Summary of the invention
Based on the above, applicant, on the basis of early period, the genome editing frame based on CRISPR utilizes the letter of amino acid
And property and codon optimization, design have synthesized the new efficient donor precisely repaired --- in modification type recovery template (ssODN)
Upper introducing nonsense mutation, that is, the base being mutated can't cause the change of corresponding amino acid, it can be with high efficiency and accuracy selection
Property introduce monoallelic and diallele sequence and change, be greatly promoted the raising accurately repaired.Technical principle describes such as
Under:
CRISPR/Cas gene editing systemic origin in bacterial adaptation immune system, from nuclease Cas and 20bp to
Lead RNA (sgRNA) composition.The specificity cutting of CRISPR is mediated by sgRNA, and sgRNA is matched by RNA-DNA base complementrity
It is right, there is the site of protospacer-adjacent motif (PAM) sequence to combine with neighbouring on genomic DNA, by Cas enzyme
It is oriented to target site.It is this to be navigated by may be programmed the simple target that sgRNA is carried out, so that CRISPR system is different from the technology of early stage
(such as Zinc finger nuclease or activating transcription factor sample effect nuclease (TALENs), both technologies require complicated DNA and combine
The assembling of protein structure domain carries out locus specificity editor).CRISPR/Cpf1 is a kind of 2 new class V-type CRISPR effect eggs
It is white, it is the endonuclease that Jian is cut in conjunction with target DNA specific site under single-stranded guide RNA guidance.With common classics
CRISPR/Cas9 is compared, and the single stranded RNA that Cpf1 only needs one section of 42-44 nucleotide to form can recognize and shear DNA, thus
Experimental design step is simplified, polygenes editor is more advantageous to;Cpf1 shearing can generate cohesive terminus,cohesive termini, and target gene can be promoted to insert
Enter to target site;In addition, Cpf1 can identify the PAM sequence rich in thymidine (T), editor's model of CRISPR can be extended
It encloses.The exploitation of CRISPR/Cpf1 is conducive to break through and overcomes some limitations in CRISPR/Cas9 application, therefore is known as
The CRISPR genome edit tool of a new generation.The beta globin IVS-II-654 disease cause mutation being directed to reference to present invention research
Sequence signature, it is known that catastrophe point nearby have be suitable for using CRISPR/Cpf1 carry out genome editor target site.
CRISPR/Cpf1 albumen needs PAM and sgRNA and combines and could introduce double-strand break (DSB) in specific position.
In most cases, these DSBs lead to non-specific insertion, missing by non-homologous end joining (NHEJ) approach reparation
Or other mutation, commonly referred to as ' indels '.This is easy to generate to be mutated in the open reading frame of target gene to lead to codon
Translation or erroneous translation are terminated in advance, to achieve the purpose that gene knockout.However, NHEJ reparation does not allow to introduce specifically
Sequence changes, for maintaining normal gene necessary to normal life function to be mutated for the accurate gene therapy for this type of causing a disease
And it is not suitable for.
Specific sequence is generated to change, for example, be introduced into pathogenic mutation or correct the mutation in patient-derived cell system, it must
With source orientation reparation (HDR), this is a kind of unique cell DNA reparation approach for palpus use.Accomplish this point, the most common side
Method is the DNA recovery template for introducing a modification simultaneously, such as single-stranded oligonucleotide (ssODN), wherein including and base around DSB
Because of the homologous both ends flanking sequence in group region and expected sequence variation.Single stranded DNA is often as " donor template "
It is widely used in during gene editing, it can be achieved that fixed point is repaired and DNA fragmentation is knocked in, research shows that length is 70-100bp
SsDNA as homology arm have higher fixed point repair and segment knock in efficiency, be easier to screening obtain fixed point edit and segment
The mutant knocked in.In mammalian cells, HDR is relatively rare, and genome is edited the double-strand break generated by CRISPR
(double-strand break, DSBs) is mainly repaired by NHEJ, but cell cycle regulating, NHEJ component inhibit or introduce to repair
The frequency of HDR can be improved in multiple template.However, genome editor's event needed for being generated by HDR, it is also desirable to be cut by preventing
SgRNA is targeted again in conjunction with come the accuracy that improves editor afterwards, and there is no directly solutions in the research of early stage for this point.This
The editor of " inaccuracy " updates previous edited site from CRISPR complex a bit, this will reappear mesh
Mark point, until they are sufficiently modified (Fig. 1).We are by utilizing amino acid in the target sequence that CRISPR is targeted
Degenerate is introduced into nonsense mutation (blocking base) into HDR-ssDNA recovery template, can largely prevent
Unwelcome editor again (Fig. 2), achievees the purpose that seamless reparation.
SsDNA donor (is included in cell experiment and embryo's microinjection etc.) in multiple experimental systems and is proved
There is powerful fixed point remediation efficiency.The energy that ODN resists nuclease degradation can be greatly improved in the part thio-modification of terminal nucleotide
Power, without carrying out thio-modification to entire ODN, though thio oligonucleotide can be miscellaneous with the RNA or DNA fragmentation of complementary strand
Friendship forms stable duplex structure, but studies have shown that compares the variation discovery of its Tm value, the stability and unwinding temperature of this double-strand
Degree (Tm) has certain reduction compared with the double-strand of corresponding normal oligonucleotides, in addition, G 3139 is usually to normal cell
There is mild toxicity effect.The method of oligonucleotides end section thio-modification had both overcome the disadvantages mentioned above of complete thio-modification,
The stability for substantially increasing oligonucleotides again is a good method for improving exonuclease treatment effect.At present we use pair
5 ' and 3 ' 2, end bases carry out the ssODN of thio-modification, observe it in an experiment and have reached optimal fixed point edit effect.This
Kind of method with and research be concentrated mainly on cell line or animal embryo, the utilization in human embryonic cell is rarely reported.
Therefore, the present invention is for the normal of this noncoding region point mutation of the thalassemia of HBB-IVS-II-654 point mutation
Autosomal recessive hereditary disease constructs the CRISPR/Cpf1 expression plasmid in the mutational site in corresponding targeting thalassemia, together
Shi Caiyong 5 ' and 3 ' holds the ssDNA (single-stranded oligonucleotide) of 2 base thio-modifications, and former using amino acid degeneracy wherein
Reason introduces the nonsense mutation for blocking and editing again, synthesizes donor, and both CRISPR/Cpf1 expression plasmid and donor is common
It is transfected into cell, the gene mutation site in specific induction IVS-II-654 type thalassemia in 293TT cell
Seamless directional transformation precisely treats to the gene editing based on single-gene point mutation disease is carried out, has important clinical application
Value.
To achieve the above object, the present invention adopts the following technical scheme that:
It is an object of the present invention to provide a kind of single base mutation methods, include the following steps:
(1) sgRNA is designed for the point mutation site for being intended to mutated gene;
(2) sgRNA the and CRISPR/Cpf1 nickase is cloned into building on carrier for expression of eukaryon PX330 has
The CRISPR/Cpf1 plasmid of selectively targeted cutting power;
(3) base sequence near the catastrophe point of gene to be mutated into is intercepted, and introduces nothing in the base sequence
The base progress thio-modification of justice mutation and 5 ' and 3 ' ends to the base sequence, then synthesizes donor1;
(4) the CRISPR/Cpf1 plasmid and the donor1 cotransfection are contained to the cell for being intended to mutated gene, warp
The cell containing nonsense mutation is obtained after colony screening;
(5) for the point mutation site design of the sequence containing nonsense mutation in the cell containing nonsense mutation
Re-sgRNA;
(6) Re-sgRNA the and CRISPR/Cpf1 nickase is cloned on carrier for expression of eukaryon PX330 and is constructed
Re-CRISPR/Cpf1 plasmid;
(7) base sequence near the catastrophe point of gene to be mutated into is intercepted, and to the 5 ' and 3 ' of the base sequence
The base at end carries out thio-modification, then synthesizes donor2;
(8) will described in the Re-CRISPR/Cpf1 plasmid and the donor2 cotransfection containing targeted mutagenesis with
And the cell of nonsense mutation, obtain the cell line containing gene to be mutated into.
Preferably, the method is directed to the point mutation of IVS-II-654 type thalassemia.
Preferably, in step (3) and step (7), when carrying out the thio-modification, two bases being held to 5 ' and 3 ' into
Row modification.
Preferably, the length of the donor1 and the donor2 are 90bp.
Preferably, the sequence of the sgRNA be aatttctactcttgtagattgggttaaggcaatagcaatat,
aatttctactcttgtagatctattgccttaacccagaaatta、aatttctactcttgtagataggcaatagcaata
The sequence of tctctgcat, the Re-sgRNA are aatttctactcttgtagatctggtaccttaacccagaaatta.
Preferably, the sequence of the donor1 is
c*c*attctaaagaataacagtgataatttctgggttaaggtaccagcaatatctctgcatataaata
The sequence of tttctgcatataaattgtaact*g*a, the donor2 is
c*c*attctaaagaataacagtgataatttctgggttaaggcaatagcaatatctctgcatataaata
Tttctgcatataaattgtaact*g*a, wherein * indicates thio-modification.
It is a further object to provide a kind of system for single base mutation, the system include for
It is intended to introduce the first system unit of nonsense mutation in mutated gene, and for will be through the base after the first system unit orthomutation
Because sporting the second system unit of gene to be mutated into, the first system unit includes CRISPR/Cas9Cpf1 plasmid
And donor1, the second system unit include Re-CRISPR/Cas9Cpf1 plasmid and donor2, the donor1's
Contain nonsense mutation in base sequence.
Preferably, the base of the nonsense mutation is cc.
Preferably, the induction HBB-IVS-II-654 that the system for single base mutation can be specific is pathogenic prominent
The reparation of change.The specificity refers to the specificity just for HBB-IVS-II-654 pathogenic sites, targets its CRISPR/Cpf1
With corresponding donor, it is only capable of the reparation of the induction HBB-IVS-II-654 disease cause mutation of specificity, it is waited to HBB- β 41/42
His type disease cause mutation and normal cell are without editor's therapeutic effect.
Due to the implementation of above technical scheme, the invention has the following advantages over the prior art:
The present invention by introduce nonsense mutation, can be avoided it is repaired after gene order cut again, to improve
Cutting efficiency, reduces undershooting-effect, so as to achieve the purpose that seamless reparation, is based on single-gene point mutation disease to carrying out
The gene editing of disease is precisely treated, and has important clinical value.
Specific embodiment
Below will by specific embodiment, the present invention is further explained, but the protection scope being not intended to restrict the invention.
Those skilled in the art can be made improvements to preparation method and using instrument within the scope of the claims, these improvement also should be regarded as
Protection scope of the present invention.Therefore, the scope of protection of the patent of the invention shall be subject to the appended claims.
Design of primers used in the present embodiment use the online design of primers tool of Primer3Plus (http: //
Www.primer3plus.com/cgi-bin/dev/primer3plus.cgi it) completes;It is limited by Suzhou Jin Weizhi biotechnology
Company's synthesis, the thio-modification type donor-ssDNA of integration are synthesized by Suzhou Jin Weizhi Biotechnology Co., Ltd;Identify knife
Engineering enzyme T7E1 enzyme used in whether cutting, is purchased from NEW ENGLAND BIOLAB (article No. #M0302S), identifies donor
Integrate repair engineering enzyme KpnI enzyme and matched 10 × Buffer purchased from Thermo Scientific company (article No.:
FD0524).Sanger sequencing commission Sangon Biotech (Shanghai) Co., Ltd.) limited liability company's completion, according to applicants' design
Sequence carries out plasmid construction by Suzhou Jin Weizhi Biotechnology Co., Ltd completion etc..
1, take normal person in clinical sample (homozygous without mutation), light-duty IVS-II-654 poor patient (heterozygous mutant) and
Heavy IVS-II-654 poor patient (homozygous mutation) blood DNA carry out sanger sequencing, specify IVS-II-654 and sport C
→ T causes a disease.
Normal person (homozygous without mutation), the ground light-duty IVS-II-654 poor patient (heterozygous mutant) and again are taken using blood taking needle
Type IVS-II-654 poor patient (homozygous mutation) blood sample, and use full formula gold DNA extraction agent box (article No.: #
M10122), the DNA in blood is extracted according to operating instruction, as a result sees Fig. 4.
By ncbi database, the upstream and downstream sequence of IVS-II-654 catastrophe point is found, in the online primer of Primer3Plus
Design tool website (http://www.primer3plus.com/cgi-bin/dev/primer3plus.cgi) design primer,
The upstream and downstream segment of targeted mutagenesis point is expanded, PCR product serves Hai Shenggong biotech company and carries out Sanger sequencing, clear
IVS-II-654 Characteristics of Mutation is the point mutation of C → T single base.Primer sequence are as follows:
primer-F:aactttacacagtctgcctagt(SEQ ID NO.1)
primer-R:aagggcctagcttggactca(SEQ ID NO.2)
To heavy IVS-II-654 the blood DNA of poor patient's (homozygous mutation) carries out that resulting sequencing sequence is sequenced are as follows:
(the coarse base of writing of mark is mutating alkali yl T)
2, according to the design principle of Fig. 2, gained is sequenced in the blood DNA to normal person (homozygous without mutation), institute is sequenced
SgRNA is nearby designed in the mutational site for obtaining sequence, designs and selects 3 optimal sgRNA, constructs CRISPR plasmid accordingly.
The sequence selected are as follows:
Wherein, the thick letter of mark is sequence of the sgRNA sequence in conjunction with target DNA, and not marking thick letter part is scaffold
(DR), i.e. the secondary structure region that sgRNA plays a role.
The expression vector establishment method of CRISPR/Cpf1 with reference to quotation (Zhang F.Cell.2015Sep 23.pii:
S0092-8674 (15) 01200-3.doi:10.1016/j.cell.2015.09.038.) in construction method complete building, will
Cpf1 sequence and sgRNA sequence are cloned on expression vector PX330, construct the eukaryotic expression plasmid of CRISPR/Cpf1, structure
After the completion of building, determining carrier construction sequence is compared correctly without mutation by conventional be sequenced, right-on clone is picked out and carries out
It expands and extracts plasmid.
3, according to the design principle of Fig. 2, design synthesis pinpoints the donor1 sequence of seamless mutation and synthesizes.
The 90bp base sequence near IVS-II-654 catastrophe point is intercepted, introduces IVS-II-654 pathogenic mutation wherein
(mark is thick) and nonsense mutation (capitalization), and thio-modification (shown in *) is carried out at both ends, donor sequence is as follows:
Sequence submits the synthesis of Suzhou Jin Weizhi Biotechnology Co., Ltd.
4, identify whether the dissection of CRISPR/Cpf1 plasmid knife and donor are integrated.
After CRISPR/Cpf1 plasmid and donor1-ssDNA cotransfection 293TT cell, extract total cellular genomic DNA
Whether the dissection and donor1 for carrying out Sanger sequence verification CRISPR/Cpf1 plasmid knife are integrated.WT representative does not have
Transfect CRISPR/Cpf1 plasmid;SgRNA1, sgRNA2 and sgRNA3 (i.e. 654-g1,654-g2,654-g3) are respectively represented
3 sgRNA that the mutational site IVS-II-654 is nearby designed.After plasmid and ssDNA are transfected into cell, the target of plasmid expression out
To the CRISPR/Cpf1 system in the mutational site IVS-II-654, the mutational site IVS-II-654 sequence can be rapidly identified, send out
Wave dissection.Cell increases the homologous efficiency for repairing HDR when having external source ssDNA as recovery template after cutting.Together
When will extracting cell genomic dna carry out the target fragment that PCR amplification includes mutation after carry out digestion experiment, wherein T7E1 enzyme
Conscientiously the cutting efficiency of stationary knife, the efficiency of KpnI digestion experimental identification donor1-ssDNA integration, two groups of digestion experiments are authenticated
Control is tests with a batch, and template quantity is consistent.It can observe experimental group (654-g1,654-g2,654-g3) to occur
The digestion band of T7E1 enzyme and KpnI enzyme.
Concrete operation method is:
(1) cell culture
293TT cell line is cultivated in 37 DEG C, 5%CO2 incubator with the DMEM complete medium containing 10% serum.To
With after 0.25% pancreatin digestion when cell fusion degree reaches 90%, is terminated and digested with DMEM complete medium, be inoculated into 6 orifice plates
In, continue culture 24 hours.
(2) plasmid transfection
After 24 hours, confirmation cell is adherent good, and cell fusion degree reaches 80%, can be transfected.Every hole transfects 2ug
The donor-ssDNA of CRISPR/Cpf1 plasmid and 100pmol uses the X-tremeGENE HP DNA of Roche company
Transfection Reagent transfection reagent requires to be transfected to specifications, and the cell after transfection continues in 37 DEG C, 5%
It is cultivated in CO2 incubator.
(3) genome DNA extraction
After transfection 48 hours, routine uses 0.25% trypsin digestion cell, collects cell into centrifuge tube, normal temperature condition
Lower 300g is centrifuged 5 minutes, and PBS washed once, and 300g is centrifuged 5 minutes under normal temperature condition.Use full formula gold DNA extraction agent box
The reagent component of (Quan Shijin Bioisystech Co., Ltd, article No.: EE101-01), extracts cellular genome in accordance with the following methods
DNA:
100ul cell pyrolysis liquid LB2 is added, mixes well, suspension cell, 20ul RnaseA and 20ul is added
Proteinase K is vortexed and mixes in sample, is incubated at room temperature 2min.
The BB2 reagent of 500ul combination DNA is added, is vortexed 5 seconds immediately, is incubated at room temperature 10min.
Whole solution is added in centrifugal column, 12000xg is centrifuged 30 seconds, discards efflux.
It is added 500ul solution clean buffer2 (CB2), 12000xg is centrifuged 30 seconds, discards efflux.Then it repeats
Once.
It is added 500ul solution wash buffer2 (WB2), 12000xg is centrifuged 30 seconds, discards efflux.Then it repeats
Once.
12000xg is centrifuged 2 minutes, completely removes remaining WB2.
Centrifugal column is placed in a clean centrifuge tube, column center be added 50ul preheating (60-70 DEG C) go from
Sub- water (PH > 7) is stored at room temperature 1 minute, and 12000xg is centrifuged 1 minute, eluted dna.Measure DNA concentration.
(4) design of primer
Using the primer for the upstream and downstream segment for expanding targeted mutagenesis point before, across target spot, (product length is excellent at primer both ends
Choosing~500bp, and target spot apart from two sections of primer distance should difference 50bp or more so as to the energy in agarose gel electrophoresis
Effective two small fragments distinguishing digestion and opening).PCR product serves Hai Shenggong biotech company and carries out Sanger sequencing, expands
It is consistent with sequencing primer to increase primer, sequence are as follows:
primer-F:aactttacacagtctgcctagt(SEQ ID NO.8)
primer-R:aagggcctagcttggactca(SEQ ID NO.9)
(5) PCR reacts
Using the genomic DNA of said extracted as template, PCR reaction is carried out with above-mentioned primer.The high-fidelity that this experiment uses
Archaeal dna polymerase is Beijing Quan Shijin Biotechnology Co., LtdPCR SuperMix (article No.: AS111-02).
PCR reaction system:
PCR reaction condition:
PCR after the reaction was completed, takes a small amount of PCR product to carry out agarose gel electrophoresis, according to electrophoresis result preliminary judgement PCR
Whether the concentration and stripe size of product are correct etc..
(6) T7Endonuclease I digestion experiment and agarose gel electrophoresis
The T7Endonuclease I and matched 10 × NEB Buffer 2 that this experiment uses are purchased from New England
Biolabs company (article No.: M0302S).Operating procedure is as follows:
200ng purified pcr product is taken to be reacted as follows:
Reaction system:
Annealing conditions:
After the completion of annealing reaction, 1 μ L of T7Endonuclease I is added at this time, and after concussion mixes, 37 DEG C are incubated for 20 points
Clock completes cutting, and 2 μ L 0.25M EDTA solution are added and terminate endonuclease reaction.After the reaction was completed, using 2% Ago-Gel into
Row electrophoresis.
Agarose gel electrophoresis results show that above-mentioned PCR product can be cut off by T7Endonuclease I, and it is big by one to occur one
Small two band (see Fig. 6) illustrates that CRISPR/Cpf1 successfully cuts IVS-II-654 gene order in the cell, passes through
ImageJ software calculates the gray value of band, can estimate its cutting efficiency (see Fig. 7).
(7) integration identification KpnI digestion experiment and agarose gel electrophoresis
The KpnI enzyme and matched 10 × Buffer that this experiment uses purchased from Thermo Scientific company (article No.:
FD0524).Operating procedure is as follows:
200ng purified pcr product is taken to be reacted as follows:
Reaction system:
10×Buffer 2 |
2μL |
Purified pcr product |
200ng |
KpnI |
1ul |
H2O |
It mends to 19ul |
Total volume |
20μL |
After mixing, 37 DEG C of incubation completion in 1 hour cuttings are added 2 μ L 0.25M EDTA solution and terminate endonuclease reaction.Reaction
After the completion, electrophoresis is carried out using 2% Ago-Gel.
Agarose gel electrophoresis results show that above-mentioned PCR product can be cut off by KpnI, small one and large one two band occur
(see Fig. 6), after illustrating that CRISPR/Cpf1 successfully cuts IVS-II-654 gene in the cell, the donor1-ssDNA of modification is whole
It has been bonded to target site.Calculated by gray value of the Image J software to band, can estimate KpnI cutting efficiency, it will
It is compared with T7E1 digesting efficiency, can calculate the integration efficiency for obtaining donor (see Fig. 7).
5, by select the further evaluation and screening of monoclonal cell go out IVS-II-654 mutation and nonsense mutation 293TT it is thin
Born of the same parents system.
Monoclonal cell sequencing data is shown, introduces IVS-II- in normal 293TT cell by the method success
654 mutation and nonsense mutation, to obtain IVS-II-654 saltant type 293TT cell line.Show efficient directed mutagenesis method
Successful use.
Group of cells after taking transfection 48h, respectively with 0.25% trypsin digestion and piping and druming is at individual cells, and handle
Cell is suspended in spare in the DMEM culture solution of 10% fetal calf serum.
Cell suspension is made into the dilution of gradient multiple, every group of cell is close with the gradient of every 50,100,200 cells of ware respectively
Degree is inoculated with respectively in the ware of 37 DEG C of pre-temperature culture solutions containing 10mL, and is gently rotated, and so that cell is uniformly dispersed, is finally made culture hole
In contain up to 1 cell.It sets in 37 DEG C of 5%CO2 and the cell incubator of saturated humidity and cultivates 2~3 weeks.
Often observation, when occurring macroscopic clone in culture dish, amplification is passaged to cell quantity and reaches 500,000
A/hole collects a part of cell by preceding method and extracts cell DNA, by sending raw work bioengineering after preceding method PCR amplification
The sequencing of (Shanghai) limited liability company.
6, according to Fig. 2 design principle, step 5 extract cell DNA sequencing obtained by sequence mutational site near set
SgRNA is counted, 1 optimal sgRNA is designed, constructs Re-CRISPR/Cpf1 plasmid accordingly, 654-293TT cell mutation is returned
Normal wild type 293TT cell.
According to afore-mentioned test as a result, selecting the sgRNA sequence opposite with 654-g2 are as follows:
Wherein, the thick letter of mark is sequence of the sgRNA sequence in conjunction with target DNA, and not marking thick letter part is scaffold
(DR), i.e. the secondary structure region that sgRNA plays a role.
The expression vector establishment method of CRISPR/Cpf1 with reference to quotation (Zhang F.Cell.2015Sep 23.pii:
S0092-8674 (15) 01200-3.doi:10.1016/j.cell.2015.09.038.) in construction method complete building, will
Cpf1 sequence and sgRNA sequence are cloned on expression vector PX330, construct the eukaryotic expression plasmid of CRISPR/Cpf1, structure
After the completion of building, determining carrier construction sequence is compared correctly without mutation by conventional be sequenced, right-on clone is picked out and carries out
It expands and extracts plasmid.
7, according to the design principle of Fig. 2, design synthesis pinpoints the donor2 sequence of seamless mutation and synthesizes.
The 90bp base sequence near IVS-II-654 catastrophe point is intercepted, introduces repair IVS-II-654 mutation wherein
(mark boldface type) and nonsense mutation (capitalization), and thio-modification (shown in *) is carried out at both ends, donor sequence is as follows:
Sequence submits the synthesis of Suzhou Jin Weizhi Biotechnology Co., Ltd.
8, it will be edited as the 293TT monoclonal cell of 654 mutation and nonsense mutation, edited again, by it into one
Step is mutated back the 293TT cell line of normal wild type, and is verified by PCR-sanger sequencing.
Due to having been verified that the cutting effect of 654-sg2 plasmid early period, and for 654-repair- designed by reparation
Sg2 is its Relative sequence, therefore we are by the CRISPR/Cpf1 plasmid and donor-ssDNA cotransfection of 654-repair-sg2
After 293TT cell, the positive colony for directly selecting the 293TT cell that reparation is normal wild type proves the validity of this method,
Qualification result is shown in Fig. 9.
Concrete operation method is:
(1) cell culture
293TT cell line is cultivated in 37 DEG C, 5%CO2 incubator with the DMEM complete medium containing 10% serum.To
With after 0.25% pancreatin digestion when cell fusion degree reaches 90%, is terminated and digested with DMEM complete medium, be inoculated into 6 orifice plates
In, continue culture 24 hours.
(2) plasmid transfection
After 24 hours, confirmation cell is adherent good, and cell fusion degree reaches 80%, can be transfected.Every hole transfects 2ug
The donor2-ssDNA of CRISPR/Cpf1 plasmid and 100pmol uses the X-tremeGENE HP DNA of Roche company
Transfection Reagent transfection reagent requires to be transfected to specifications, and the cell after transfection continues in 37 DEG C, 5%
It is cultivated in CO2 incubator.
(3) monoclonal cell is planted
Group of cells after taking transfection 48h with 0.25% trypsin digestion and is blown and beaten into individual cells respectively, and carefully
Born of the same parents are suspended in spare in the DMEM culture solution of 10% fetal calf serum.
Cell suspension is made into the dilution of gradient multiple, every group of cell is respectively with the Graded Density of every 50,100,200 cells of ware
It is inoculated in the ware of 37 DEG C of pre-temperature culture solutions containing 10mL, and gently rotates respectively, so that cell is uniformly dispersed, finally make in culture hole
Contain up to 1 cell.It sets in 37 DEG C of 5%CO2 and the cell incubator of saturated humidity and cultivates 2~3 weeks.
(4) monoclonal cell genome DNA extraction
Often observation, when occurring macroscopic clone in culture dish, amplification be passaged to cell quantity reach 500,000/
It collects a part of cell and extracts cell DNA by the following method in hole:
Routine uses 0.25% trypsin digestion cell, collects cell into centrifuge tube, 300g is centrifuged 5 points under normal temperature condition
Clock, PBS washed once, and 300g is centrifuged 5 minutes under normal temperature condition.Use full formula gold DNA extraction agent box (Quan Shijin biotechnology
Co., Ltd, article No.: EE101-01) reagent component, extract cell genomic dna in accordance with the following methods:
100ul cell pyrolysis liquid LB2 is added, mixes well, suspension cell, 20ul RnaseA and 20ul is added
Proteinase K is vortexed and mixes in sample, is incubated at room temperature 2min.
The BB2 reagent of 500ul combination DNA is added, is vortexed 5 seconds immediately, is incubated at room temperature 10min.
Whole solution is added in centrifugal column, 12000xg is centrifuged 30 seconds, discards efflux.
It is added 500ul solution clean buffer2 (CB2), 12000xg is centrifuged 30 seconds, discards efflux.Then it repeats
Once.
It is added 500ul solution wash buffer2 (WB2), 12000xg is centrifuged 30 seconds, discards efflux.Then it repeats
Once.
12000xg is centrifuged 2 minutes, completely removes remaining WB2.
Centrifugal column is placed in a clean centrifuge tube, column center be added 50ul preheating (60-70 DEG C) go from
Sub- water (PH > 7) is stored at room temperature 1 minute, and 12000xg is centrifuged 1 minute, eluted dna.Measure DNA concentration.
(5) design of primer
Using the primer for the upstream and downstream segment for expanding targeted mutagenesis point before, across target spot, (product length is excellent at primer both ends
Choosing~500bp, and target spot apart from two sections of primer distance should difference 50bp or more so as to the energy in agarose gel electrophoresis
Effective two small fragments distinguishing digestion and opening).PCR product serves Hai Shenggong biotech company and carries out Sanger sequencing, expands
It is consistent with sequencing primer to increase primer, sequence are as follows:
primer-F:aactttacacagtctgcctagt(SEQ ID NO.12)
primer-R:aagggcctagcttggactca(SEQ ID NO.13)
(6) PCR reacts
Using the genomic DNA of said extracted as template, PCR reaction is carried out with above-mentioned primer.The high-fidelity that this experiment uses
Archaeal dna polymerase is Beijing Quan Shijin Biotechnology Co., LtdPCR SuperMix (article No.: AS111-
02)。
PCR reaction system:
PCR reaction condition:
PCR after the reaction was completed, takes a small amount of PCR product to carry out agarose gel electrophoresis, according to electrophoresis result preliminary judgement PCR
Whether the concentration and stripe size of product are correct etc..
(6) product send Sangon Biotech (Shanghai) Co., Ltd. to be sequenced after PCR amplification.Existed by the method success
Normal IVS-II-654 saltant type 293TT cell line reparation sports normal wild type 293TT cell.Show efficient fixed point
The successful use of mutation method.
The above embodiments merely illustrate the technical concept and features of the present invention, and its object is to allow person skilled in the art
Scholar cans understand the content of the present invention and implement it accordingly, and it is not intended to limit the scope of the present invention.It is all according to the present invention
Equivalent change or modification made by Spirit Essence, should be covered by the protection scope of the present invention.
Sequence table
<110>Guangzhou Gu Run medical science and technology Co., Ltd
<120>a kind of single base mutation method and the system of use
<160> 13
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213>artificial sequence (rengongxulie)
<400> 1
aactttacac agtctgccta gt 22
<210> 2
<211> 20
<212> DNA
<213>artificial sequence (rengongxulie)
<400> 2
aagggcctag cttggactca 20
<210> 3
<211> 505
<212> DNA
<213> Homo sapiens
<400> 3
aactttacac agtctgccta gtacattact atttggaata tatgtgtgct tatttgcata 60
ttcataatct ccctacttta ttttctttta tttttaattg atacataatc attatacata 120
tttatgggtt aaagtgtaat gttttaatat gtgtacacat attgaccaaa tcagggtaat 180
tttgcatttg taattttaaa aaatgctttc ttcttttaat atactttttt gtttatctta 240
tttctaatac tttccctaat ctctttcttt cagggcaata atgatacaat gtatcatgcc 300
tctttgcacc attctaaaga ataacagtga taatttctgg gttaaggtaa tagcaatatc 360
tctgcatata aatatttctg catataaatt gtaactgatg taagaggttt catattgcta 420
atagcagcta caatccagct accattctgc ttttatttta tggttgggat aaggctggat 480
tattctgagt ccaagctagg ccctt 505
<210> 4
<211> 41
<212> DNA
<213>artificial sequence (rengongxulie)
<400> 4
aatttctact cttgtagatt gggttaaggc aatagcaata t 41
<210> 5
<211> 42
<212> DNA
<213>artificial sequence (rengongxulie)
<400> 5
aatttctact cttgtagatc tattgcctta acccagaaat ta 42
<210> 6
<211> 42
<212> DNA
<213>artificial sequence (rengongxulie)
<400> 6
aatttctact cttgtagata ggcaatagca atatctctgc at 42
<210> 7
<211> 90
<212> DNA
<213>artificial sequence (rengongxulie)
<400> 7
ccattctaaa gaataacagt gataatttct gggttaaggt accagcaata tctctgcata 60
taaatatttc tgcatataaa ttgtaactga 90
<210> 8
<211> 22
<212> DNA
<213>artificial sequence (rengongxulie)
<400> 8
aactttacac agtctgccta gt 22
<210> 9
<211> 20
<212> DNA
<213>artificial sequence (rengongxulie)
<400> 9
aagggcctag cttggactca 20
<210> 10
<211> 42
<212> DNA
<213>artificial sequence (rengongxulie)
<400> 10
aatttctact cttgtagatc tggtacctta acccagaaat ta 42
<210> 11
<211> 90
<212> DNA
<213>artificial sequence (rengongxulie)
<400> 11
ccattctaaa gaataacagt gataatttct gggttaaggc aatagcaata tctctgcata 60
taaatatttc tgcatataaa ttgtaactga 90
<210> 12
<211> 22
<212> DNA
<213>artificial sequence (rengongxulie)
<400> 12
aactttacac agtctgccta gt 22
<210> 13
<211> 20
<212> DNA
<213>artificial sequence (rengongxulie)
<400> 13
aagggcctag cttggactca 20