutation and nonsense mutation, edited again, by it into one Step is mutated back the 293TT cell line of normal wild type, and is verified by PCR-sanger sequencing.

Due to having been verified that the cutting effect of 654-sg2 plasmid early period, and for 654-repair- designed by reparation Sg2 is its Relative sequence, therefore we are by the CRISPR/Cpf1 plasmid and donor-ssDNA cotransfection of 654-repair-sg2 After 293TT cell, the positive colony for directly selecting the 293TT cell that reparation is normal wild type proves the validity of this method, Qualification result is shown in Fig. 9.

Concrete operation method is:

(1) cell culture

(2) plasmid transfection

After 24 hours, confirmation cell is adherent good, and cell fusion degree reaches 80%, can be transfected.Every hole transfects 2ug The donor2-ssDNA of CRISPR/Cpf1 plasmid and 100pmol uses the X-tremeGENE HP DNA of Roche company Transfection Reagent transfection reagent requires to be transfected to specifications, and the cell after transfection continues in 37 DEG C, 5% It is cultivated in CO2 incubator.

(3) monoclonal cell is planted

Group of cells after taking transfection 48h with 0.25% trypsin digestion and is blown and beaten into individual cells respectively, and carefully Born of the same parents are suspended in spare in the DMEM culture solution of 10% fetal calf serum.

Cell suspension is made into the dilution of gradient multiple, every group of cell is respectively with the Graded Density of every 50,100,200 cells of ware It is inoculated in the ware of 37 DEG C of pre-temperature culture solutions containing 10mL, and gently rotates respectively, so that cell is uniformly dispersed, finally make in culture hole Contain up to 1 cell.It sets in 37 DEG C of 5%CO2 and the cell incubator of saturated humidity and cultivates 2~3 weeks.

(4) monoclonal cell genome DNA extraction

Often observation, when occurring macroscopic clone in culture dish, amplification be passaged to cell quantity reach 500,000/ It collects a part of cell and extracts cell DNA by the following method in hole:

Routine uses 0.25% trypsin digestion cell, collects cell into centrifuge tube, 300g is centrifuged 5 points under normal temperature condition Clock, PBS washed once, and 300g is centrifuged 5 minutes under normal temperature condition.Use full formula gold DNA extraction agent box (Quan Shijin biotechnology Co., Ltd, article No.: EE101-01) reagent component, extract cell genomic dna in accordance with the following methods:

12000xg is centrifuged 2 minutes, completely removes remaining WB2.

(5) design of primer

primer-F:aactttacacagtctgcctagt(SEQ ID NO.12)

primer-R:aagggcctagcttggactca(SEQ ID NO.13)

(6) PCR reacts

Using the genomic DNA of said extracted as template, PCR reaction is carried out with above-mentioned primer.The high-fidelity that this experiment uses Archaeal dna polymerase is Beijing Quan Shijin Biotechnology Co., LtdPCR SuperMix (article No.: AS111- 02)。

PCR reaction system:

PCR reaction condition:

(6) product send Sangon Biotech (Shanghai) Co., Ltd. to be sequenced after PCR amplification.Existed by the method success Normal IVS-II-654 saltant type 293TT cell line reparation sports normal wild type 293TT cell.Show efficient fixed point The successful use of mutation method.

The above embodiments merely illustrate the technical concept and features of the present invention, and its object is to allow person skilled in the art Scholar cans understand the content of the present invention and implement it accordingly, and it is not intended to limit the scope of the present invention.It is all according to the present invention Equivalent change or modification made by Spirit Essence, should be covered by the protection scope of the present invention.

Sequence table

<110>Guangzhou Gu Run medical science and technology Co., Ltd

<120>a kind of single base mutation method and the system of use

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213>artificial sequence (rengongxulie)

<400> 1

aactttacac agtctgccta gt 22

<210> 2

<211> 20

<212> DNA

<213>artificial sequence (rengongxulie)

<400> 2

aagggcctag cttggactca 20

<210> 3

<211> 505

<212> DNA

<213> Homo sapiens

<400> 3

aactttacac agtctgccta gtacattact atttggaata tatgtgtgct tatttgcata 60

ttcataatct ccctacttta ttttctttta tttttaattg atacataatc attatacata 120

tttatgggtt aaagtgtaat gttttaatat gtgtacacat attgaccaaa tcagggtaat 180

tttgcatttg taattttaaa aaatgctttc ttcttttaat atactttttt gtttatctta 240

tttctaatac tttccctaat ctctttcttt cagggcaata atgatacaat gtatcatgcc 300

tctttgcacc attctaaaga ataacagtga taatttctgg gttaaggtaa tagcaatatc 360

tctgcatata aatatttctg catataaatt gtaactgatg taagaggttt catattgcta 420

atagcagcta caatccagct accattctgc ttttatttta tggttgggat aaggctggat 480

tattctgagt ccaagctagg ccctt 505

<210> 4

<211> 41

<212> DNA

<213>artificial sequence (rengongxulie)

<400> 4

aatttctact cttgtagatt gggttaaggc aatagcaata t 41

<210> 5

<211> 42

<212> DNA

<213>artificial sequence (rengongxulie)

<400> 5

aatttctact cttgtagatc tattgcctta acccagaaat ta 42

<210> 6

<211> 42

<212> DNA

<213>artificial sequence (rengongxulie)

<400> 6

aatttctact cttgtagata ggcaatagca atatctctgc at 42

<210> 7

<211> 90

<212> DNA

<213>artificial sequence (rengongxulie)

<400> 7

ccattctaaa gaataacagt gataatttct gggttaaggt accagcaata tctctgcata 60

taaatatttc tgcatataaa ttgtaactga 90

<210> 8

<211> 22

<212> DNA

<213>artificial sequence (rengongxulie)

<400> 8

aactttacac agtctgccta gt 22

<210> 9

<211> 20

<212> DNA

<213>artificial sequence (rengongxulie)

<400> 9

aagggcctag cttggactca 20

<210> 10

<211> 42

<212> DNA

<213>artificial sequence (rengongxulie)

<400> 10

aatttctact cttgtagatc tggtacctta acccagaaat ta 42

<210> 11

<211> 90

<212> DNA

<213>artificial sequence (rengongxulie)

<400> 11

ccattctaaa gaataacagt gataatttct gggttaaggc aatagcaata tctctgcata 60

taaatatttc tgcatataaa ttgtaactga 90

<210> 12

<211> 22

<212> DNA

<213>artificial sequence (rengongxulie)

<400> 12

aactttacac agtctgccta gt 22

<210> 13

<211> 20

<212> DNA

<213>artificial sequence (rengongxulie)

<400> 13

aagggcctag cttggactca 20

Claims

1. a kind of single base mutation method, characterized by the following steps:

(2) sgRNA the and CRISPR/Cpf1 nickase is cloned into building on carrier for expression of eukaryon PX330 has specifically Property targeting cutting power CRISPR/Cpf1 plasmid；

(3) base sequence near the catastrophe point of gene to be mutated into is intercepted, and introduces nonsense in the base sequence and dashes forward Become and thio-modification is carried out to the base at 5 ' and 3 ' ends of the base sequence, then synthesizes donor1；

(4) the CRISPR/Cpf1 plasmid and the donor1 cotransfection are contained to the cell for being intended to mutated gene, through cloning The cell containing nonsense mutation is obtained after screening；

(5) Re- is designed for the point mutation site of the sequence containing nonsense mutation in the cell containing nonsense mutation sgRNA；

(6) Re-sgRNA the and CRISPR/Cpf1 nickase is cloned on carrier for expression of eukaryon PX330 and constructs Re- CRISPR/Cpf1 plasmid；

(7) base sequence near the catastrophe point of gene to be mutated into is intercepted, and to 5 ' and 3 ' ends of the base sequence Base carries out thio-modification, then synthesizes donor2；

(8) the thin of nonsense mutation will be contained described in the Re-CRISPR/Cpf1 plasmid and the donor2 cotransfection Born of the same parents obtain the cell line containing gene to be mutated into.

2. single base mutation method according to claim 1, it is characterised in that: the method is directed to IVS-II-654 type The point mutation of thalassemia.

3. single base mutation method according to claim 1, it is characterised in that: in step (3) and step (7), carry out institute When the thio-modification stated, two bases at 5 ' and 3 ' ends are modified.

4. single base mutation method according to claim 1, it is characterised in that: the donor1 and donor2 Length be 90bp.

5. single base mutation method according to claim 1, it is characterised in that: the sgRNA sequence is aatttcta ctcttgtagattgggttaaggcaatagcaatat、aatttctactcttgtagatctattgccttaacccagaaatta、 The sequence of aatttctactcttgtagataggcaatagcaatatctctgcat, the Re-sgRNA are aatttctactc ttgtagatctggtaccttaacccagaaatta。

6. single base mutation method according to claim 1, it is characterised in that: the donor1 and donor2 Sequence be c*c*attctaaagaataacagtgataatttctgggttaaggtaccagcaatatctc tgcatataaata Tttctgcatataaattgtaact*g*a or c*c*attctaaagaataacagtgataatttctgggttaaggcaatagc Aatatctctgcatataaatatttctgcatataaattgtaact*g*a, wherein * indicates thio-modification.

7. a kind of system for single base mutation, it is characterised in that: the system includes for drawing into desire mutated gene Enter the first system unit of nonsense mutation, and for being to be intended to be mutated by the gene mutation after the first system unit orthomutation At the second system unit of gene, the first system unit includes CRISPR/Cpf1 plasmid and donor1, and described second System unit includes Re-CRISPR/Cpf1 plasmid and donor2, contains nonsense mutation in the base sequence of the donor1.

8. the system according to claim 7 for single base mutation, it is characterised in that: the base of the nonsense mutation For cc.

9. the system according to claim 7 for single base mutation, it is characterised in that: described is used for single base mutation System can specificity induction HBB-IVS-II-654 disease cause mutation reparation.