CN106244557B - The method of rite-directed mutagenesis ApoE gene and LDLR gene - Google Patents
The method of rite-directed mutagenesis ApoE gene and LDLR gene Download PDFInfo
- Publication number
- CN106244557B CN106244557B CN201610756699.3A CN201610756699A CN106244557B CN 106244557 B CN106244557 B CN 106244557B CN 201610756699 A CN201610756699 A CN 201610756699A CN 106244557 B CN106244557 B CN 106244557B
- Authority
- CN
- China
- Prior art keywords
- gene
- sequence
- ldlr
- grna
- apoe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/775—Apolipopeptides
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
- A01K67/027—New breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
- A01K2217/054—Animals comprising random inserted nucleic acids (transgenic) inducing loss of function
- A01K2217/056—Animals comprising random inserted nucleic acids (transgenic) inducing loss of function due to mutation of coding region of the transgene (dominant negative)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/108—Swine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
Abstract
The invention discloses the methods of rite-directed mutagenesis ApoE gene and LDLR gene.The method of rite-directed mutagenesis ApoE gene and LDLR gene disclosed by the invention, encoding gene including importing the encoding gene of the gRNA of targeting ApoE gene target sequence, the encoding gene for the gRNA for targeting LDLR gene target sequence and from Cas9 to receptor cell, obtains ApoE gene and LDLR gene by the zooblast of rite-directed mutagenesis；Experiments have shown that, the gRNA of targeting ApoE gene target sequence of the invention and the gRNA for targeting LDLR gene target sequence can distinguish efficient identification ApoE gene and LDLR gene, under the action of them, the average diallele editorial efficiency of APOE and LDLR gene shows that method of the invention can be used to rite-directed mutagenesis ApoE gene and LDLR gene up to 31%.
Description
Technical field
The present invention relates to the methods of rite-directed mutagenesis ApoE gene and LDLR gene in field of biotechnology.
Background technique
CRISPR/Cas is a kind of effective acquired immunity mechanism in bacterium and archeobacteria, and CRISPR cluster is one extensive
The special repetitive dna sequence family being present in bacterium and Archimycetes genome, participation tissues-derived according to Cas locus gene
Cas protein difference, CRISPR/Cas system is divided into I type, II type and type III.II type CRISPR/Cas system there is only
It is that core forms with Cas9 albumen and guide RNA (gRNA) in bacterium, when body resists the invasion of the exogenous DNAs such as bacteriophage
When, under the regulation of leader, CRISPR is transcribed into long RNA precursor (pre-crRNA), is subsequently processed into a series of short
Mature crRNA containing conservative repetitive sequence and spacer region, crRNA and the trans-activation complementary with crRNA repetitive sequence
CrRNA (tracrRNA) and Cas9 three form complex, finally identify, are integrated on the exogenous DNA array being complementary and send out
Wave shear action.II type CRISPR/Cas system each species such as: it is mouse, rat, pig, ox, sheep, baboon, rice, wheat, quasi-
Southern mustard etc. has obtained relatively broad utilization.Its editorial efficiency is compared with the earlier generations gene editing such as homologous recombination, ZFNs, TALEN
Means are greatly improved, and experiment link is few, the period is short, expense is lower.
ApoE albumen is a kind of apolipoprotein, is present in very low density lipoprotein (very low-density
Lipoprotein, VLDL), chylomicron (chylomicrons, CM), intermediated-density lipoprotein (Intermediate-
Density lipoprotein, IDLs) and high-density lipoprotein (high-density lipoprotein, HDL) in, for richness
Necessary to the eubolism of lipoprotein component containing triglycerides.Mankind ApoE gene defect or genetic mutation and cardiovascular disease
The diseases such as disease, senile dementia are related, are the major gene resistances of hypercholesterolemia and atherosclerosis.
LDL receptor (LDLR, low-density lipoprotein receptor) gallbladder in adjusting blood
It is played a key role in the amount of sterol.They are distributed very rich, the low-density lipoprotein receptor of surface of hepatocytes in liver
The quantity of body determines how quickly to remove cholesterol from blood.LDLR has high polymorphism, at present about LDLR
The mutation type that gene has determined that is just more than 1000 kinds.The LDLR type of these mutation is increased by influencing blood cholesterol levels
Add the disease incidences such as heart disease and atherosclerosis.
In biomedical research, the foundation of animal model of human disease has study of disease generation and treatment most important
Effect.With the aggravation of Chinese society aging, cardiovascular patient will continue to increase.It is dual-gene to prepare ApoE/LDLR
Mutant animals model has important scientific research and medical value.
Summary of the invention
The technical problem to be solved by the present invention is to how carry out rite-directed mutagenesis to ApoE gene and LDLR gene.
In order to solve the above technical problems, present invention firstly provides the method for rite-directed mutagenesis ApoE gene and LDLR gene,
The method is that rite-directed mutagenesis, ApoE gene used in the CRISPR/Cas9 method are carried out using CRISPR/Cas9 method
Target sequence is following A1), A2) or A3):
A1) in sequence table sequence 1 nucleotide sequence；
A2 the DNA sequence dna) and A1) limited have 75% or 75% or more identity as A1) derived from DNA sequence dna；
A3) under strict conditions with A1) limit DNA sequence dna hybridize as A1) derived from DNA sequence dna；
LDLR gene target sequence used in the CRISPR/Cas9 method is target sequence 1 or target sequence 2, the target sequence
Column 1 are following B1), B2) or B3):
B1) in sequence table sequence 3 nucleotide sequence；
B2 the DNA sequence dna) and B1) limited have 75% or 75% or more identity as B1) derived from DNA sequence dna；
B3) under strict conditions with B1) limit DNA sequence dna hybridize as B1) derived from DNA sequence dna；
The target sequence 2 is following C1), C2) or C3):
C1) in sequence table sequence 4 nucleotide sequence；
C2 the DNA sequence dna) and C1) limited have 75% or 75% or more identity as C1) derived from DNA sequence dna；
C3) under strict conditions with C1) limit DNA sequence dna hybridize as C1) derived from DNA sequence dna.
Term " identity " used herein refers to the sequence similarity with native sequence nucleic acid." identity " includes and this hair
The nucleotide sequence of bright sequence 1, sequence 3 or sequence 4 has 75% or higher or 85% or higher or 90% or higher, or
The nucleotide sequence of 95% or higher identity.Identity can with the naked eye or computer software is evaluated.Use computer
Software, the identity between two or more sequences can indicate with percentage (%), can be used to evaluate correlated series it
Between identity.
In the above method, the stringent condition is to hybridize at 68 DEG C in 2 × SSC, the solution of 0.1%SDS and wash film
2 times, each 5min, but in 0.5 × SSC, the solution of 0.1%SDS, hybridize at 68 DEG C and washes film 2 times, each 15min；
Or, hybridizing under the conditions of 65 DEG C in the solution of 0.1 × SSPE (or 0.1 × SSC), 0.1%SDS and washing film.
Above-mentioned 75% or 75% or more identity can be 80%, 85%, 90% or 95% or more identity.
The method of above-mentioned rite-directed mutagenesis ApoE gene and LDLR gene may include importing into vitro receptor cell
Target the encoding gene of the gRNA of ApoE gene target sequence, the encoding gene for the gRNA for targeting LDLR gene target sequence and Cas9
Encoding gene obtains ApoE gene and LDLR gene by the zooblast of rite-directed mutagenesis.
In the above method, the encoding gene of the gRNA of the targeting ApoE gene target sequence can be imported by expression vector 1
In the receptor cell, the expression vector 1 is the encoding gene of the gRNA containing the targeting ApoE gene target sequence
Expression cassette expression vector.
In one embodiment of the invention, the expression vector 1 is U6-sgRNA-ApoE2, and U6-sgRNA-ApoE2 is
The weight that can recognize that the oligonucleotides dimer of sequence 1 obtains is inserted into the sequence of pGL3-U6-sgRNA-PGK-puromycin
Group carrier.
In the above method, the encoding gene of the gRNA of the targeting LDLR gene target sequence can be imported by expression vector 3
In the receptor cell, the expression vector 3 is the encoding gene of the gRNA containing the targeting LDLR gene target sequence
Expression cassette expression vector.
In one embodiment of the invention, the expression vector 3 is U6-sgRNA-LDLR1 or U6-sgRNA-LDLR2,
U6-sgRNA-LDLR1 is that the few nucleosides that can recognize sequence 3 are inserted into the sequence of pGL3-U6-sgRNA-PGK-puromycin
The recombinant vector that acid dimer obtains, U6-sgRNA-LDLR2 are in the sequence of pGL3-U6-sgRNA-PGK-puromycin
It is inserted into the recombinant vector that can recognize that the oligonucleotides dimer of sequence 4 obtains.
In the above method, the encoding gene of the Cas9 can be imported in the receptor cell by expression vector 2, institute
State the expression vector for the expression cassette that expression vector 2 is the encoding gene containing the Cas9.
In one embodiment of the invention, the Cas9 expression that the article No. that the expression vector 2 is Addgene is #44758
Carrier.
In the above method, the sequence of the gRNA of the targeting ApoE gene target sequence can be by the T in sequence table in sequence 2
Replace with the sequence that U is obtained；The encoding gene of the gRNA of the targeting ApoE gene target sequence is shown in sequence 2 in sequence table
DNA molecular.The sequence of the gRNA of the targeting LDLR gene target sequence is to replace with sequence 5 in sequence table or the T in sequence 6
The sequence that U is obtained；The encoding gene of the gRNA of the targeting LDLR gene target sequence is shown in sequence 5 in sequence table or sequence 6
DNA molecular.
In the above method, the receptor cell can be mammalian cell.The mammalian cell is concretely
Pig cell, such as porcine fetus fibroblasts.
In order to solve the above technical problems, the present invention also provides following any products:
P1, complete RNA, by it is described targeting ApoE gene target sequence gRNA (gRNA is named as ApoE-gRNA) with
GRNA (gRNA the is named as LDLR-gRNA) composition of the targeting LDLR gene target sequence；
P2, complete gene, are made of the encoding gene of ApoE-gRNA and the encoding gene of LDLR-gRNA；
The expression cassette of the encoding gene of P3, the encoding gene containing ApoE-gRNA and LDLR-gRNA；
P4, complete expression cassette, by the expression cassette of the encoding gene containing ApoE-gRNA and the encoding gene of LDLR-gRNA
Expression cassette composition；
The recombinant vector of the encoding gene of P5, the encoding gene of encoding gene containing ApoE-gRNA and LDLR-gRNA；
P6, the recombinant vector containing expression cassette described in P3；
P7, the recombinant vector containing complete expression cassette described in P4；
P8, complete carrier, by the recombinant vector and LDLR-gRNA of the encoding gene of the encoding gene containing ApoE-gRNA
Encoding gene recombinant vector composition；
P9, complete target sequence are made of the ApoE gene target sequence and the LDLR gene target sequence.
In an embodiment of the present invention, LDLR-gRNA is LDLR1-gRNA or LDLR2-gRNA.The sequence of LDLR1-gRNA
For the T in sequence table in sequence 5 is replaced with the sequence that U is obtained, the sequence of LDLR2-gRNA is will be in sequence table in sequence 6
T replaces with the sequence that U is obtained.
In the said goods, the expression cassette of the encoding gene containing ApoE-gRNA is to refer to the table in host cell
Up to the DNA of ApoE-gRNA, which not only may include the promoter for starting the encoding gene transcription of ApoE-gRNA, may also include
Terminate the terminator of the encoding gene transcription of ApoE-gRNA.The expression cassette of the encoding gene containing LDLR-gRNA, refers to
The DNA of LDLR-gRNA can be expressed in host cell, which not only may include the encoding gene transcription for starting LDLR-gRNA
Promoter, may also include terminate LDLR-gRNA encoding gene transcription terminator.Further, the expression cassette can also wrap
Include enhancer sequence.
The recombination of the encoding gene expression cassette of ApoE-gRNA or LDLR-gRNA can be contained with existing expression vector establishment
Carrier.The expression vector concretely pGL3-U6-sgRNA-PGK-puromycin.
In order to solve the above technical problems, the present invention also provides the complete examinations of rite-directed mutagenesis ApoE gene and LDLR gene
Agent, the reagent set include any one of the product and following M1-M3 composition；
The encoding gene of M1, Cas9；
The expression cassette of M2, encoding gene containing Cas9；
The expression vector of M3, encoding gene containing Cas9.
In above-mentioned reagent set, the expression cassette of the encoding gene described in M2 containing Cas9 is referred in host cell
The DNA of middle expression Cas9, the DNA not only may include the promoter for starting the encoding gene transcription of Cas9, may also include termination
The terminator of the encoding gene transcription of Cas9.Further, the expression cassette may also include enhancer sequence.
The recombinant vector of the encoding gene expression cassette of Cas9 can be contained with existing expression vector establishment.It is described to contain Cas9
Encoding gene expression vector concretely Addgene article No. be #44758 Cas9 expression vector.
In order to solve the above technical problems, the present invention also provides following any applications:
The application of X1, the product in rite-directed mutagenesis ApoE gene and LDLR gene；
The application of X2, the reagent set in rite-directed mutagenesis ApoE gene and LDLR gene.
X3, the product are preparing the application in ApoE gene and LDLR site-directed point mutation animal model；
X4, the reagent set are preparing the application in ApoE gene and LDLR site-directed point mutation animal model.
In above-mentioned application, the animal can be mammal.The mammal concretely pig.
In the present invention, product that the article No. that pGL3-U6-sgRNA-PGK-puromycin is addgene is #51133.
It is demonstrated experimentally that ApoE-gRNA of the invention and LDLR1-gRNA and ApoE-gRNA and LDLR2-gRNA can distinguish
Efficient identification ApoE gene and LDLR gene, realize accurate cutting under CAS9 enzyme effect, and ApoE gene and LDLR gene exist
The mutation type that cas9 cleavage site nearby occurs has: single base insertion, the insertion of polybase base, single base is deleted and polybase base is deleted
Except four kinds of mutation types.The average diallele of APOE and LDLR gene under the action of ApoE-gRNA and LDLR1-gRNA
Editorial efficiency is 31%；The average diallele of APOE and LDLR gene under the action of ApoE-gRNA and LDLR2-gRNA
Editorial efficiency is 14%.The cell that the LDLR gene for carrying various mutations type and APOE gene are mutated can be prepared, is
The mutation of APOE gene/LDLR gene and functional analysis provide experiment basis.Rite-directed mutagenesis ApoE gene of the invention with
The method of LDLR gene can be used to rite-directed mutagenesis ApoE gene and LDLR gene, can also be used to prepare ApoE gene and LDLR
Gene defect disease animal model.
Detailed description of the invention
Cell mixes pond PCR sequencing after Fig. 1 is transfection U6-sgRNA-ApoE2 48h.Black region show gRNA and sets in figure
Count site.
Fig. 2 is the analysis of cell monoclonal mutation type.
Cell mixes pond PCR sequencing after Fig. 3 is transfection U6-sgRNA-LDLR1 and U6-sgRNA-LDLR2 48h.A:CAS9/
Pond PCR is mixed after U6-sgRNA-LDLR1 transfection, and peak figure is sequenced；Pond PCR is mixed after B:CAS9/U6-sgRNA-LDLR2 transfection, and peak is sequenced
Figure；LDLR-E2-1 and LDLR-E2-2 respectively indicates the recognition site of LDLR1-gRNA and LDLR2-gRNA in figure.
Cell monoclonal mutation type is analyzed after Fig. 4 is transfection U6-sgRNA-LDLR1 and U6-sgRNA-LDLR2.Wherein,
LDLR-e2-1 and LDLR-e2-2 respectively indicates transfection U6-sgRNA-LDLR1 and U6-sgRNA-LDLR2；"+" indicates insertion；
" △ " indicates to delete；" wt " indicates wild type.
Cell is mixed after Fig. 5 is transfection U6-sgRNA-LDLR1 and U6-sgRNA-LDLR2 and U6-sgRNA-ApoE2 48h
Pond PCR sequencing.In figure APOE-E2, LDLR-E2-1 and LDLR-E2-2 respectively indicate APOE-gRNA, LDLR1-gRNA with
The recognition site of LDLR2-gRNA.A and B is respectively the mixed pond of cell after transfecting U6-sgRNA-ApoE2/U6-sgRNA-LDLR1
Peak figure is sequenced in APOE and LDLR gene PCR；Cell is mixed after C and D respectively transfects U6-sgRNA-ApoE2/U6-sgRNA-LDLR1
Peak figure is sequenced in pond APOE and LDLR gene PCR.
Fig. 6 is the analysis of cell monoclonal mutation type, wherein A is transfection U6-sgRNA-ApoE2/U6-sgRNA-LDLR1
As a result, B be transfect U6-sgRNA-ApoE2/U6-sgRNA-LDLR2 after result；The mutation of APOE-e2 expression ApoE gene
As a result；LDLR-e2-1 and LDLR-e2-2 respectively indicates transfection U6-sgRNA-LDLR1 and U6-sgRNA-LDLR2LDLR gene
Catastrophe；"+" indicates insertion；" △ " indicates to delete；" wt " indicates wild type；" # " is clone's number.
Specific embodiment
The present invention is further described in detail With reference to embodiment, and the embodiment provided is only for explaining
The bright present invention, the range being not intended to be limiting of the invention.
Experimental method in following embodiments is unless otherwise specified conventional method.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Porcine fetus fibroblasts (porcine embryonic fibroblast, PEF) in following embodiments according to
Following method preparation: by 37 day Embryos of Ba-Ma mini pig, removing head, tail, four limbs, internal organ and the bone of fetus, and by blood
It cleans out.It persistently shears fetus 30min guarantee with elbow eye scissors sufficiently to shred, by the indigo plant of the fetal tissue's haircut shredded
Pipette tips are drawn in 15mL centrifuge tube, and the full culture medium of 5mL is added, removes solution above after several minutes of natural subsidence, and in lower layer
A few drop FBS are added in tissue block, is sucked out with 15cm glass Pasteur's pipe curved at the 1cm of tip, is laid in two T75 culture bottles
In, bottom of bottle is placed upward, and 15mL full nutrient solution is added in opposite side, and culture bottle is carefully turned over after 6-8h, tissue block is immersed
In culture solution, changes a not good liquor within every two days, frozen after cell covers with T75 culture bottle spare.Wherein, Ba-Ma mini pig is Chinese agriculture
The pig of the industry academy of sciences, animal and veterinary research institute, base pig farm, Tianjin, Beijing raising.
The rite-directed mutagenesis of embodiment 1, ApoE gene
Specific recognition pigs ApoE gene gRNA (being named as ApoE-gRNA) provided by the present embodiment is held from 5 ' to 3 '
End is successively are as follows: (sequence with ApoE gene target sequence specific bond, ApoE gene target sequence are sequence in sequence table to the base of 19nt
Column 1), the hairpin structure (being responsible for cutting DNA with Cas9 protein binding guidance Cas9 nuclease) of a long 42nt, 3 ' ends
The transcription terminator of one long 40nt.The sequence of ApoE-gRNA is that the T in sequence table in sequence 2 is replaced with the sequence that U is obtained
Column, ApoE-gRNA DNA molecular as shown in sequence 2 in sequence table coding.Under the guiding function of mature ApoE-gRNA
Cas9 is integrated to ApoE gene, and cuts to it, introduces double-strand break (DSB), radiation-indued DNA damage reparation, in target site
Mutation is nearby introduced, a variety of ApoE gene mutation bodies are manufactured.
One, expression vector establishment
Skeleton carrier used be pGL3-U6-sgRNA-PGK-puromycin (addgene product, article No. #51133, with
Lower abbreviation U6-sgRNA), the specific building process of gRNA expression vector is as follows:
1, prepared by skeleton carrier
U6-sgRNA skeleton carrier digestion recycling: 50 μ l digestion systems are as follows: 10 μ g U6-sgRNA, 5 μ l BbsI
(NEB), 5 μ l cutsmart buffer (NEB), ddH2O is mended to 50 μ l.
2, the formation of oligonucleotides dimer and dephosphorylation
Reaction system is as follows:
The primer sequence of ApoE-e2-F and ApoE-e2-R is as shown in table 1.
Table 1, ApoE-gRNA construct primer sequence
| Title | Sequence (5 ' -3 ') |
| ApoE-e2-F | ACCGgaggtgcacgtgtggtggg |
| ApoE-e2-R | AAACcccaccacacgtgcacctc |
Above-mentioned system is mixed, carries out annealing reaction using PCR instrument, program is as follows:
3, the preparation of U6-sgRNA-ApoE2
The skeleton carrier that the oligonucleotides dimer that step 2 obtains is obtained with step 1 is attached, 16 DEG C of connection 1h,
Obtain recombinant vector.Specific reaction system is as follows: the skeleton carrier that 50ng step 1 obtains, the oligonucleotides dimerization that step 2 obtains
Body (1:200 dilution), 1 μ 10 × T4Ligase of l Buffer (TKARA), 1 μ l T4Ligase (TKARA), ddH2O is mended to 11 μ
l。
Connection product is converted into Escherichia coli, and sequence verification obtains the recombination load that sequence correctly expresses ApoE-gRNA
Body is named as U6-sgRNA-ApoE2.
Two, porcine fetus fibroblasts and verifying are transfected
In triplicate, repeating experiment every time, specific step is as follows for experiment:
U6-sgRNA-ApoE2 the and Cas9 expression vector (Addgene for being obtained step 1 using the method for nuclear transfection
Product, article No. #44758) each 5 μ g transfects porcine fetus fibroblasts (about 1 × 106It is a), nuclear transfection is in strict accordance with kit
The operation of (Catalog Number:VPI-1002, Lonza) and cell nuclear transfection instrument (Amaxa company) specification, selects T-016
Program.48h after nuclear transfection extracts cytogene using cell/tissue genome DNA extracting reagent kit (bioteke, DP1901)
Group DNA.
Using the DNA of said extracted as template, amplification includes the ApoE gene of ApoE-gRNA binding site, and amplimer is such as
Following table recycles about 698bp PCR product.Amplification condition is as follows: initial denaturation 98 DEG C of 3min, 98 DEG C of 10s, 63 DEG C of 15s, 72 DEG C of 40s,
33 72 DEG C of 5min of circulation are re-extended.
Table 2, ApoE amplimer
| Title | Sequence (5 ' -3 ') |
| ApoE-F | GCAGGGCGTGAGCATTAGAT |
| ApoE-R | AGGACGGCAAGACTGACCCA |
PCR product is sequenced, sequencing result in cas9 nucleic acid cleavage sites downstream as shown in Figure 1, start to occur
Cover peak, it was demonstrated that cas9 nuclease successfully cuts pig ApoE gene.It is combined in figure shown in black box for ApoE-gRNA
Position, set peak show that there are multiple base types in the site.
Three, clonality and clonal mutation type analysis
In triplicate, repeating experiment every time, specific step is as follows for experiment:
U6-sgRNA-ApoE2 the and Cas9 expression vector (Addgene for being obtained step 1 using the method for nuclear transfection
Product, article No. #44758) each 5 μ g transfects porcine fetus fibroblasts (about 1 × 106It is a), nuclear transfection is in strict accordance with kit
It is operated with consideration convey instrument specification, selects T-016 program.After nuclear transfection for 24 hours, the processing of 1 μ g/mL puromycin is added, is used after 36h
The digestion of 0.1% pancreatin, collects cell, is inoculated into (1 × 10 in 3 100mm Tissue Culture Dish4A/ware), contain in Tissue Culture Dish
Have DMEM culture medium (Thermo Fisher Scientific), culture is formed for 15 days to monoclonal, replaces fresh training within every two days
Support base.Picking monoclonal cell extracts monoclonal genome, expands ApoE gene and (rapid two) of PCR amplification conditional synchronization are sequenced.
Mutation type analysis is done to the monoclonal of picking, occurs single base insertion, polybase base near cas9 cleavage site
Insertion, single base are deleted and polybase base deletes four kinds of mutation types (Fig. 2).Figure Green short-term illustrates ApoE-gRNA to identify sequence
It is listed in the position in ApoE gene, red short-term illustrates PAM sequence, and alignment's figure shows detailed mutation type situation,
Middle first trip sequence is wild type ApoE gene order.
Table 3 averagely knocks out efficiency
The results show that ApoE-gRNA energy efficient identification pig ApoE gene Second Exon of the invention, in CAS9 enzyme effect
The lower accurate cutting of realization, as a result (table 3) is shown, CAS9/U6-sgRNA-ApoE2 system is averaged editorial efficiency to pig ApoE gene
For 86%, (the ApoE gene i.e. on two chromosomes of pig cell is edited (genotype APOE-/-) the total Dan Ke of monoclonal Zhan
ApoE gene in the ratio and item chromosome of grand number is edited (genotype APOE-/+) the total monoclonal number of monoclonal Zhan
The sum of ratio), wherein average monoallelic editorial efficiency is 72% (to only have on item chromosome i.e. in pig cell
ApoE gene is edited (genotype APOE-/+) the total monoclonal number of monoclonal Zhan ratio), average diallele (gene
Type is APOE-/-) editorial efficiency be 14% (the ApoE gene monoclonal to be edited on two chromosomes i.e. in pig cell
The ratio of the total monoclonal number of Zhan).A large amount of gene mutation type has been manufactured simultaneously, has been mutation and function of the later period to pig ApoE gene
It can analyze and provide experiment basis.
The rite-directed mutagenesis of embodiment 2, LDLR gene
The present embodiment provides providing the gRNA of two specific recognition pigs LDLR genes, respectively LDLR1-gRNA with
LDLR2-gRNA, LDLR1-gRNA and LDLR2-gRNA are held successively from 5 ' ends to 3 ' are as follows: the base of 19nt or 20nt is (with LDLR
The sequence of gene target sequence specific bond, LDLR1-gRNA are sequence 3, LDLR2- in sequence table in the target sequence in LDLR gene
GRNA is sequence 4 in sequence table in the target sequence in LDLR gene), the hairpin structure of a long 42nt (is responsible for and Cas9 albumen
DNA is cut in conjunction with guidance Cas9 nuclease), the transcription terminator of 3 ' the one long 40nt in end.The sequence of LDLR1-gRNA
For the T in sequence table in sequence 5 is replaced with the sequence that U is obtained, LDLR1-gRNA DNA as shown in sequence 5 in sequence table divides
Son coding；The sequence of LDLR2-gRNA is that the T in sequence table in sequence 6 is replaced with the sequence that U is obtained, and LDLR2-gRNA is by sequence
DNA molecular shown in sequence 6 encodes in list.Cas9 is tied under the guiding function of mature LDLR1-gRNA or LDLR2-gRNA
LDLR gene is closed, and it is cut, is introduced double-strand break (DSB), radiation-indued DNA damage reparation is drawn near target site
Enter mutation, manufactures a variety of LDLR gene mutation bodies.
One, expression vector establishment
Skeleton carrier used be pGL3-U6-sgRNA-PGK-puromycin (addgene product, article No. #51133, with
Lower abbreviation U6-sgRNA), the specific building process of gRNA expression vector is as follows:
1, prepared by skeleton carrier
With in 1 step 1 of embodiment 1.
2, the formation of oligonucleotides dimer and dephosphorylation
According in 1 step 1 of embodiment 2 method, by ApoE-e2-F and ApoE-e2-R replace with LDLR-e2-1-F with
LDLR-e2-1-R, other steps are constant, obtain LDLR1 oligonucleotides dimer.
According in 1 step 1 of embodiment 2 method, by ApoE-e2-F and ApoE-e2-R replace with LDLR-e2-2-F with
LDLR-e2-2-R, other steps are constant, obtain LDLR2 oligonucleotides dimer.
The sequence of LDLR-e2-1-F and LDLR-e2-1-R, LDLR-e2-2-F and LDLR-e2-2-R are as shown in table 4.
Table 4, gRNA construct primer sequence
| Title | Sequence (5 ' -3 ') |
| LDLR-e2-1-F | ACCGGAAATGCATCTCCTACAAG |
| LDLR-e2-1-R | AAACCTTGTAGGAGATGCATTTC |
| LDLR-e2-2-F | ACCGGCACGTCTCCAGGGACTCAT |
| LDLR-e2-2-R | AAACATGAGTCCCTGGAGACGTGC |
3, the preparation of U6-sgRNA-LDLR1 and U6-sgRNA-LDLR2
The skeleton carrier that the LDLR1 oligonucleotides dimer that step 2 obtains is obtained with step 1 is attached, 16 DEG C of companies
1h is met, recombinant vector is obtained.Specific reaction system is as follows: the skeleton carrier that 50ng step 1 obtains, and the LDLR1 that step 2 obtains is few
Nucleotide dimer (1:200 dilution), 1 μ 10 × T4Ligase of l Buffer (TKARA), 1 μ l T4Ligase (TKARA),
ddH2O is mended to 11 μ l.Connection product is converted into Escherichia coli, and sequence verification obtains sequence and correctly expresses LDLR1-gRNA's
Recombinant vector is named as U6-sgRNA-LDLR1.
The skeleton carrier that the LDLR2 oligonucleotides dimer that step 2 obtains is obtained with step 1 is attached, 16 DEG C of companies
1h is met, recombinant vector is obtained.Specific reaction system is as follows: the skeleton carrier that 50ng step 1 obtains, and the LDLR2 that step 2 obtains is few
Nucleotide dimer (1:200 dilution), 1 μ 10 × T4Ligase of l Buffer (TKARA), 1 μ l T4Ligase (TKARA),
ddH2O is mended to 11 μ l.Connection product is converted into Escherichia coli, and sequence verification obtains sequence and correctly expresses LDLR1-gRNA's
Recombinant vector is named as U6-sgRNA-LDLR2.
Two, porcine fetus fibroblasts and verifying are transfected
In triplicate, repeating experiment every time, specific step is as follows for experiment:
The U6-sgRNA-LDLR1 and Cas9 for obtaining step 1 according to the method for the nuclear transfection in 1 step 2 of embodiment
Each 5 μ g of expression vector (Addgene product, article No. #44758) transfects porcine fetus fibroblasts (about 1 × 106It is a).Consideration convey
48h after dye extracts cell genomic dna using cell/tissue genome DNA extracting reagent kit.
Using the DNA of said extracted as template, amplification includes the LDLR gene of LDLR1-gRNA binding site, and amplimer is such as
The following table 5 recycles about 850bp PCR product.Amplification condition is as follows: initial denaturation 98 DEG C of 3min, 98 DEG C of 10s, 63 DEG C of 15s, and 72 DEG C
40s, 33 72 DEG C of 5min of circulation are re-extended.
Table 5, LDLR amplimer
The U6-sgRNA-LDLR2 and Cas9 for obtaining step 1 according to the method for the nuclear transfection in 1 step 2 of embodiment
Each 5 μ g of expression vector (Addgene product, article No. #44758) transfects porcine fetus fibroblasts (about 1 × 106It is a).Consideration convey
48h after dye extracts cell genomic dna using cell/tissue genome DNA extracting reagent kit.Utilize LDLR-F and LDLR-R
PCR amplification is carried out, amplification condition is same as above.
Sequencing result such as Fig. 3 shows that transfection U6-sgRNA-LDLR1 starts to occur in cas9 nucleic acid cleavage sites downstream
It covers peak (A in Fig. 3), it was demonstrated that this Success in Experiment cuts pig LDLR gene.GRNA binding site and PAM sequence are as schemed
Show, set peak shows that the site there are multiple base types.Wherein U6-sgRNA-LDLR2 set peak is almost invisible, B in Fig. 3.
Above-mentioned PCR product is recycled, is connected respectively with PMD-18T carrier (precious bioengineering (Dalian) Co., Ltd, D101A)
After convert Escherichia coli, 40 clones of every group of picking are sequenced, according to positive colony number calculate mutation efficiency, transfect U6-
The average mutation rate of sgRNA-LDLR1 is 26.7%, and the average mutation rate for transfecting U6-sgRNA-LDLR2 is 9.7%.
Three, clonality and clonal mutation type analysis
In triplicate, repeating experiment every time, specific step is as follows for experiment:
The U6-sgRNA-LDLR1 or U6- for obtaining step 1 according to the method for the nuclear transfection in 1 step 2 of embodiment
SgRNA-LDLR2 and Cas9 expression vector transfect porcine fetus fibroblasts, after nuclear transfection for 24 hours, 1 μ g/mL puromycin are added
It handles, is digested after 36h with 0.1% pancreatin, collect cell, be inoculated into (1 × 10 in 3 100mm Tissue Culture Dish4A/ware), carefully
Contain DMEM culture medium (Thermo Fisher Scientific) in born of the same parents' culture dish, is formed to monoclonal within culture 15 days, every two
Its replacement fresh culture.Picking monoclonal cell extracts monoclonal genome, expands ApoE gene and (PCR amplification item is sequenced
The same step 2 of part).
Mutation type analysis (Fig. 4) is done to the monoclonal of picking, occurs single base near cas9 cleavage site and is inserted into, is more
Base insertion, single base are deleted and polybase base deletes four kinds of mutation types.The identification sequence of underscore signal gRNA or gRNA in figure
It is listed in the position in LDLR gene, alignment's figure shows detailed mutation type situation, and wherein first trip sequence is wild type
LDLR gene order.
Table 6 averagely knocks out efficiency
| Title | Monoallelic knocks out efficiency | Diallele knocks out efficiency | Efficiency is knocked out to amount to |
| LDLR1 | 19% | 31% | 50% |
| LDLR2 | 32% | 14% | 46% |
The results show that LDLR1-gRNA of the invention and LDLR2-gRNA can be shown outside efficient identification pig LDLR gene second
Son realizes accurate cutting under CAS9 enzyme effect, and wherein CAS9/U6-sgRNA-LDLR1 system averagely edits pig LDLR gene
Efficiency be 50% (ratio of the LDLR gene total monoclonal number of monoclonal Zhan to be edited i.e. on two chromosomes of pig cell with
The sum of the ratio of the total monoclonal number of LDLR gene monoclonal Zhan to be edited on item chromosome), wherein average list equipotential base
Because editorial efficiency (only has the LDLR gene total monoclonal of monoclonal Zhan to be edited on item chromosome for 19% i.e. in pig cell
Several ratio (genotype LDLR-/+)), average diallele editorial efficiency is 31% (two chromosomes i.e. in pig cell
On the LDLR gene total monoclonal number of monoclonal Zhan to be edited ratio (genotype LDLR-/-))；CAS9/U6-
SgRNA-LDLR2 system is averaged editorial efficiency to pig LDLR gene as 46% (the LDLR gene i.e. on two chromosomes of pig cell
LDLR gene monoclonal Zhan to be edited in the ratio and item chromosome of the total monoclonal number of monoclonal Zhan to be edited is total
The sum of the ratio of monoclonal number), wherein average monoallelic editorial efficiency is a 32% (only dyeing i.e. in pig cell
The ratio of the total monoclonal number of LDLR gene monoclonal Zhan to be edited on body), average diallele editorial efficiency is 14%
(ratio of the total monoclonal number of monoclonal Zhan to be edited of the LDLR gene on two chromosomes i.e. in pig cell).It makes simultaneously
A large amount of gene mutation type has been made, experiment basis is provided to the mutation and functional analysis of pig LDLR gene for the later period.
The rite-directed mutagenesis of embodiment 3, ApoE gene and LDLR gene
The present embodiment is using the ApoE-gRNA of embodiment 1 and the LDLR1-gRNA or LDLR2-gRNA of embodiment 2 to ApoE
Gene and LDLR gene carry out rite-directed mutagenesis simultaneously.In triplicate, repeating experiment every time, specific step is as follows for experiment:
One, porcine fetus fibroblasts and verifying are transfected
Using the method for nuclear transfection by the U6-sgRNA- of U6-sgRNA-ApoE2 (2.5 μ g) and embodiment 2 of embodiment 1
LDLR1 (2.5 μ g) mixing after respectively with 5 μ g Cas9 expression vector (Addgene product, article No. #44758) cotransfection pig tires
Youngster fibroblast (about 1 × 106It is a), nuclear transfection is operated in strict accordance with kit and consideration convey instrument specification, selects T-016 journey
Sequence.48h after nuclear transfection extracts cytogene using cell/tissue genome DNA extracting reagent kit (bioteke, DP1901)
Obtained genome is named as genome 1 by group.
According to the method described above, U6-sgRNA-LDLR1 is replaced with into U6-sgRNA-LDLR2, other steps are constant, obtain thin
Obtained genome is named as genome 2 by born of the same parents' genome.
Using embodiment 1 ApoE-F and ApoE-R and embodiment 2 LDLR-F and LDLR-R respectively to genome 1 with
Genome 2 carries out PCR amplification, and condition is the same as embodiment 1 and embodiment 2.The progress of about 698bp and 850bp PCR product is separately recovered
Sequencing.
Sequencing result such as Fig. 5 is shown, transfects U6-sgRNA-ApoE2/U6-sgRNA-LDLR1 in cas9 nuclease cleavage
Point downstream, APOE gene and LDLR gene occur covering peak (A and B in Fig. 5), it was demonstrated that this Success in Experiment to pig APOE gene and
LDLR gene carries out fixed point cutting, gRNA binding site and PAM sequence as shown, set peak shows that there are multiple base classes in the site
Type.The set peak for transfecting LDLR gene in U6-sgRNA-ApoE2/U6-sgRNA-LDLR2 is almost invisible, C and D in Fig. 5.
Two, clonality and clonal mutation type analysis
Using the method for nuclear transfection by the U6-sgRNA- of U6-sgRNA-ApoE2 (2.5 μ g) and embodiment 2 of embodiment 1
LDLR1 (2.5 μ g) mixing after respectively with 5 μ g Cas9 expression vector (Addgene product, article No. #44758) cotransfection pig tires
Youngster fibroblast, nuclear transfection are operated in strict accordance with kit and consideration convey instrument specification, select T-016 program.After nuclear transfection
For 24 hours, the processing of 1 μ g/mL puromycin is added, is digested after 36h with 0.1% pancreatin, collects cell, collect cell, be inoculated into 3
(1 × 10 in 100mm Tissue Culture Dish4A/ware), DMEM culture medium (Thermo Fisher is contained in Tissue Culture Dish
Scientific), cultivate 15 days and formed to monoclonal, every two days replacement fresh cultures.Picking monoclonal cell extracts Dan Ke
Grand genome carries out PCR amplification, item using the ApoE-F and ApoE-R of embodiment 1 and the LDLR-F and LDLR-R of embodiment 2
Part is the same as embodiment 1 and embodiment 2.
According to the method described above, U6-sgRNA-LDLR1 is replaced with into U6-sgRNA-LDLR2, other are constant, to transfection
Obtained monoclonal cell is detected.
Mutation type analysis (Fig. 6) is done to the monoclonal of picking, occurs single base near cas9 cleavage site and is inserted into, is more
Base insertion, single base are deleted and polybase base deletes four kinds of mutation types.In figure underscore signal gRNA sequence in APOE and
Position in LDLR gene, alignment's figure show detailed mutation type situation, and wherein first trip sequence is that corresponding gene is wild
Type sequence.
The results show that gRNA energy of the present invention while efficient identification pig APOE and LDLR gene Second Exon,
Accurate cutting is realized under CAS9 enzyme effect, wherein CAS9/U6-sgRNA-ApoE2/U6-sgRNA-LDLR1 system is to pig APOE/
It is 31% (i.e. on two chromosomes of pig cell that two genes of LDLR, which are completed at the same time the diallele editorial efficiency of editor,
APOE gene be edited to and two chromosomes on LDLR gene efficiency (genotype APOE to be edited-/-/
LDLR-/-))；CAS9/U6-sgRNA-ApoE2/U6-sgRNA-LDLR2 system double equipotential bases average to pig APOE/LDLR gene
Because editorial efficiency is 14% (genotype APOE-/-/LDLR-/-).The LDLR gene for carrying various mutations type is obtained simultaneously
The cell being mutated with APOE gene provides experiment to the mutation of pig APOE gene/LDLR gene and functional analysis for the later period
Basis.
Claims (4)
1. the method for rite-directed mutagenesis ApoE gene and LDLR gene, special to carry out rite-directed mutagenesis using CRISPR/Cas9 method
Sign is: ApoE gene target sequence used in the CRISPR/Cas9 method is the nucleotide sequence of sequence 1 in sequence table；
LDLR gene target sequence used in the CRISPR/Cas9 method is the nucleotide sequence of sequence 3 in sequence table；
The method of the rite-directed mutagenesis ApoE gene and LDLR gene, including targeting ApoE gene is imported into receptor cell
Encoding gene, the encoding gene of the gRNA of targeting LDLR gene target sequence and the encoding gene of Cas9 of the gRNA of target sequence, obtains
To ApoE gene and LDLR gene by the zooblast of rite-directed mutagenesis；
The sequence of the gRNA of the targeting ApoE gene target sequence is that the T in sequence table in sequence 2 is replaced with the sequence that U is obtained
Column；The encoding gene of the gRNA of the targeting ApoE gene target sequence is DNA molecular shown in sequence 2 in sequence table；The target
Sequence to the gRNA of LDLR gene target sequence is that the T in sequence table in sequence 5 is replaced with the sequence that U is obtained；
The encoding gene of the gRNA of the targeting LDLR gene target sequence is DNA molecular shown in sequence 5 in sequence table；
The receptor cell is pig cell.
2. according to the method described in claim 1, it is characterized by: the coding base of the gRNA of the targeting ApoE gene target sequence
Because being imported in the receptor cell by expression vector 1, the expression vector 1 is to contain the targeting ApoE gene target sequence
The expression vector of the expression cassette of the encoding gene of the gRNA of column；
The encoding gene of the gRNA of the targeting LDLR gene target sequence imports the receptor cell by expression vector 3
In, the expression vector 3 is that the expression of the expression cassette of the encoding gene of the gRNA containing the targeting LDLR gene target sequence carries
Body；
The encoding gene of the Cas9 is imported in the receptor cell by expression vector 2, the expression vector 2 be containing
The expression vector of the expression cassette of the encoding gene of the Cas9.
3. the reagent set of rite-directed mutagenesis ApoE gene and LDLR gene, it is characterised in that: the reagent set include following P4,
Any one of any product of P5 or P7 and following M1-M3 composition；
P4, complete expression cassette, as the encoding gene containing the gRNA for targeting ApoE gene target sequence described in claims 1 or 2
Expression cassette and it is as claimed in claim 1 or 2 targeting LDLR gene target sequence gRNA encoding gene expression cassette form；
P5, encoding gene and the targeting LDLR containing the gRNA for targeting ApoE gene target sequence described in claims 1 or 2
The recombinant vector of the encoding gene of the gRNA of gene target sequence；
P7, the recombinant vector containing complete expression cassette described in P4；
The encoding gene of M1, Cas9；
The expression cassette of M2, encoding gene containing Cas9；
The expression vector of M3, encoding gene containing Cas9.
4. reagent set described in claim 3 is preparing the application in ApoE gene and LDLR site-directed point mutation animal model；
The animal is pig.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610756699.3A CN106244557B (en) | 2016-08-29 | 2016-08-29 | The method of rite-directed mutagenesis ApoE gene and LDLR gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610756699.3A CN106244557B (en) | 2016-08-29 | 2016-08-29 | The method of rite-directed mutagenesis ApoE gene and LDLR gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106244557A CN106244557A (en) | 2016-12-21 |
| CN106244557B true CN106244557B (en) | 2019-10-25 |
Family
ID=57596690
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610756699.3A Active CN106244557B (en) | 2016-08-29 | 2016-08-29 | The method of rite-directed mutagenesis ApoE gene and LDLR gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106244557B (en) |
Families Citing this family (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2017308889B2 (en) | 2016-08-09 | 2023-11-09 | President And Fellows Of Harvard College | Programmable Cas9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| KR20230125856A (en) * | 2016-12-23 | 2023-08-29 | 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 | Gene editing of pcsk9 |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| EP3592777A1 (en) | 2017-03-10 | 2020-01-15 | President and Fellows of Harvard College | Cytosine to guanine base editor |
| CN106987604B (en) * | 2017-03-29 | 2021-05-28 | 北京希诺谷生物科技有限公司 | Method for preparing atherosclerosis disease model dog |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| WO2019023680A1 (en) | 2017-07-28 | 2019-01-31 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (pace) |
| WO2019139645A2 (en) | 2017-08-30 | 2019-07-18 | President And Fellows Of Harvard College | High efficiency base editors comprising gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| CN107937345B (en) * | 2017-11-16 | 2019-01-29 | 山东蓝思种业股份有限公司 | A kind of fibroblastic method of pig for preparing while knocking out CD163 gene and CD13 gene |
| CA3130488A1 (en) | 2019-03-19 | 2020-09-24 | David R. Liu | Methods and compositions for editing nucleotide sequences |
| CN110178792B (en) * | 2019-05-07 | 2021-11-16 | 哈尔滨医科大学 | Method for constructing atherosclerosis vulnerable plaque mouse model |
| CN112813063A (en) * | 2019-11-15 | 2021-05-18 | 中国科学院分子细胞科学卓越创新中心 | Construction of animal model for lipid metabolism disorder and repair by AAV-CRISPR/CAS9 |
| GB2614813A (en) | 2020-05-08 | 2023-07-19 | Harvard College | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| CN116790604B (en) * | 2023-08-18 | 2023-10-27 | 成都中科奥格生物科技有限公司 | sgRNA and CRISPR/Cas9 vector as well as construction method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103388006A (en) * | 2013-07-26 | 2013-11-13 | 华东师范大学 | Method for constructing gene site-directed mutation |
-
2016
- 2016-08-29 CN CN201610756699.3A patent/CN106244557B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103388006A (en) * | 2013-07-26 | 2013-11-13 | 华东师范大学 | Method for constructing gene site-directed mutation |
Non-Patent Citations (3)
| Title |
|---|
| apoE基因对大白猪和长白猪产仔数的影响研究;房文宁等;《遗传育种》;20101231;第46卷(第15期);第1.3节以及表1 * |
| Effective gene targeting in rabbits using RNA-guided Cas9 nucleases;Yang等;《Journal of Molecular Cell Biology》;20141231;第97页左栏第3段,图1C * |
| 遗传与营养因素对猪LDLR 与SCD 基因表达的影响;蒋越等;《上海交通大学学报》;20100831;第28卷(第4期);第1.2节以及表2 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106244557A (en) | 2016-12-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106244557B (en) | The method of rite-directed mutagenesis ApoE gene and LDLR gene | |
| WO2017190664A1 (en) | Use of chemosynthetic crrna and modified crrna in crispr/cpf1 gene editing systems | |
| CN107099533A (en) | A kind of sgRNA targeting sequencings of special target pig IGFBP3 genes and application | |
| CN108285906B (en) | Construction method of site-specific integration exogenous DNA transgenic pig | |
| CN108707629A (en) | The preparation method of zebra fish notch1b gene mutation bodies | |
| CN106282230B (en) | The method of rite-directed mutagenesis LDLR gene | |
| CN106191113A (en) | A kind of preparation method of MC3R gene knock-out pig | |
| CN106414740A (en) | Method for specific knockout of swine SLA-3 gene using CRISPR-Cas9 specificity, and sgRNA used for specifically targeting sla-3 gene | |
| CN104531704A (en) | Method for knocking off animal FGF5 gene by using CRISPR-Cas9 system | |
| CN106636210B (en) | Transcription factor combines the method that induced fibroblast transdifferentiation is class interstitial glands | |
| CN106086031B (en) | Pig flesh chalone gene editing site and its application | |
| CN106244556B (en) | The method of rite-directed mutagenesis ApoE gene | |
| CN107365803A (en) | Exempt from the method that drug screening quickly obtains mouse Rosa26 Gene targeting foreign genes | |
| CN108949832A (en) | A kind of targeting vector and its application for knock-out pig GHR gene | |
| CN106148406B (en) | Pig ApoE gene knockout carrier and its construction method and application | |
| CN106754949B (en) | Pig flesh chalone gene editing site 864-883 and its application | |
| CN111484994B (en) | Method for specifically knocking out pig Fah and Rag2 double genes by CRISPR-Cas9 | |
| CN102876700B (en) | PiggyBac transposon mediated muscle specific expression A-FABP (adipocyte fatty acid binding protein) universal vector construction method | |
| CN108018315A (en) | A kind of application of separated gene order in the blue or green Medaka albefaction strain of Japan is prepared | |
| CN104894255B (en) | A kind of method and its application detecting inefficient genome editor based on polyacrylamide gel electrophoresis | |
| CN109055379B (en) | Preparation method of transgenic chicken oviduct bioreactor | |
| US20220364072A1 (en) | Fusion protein that improves gene editing efficiency and application thereof | |
| CN110819592A (en) | Universal donor stem cell and preparation method thereof | |
| CN111088253A (en) | CRISPR (clustered regularly interspaced short palindromic repeats) single-base donor repair system for HBB-28 thalassemia gene | |
| WO2022012512A1 (en) | Grna for knocking out pig xenoantigen gene, and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20210507 Address after: Building A8, phase I, Nanning ASEAN enterprise headquarters port, No.10, Xinji Road, high tech Zone, Nanning, Guangxi 530000 Patentee after: Nanning zhuangbo Biotechnology Co.,Ltd. Address before: 100193 No. 2 Old Summer Palace West Road, Beijing, Haidian District Patentee before: Beijing Institute of Animal Science and Veterinary Medicine, Chinese Academy of Agricultural Sciences |