CN110616217A - Gene repair kit for repairing gene mutation and preparation method of pluripotent stem cells - Google Patents

Abstract

The invention relates to a gene repair kit for repairing gene mutation and a preparation method of a pluripotent stem cell, wherein the gene repair kit comprises a first sgRNA, a second sgRNA, a first DNA template and a second DNA template; the first sgRNA and the first DNA template cooperate for repairing a target mutation of a gene of interest by a CRISPR/Cas9 technique and introduce a second mutation, the second sgRNA and the second DNA template cooperate for repairing the second mutation of a gene of interest by a CRISPR/Cas9 technique. The gene repair kit can reduce the occurrence of secondary cutting by gene editing twice, finally improves the repair efficiency of gene mutation, is more suitable for the gene mutation of mutation sites in introns, and provides a more reliable and more efficient way for repairing the gene mutation. In addition, compared with the construction of a complex homologous arm and other structures for homologous recombination, the synthesis by utilizing the single-stranded nucleotide fragment is more convenient.

Description

Gene repair kit for repairing gene mutation and preparation method of pluripotent stem cells

Technical Field

The invention relates to the field of genetic engineering, in particular to a gene repair kit for repairing gene mutation and a preparation method of pluripotent stem cells.

Background

The genome of eukaryotes consists of billions of DNA bases, which can be changed at precise locations, and is of great value in molecular biology and medicine. Gene editing techniques can precisely destroy, insert or replace the DNA sequence of a specific gene in the genome, providing a powerful tool for biological research, prevention and treatment of genetic diseases. The technical principle comprises two steps, firstly using specific endonuclease to cause DNA Double Strand Break (DSB), and then triggering two mechanisms of homology-mediated repair (HDR) or non-homology end joining (NHEJ) to perform effective gene editing. HDR occurs by using a donor DNA template to direct homologous recombination to produce the desired sequence substitutions at the DSB site, resulting in targeted gene deletions, mutations, insertions, or gene repairs.

The CRISPR system is a regularly repeated short palindromic sequence cluster, is an adaptive immune defense mechanism generated by archaea in evolution and is used for avoiding invasion of exogenous DNA. The length of a repetitive sequence in the CRISPR is 21-48 bp, and the sequence parts of the 5 'end and the 3' end are conserved. The repetitive sequence contains a palindrome structure, forms a stable and conservative secondary structure after transcription, and participates in the formation of a ribonucleoprotein complex together with the Cas protein. The repeated sequences are separated by spacer sequences with the length of 26-72 bp, the number of the spacer sequences of different CRISPR loci is different, and the CRISPR recognizes the target sites through the spacer sequences. Cas9 is a double-stranded DNA nuclease that cleaves the target site under the guidance of grnas, including HNH nuclease domains and RuvC-like structures. The HNH nuclease domain cleaves the DNA strand complementary to the gRNA, while the RuvC-like domain cleaves the other strand, thereby producing a DSB in the DNA. In gene editing, a Type II system is a commonly used CRISPR/Cas9 Type, and the principle is that firstly, the CRISPR/Cas9 Type is transcribed and cut into mature cr-RNA, the sgRNA and the tracRNA form sgRNA, then a ribonucleoprotein complex is formed with a specific Cas9 protein, and the fixed-point double-strand cutting of the DNA is realized by recognizing a PAM sequence (NGG) and complementary pairing of a spacer sequence and a target sequence and guiding the Cas9 protein. On the basis, a DNA template is introduced into the cell, so that the cell can introduce segment insertion or site-directed mutation in the repair process according to the provided DNA template to realize gene repair. However, the repair efficiency of the current gene mutation is still low, and further improvement means have to be explored.

Disclosure of Invention

Accordingly, there is a need for a gene repair kit for repairing a gene mutation, which has high gene mutation repair efficiency.

A gene repair kit for repairing gene mutation comprises a first sgRNA, a second sgRNA, a first DNA template and a second DNA template; the first sgRNA and the first DNA template cooperate for repairing a target mutation of a gene of interest by a CRISPR/Cas9 technique and introduce a second mutation, the second sgRNA and the second DNA template cooperate for repairing the second mutation of a gene of interest by a CRISPR/Cas9 technique.

At present, the repair of gene mutation is usually realized by once editing, namely, the repair is realized by once sgRNA positioning, double-strand cutting and homologous mediated repair, but in practical application, the sgRNA is positioned and combined on a target sequence again with high probability after the repair is finished, and the double-strand cutting and homologous mediated repair are carried out again, so that the originally repaired sequence is changed again, namely, the secondary cutting is carried out, and the repair efficiency of the gene mutation is reduced. When the gene repair kit for repairing gene mutation is used, a target gene can be firstly edited for the first time by using the first sgRNA and the first DNA template through the CRISPR/Cas9 technology, and another mutation is introduced while a target in-situ mutation is repaired, so that the probability of the first sgRNA being positioned and combined to a target sequence which is subjected to the first editing again can be reduced, and the occurrence of secondary cutting can be reduced. And then, a second sgRNA and a second DNA template are utilized to carry out second editing on the target gene through a CRISPR/Cas9 technology, and the mutation introduced in the first editing is repaired, so that the repair can be completed. The gene repair kit can reduce the occurrence of secondary cutting by gene editing twice, finally improves the repair efficiency of gene mutation, is more suitable for the gene mutation of mutation sites in introns, and provides a more reliable and more efficient way for repairing the gene mutation.

In one embodiment, the gene of interest is the HBB gene and the target mutation is the IVS2-654(C > T) mutation.

In one embodiment, the first DNA template and the second DNA template are both single stranded oligodeoxynucleotides.

In one embodiment, the first sgRNA and the second sgRNA are both 20bp in length, and the first DNA template and the second DNA template are both 127bp in length.

In one embodiment, the first sgRNA has the nucleotide sequence shown in SEQ ID No.1, the first DNA template has the nucleotide sequence shown in SEQ ID No.2 or SEQ ID No.3, the second sgRNA has the nucleotide sequence shown in SEQ ID No.4 or SEQ ID No.5, and the second DNA template has the nucleotide sequence shown in SEQ ID No. 6.

In one embodiment, the first sgRNA is carried on a first vector and the second sgRNA is carried on a second vector.

In one embodiment, one or more of a Cas9 vector, electrotransfer, and an anti-apoptotic factor are also included.

In one embodiment, the first vector comprises a first fluorescent protein coding sequence thereon and the Cas9 vector comprises a second fluorescent protein coding sequence thereon.

In one embodiment, the first vector is a pcagmchery-gRNA plasmid and the Cas9 vector is a pCas9-GFP plasmid.

The invention also provides a preparation method of the pluripotent stem cells, which comprises the following steps:

providing the gene repair kit and the pluripotent stem cells containing the target mutation;

transferring the first sgRNA, the Cas9 vector and the first DNA template into the pluripotent stem cell containing the target mutation, and then culturing and screening to obtain the pluripotent stem cell with the target mutation repaired and introduced with a second mutation;

transferring the second sgRNA, the Cas9 vector and the second DNA template into the pluripotent stem cell with the target mutation being repaired and the second mutation being introduced, and then culturing and screening to obtain the pluripotent stem cell with the second mutation being repaired.

Drawings

FIG. 1 is a schematic diagram showing the method for repairing the IVS2-654 mutation site of HBB gene in example 1;

FIG. 2 is a graph of Sanger sequencing peaks at IVS2-654 mutation sites before and after gene repair in example 1; wherein, N-iPS represents a normal iPS cell line, Pre-iPS represents a patient specific iPS cell line containing target mutation, M-iPS represents the iPS cell line after repairing the target mutation and introducing another mutation, and Corrected iPS represents the iPS cell line with successful gene repair;

FIG. 3 is a comparison of gene editing efficiency and gene repair efficiency of the gene repair method of example 1 and a general method; in this figure, A is a comparison of gene editing efficiency, and B is a comparison of gene repair efficiency.

Detailed Description

In order that the invention may be more fully understood, a more particular description of the invention will now be rendered by reference to specific embodiments thereof that are illustrated in the appended drawings. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

The gene repair kit for repairing gene mutation in one embodiment of the invention includes a first sgRNA, a second sgRNA, a first DNA template, and a second DNA template. The first sgRNA and the first DNA template cooperate to repair a mutation of interest by CRISPR/Cas9 technique and introduce a second mutation, and the second sgRNA and the second DNA template cooperate to repair a second mutation of interest by CRISPR/Cas9 technique.

At present, the repair of gene mutation is usually realized by once editing, namely, the repair is realized by once sgRNA positioning, double-strand cutting and homologous mediated repair, but in practical application, the sgRNA is positioned and combined on a target sequence again with high probability after the repair is completed, and the double-strand cutting is performed again, so that the originally repaired sequence is changed again, namely, the secondary cutting is performed, and the gene mutation repair efficiency is reduced. When the gene repair kit for repairing gene mutation is used, a target gene can be firstly edited for the first time by using the first sgRNA and the first DNA template through the CRISPR/Cas9 technology, and another mutation is introduced while a target in-situ mutation is repaired, so that the probability of the first sgRNA being positioned and bound to a target sequence which is subjected to the first editing again can be reduced, and the occurrence of secondary cutting can be reduced. And then, a second sgRNA and a second DNA template are utilized to carry out second editing on the target gene through a CRISPR/Cas9 technology, and the mutation introduced in the first editing is repaired, so that the repair can be completed. The gene repair kit of the embodiment can reduce the occurrence of secondary cutting by gene editing twice, finally improves the repair efficiency of gene mutation, is more suitable for the gene mutation of mutation sites in introns, and provides a more reliable and more efficient way for repairing the gene mutation.

In one specific example, the gene of interest is the hbb (hepatoglobin subbunit beta) gene and the mutation of interest is the IVS2-654(C > T) mutation. Beta-thalassemia is a common hereditary hemoglobinopathy, which is caused by an imbalance in the alpha/beta globin ratio due to a dysregulated beta globin synthesis caused by gene mutation. To date, more than 200 mutations from the HBB gene have been found in three exons, splice sites and other regulatory elements, classified into two types, point mutations and fragment deletions, and are race specific. Wherein, the IVS2-654(C > T) mutation of HBB gene is positioned at 654 th position of intron 2, which generates an abnormal splice site at the position, resulting in abnormal mRNA transcription of HBB gene. Bone Marrow Transplantation (BMT) is currently the only clinical treatment capable of curing beta-thalassemia, however, it is still limited by graft versus host disease and the lack of immune-matched donors. Therefore, gene therapy based on gene mutation repair technology has brought new research, prevention and treatment directions for beta-thalassemia.

In one specific example, the first DNA template and the second DNA template are both single-stranded oligodeoxynucleotides (ssodns). Compared with double-stranded deoxynucleotide (dsDNA), the ssODN is easier to synthesize, has higher efficiency and does not need to carry a screening marker.

In a specific example, the first sgRNA and the second sgRNA are both 20bp in length, and the first DNA template and the second DNA template are both 127bp in length.

In a specific example, for the IVS2-654(C > T) mutation of the HBB gene, the first sgRNA has the nucleotide sequence shown as SEQ ID No.1, the first DNA template has the nucleotide sequence shown as SEQ ID No.2 or SEQ ID No.3, the second sgRNA has the nucleotide sequence shown as SEQ ID No.4 or SEQ ID No.5, and the second DNA template has the nucleotide sequence shown as SEQ ID No. 6. It is understood that the sgrnas are expressed by corresponding DNA nucleotide sequences, and are routine representations for those skilled in the art.

In one particular example, a first sgRNA is carried on a first vector and a second sgRNA is carried on a second vector. It is understood that constructing the first sgRNA and the second sgRNA on a vector, such as a plasmid, facilitates storage and transformation.

In a specific example, the gene repair kit further comprises one or more of a Cas9 vector, an electrotransfer, and an anti-apoptotic factor. It is understood that Cas9 vector, electrotransformation, and anti-apoptotic factors, etc. can also be sold or purchased separately.

In one specific example, the first vector contains a first fluorescent protein coding sequence and the Cas9 vector contains a second fluorescent protein coding sequence. Therefore, after the target gene is edited for the first time, double positive screening can be conveniently carried out through the first fluorescent protein sequence and the second fluorescent protein sequence.

In a specific example, the first vector is a pcagmchery-gRNA plasmid and the Cas9 vector is a pCas9-GFP plasmid, but is not so limited. It is understood that the second carrier may be the same as or different from the first carrier.

The preparation method of the pluripotent stem cell of the embodiment of the invention comprises the following steps of S1-S3:

s1, providing the gene repair kit and the pluripotent stem cell containing the target mutation.

S2, transferring the first sgRNA, the Cas9 vector and the first DNA template into the pluripotent stem cells containing the target mutation, and then culturing and screening to obtain the pluripotent stem cells with the target mutation repaired and introduced with the second mutation.

S3, transferring the second sgRNA, the Cas9 vector and the second DNA template into the pluripotent stem cell with the target mutation being repaired and the second mutation being introduced, and then culturing and screening to obtain the pluripotent stem cell with the second mutation being repaired.

The preparation method of the pluripotent stem cell realizes gene repair by utilizing sgRNA sequence-specific targeting positioning, double-strand cutting caused by Cas9 protein and DNA template homologous recombination, can reduce the occurrence of secondary cutting through two times of gene editing, finally improves the repair efficiency of gene mutation, is more suitable for the gene mutation of mutation sites in introns, and provides a more reliable and more efficient way for repairing gene mutation. In addition, compared with the construction of a complex homologous arm and other structures for homologous recombination, the synthesis of the single-stranded nucleotide fragment with the length of about 127bp is more convenient. It is understood that the method for preparing pluripotent stem cells is only used for preparing pluripotent stem cells and is not used for diagnosis and treatment of diseases.

The following are specific examples.

Example 1

The reagents and materials involved are as follows: induced pluripotent Stem cell culture solution mTeSR culture medium and cell digestion solution Accutase are purchased from Stem cell company; pCAGmCherry-gRNA, 0.25% trypsin from Gibco; matrigel was purchased from Corning corporation; anti-apoptotic factor Y-27632 was purchased from Sigma; preparing a D-PBS buffer solution sterilized at high temperature in a laboratory; 2 Xpfu PCR MasterMix and plasmid extraction kit purchased from Tiangen corporation; primer synthesis was from agile; restriction enzyme Afl II was obtained from NEB, T4 DNA ligase from TAKARA; electrotransfer instruments and electrotransfer solutions were purchased from Invitrogen corporation; the flow meter was purchased from BD.

The iPS cells (induced pluripotent stem cells) of this example were derived from β -thalassemia patients at the third hospital affiliated to the medical university of guangzhou, and were mutated to the HBB gene IVS2-654(C > T), homozygous mutation.

(1) Design sgRNA and single-stranded nucleotide fragment (ssODN) according to sequence upstream and downstream of IVS2-654(C > T) mutation site of HBB gene

According to the upstream and downstream sequences of the mutation site and the PAM principle of SpCas9, sgRNA for identifying the NGG sequence is designed, the length is 20bp, and if the 5' end is not a base G, the original base is replaced by the base G. The ssODN is used as a DNA template for gene targeting, the ssODN is designed on an antisense chain according to the sequence of the upstream and downstream of a mutation site, the length is 127bp, the upstream and downstream distribution of the position of the gRNA is asymmetrical, and the sequence synthesis direction is opposite to that of the gRNA. The sequences of the first sgRNA, the second sgRNA, the first DNA template, and the second DNA template are shown in the following table, and at the same time, when a repair target is mutated in situ, another mutation is introduced through the first sgRNA and the first DNA target, and then the introduced mutation is repaired using the second sgRNA and the second DNA template, as shown in fig. 1. It is understood that the sequence of the second sgRNA can be adjusted according to the mutation introduced by the first DNA template, for example, in fig. 1, when the first DNA template is ssODN1, the introduced mutation is T > a, then the second sgRNA selects sgRNA1, when the first DNA template is ssODN2, the introduced mutation is T > C, then the second sgRNA selects sgRNA 2.

(2) Plasmid construction, plasmid extraction, precipitation and concentration

When sgRNA is synthesized, homologous fragments of 20bp adjacent to Afl II enzyme cutting sites of pCAGmCherry-gRNA frameworks are added at the upstream and the downstream respectively. Annealing the 60bp fragment containing the sgRNA and the reverse complementary sequence thereof by using a bidirectional primer to synthesize a double-stranded oligo, and carrying out Gibson method assembly on the double-stranded oligo and an Afl II linearized vector skeleton pCAGmCherry-gRNA at 50 ℃ to obtain a plasmid carrying the sgRNA. Purifying sgRNAThe plasmid and the pCas9_ GFP plasmid are transformed into Dh5 alpha competence, plated (ampicillin resistance), inverted in an incubator at 37 ℃ overnight, monoclonal bacteria are picked, cultured for 16h in LB culture medium containing benzyl resistance, and positive clones are identified by sequencing, wherein sequencing primers are as follows: gagggcctatttcccatgatt are provided. Plasmid extraction is carried out on bacterial liquid which is correctly identified by using a kit, and after extraction, if the concentration is lower than 1ug/ul, 3M sodium acetate with the volume of 1/10 is added into 100 mu L of plasmid, and then 500 mu L of absolute ethyl alcohol is added and placed at-80 ℃. Before electrotransfer, the concentrated plasmid is taken out from-80 ℃, centrifuged at 4 ℃ and 12000g for 30min, the supernatant is discarded, and 1mL of 75% ethanol is added for washing twice. Removing supernatant as much as possible in a super clean bench, standing at room temperature for 15min, air drying ethanol, and preheating with 10 μ L sterile ddH₂Dissolving the precipitate with O, and measuring the concentration for electric conversion.

(3) Transferring the first sgRNA, the Cas9 plasmid and the first DNA template into the iPS cell of the patient through an electrotransfer instrument

Anti-apoptosis factors are added into iPS cells of a patient with the fusion degree of about 80%, then the iPS cells are digested by Accutase and collected, and the iPS cells are washed repeatedly after centrifugation. And (3) fully resuspending the cell precipitate by using the uniformly mixed first sgRNA plasmid, Cas9 plasmid, first DNA template and electrotransformation solution, and performing electric shock by using an electrotransformation instrument after the cell precipitate is in a single cell state. Then, the cells were seeded on a culture dish previously plated with Matrigel, and the culture was continued by adding an anti-apoptotic factor.

(4) mCherry and GFP double-fluorescence positive cells are sorted by a flow meter and inoculated

And (3) digesting the cells 48h after electrotransformation into single cells and collecting the single cells, sorting out double-fluorescence positive cells by using a flow meter according to the condition that the first sgRNA plasmid contains mCherry fluorescent protein and the Cas9 plasmid contains GFP fluorescent protein, paving the cells in an ultra-low density of 5000 cells according to a 35mm culture dish, planting the cells in a culture dish paved with Matrigel in advance, adding an anti-apoptosis factor to continue culturing, and growing the cells into single clones.

(5) Sequencing and identification of monoclonal

After 7-10 days of flow sorting, the iPS cell monoclonals grow to a certain size, and the clones are recorded to be incapable of fusing. Selecting a part of cloned cells by using a needle, carrying out PCR by using the cloned cells as a template, carrying out Sanger sequencing on an obtained PCR product to obtain a cell line with a mutation site T restored to C and simultaneously introducing a mutation at an upstream 6bp position, wherein a sequencing primer is as follows: tgcatcagtgtggaagtctca are provided.

(6) Performing second gene editing to obtain cell line successfully repaired by targeting

And (3) repeating the steps (3) to (5) by using a second sgRNA plasmid, a Cas9 plasmid and a second DNA template to obtain a positive cell line with successfully repaired IVS2-654(C > T) mutation site and introduced mutation, as shown in figure 2, which indicates that HBB gene mutation is successfully repaired in vitro.

(7) Computational efficiency, comparison of Gene editing and Gene repair efficiencies

Compared with the efficiency of the general method (one-time editing), the gene editing efficiency is (number of heterozygous repair clones + number of homozygous repair clones + number of indel clones)/total number of clones, and the gene repairing efficiency is (number of heterozygous repair clones + number of homozygous repair clones)/total number of clones. The comparison between samples was performed by t-test, means. + -. SEM. P <0.05 represents meaningful results. Analyzed or plotted by GraphPad et al software. The gene editing efficiency of the method and the general method is not statistically significant, but the gene repair efficiency is significantly higher than that of the general method (P ═ 0.007), and the results are shown in fig. 3.

The results of the embodiment prove that the gene repair kit can be successfully applied to in vitro repair of the IVS2-654(C > T) mutation of the HBB gene, can reduce the occurrence of secondary cutting, and finally obviously improves the gene repair efficiency, and the specific sequence, parameter conditions and the like of the IVS2-654(C > T) mutation of the HBB gene are obtained by repeated experimental exploration and optimization.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Guangzhou university of medical sciences attached to the third Hospital (Guangzhou intensive pregnant and lying-in woman treatment center, Guangzhou soft hospital)

<120> gene repair kit for repairing gene mutation and method for preparing pluripotent stem cell

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gagtgataat ttctgggtta 20

<210> 2

<211> 127

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgtagctgct attagcaata tgaaacctct tacatcagtt acaatttata tgcagaaata 60

tttatatgca gaaatattgc tattgcctta tcccagaaat tatcactgtt attctttaga 120

atggtgc 127

<210> 3

<211> 127

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tgtagctgct attagcaata tgaaacctct tacatcagtt acaatttata tgcagaaata 60

tttatatgca gaaatattgc tattgcctta gcccagaaat tatcactgtt attctttaga 120

atggtgc 127

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gagtgataat ttctgggata 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gagtgataat ttctgggcta 20

<210> 6

<211> 127

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tgtagctgct attagcaata tgaaacctct tacatcagtt acaatttata tgcagaaata 60

tttatatgca gaaatattgc tattgcctta acccagaaat tatcactgtt attctttaga 120

atggtgc 127

Claims (10)

1. A gene repair kit for repairing gene mutation is characterized by comprising a first sgRNA, a second sgRNA, a first DNA template and a second DNA template; the first sgRNA and the first DNA template cooperate for repairing a target mutation of a gene of interest by a CRISPR/Cas9 technique and introduce a second mutation, the second sgRNA and the second DNA template cooperate for repairing the second mutation of a gene of interest by a CRISPR/Cas9 technique.

2. The gene repair kit according to claim 1, wherein the gene of interest is the HBB gene and the target mutation is the IVS2-654(C > T) mutation.

3. The gene repair kit of claim 2, wherein the first DNA template and the second DNA template are both single-stranded oligodeoxynucleotides.

4. The gene repair kit of claim 1, wherein the first sgRNA and the second sgRNA are both 20bp in length, and the first DNA template and the second DNA template are both 127bp in length.

5. The gene repair kit of claim 4, wherein the first sgRNA has a nucleotide sequence shown as SEQ ID No.1, the first DNA template has a nucleotide sequence shown as SEQ ID No.2 or SEQ ID No.3, the second sgRNA has a nucleotide sequence shown as SEQ ID No.4 or SEQ ID No.5, and the second DNA template has a nucleotide sequence shown as SEQ ID No. 6.

6. The gene repair kit according to any one of claims 1 to 5, wherein the first sgRNA is carried on a first vector, and the second sgRNA is carried on a second vector.

7. The gene repair kit of claim 6, further comprising one or more of a Cas9 vector, electrotransfer, and an anti-apoptotic factor.

8. The gene repair kit of claim 7, wherein the first vector comprises a first fluorescent protein coding sequence and the Cas9 vector comprises a second fluorescent protein coding sequence.

9. The gene repair kit of claim 8, wherein the first vector is a pcagmchery-gRNA plasmid and the Cas9 vector is a pCas9-GFP plasmid.

10. A method for preparing pluripotent stem cells, comprising the steps of:

providing a gene repair kit according to any one of claims 1 to 9 and a pluripotent stem cell containing a mutation of interest;

transferring the first sgRNA, the Cas9 vector and the first DNA template into the pluripotent stem cell containing the target mutation, and then culturing and screening to obtain the pluripotent stem cell with the target mutation repaired and introduced with a second mutation;

transferring the second sgRNA, the Cas9 vector and the second DNA template into the pluripotent stem cell with the target mutation being repaired and the second mutation being introduced, and then culturing and screening to obtain the pluripotent stem cell with the second mutation being repaired.