CN107937345B - A kind of fibroblastic method of pig for preparing while knocking out CD163 gene and CD13 gene - Google Patents
A kind of fibroblastic method of pig for preparing while knocking out CD163 gene and CD13 gene Download PDFInfo
- Publication number
- CN107937345B CN107937345B CN201711138478.0A CN201711138478A CN107937345B CN 107937345 B CN107937345 B CN 107937345B CN 201711138478 A CN201711138478 A CN 201711138478A CN 107937345 B CN107937345 B CN 107937345B
- Authority
- CN
- China
- Prior art keywords
- gene
- carrier
- seq
- pig
- gene knockout
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
- C12N5/0656—Adult fibroblasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/873—Techniques for producing new embryos, e.g. nuclear transfer, manipulation of totipotent cells or production of chimeric embryos
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
Abstract
The present invention provides a kind of dual-gene knockout carrier system, the carrier system includes CD163 gene knockout carrier and CD13 gene knockout carrier, wherein: the CD163 gene knockout carrier includes gene editing carrier framework and the section of DNA segment being connected on the carrier framework, and the nucleotide sequence of the DNA fragmentation is as shown in SEQ ID any one of NO:1-3;The CD13 gene knockout carrier includes gene editing carrier framework and the section of DNA segment being connected on the carrier framework, and the nucleotide sequence of the DNA fragmentation is as shown in SEQ ID any one of NO:4-6;The carrier framework of the CD163 gene knockout carrier and the CD13 gene knockout carrier is selected from CRISPR/Cas9, CRISPR/Cas9n, CRISPR/Cpf1 or CRISPR/C2c2.It can simply, fast and efficiently be pinpointed by above-mentioned carrier system while knock out CD163 gene and CD13 gene.
Description
Technical field
The present invention relates to gene editing field, prepares in particular to a kind of while knocking out CD163 gene and CD13 base
The fibroblastic method of the pig of cause.
Background technique
Pig reproduction and respiration syndrome (porcine reproductive and respiratory syndrome,
It PRRS is) by pig reproduction and breath syndrome virus (porcine reproductive and respiratory syndrome
Virus, PRRSV) it is caused with pig anorexia, fever, pregnant sow premature labor, late abortion, stillborn foetus, weak tire and the mummification of fetus etc. are numerous
The respiratory disease and height death for growing obstacle and piglet and grower pigs are that a kind of high degree in contact of main feature infects
Disease.Because the disease clinically shows as ear skin cyanosis, so being otherwise known as " blue otopathy ".The disease is in 1987 for the first time in beauty
State is found, and and then breaks out in 1989 in Europe, in China's Mainland the first explosion at the bottom of nineteen ninety-five, the infection rate of swinery is up to
90%, great economic loss is brought to pig breeding industry, it has also become a kind of infectious disease for seriously endangering pig breeding industry in world wide.
Porcine alveolar macrophage (the porcine alveolar of PRRSV main infection well differentiated in vivo
Macrophages, PAM).PRRSV infect target cell prerequisite be with host cell adsorb, and host cell surface by
Body is that this adsorption process of completion is essential.The study found that Heparan sulfate (Heparin Sulphate, HS), saliva
Plain (Sialoadhesin, Sn) and CD163 (the Cluster of Differentiation 163) molecule of liquid acid adhesion is on PAM
It is existing can three important acceptor molecules in conjunction with PRRSV.Wherein, CD163 be a kind of street cleaner rich in cysteine by
Body, is typical I type glycosylation albumen and a kind of antigen of macrophage differentiation, molecular size are 130kD, Gu claimed again
For M130 albumen.CD163 is initially that the specificity of macrophage and monocyte is used as to identify what protein was realized, lung,
Spleen, liver, aggregate nodules and thymic tissue macrophage in have expression.Some researches show that in the non-permissive cell of PRRSV
Transfection expression CD163 molecule can make these cell lines infection PRRSV and generate son in the cell in system (BHK-21 and PK-15)
For virion, the antibody of anti-human CD163 can block the infection of PRRSV, show that CD163 is the required receptor of the virus.
CD163 protein structure domain SRCR5 is necessary to virus infected cell, and 4 SRCR and cytoplasmic tail right and wrong of aminoterminal must
It needs, wherein SRCR5 structural domain is exactly as coded by the 7th exon of CD163.Therefore, research CD163 gene modification pig can be
Whether CD163 receptor is that key player during PRRSV infection provides indispensable evidence.
Pig epidemic diarrhea (porcine epidemic diarrhea, PED) is one kind by Porcine epidemic diarrhea virus
Intestines problem highly infectious caused by (porcine epidemic diarrhea virus, PEDV).The pig at any age is equal
It can infect, especially serious on piglet influence, case fatality rate is very high, effectively female lacking especially for the newborn piglet in 7 ages in days
Under the antibody of source, the death rate may be up to 100%;For the farrowing sow of adult, reproductive performance is affected after infection, is such as pregnant
It will appear miscarriage after the sow infection of early stage, pregnancy rate reduces;Weight loss after growing and fattening pigs infection.
Recent studies have shown that PEDV with the CD13 (APN) in intestinal mucosa epithelial cell mainly by combining infection young
Pig.CD13 is significant as the necessary bind receptor of PEDV intrusion cell, this is the new varieties of anti-epidemic diarrhea virus pig
It cultivates and new approaches is provided, i.e., prevent infection of the PEDV to pig by the APN gene of knock-out pig.
Therefore, establish it is a kind of can quickly, the accurately and efficiently method of knock-out pig CD163 gene and CD13 gene simultaneously,
The pig fibroblast or pig for obtaining knock-out pig CD163 gene and CD13 gene are in research pig blue-ear disease and pig prevalence diarrhea diarrhea
And have great importance in terms of disease-resistant pig breeding.
In view of this, the present invention is specifically proposed.
Summary of the invention
The first object of the present invention is to provide a kind of dual-gene knockout carrier system, the gene knockout carrier system packet
CD163 gene knockout carrier and CD13 gene knockout carrier are included, can simply, fast and efficiently be determined by above-mentioned carrier system
Point knocks out CD163 gene and CD13 gene.
The second object of the present invention is to provide a kind of pig for preparing while knocking out CD163 gene and CD13 gene into fiber
The method of cell, by the method can simply, fast and efficiently obtain CD163 gene and CD13 gene pure knock out and
The pig fibroblast for not carrying any exogenous marker, to research pig blue-ear disease, pig epidemic diarrhea and the breeding for disease resistance of pig
It is of great significance.
The third object of the present invention, which is to provide, knocks out CD163 gene and CD13 while being prepared according to the above method
The pig fibroblast of gene, pig fibroblast homozygous knockout CD163 and the CD13 gene and does not carry exogenous marker, right
Research pig blue-ear disease, pig epidemic diarrhea and the breeding for disease resistance of pig are of great significance.
The fourth object of the present invention is to provide a kind of gene editing prepared while knocking out CD163 gene and CD13 gene
The method of pig can simply and efficiently obtain CD163 gene by this method and CD13 gene pure knocks out gene editing pig,
It is of great significance to research pig blue-ear disease, pig epidemic diarrhea and the breeding for disease resistance of pig.
In order to realize above-mentioned purpose of the invention, the following technical scheme is adopted:
A kind of dual-gene knockout carrier system, the carrier system include CD163 gene knockout carrier and CD13 clpp gene
Except carrier, in which:
The CD163 gene knockout carrier includes gene editing carrier framework and be connected on the carrier framework one section
DNA fragmentation, the nucleotide sequence of the DNA fragmentation is as shown in SEQ ID any one of NO:1-3, it is preferable that such as SEQ ID NO:1
It is shown;
The CD13 gene knockout carrier includes gene editing carrier framework and be connected on the carrier framework one section
DNA fragmentation, the nucleotide sequence of the DNA fragmentation is as shown in SEQ ID any one of NO:4-6, it is preferable that such as SEQ ID NO:4
It is shown;
The carrier framework of the CD163 gene knockout carrier and the CD13 gene knockout carrier be selected from CRISPR/Cas9,
CRISPR/Cas9n, CRISPR/Cpf1 or CRISPR/C2c2.
Traditional gene knockout system mainly based on ZFN and TALEN technology, is needed through complicated operation and flower
Expense great effort could knock out target gene.And said gene knockout carrier of the present invention belongs to CRISPR gene editing system, benefit
Fixed point knockout is carried out to target gene with CRISPR technology, significantly reduces the operation difficulty of gene knockout on the whole, is improved
The efficiency knocked out;Meanwhile the present invention realizes dual-gene editor and no introducing exogenous marker gene, tool by once-through operation
Efficient advantage high, accuracy is high, easy to operate and highly-safe.Still further aspect, the present invention to for CD163 gene and
The target sequence gRNA of CD13 gene knockout is optimized, and screening, which obtains, from a plurality of target sequence knocks out the highest target sequence of efficiency
Column, overcome CRISPR gene editing system high defect of off-target rate during knockout, further increase the efficiency of target practice, from
And it can be quickly obtained the homozygote for knocking out target gene CD163 gene and CD13 gene in a short time.
In some embodiments, the carrier bone of the CD163 gene knockout carrier and the CD13 gene knockout carrier
Frame is CRISPR/Cas9, it is preferable that the CRISPR/Cas9 be selected from pX330, pX260, pX334, pX335, pX458,
PX459, pX461, pX462, pX551 and pX552, it is highly preferred that the CRISPR/Cas9 is pX330.
The invention further relates to a kind of fibroblastic method of the pig for preparing while knocking out CD163 gene and CD13 gene,
The described method includes:
(1) above-mentioned dual-gene knockout carrier system is constructed;
(2) the gene knockout carrier system is transferred in pig fibroblast, identification obtain homozygous knockout CD163 and
The monoclonal cell of CD13 gene.
The above method of the present invention is established based on aforementioned gene knockout carrier, by the method can it is simple,
It fast and efficiently obtains CD163 gene and CD13 gene pure knocks out and do not carry the pig fibroblast of any exogenous marker,
It is of great significance to research pig blue-ear disease, pig epidemic diarrhea and the breeding for disease resistance of pig.
In some embodiments, the pig fibroblast is porcine fetus fibroblasts.
In some embodiments, the step (1) specifically includes: the complementary single-stranded annealing of oligonucleotides being formed double
Chain is connect with the carrier framework Jing Guo digestion, and screening obtains positive colony up to CD163 gene knockout carrier, described complementary
Shown in the single-stranded sequence of oligonucleotides perhaps SEQ ID NO:9-10 as shown in SEQ ID NO:7-8 or SEQ ID NO:
Shown in 11-12;The complementary single-stranded annealing of oligonucleotides is formed into double-strand, is connect with the carrier framework Jing Guo digestion, screening obtains
Positive colony is up to CD13 gene knockout carrier, the single-stranded sequence of the oligonucleotides of the complementation such as SEQ ID NO:13-14 institute
Show, perhaps as shown in SEQ ID NO:15-16 or as shown in SEQ ID NO:17-18.
In some embodiments, the step (2) specifically includes: by the CD13 gene knockout carrier and described
CD163 gene knockout carrier is transferred to pig fibroblast by way of electrotransfection, and it is thin to screen monoclonal by limiting dilution assay
Born of the same parents, and identify whether the monoclonal cell system is positive monoclonal cell that CD163 gene and CD13 gene pure knock out.
In some embodiments, it identifies and specifically includes described in step (2): extracting the genomic DNA of monoclonal cell,
Respectively using the primer as shown in SEQ ID NO:19-20 and SEQ ID NO:21-22 progress PCR amplification, and to amplified production into
Row sequencing determines whether the monoclonal cell is the positive that CD163 gene and CD13 gene pure knock out according to sequencing result
Monoclonal cell;Preferably, it is 60~62 DEG C by the annealing temperature of the PCR amplification of primer of SEQ ID NO:19-20, follows
Number of rings is 32~38, it is highly preferred that 61 DEG C, 36 circulations;Using SEQ ID NO:21-22 moving back as the PCR amplification of primer
Fiery temperature is 57~59 DEG C, and recurring number is 32~36, it is highly preferred that 58 DEG C, 34 circulations.
The invention further relates to the pigs of the CD163 gene being prepared according to the above method and CD13 gene knockout into fiber finer
Born of the same parents.The above-mentioned pig fibroblast of the present invention knocks out CD163 and CD13 gene homozygously, and does not carry exogenous marker gene, to grinding
Study carefully pig blue-ear disease, pig epidemic diarrhea and the breeding for disease resistance of pig to be of great significance.
The invention further relates to a kind of method of gene editing pig for preparing while knocking out CD163 gene and CD13 gene, institutes
Method is stated using above-mentioned pig fibroblast as nuclear transfer donor cell, its nuclear transplantation is entered into non-nucleus egg mother cell, is made
Standby recombinant clone embryo is simultaneously implanted into the gene editing for obtaining while knocking out CD163 gene and CD13 gene in parent through gestation
Pig.
The above method of the present invention based on the pig fibroblast of aforementioned CD163 gene knockout and CD13 gene knockout to build
It is vertical to form, the gene of CD163 gene knockout and CD13 homozygous knockout can quickly, be simply and efficiently obtained by the method
Pig is edited, is of great significance to research pig blue-ear disease, pig epidemic diarrhea and the breeding for disease resistance of pig.
In some embodiments, the method also includes identifying the gene editing pig, the mirror
Fixed step includes: to extract the genomic DNA of pig, uses nucleotide sequence such as SEQ ID NO:19-20 and SEQ ID NO:21-
Upstream and downstream primer shown in 22 expands the DNA genome of extraction, carries out agarose gel electrophoresis or survey to amplified production
Whether sequence determines the pig by CD163 gene and CD13 gene knockout, it is preferable that with SEQ according to electrophoresis or sequencing result
ID NO:19-20 is that the annealing temperature of the PCR amplification of primer is 60~62 DEG C, and recurring number is 32~38, it is highly preferred that 61
DEG C, 36 circulations;It is 57~59 DEG C by the annealing temperature of the PCR amplification of primer of SEQ ID NO:21-22, recurring number is
32~36, it is highly preferred that 58 DEG C, 34 circulations.
Compared with prior art, the invention has the benefit that
The present invention uses CRISPR gene editing system, and the DNA sequence dna as shown in SEQ ID NO:1-6 is as target position
Point constructs the carrier system of CD163 gene and CD13 gene, is to rely on to establish a kind of prepare together with the gene knockout carrier system
When knock out the pig fibroblast of CD163 gene and CD13 gene, gene editing pig method.Above-mentioned carrier system and method tool
Having reduces genetic manipulation difficulty, improves and knock out efficiency, in a short time quickly by the excellent of CD163 gene and CD13 gene knockout
Point.And pig fibroblast or the gene of the CD163 gene and CD13 gene knockout being prepared by above-mentioned carrier and method
Edit pig, CD163 gene and CD13 gene are homozygous knockout, and in the pig fibroblast or gene editing pig without
Exogenous marker can provide research platform for pig blue-ear disease and pig epidemic diarrhea, while have high Breeding value.
Detailed description of the invention
It, below will be to specific in order to illustrate more clearly of the specific embodiment of the invention or technical solution in the prior art
Embodiment or attached drawing needed to be used in the description of the prior art be briefly described, it should be apparent that, it is described below
Attached drawing is some embodiments of the present invention, for those of ordinary skill in the art, before not making the creative labor
It puts, is also possible to obtain other drawings based on these drawings.
Fig. 1 is pX330 carrier framework figure;
Fig. 2 is that part is dual-gene while knocking out the genotype of cell line.
Specific embodiment
Embodiment of the present invention is described in detail below in conjunction with embodiment, but those skilled in the art will
Understand, the following example is merely to illustrate the present invention, and is not construed as limiting the scope of the invention.It is not specified in embodiment specific
Condition person carries out according to conventional conditions or manufacturer's recommended conditions.Reagents or instruments used without specified manufacturer is
The conventional products that can be obtained by commercially available purchase.
Porcine fetus fibroblasts (porcine embryonic fibroblast, PEF) in following embodiments according to
Following method preparation: by 35 day Embryos of Large White, head, tail, four limbs, internal organ and the bone of fetus are removed, and blood is cleared up
Completely.It persistently shears fetus 30min guarantee with elbow eye scissors sufficiently to shred, by the blue electron gun head of the fetal tissue's haircut shredded
It is drawn in 15mL centrifuge tube, 5mL complete medium is added, removes solution above after several minutes of natural subsidence, and in lower layer's group
It knits and a few drop fetal calf serums is added in block, be sucked out with 15cm glass Pasteur's pipe curved at the 1cm of tip, be laid in two T75 cultures
In bottle, bottom of bottle is placed upward, and 15mL full nutrient solution is added in opposite side, and culture bottle is carefully turned over after 6-8h, tissue block is soaked
Enter in culture solution, changes a not good liquor within every two days, frozen after cell covers with T75 culture bottle spare.Wherein, Large White is Chinese agriculture
The pig of academy of sciences Beijing animal and veterinary research institute base pig farm raising.
Embodiment 1 targets the building of the CRISPR/Cas9 targeting vector of CD163 gene and CD13 gene
1, the exon of locking coding pig CD163 gene and the exon of CD13 gene first is target practice region, and utilization is soft
Part separately designs multiple gRNA for CD163 and CD13, i.e. target practice site.Wherein, it is respectively for the target practice site of CD163
CD163-gRNA1:ggaaacccaggctggttgga (SEQ ID NO:1);CD163-gRNA2:
Ggaggggacattccctgctc (SEQ ID NO:2) and CD163-gRNA3:ggtcgtgttgaagtacaaca (SEQ ID
NO:3).It is respectively as follows: CD13-gRNA1:gcatcctcctcggcgtgg (SEQ ID NO:4) for the target practice site of CD13;
CD13-gRNA2:caagggattctacatttcca (SEQ ID NO:5) and CD13-gRNA3:ttctacatttccaaggccct
(SEQ ID NO:6).
2, according to the oligonucleotide of above-mentioned gRNA sequent synthesis complementary pairing, as shown in the table, lowercase is digestion
Site.
The oligonucleotides of table 1 and gRNA sequence complementary pairing
3, the CRISPR/Cas9 targeting vector of building targeting CD163 gene and CD13 gene,
PX330 carrier framework is as shown in Figure 1.Specific construction method is as follows:
(1) 6 pairs of oligonucleotides for synthesizing table 1 handle 10min under the conditions of 98 DEG C respectively, after cooled to room temperature
It anneals;
(2) with restriction enzyme Bbs I to digestion under the conditions of 37 DEG C of the pX330 skeleton carrier containing Cas9 sequence
2h, gel extraction linearized fragment;
(3) after, by linearized fragment with annealing after oligonucleotide connect 1h at 16 DEG C, then conversion Top10 or
DH5 α competent cell is coated on the LB plated growth of the benzyl containing ammonia;
(4) picking single colonie, which expands, cultivates and is sequenced, sequencing primer U6-FWD.Sequence is correct, expands culture;
(5) method for going the big extraction reagent kit of endotoxin (EndoFree Plasmid Maxi Kit) to provide with plasmid is extracted
Plasmid, the plasmid mentioned are used for the transfection of cell.
Embodiment 2 knocks out the foundation of the Large White fetal fibroblast cell line of CD163 gene and CD13 gene simultaneously
1, cell transfecting
The day before transfection recovers primary Large White fetal fibroblast into 6cm plate, when cell reaches 70-80%
Cell transfecting can be carried out when convergence degree.Transfection procedure is in strict accordance with Basic Primary Fibroblasts
Nucleofector Kit (Lonza) kit specification is operated.
2, the detection of target practice efficiency
After cell culture 48h after electrotransfection, a part is used for bed board, in addition collection part cell, extracts cytogene
Group carries out PCR amplification, to detect target practice efficiency.The result shows that: the target practice efficiency of 3 gRNA of CD163 gene is respectively 9%,
5% and 4%;The target practice efficiency of 3 gRNA of CD13 gene is respectively 17%, 12% and 7%.Choose highest two gRNA of efficiency
Subsequent experimental is carried out, and the two carriers are respectively designated as pX330-CD163 and pX330-CD13.
Using the cellular genome of extraction as template, PCR, the pcr amplification primer are carried out with Pre mix Taq archaeal dna polymerase
Object is as follows:
Wherein the primer of CD163 gene is CD163-F:5 '-aagcccactgtaggcagaa-3 ' (SEQ ID BO:19)
And CD163-R:5 '-gtggtttccctcctgggg-3 ' (SEQ ID BO:20).Amplification condition is 95 DEG C, 5min;95 DEG C,
30s;61 DEG C, 30s;72 DEG C, 30s;72 DEG C, 10min;36 circulations, 2% agarose gel electrophoresis observe band.
Wherein the amplimer of CD13 gene is (the SEQ ID of CD13-F:5 ' tacccagttcagtgaccttcgtc 3 '
) and CD13-R:5 ' agaagaacaagaatgccgagca 3 ' (SEQ ID NO:22) BO:21.Amplification condition is 95 DEG C, 5min;
95 DEG C, 30s;58 DEG C, 30s;72 DEG C, 30s;72 DEG C, 10min;34 circulations, 2% agarose gel electrophoresis observe band.
3, the screening of positive monoclonal cell line
Electricity turns when cell confluency degree after 48h is about 90% or so with suitable density bed board, the primary culture of replacement in every 3 days
Liquid.Cell after bed board is about cultivated 10 days or so, it can be observed that the clone of suitable size puts to be formed.By monoclonal cell into
Row expands culture, while taking part cell for extracting genome identification genotype.
4, the identification of positive monoclonal cell line
The cell monoclonal of institute's picking is identified: using the cellular genome of extraction as template, with Pre mix Taq
Archaeal dna polymerase carries out PCR.
Wherein the amplified fragments of CD163 gene are 300bp, primer CD163-F:5 ' aagcccactgtaggcagaa 3 '
(SEQ ID NO:19) and CD163-R:5 ' gtggtttccctcctgggg 3 ' (SEQ ID NO:20).Amplification condition is 95 DEG C,
5min;95 DEG C, 30s;61 DEG C, 30s;72 DEG C, 30s;72 DEG C, 10min;36 circulations.
The target fragment that CD13 gene magnification goes out is 286bp, and primer is Forward primer:5 '
Tacccagttcagtgaccttcgtc 3 ' (SEQ ID NO:21) and Reverse primer:5 '
Agaagaacaagaatgccgagca 3 ' (SEQ ID NO:22).Amplification condition is 95 DEG C, 5min;95 DEG C, 30s;58 DEG C,
30s;72 DEG C, 30s;72 DEG C, 10min;34 circulations.
2% agarose gel electrophoresis observes band, and PCR product send Beijing Tian Yihuiyuan company to be sequenced, according to sequencing result,
Screen donorcells of the cell line dual-gene while that frameshift mutation occurs as nuclear transfer when.
5, experimental result
Sequencing result shows, we successfully obtain pig fetus that more plants of CD163 genes and CD13 gene all knock out at
Fibrocyte system, it is as shown in Figure 2 that part of diallele knocks out cell line genotype.
The method that 3 somatic cell nuclear transfer technique of embodiment prepared while knocking out the gene editing pig of CD163 and CD13 gene
It is female thin with the young pig ovum of maturation in vitro 40h using the positive cell that embodiment 2 obtains as nuclear transfer donor cell
Born of the same parents are nuclear transfer recipient cell, and nuclear transfer donor cell is moved into non-nucleus egg mother cell, through electro' asion and activation, are built into weight
Group clone embryos select the good clone recombination embryo of developmental condition with modus operandi immigration spontaneous estrus and are produced large white sow
Gestation is in utero carried out, modus operandi embryo transfer step is ventilator anesthesia, and maintains to anaesthetize with 2% chloraldurate, in hand
It lies on the back on art frame Baoding, ventrimeson does the operative incision for being about 10cm, exposes ovary, fallopian tubal and uterus to the open air, moved with embryo
It plants glass tube and enters about 5cm along fimbriae tubae portion, developmental condition is well cloned to recombination embryo and is transplanted to ampulla of uterine tube-
Isthmus junction.After embryo transfer, technical staff notices that observing it returns feelings situation, periodically uses B-type ultrasonography receptor sow
Pregnancy.
Experimental result: successfully obtaining while knocking out the gene editing pig of CD163 gene and CD13 gene.
Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention., rather than its limitations;To the greatest extent
Present invention has been described in detail with reference to the aforementioned embodiments for pipe, but those skilled in the art should understand that: its
It is still possible to modify the technical solutions described in the foregoing embodiments, or to some or all of the technical features
It is equivalently replaced;And these are modified or replaceed, various embodiments of the present invention skill that it does not separate the essence of the corresponding technical solution
The range of art scheme.
Sequence table
<110>Shandong Lan Sizhong industry limited liability company
<120>a kind of fibroblastic method of pig for preparing while knocking out CD163 gene and CD13 gene
<160> 22
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>artificial sequence ()
<400> 1
ggaaacccag gctggttgga 20
<210> 2
<211> 20
<212> DNA
<213>artificial sequence ()
<400> 2
ggaggggaca ttccctgctc 20
<210> 3
<211> 20
<212> DNA
<213>artificial sequence ()
<400> 3
ggtcgtgttg aagtacaaca 20
<210> 4
<211> 18
<212> DNA
<213>artificial sequence ()
<400> 4
gcatcctcct cggcgtgg 18
<210> 5
<211> 20
<212> DNA
<213>artificial sequence ()
<400> 5
caagggattc tacatttcca 20
<210> 6
<211> 20
<212> DNA
<213>artificial sequence ()
<400> 6
ttctacattt ccaaggccct 20
<210> 7
<211> 24
<212> DNA
<213>artificial sequence ()
<400> 7
caccggaaac ccaggctggt tgga 24
<210> 8
<211> 24
<212> DNA
<213>artificial sequence ()
<400> 8
aaactccaac cagcctgggt ttcc 24
<210> 9
<211> 24
<212> DNA
<213>artificial sequence ()
<400> 9
caccggaggg gacattccct gctc 24
<210> 10
<211> 24
<212> DNA
<213>artificial sequence ()
<400> 10
aaacgagcag ggaatgtccc ctcc 24
<210> 11
<211> 24
<212> DNA
<213>artificial sequence ()
<400> 11
caccggtcgt gttgaagtac aaca 24
<210> 12
<211> 24
<212> DNA
<213>artificial sequence ()
<400> 12
aaactgttgt acttcaacac gacc 24
<210> 13
<211> 22
<212> DNA
<213>artificial sequence ()
<400> 13
caccgcatcc tcctcggcgt gg 22
<210> 14
<211> 22
<212> DNA
<213>artificial sequence ()
<400> 14
aaacccacgc cgaggaggat gc 22
<210> 15
<211> 24
<212> DNA
<213>artificial sequence ()
<400> 15
cacccaaggg attctacatt tcca 24
<210> 16
<211> 24
<212> DNA
<213>artificial sequence ()
<400> 16
aaactggaaa tgtagaatcc cttg 24
<210> 17
<211> 24
<212> DNA
<213>artificial sequence ()
<400> 17
caccttctac atttccaagg ccct 24
<210> 18
<211> 24
<212> DNA
<213>artificial sequence ()
<400> 18
aaacagggcc ttggaaatgt agaa 24
<210> 19
<211> 19
<212> DNA
<213>artificial sequence ()
<400> 19
aagcccactg taggcagaa 19
<210> 20
<211> 18
<212> DNA
<213>artificial sequence ()
<400> 20
gtggtttccc tcctgggg 18
<210> 21
<211> 23
<212> DNA
<213>artificial sequence ()
<400> 21
tacccagttc agtgaccttc gtc 23
<210> 22
<211> 22
<212> DNA
<213>artificial sequence ()
<400> 22
agaagaacaa gaatgccgag ca 22
Claims (10)
1. a kind of dual-gene knockout carrier system, which is characterized in that the carrier system include CD163 gene knockout carrier and
CD13 gene knockout carrier, in which:
The CD163 gene knockout carrier includes gene editing carrier framework and the section of DNA that is connected on the carrier framework
Segment, the nucleotide sequence of the DNA fragmentation is as shown in SEQ ID NO:1;
The CD13 gene knockout carrier includes gene editing carrier framework and the section of DNA piece being connected on the carrier framework
Section, the nucleotide sequence of the DNA fragmentation is as shown in SEQ ID NO:4;
The carrier framework of the CD163 gene knockout carrier and the CD13 gene knockout carrier is CRISPR/Cas9.
2. carrier system according to claim 1, which is characterized in that the CRISPR/Cas9 be selected from pX330, pX260,
PX334, pX335, pX458, pX459, pX461, pX462, pX551 and pX552.
3. carrier system according to claim 2, which is characterized in that the CRISPR/Cas9 is pX330.
4. a kind of fibroblastic method of pig for preparing while knocking out CD163 gene and CD13 gene, which is characterized in that described
Method includes:
(1) any one of building claim 1 ~ 3 dual-gene knockout carrier system;
(2) the gene knockout carrier system is transferred in pig fibroblast, by screening and identifying acquisition homozygous knockout
The monoclonal cell of CD163 gene and CD13 gene.
5. according to the method described in claim 4, it is characterized in that, the pig fibroblast is porcine fetus fibroblasts.
6. according to the method described in claim 4, it is characterized in that, the step (1) specifically includes: by complementary oligonucleotides
Single-stranded annealing forms double-strand, connect with the carrier framework Jing Guo digestion, and screening obtains positive colony up to CD163 gene knockout load
Body, the single-stranded sequence of the oligonucleotides of the complementation is as shown in SEQ ID NO:7-8;By the complementary single-stranded annealing shape of oligonucleotides
It at double-strand, is connect with the carrier framework Jing Guo digestion, screening obtains positive colony up to CD13 gene knockout carrier, the complementation
The single-stranded sequence of oligonucleotides as shown in SEQ ID NO:13-14.
7. according to the method described in claim 4, it is characterized in that, the step (2) specifically includes: by the CD13 clpp gene
Except carrier and the CD163 gene knockout carrier are transferred to pig fibroblast by way of electrotransfection, pass through limiting dilution assay
Monoclonal cell is screened, and identifies whether the monoclonal cell system is the positive that CD163 gene and CD13 gene pure knock out
Monoclonal cell.
8. according to the method described in claim 4, being specifically included it is characterized in that, being identified described in step (2): extracting monoclonal
The genomic DNA of cell carries out PCR expansion using the primer as shown in SEQ ID NO:19-20 and SEQ ID NO:21-22 respectively
Increase, and amplified production is sequenced, determines whether the monoclonal cell is CD163 gene and CD13 base according to sequencing result
Because of the positive monoclonal cell of homozygous knockout.
9. according to the method described in claim 8, it is characterized in that, in step (2), using SEQ ID NO:19-20 as primer
The annealing temperature of the PCR amplification is 60 ~ 62 DEG C, and recurring number is 32 ~ 38;Using SEQ ID NO:21-22 as the PCR of primer
The annealing temperature of amplification is 57 ~ 59 DEG C, and recurring number is 32 ~ 36.
10. according to the method described in claim 9, it is characterized in that, in step (2), using SEQ ID NO:19-20 as primer
The annealing temperature of the PCR amplification is 61 DEG C, recurring number 36;Using SEQ ID NO:21-22 as the PCR amplification of primer
Annealing temperature is 58 DEG C, recurring number 34.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201711138478.0A CN107937345B (en) | 2017-11-16 | 2017-11-16 | A kind of fibroblastic method of pig for preparing while knocking out CD163 gene and CD13 gene |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201711138478.0A CN107937345B (en) | 2017-11-16 | 2017-11-16 | A kind of fibroblastic method of pig for preparing while knocking out CD163 gene and CD13 gene |
Publications (2)
Publication Number | Publication Date |
---|---|
CN107937345A CN107937345A (en) | 2018-04-20 |
CN107937345B true CN107937345B (en) | 2019-01-29 |
Family
ID=61932599
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201711138478.0A Active CN107937345B (en) | 2017-11-16 | 2017-11-16 | A kind of fibroblastic method of pig for preparing while knocking out CD163 gene and CD13 gene |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107937345B (en) |
Families Citing this family (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AU2019257776A1 (en) * | 2018-04-27 | 2020-10-22 | The Curators Of The University Of Missouri | Pathogen-resistant animals having modified aminopeptidase N (ANPEP) genes |
CN110257381B (en) * | 2019-07-22 | 2020-12-15 | 中国农业科学院北京畜牧兽医研究所 | Complete sgRNA for specifically recognizing porcine CD13 gene, and coding DNA, kit and application thereof |
CN110438155A (en) * | 2019-08-15 | 2019-11-12 | 中国农业科学院北京畜牧兽医研究所 | Modify composition, application, cell and the preparation method of gene editing pig of the 561st amino acids of CD163 gene |
CN111172191B (en) * | 2020-02-21 | 2020-12-22 | 浙江大学 | Efficient gene knockout vector and application thereof |
CN112094866B (en) * | 2020-11-10 | 2021-05-11 | 北京首农未来生物科技有限公司 | Method for preparing CD163 gene editing pig by using SpRY-Cas9 system |
CN112795566B (en) * | 2020-12-08 | 2023-03-17 | 南京启真基因工程有限公司 | OPG gene editing system for constructing osteoporosis clone pig nuclear donor cell line and application thereof |
CN112680444B (en) * | 2020-12-16 | 2023-07-21 | 南京启真基因工程有限公司 | CRISPR system for OCA2 gene mutation and application thereof in construction of albino clone pig nuclear donor cells |
CN113403337A (en) * | 2021-05-13 | 2021-09-17 | 温氏食品集团股份有限公司 | Carrier system, method for preparing pig fibroblast and gene editing pig |
CN114774468B (en) * | 2022-04-20 | 2022-12-20 | 温氏食品集团股份有限公司 | Allele molecular marker and anti-blue-ear-disease pig group construction method |
Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103687482A (en) * | 2011-05-16 | 2014-03-26 | 密苏里大学管理者 | Porcine reproductive and respiratory syndrome virus resistant animals |
CN104593422A (en) * | 2015-01-08 | 2015-05-06 | 中国农业大学 | Method of cloning reproductive and respiratory syndrome resisting pig |
CN105132427A (en) * | 2015-09-21 | 2015-12-09 | 新疆畜牧科学院生物技术研究所 | Method for acquiring gene editing sheep by RNA-mediated specific double-gene knockout and special sgRNA for method |
WO2016197355A1 (en) * | 2015-06-11 | 2016-12-15 | 深圳市第二人民医院 | Crispr-cas9 method for specific knockout of swine sall1 gene and sgrna for use in targeting specifically sall1 gene |
CN106244557A (en) * | 2016-08-29 | 2016-12-21 | 中国农业科学院北京畜牧兽医研究所 | Rite-directed mutagenesis ApoE gene and the method for LDLR gene |
CN107034218A (en) * | 2017-06-07 | 2017-08-11 | 浙江大学 | Targeting sgRNA, modification carrier for pig APN gene editings and its preparation method and application |
CN107177595A (en) * | 2017-06-07 | 2017-09-19 | 浙江大学 | Targeting sgRNA, modification carrier for pig CD163 gene editings and its preparation method and application |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US10091975B2 (en) * | 2015-08-06 | 2018-10-09 | The Curators Of The University Of Missouri | Pathogen-resistant animals having modified CD163 genes |
-
2017
- 2017-11-16 CN CN201711138478.0A patent/CN107937345B/en active Active
Patent Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103687482A (en) * | 2011-05-16 | 2014-03-26 | 密苏里大学管理者 | Porcine reproductive and respiratory syndrome virus resistant animals |
CN104593422A (en) * | 2015-01-08 | 2015-05-06 | 中国农业大学 | Method of cloning reproductive and respiratory syndrome resisting pig |
WO2016197355A1 (en) * | 2015-06-11 | 2016-12-15 | 深圳市第二人民医院 | Crispr-cas9 method for specific knockout of swine sall1 gene and sgrna for use in targeting specifically sall1 gene |
CN105132427A (en) * | 2015-09-21 | 2015-12-09 | 新疆畜牧科学院生物技术研究所 | Method for acquiring gene editing sheep by RNA-mediated specific double-gene knockout and special sgRNA for method |
CN106244557A (en) * | 2016-08-29 | 2016-12-21 | 中国农业科学院北京畜牧兽医研究所 | Rite-directed mutagenesis ApoE gene and the method for LDLR gene |
CN107034218A (en) * | 2017-06-07 | 2017-08-11 | 浙江大学 | Targeting sgRNA, modification carrier for pig APN gene editings and its preparation method and application |
CN107177595A (en) * | 2017-06-07 | 2017-09-19 | 浙江大学 | Targeting sgRNA, modification carrier for pig CD163 gene editings and its preparation method and application |
Non-Patent Citations (1)
Title |
---|
rational design of highly active sgrNAs for CrIsPr-Cas9–mediated gene inactivation;John G Doench,et al.;《nature biotechnology》;20140903;第32卷(第12期);第1262-1269页 |
Also Published As
Publication number | Publication date |
---|---|
CN107937345A (en) | 2018-04-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN107937345B (en) | A kind of fibroblastic method of pig for preparing while knocking out CD163 gene and CD13 gene | |
CN105821049B (en) | A kind of preparation method of Fbxo40 gene knock-out pig | |
CN107043787B (en) | A kind of construction method and application that MARF1 rite-directed mutagenesis mouse models are obtained based on CRISPR/Cas9 | |
CN108823248A (en) | A method of Luchuan pigs CD163 gene is edited using CRISPR/Cas9 | |
CN105132427B (en) | A kind of dual-gene method for obtaining gene editing sheep of specific knockdown mediated with RNA and its dedicated sgRNA | |
WO2016110214A1 (en) | Preparation method for anti-porcine reproductive and respiratory syndrome cloned pig | |
CN107893088A (en) | A kind of method of the pig fibroblast for preparing CD13 gene knockouts and gene editing pig | |
CN107354170A (en) | A kind of gene knockout carrier and the fibroblastic method of preparation CD163 gene knock-out pigs | |
CN108753835A (en) | A method of editing pig BMP15 genes using CRISPR/Cas9 | |
CN108753832A (en) | A method of editing Large White CD163 genes using CRISPR/Cas9 | |
CN106191064A (en) | A kind of method preparing MC4R gene knock-out pig | |
CN113957069B (en) | Composition for simultaneous modification of amino acids at 736 th site and 738 th site of pAPN gene and application thereof | |
US11240997B2 (en) | Method for preparing porcine fibroblasts with both CD163 gene and CD13 gene being knocked-out | |
CN104419719B (en) | A kind of method that transgene pig riddled basins are knocked out | |
CN113957093B (en) | System for site-directed modification of pAPN gene and application thereof | |
CN113604504A (en) | Composition for site-directed modification of pAPN gene 16 exon and application thereof | |
CN110257435A (en) | A kind of construction method of PROM1-KO mouse model and its application | |
CN103993027B (en) | A kind of method that transgene pig riddled basins are knocked out | |
CN111926037A (en) | Plasmid for knocking out MSTN gene by using double sgRNA technology and method for knocking out MSTN gene | |
CN113403337A (en) | Carrier system, method for preparing pig fibroblast and gene editing pig | |
CN116445454B (en) | Complete system for breeding pig breeds resistant to TGEV infection and application thereof | |
CN106957857A (en) | A kind of method that utilization CRISPR/Cas9 systems knock out goat MSTN and FGF5 gene jointly | |
CN117487855A (en) | Methods for improving swine health by targeted inactivation of CD163 | |
CN104830752B (en) | A kind of unicellular cultural method of porcine fetus fibroblasts | |
CN109055385B (en) | Gene sequence for effectively inhibiting II type PRRSV infection and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant | ||
TR01 | Transfer of patent right |
Effective date of registration: 20220330 Address after: 276800 Room 201, unit 4, building 2, Haixing community, Donggang District, Rizhao City, Shandong Province Patentee after: Shandong Rongfa Biotechnology Development Co.,Ltd. Address before: 276800 Road north of 341 Province, International Ocean City, Rizhao City, Shandong Province (Songling village north of taoluo town government) Patentee before: SHANDONG LANDSEE GENETICS Co.,Ltd. |
|
TR01 | Transfer of patent right |