CN110819592A - Universal donor stem cell and preparation method thereof - Google Patents
Universal donor stem cell and preparation method thereof Download PDFInfo
- Publication number
- CN110819592A CN110819592A CN201810918727.6A CN201810918727A CN110819592A CN 110819592 A CN110819592 A CN 110819592A CN 201810918727 A CN201810918727 A CN 201810918727A CN 110819592 A CN110819592 A CN 110819592A
- Authority
- CN
- China
- Prior art keywords
- stem cell
- mhc
- artificial sequence
- expression
- hla
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0603—Embryonic cells ; Embryoid bodies
- C12N5/0606—Pluripotent embryonic cells, e.g. embryonic stem cells [ES]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0696—Artificially induced pluripotent stem cells, e.g. iPS
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Developmental Biology & Embryology (AREA)
- Cell Biology (AREA)
- Gynecology & Obstetrics (AREA)
- Reproductive Health (AREA)
- Transplantation (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a universal donor stem cell and a preparation method thereof. The universal donor stem cells disclosed herein are useful for overcoming immune rejection in cell-based transplantation therapies, and in particular, do not express MHC-I and MHC-II (or HLA-I and HLA-II), thereby rendering the stem cells less immunogenic.
Description
Technical Field
The invention relates to the field of stem cells, in particular to a universal donor stem cell and a preparation method thereof.
Background
Pluripotent stem cells have great therapeutic potential. These undifferentiated cells can give rise to almost any specialized cell type, either as a natural repair system for damaged tissues, or as a novel therapeutic agent that can be further designed to treat diseases. Scientists take advantage of the unique properties of stem cells to treat diseases associated with dead or damaged cells. Currently, in europe 26000 patients receive stem cell therapy annually for the treatment of hematological disorders and some cancers, including leukemia. However, human donors are currently the major source of stem cells, limiting the success of treatment due to rejection by the patient's immune system. Recent advances in stem cell biology now make it possible to consider patients' own cells as an unlimited source for transplantation. Unfortunately, iPSC production remains an expensive, time-consuming and highly variable process in terms of pluripotency, epigenetic status, differentiability and genomic stability. Furthermore, it was found that changes occurring during reprogramming and long culture elicited adaptive immune responses, leading to immune rejection of even autologous stem cell derived grafts.
There is some important evidence to date that HLA-engineered cells will function properly and avoid allograft rejection after transplantation.
(1) Rare individuals that are HLA class I negative or HLA class II negative are relatively healthy, indicating that HLA negative cells can differentiate into all essential organs.
(2) Mice lacking Major Histocompatibility Complex (MHC) class I and class II antigens (murine equivalents of HLA) have been extensively studied and except for the lack of CD4+And CD8+T cells are healthy. Importantly, transplantation experiments have shown that organs or cells from type I negative mouse donors survive longer (sometimes indefinitely) in allogenic recipients (including hepatocytes, kidney, heart and islets). These mouse experiments show that in many clinical settings for pluripotent stem cells, HLA-engineered human cells will also survive longer than allogeneic cells.
In the human population, the genes encoding HLA molecules are highly variable-meaning that each individual has a specific HLA molecule barcode tailored to their immune system.
Disclosure of Invention
To overcome this immune barrier, one aspect of the invention provides a universal donor stem cell whose expression of MHC I and MHC II is modulated relative to a wild-type stem cell. In the present invention, MHC I and MHC II are not expressed because the expression of transcription regulators of genes encoding MHC I and MHC is regulated. In the present invention, the stem cell further comprises modulated expression of at least one tolerogenic factor relative to a wild-type stem cell.
In an embodiment of the invention, the expression of the transcription regulator is regulated refers to a decrease in expression.
In an embodiment of the present invention, the expression of the transcription regulator is regulated means that the expression is inhibited.
In an embodiment of the invention, the expression of the transcriptional regulator is modulated by deletion of the transcriptional regulator.
In an embodiment of the invention, the transcriptional regulator is selected from at least one of B2M, CIITA, RFXANK, RFX5 and RFXP. In a preferred embodiment of the invention, the regulatory factors are B2M and RFXANK.
In an embodiment of the invention, the expression of said tolerogenic factors being modulated refers to an increased expression.
In an embodiment of the invention, the tolerogenic factor inhibits immune rejection.
In an embodiment of the invention, the tolerogenic factors are selected from at least one of HLA-C, HLA-E, HLA-G, PD-L1, CTKA-4-Ig, CD47 and IL-35.
In an embodiment of the invention, the tolerogenic factor is HLA-E.
In an embodiment of the invention, the stem cell further comprises expression or elevated expression of a suicide gene.
In an embodiment of the invention, the suicide gene is an iCaspase gene.
In an embodiment of the invention, the stem cells are selected from the group consisting of embryonic stem cells, pluripotent stem cells, human stem cells.
Another aspect of the present invention provides a method for preparing a universal donor stem cell, comprising the steps of, in an isolated cell:
(1) modulating expression of MHC I and MHC II;
(2) modulating the expression of tolerogenic factors.
In an embodiment of the invention, said modulating MHC I and MHC II expression refers to reducing MHC I and MHC II expression.
In an embodiment of the invention, said modulating of the expression of MHC I and MHC II refers to inhibiting the expression of MHC I and MHC II.
In an embodiment of the invention, said modulation of MHC I and MHC II expression refers to interference with MHC I and MHC II expression.
In an embodiment of the invention, said modulation of the expression of MHC I and MHC II is achieved by deletion of transcriptional regulators of genes encoding MHC I and MHC II.
In an embodiment of the invention, the deletion of the transcriptional regulator of the genes encoding MHC I and MHC II is achieved by gene knockout. In an embodiment of the invention, the gene knockout refers to the knockout of a pair of alleles of a transcriptional regulator.
In an embodiment of the invention, the transcriptional regulator is selected from at least one of B2M, CIITA, RFXANK, RFX5 and RFXP. In a preferred embodiment of the invention, the regulatory factors are B2M and RFXANK.
In an embodiment of the invention, said modulating the expression of a tolerogenic factor refers to increasing the expression of a tolerogenic factor.
In an embodiment of the invention, said increasing the expression of a tolerogenic factor refers to the insertion of a tolerogenic factor.
In an embodiment of the invention, the insertion of the tolerogenic factors is effected by means of gene knock-in.
In an embodiment of the invention, the tolerogenic factors are selected from at least one of HLA-C, HLA-E, HLA-G, PD-L1, CTKA-4-Ig, CD47 and IL-35.
In embodiments of the invention, gene knockout or gene knock-in is performed using CRISPR Cas9 technology.
In embodiments of the invention, the CRISPR Cas9 technology includes a guide RNA that specifically binds to a specific sequence of a targeted gene and a Cas protein.
In an embodiment of the invention, the guide RNA sequence targeting the B2M gene is shown in SEQ ID NO 1-3.
In an embodiment of the invention, the guide RNA sequence targeting the RFXANK gene is shown in SEQ ID NO: 22-24.
In an embodiment of the invention, the gene knockout or gene introgression is accomplished by introducing into the cell a guide RNA, or DNA encoding a guide RNA, and a nucleic acid encoding a Cas protein, or the Cas protein itself.
In an embodiment of the present invention, the guide RNA may be in the form of a double-stranded RNA of crRNA and tracrRNA, or may be in the form of a single-stranded RNA.
In an embodiment of the invention, the Cas protein is a Cas9 protein.
In an embodiment of the present invention, the method of preparing a universal donor stem cell further comprises the step of increasing expression of a suicide gene.
In an embodiment of the invention, the suicide gene is an iCaspase gene.
The invention has the advantages of
The universal donor stem cells provided by the present invention are pluripotent, capable of differentiating into a variety of cells to treat diseases, and are not rejected by the recipient's immune system.
Drawings
Fig. 1 shows the relative positions of three sgrnas targeting the B2M gene.
FIG. 2 shows a PX458 enzymatic cleavage map.
Fig. 3 shows the power conversion efficiency.
Fig. 4 shows the determination of the optimal concentration of the drug.
FIG. 5 shows the results of the Hygromycin screen.
FIG. 6 shows the results of amplification using B2M-735F and B2M-1126R.
FIG. 7 shows the results of amplification using primer Hygro-7F, Hygro-890R.
FIG. 8 shows the relative expression of HLA-E following cotransformation of three sgRNAs and donor vectors with B2M, respectively.
FIG. 9 shows the relative expression of Hygro after cotransformation of three sgRNAs and donor vector of B2M.
Fig. 10 shows the relative positions of three sgrnas targeting the RFXANK site.
FIG. 11 shows the results of electrophoresis after co-transformation of three sgRNAs and a donor vector of RFXANK.
FIG. 12 shows the relative expression levels of iCaspase following cotransformation of three sgRNAs and a donor vector of RFXANK.
FIG. 13 shows relative expression levels of Puro following cotransformation of three sgRNAs and donor vector of RFXANK.
FIG. 14 shows the reduction of MHC-I expression in B2M-/-RFXANK-/-human Mesenchymal Progenitor Cells (MPC).
FIG. 15 shows the reduction of MHC-II expression in B2M-/-RFXANK-/-human Mesenchymal Progenitor Cells (MPC).
Figure 16 shows improved genome-edited stem cell transplantation in humanized mice.
Detailed Description
In order to make the technical problems, technical solutions and advantageous effects solved by the present invention more apparent, the present invention is further described in detail below with reference to the following embodiments.
Examples
The following examples are used herein to demonstrate preferred embodiments of the invention. It will be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function in the invention, and thus can be considered to constitute preferred modes for its practice. Those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit or scope of the invention.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs and the disclosures and references cited herein and the materials to which they refer are incorporated by reference.
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.
Example 1 HLA class I engineering
Because HLA-I is a dimer consisting of α chains and β chains and all HLA-I are the same β chain in common, knocking out B2M gene encoding β chain can realize the knock-out of HLA-I, however, for some cells, the cells with knocked-out HLA-I will be cracked by NK cells.
Design of sgRNA
1.1 selection of design position of sgRNA
According to the gene name B2M found in NCBI, B2M has four exons in total, in order to completely knock out B2M without affecting the expression of other proteins, sgRNA is designed on the first exon, and the search of exon sequences can be found in NCBI, a UCSC database or geneious software. Later, sgrnas could be designed on transcripts common to this gene. Generally, the sgRNA template sequence specific for the gene is located in the pam (protospaceradjjacent motif) pre-adjacent sequence, and can be specifically recognized and cleaved by cas9 protein.
1.2 design of sgRNA
Currently, sgRNA designs have many websites, the most common being the thermo sgRNA design website, and the yagi sgRNA design website http: MIT. edu, the inventors designed sgRNA to select the zhangfeng laboratory website, pasted the B2M exon 1 sequence to the MIT zhangfeng laboratory sgRNA website, and selected 3 sequences from the higher scoring sequences as shown in table 1, and the positions of the sgRNA sequences targeting the B2M gene are shown in fig. 1.
Table 1 three sgRNA sequences targeting the B2M gene
1.3 design of sgRNA primers
After the sgRNA targeting B2M is designed, the sequence needs to be synthesized, and since the double-stranded sgRNA is inserted into a PX458 vector (addvine company), the forward sequence and the reverse sequence of each sgRNA need to be synthesized, and the 5' end of the sequence is added with the enzyme cutting site of BbS I matched with the vector. Detection primers are designed according to the sequences of the sgRNA and the B2M gene, and the designed primers are shown in Table 2.
Table 2 detection primers for three sgrnas targeting the B2M gene inserted into px458 vector
Design of 2 inserted Gene donor vector
The sequence of the cds region is found by searching in NCBI according to the gene name HLA-E.
Donor vector design:
a large frame: homology arms, SA sequences, T2A sequences, knock in fragments, bGH poly (A) signal, FRT sequences, EF1a, SV40poly (A) signal, resistance selection genes, and restriction endonuclease sites are required. SA is a cutting site, so that the coding frames can be ensured to be aligned to frames, different transcripts can be formed after the fragments are knocked in, the whole transcript is transcribed, 6 transcripts are generated by cutting, and two transcripts can be translated correctly.
T2A sequence: translation is split and different transcripts are recruited for translation. The length of the homology arms at the two ends does not exceed 800bp when the donor vector is designed, and the length of the homology arms at the two ends does not exceed 400bp generally.
When designing Donor vector, the PAM sequence in the sgRNA sequence should be replaced by the synonymous mutant sequence, and the gene to be changed by the synonymous mutation should be determined to encode the same amino acid sequence, so that changing the base in the PAM sequence can change the first base and also can change the second or third base. Since CAS9 cleaves two bases after the PAM sequence, if the PAM sequence is not changed to the base sequence of its synonymous mutation in the donor vector sequence, sgRNA cleaves the donor vector as well. The designed gene sequence to be integrated is inserted into the PUC57 vector.
The synthesis of Donor vector was synthesized by Kinsley Biometrics.
3 method of Experimental materials
3.1 insertion of sgRNA2 and sgRNA3 designed at B2M site into the px458 vector
3.1.1 annealing of the forward and reverse strands of sgRNAs into double-stranded RNAs
(1) The sgRNA primers (powder) were centrifuged at 3000rpm for 5 min;
(2) adding ddH2O to dissolve the forward chain and the reverse chain of the sgRNA according to the requirement of the Scoprydae company;
(3) annealing System is shown in Table 3 below
Table 3 preparation of sgrnas
| Components | Dosage (mu L) |
| SgRNA primer F(100μmol/L) | 1 |
| SgRNA primer R(100μmol/L) | 1 |
| T4 PNK buffer(10×) | 1 |
| |
1 |
| ddH2O | 6 |
| In total | 10 |
(4) Reaction program 37 ℃ for 30 min; 95 ℃ for 5 min; ramp down to 25 ℃ at ℃ min-1.
(5) After determination of the concentration with ddH2Diluting with O1: 10;
3.1.2 linearizing PX458
The restriction enzyme is Bbs I, and the enzyme digestion system is shown in Table 4;
TABLE 4 enzyme cleavage of PX458
| Components | Dosage (mu L) |
| PX458 | 15 |
| Bbs I | 2 |
| Buffer2.1 | 5 |
| ddH2O | 28 |
| In |
50 |
The reaction condition is that the mixture is placed for 4 hours at 37 ℃ and 20min at 65 ℃;
and then, recovering the cut PX458 gel after enzyme digestion according to a gel recovery kit, and measuring the concentration. The cleavage pattern is shown in FIG. 2.
3.1.3 connection
Ligation was performed with T7 ligase, the ligation system is shown in Table 5; (in this case, a negative control should be set, i.e., the inserted DNA is ddH2O)
TABLE 5T 7 enzymatic ligation
| Components | Dosage of |
| |
10μL |
| PX458 | 50ng |
| Insert DNA | 37.5ng |
| ddH2O | To 20ul |
| T7 Ligation | 1μL |
3.1.4 transformation, ligation products were transferred to DH5a
(1) Competent cells were placed in an ice bath.
(2) After the competent cells were thawed, 30. mu.L of the competent cells were put into a new sterile EP tube, 10. mu.L of the ligation product was added to the competent cell suspension, gently pipetted and mixed, and ice-cooled for 30 min.
(3) Heat shock at 42 deg.c for 45 sec, fast transferring the centrifugal tube into ice bath and letting stand on ice for 2-3 min.
(4) Adding 450 μ L sterile LB culture medium (containing no antibiotic) into each centrifuge tube, mixing, placing on 37 deg.C shaking table, and shaking culturing at 150rpm for 45min to recover thallus.
(5) Centrifuging the recovered bacteria liquid at 3000rpm for 2min, removing 300 μ L of supernatant by using a pipette, blowing and uniformly mixing the residual culture medium and bacteria by using the pipette, taking out an amp culture plate prepared in advance, uniformly coating cells by using a sterile coating rod, placing the plate at 37 ℃ until the liquid is absorbed, carrying out inverted culture, and culturing at 37 ℃ for 12-16 h.
(6) Individual clones were picked into 5mL of amp medium and incubated on a shaker at 37 ℃ for 12-16h at 220 rpm.
(7) And (3) strain storage: taking 500 mu L of fresh bacterial liquid and 500 mu L of 50% glycerol 1:1, mixing uniformly, and storing at-80 ℃.
(8) Sequencing: 500. mu.L of the suspension was sequenced with primer U6. And carrying out small plasmid extraction after the residual bacterial liquid is successfully subjected to sequencing. The sequencing result is completely consistent with the target sequence.
3.2 plasmid electrotransformation and monoclonal picking
3.2.1 cell treatment
(1) Cells were treated with 1umol/L ROCK inhibitor 24h before electroporation.
(2) Cells were washed with PBS during electroporation, H9 cells were treated with 200. mu.L of the enzyme accutase and left at 37 ℃ for 5 min.
(3) Digestion was stopped by adding 800. mu.L of 10% KSR. Cells were pipetted and counted.
(4) The electroporation system in this experiment was 120. mu.L, and the number of cells required for each system was 1.5X 106。
(5) After counting, the required cell number is sucked, added into a 15mL centrifuge tube for 160g and centrifuged for 5min, the supernatant is discarded, 1mL PBS is added, blown and beaten, and centrifuged for 5min at 160 Xg.
(6) 3X 120. mu.L of electrotransfer solution is added into the cleaned cells, and the electrotransfer is carried out for 120. mu.L of one system, and one system needs 1.5X 106Therefore, three systems require 4.5X 106。
3.2.2 plasmid treatment
(1) sgRNA1 and donor vector2, sgRNA2 and donor vector2, sgRNA3 and donor vector1 were electroporated, respectively, for a total of 10. mu.g of electroporated plasmid per system, at a ratio of 1: 4. I.e., sgRNA 2. mu.g, dororevector 8. mu.g.
(7) Firstly, the plasmid is premixed, 120 mu L of cells premixed with the electrotransformation liquid are added into the premixed plasmid and mixed evenly, and the mixture is transferred into an electrode cup, wherein the electrotransformation voltage is 600V and is 30 m.
(8) After the electroporation, the cells were cultured in M-TESER medium containing 1. mu. mol/L of ROCK inhibitor.
(9) After 24h of electrotransfer, the M-TESER medium was replaced with fresh medium (in this case, the ROCK inhibitor was not added to the medium).
(10) After 48h of electrotransformation, the drugs were added for screening, and the electrotransformation efficiency was as shown in FIG. 3.
3.2.3 optimal concentration determination of Hygromycin
(1) Cells grown to 70% -80% in 24 wells, 1: 3 to 24-well cell culture plates, and the medium is changed to the culture medium containing Hygro and genetine the next day. Then the solution was changed every 3 days. The lowest concentration at which the cells die completely after one week is the optimal concentration.
(2) The concentration settings of Hygromycin are 0, 25. mu.g/mL, 50. mu.g/mL, 75. mu.g/mL, 100. mu.g/mL, 150. mu.g/mL, 200. mu.g/mL in this order, and the experimental results are shown in FIG. 4.
From FIG. 4, it can be seen that the optimal concentration of Hygromycin was set at 75 μ g/mL.
3.2.4 screening
After 48h of electrotransformation, 75ug/ml of Hygromycin was added for screening, wherein the screening results are shown in FIG. 5.
The results show that the growth conditions of the cells of the A, B, C control group are basically the same before dosing, the cells of the control group die basically after 4 days after dosing, and the cells of the experimental group also have clones.
After the control group is completely dead, the experimental group stops adding the medicine, after the cells grow full, the passage is respectively carried out for analyzing the DNA and RNA level, and one cell is stored.
3.2.5 genotyping
3.2.5.1 when the cells in the step 3.2.4 are full, respectively extracting genome and RNA, extracting the genome according to the extraction kit of Pomacea organisms, and performing PCR amplification. The primer sequences are shown in Table 6, and the PCR results are shown in FIG. 12.
TABLE 6 primer sequences
| Name (R) | Sequence (5 '-3') | SEQ ID NO： |
| Hygro-7F | TGAACTCACCGCGACGTCTGTC | 12 |
| Hygro-890R | ACAGTCCCGGCTCCGGATC | 13 |
| B2M-735F | GAGCAGGAGGGGTCAGAG | 14 |
| B2M-1126R | TCCAGGTGAAGCAACGTCTC | 15 |
TABLE 7 reaction System (Takara kit)
| Components | Content (μ L) |
| |
2 |
| B2M-735F | 0.5 |
| B2M-1126R | 0.5 |
| ddH2O | 10.5 |
| ExTaqversion | 12.5 |
| In total | 25 |
Reaction conditions of 98 ℃ for 10s, 58 ℃ for 10s and 72 ℃ for 1 min; 30 cycles.
The system and conditions were the same except that the annealing temperature for amplification by Hygro-7F, Hygro-890R was 54.5 ℃.
The results of amplification using B2M-735F and B2M-1126R are shown in FIG. 6, and the results of amplification using primer Hygro-7F, Hygro-890R are shown in FIG. 7.
3.2.6 RNA level analysis
TABLE 8 primer sequences, annealing temperature B2M at 54 ℃ and Hygro at 52 DEG C
| Name (R) | Sequence (5 '-3') | SEQ ID NO： |
| B2M-735F | GAGCAGGAGGGGTCAGAG | 14 |
| B2M-1001R | TCCAGGTGAAGCAACGTCTC | 16 |
| B2M-999R | CAGGTGAAGCAACGTCTCC | 17 |
| B2M-1126R | TCCAGGTGAAGCAACGTCTC | 15 |
| Hygro-4031F | ACAGCGGTCATTGACTGGAG | 18 |
| Hygro-4131R | TGCTGCTCCATACAAGCCAA | 19 |
| Hygro-4323R | ATTTGTGTACGCCCGACAGT | 20 |
| Hygro-4112F | TTGGCTTGTATGGAGCAGCA | 21 |
(1) Extracting total RNA according to an RNA extraction kit, measuring the concentration after extraction, taking 3 mu g for reverse transcription, and carrying out reverse transcription according to a Thermo reverse transcription kit K1622 by a reverse transcription kit.
(2) And (3) carrying out reverse transcription on the cDNA according to the proportion of 1: diluting by 10 times, carrying out qPCR amplification, wherein a Vazyme chamQSYBR qPCR Master Mix Q311-02 is selected as a qPCR reagent.
(3) qPCR reaction system Table 9, HLA-E and Hygro were quantitatively analyzed, respectively. The results are shown in FIGS. 8 and 9.
TABLE 9 qPCR reaction System
| Components | Dosage (mu L) |
| 2×chamQ SYBR qpcr Master Mix | 10 |
| Primer1 | 0.4 |
| Primer2 | 0.4 |
| 50×ROX Reference Dye1 | 0.4 |
| H2O | 6.8 |
Reaction procedure: reps 1: 30s at 95 ℃; reps40 at 95 ℃ for 10 s; 30s at 60 DEG C
Example 2 HLA II engineering
Unlike HLA class I, class II proteins lack common subunits that can be edited to prevent surface expression. MHC class ii defects are combined immunodeficiencies caused by defects in the four regulatory factors CIITA, RFXANK, RFX5 and rfxp, which control MHC ii expression at the transcriptional level. The RFXANK gene encodes a subunit of the heterotrimeric RFX complex, which is involved in the assembly of several transcription factors on the MHC ii promoter. Thus, the present invention edits two copies of the RFXANK transcription factor gene required for MHC class II expression. Patients with RFXANK mutations do not express HLA class II molecules on their antigen presenting cells. And transferring the iCaspase to enhance the safety of the iCaspase.
The relative positions of the three sgrnas targeting the RFXANK site are shown in fig. 10, and the sequences are as follows:
GCAGAAGACCTCATCCAGAC(SEQ ID NO:22)
TGAGCCTGTGAATCCTGAAC(SEQ ID NO:23)
AGACCCCTGCCTCAGAACTT(SEQ ID NO:24)
table 10 RFXANK site three sgRNA inserted into PX458 vector primer sequence
Primers for detection were also designed as shown in Table 11.
TABLE 11 primers for detection
| Primer name | Sequence (5 '-3') | SEQ ID NO： |
| RFXANK 6636F | AGTTTACCCACCCTCACAGTGCAAG | 31 |
| RFXANK 7766R | GTGTAGGAAGAGCATTCCAGACAGGAG | 32 |
| RFXANK 7081R | GCATGGGCAACAAGAGC | 33 |
The Donor vector was designed according to the method of example 1.
Electrotransfer was carried out according to the method of example 1. After 48h of electrotransformation, the cells are screened by puro 0.5. mu.g/mL, and after all normal cells die, the cells are replaced by normal medium, and then subcultured, 1:5, DNA and RNA are respectively extracted, frozen and subcultured (transferred to MEF plates for monoclonal culture).
1. Detection of DNA levels
The primers are as follows: the annealing temperature is 51 DEG C
TABLE 12 DNA level detection primers
| Primer name | Sequence (5 '-3') | SEQ ID NO： |
| Puro-4114F | CAACCTCCCCTTCTACGAGC | 34 |
| RFXANK-7081R | GCATGGGCAACAAGAGC | 33 |
Amplification was performed using the KAPA kit, as shown in Table 13.
TABLE 13 DNA level detection System
Reaction conditions are as follows: pre-denaturation at 94 deg.C for 3 min; denaturation at 94 ℃ for 20s, annealing at 50 ℃ for 15s, extension at 51.5 ℃ for 3min, and 30 cycles; annealing at 72 deg.C for 1 min.
The results of agarose gel electrophoresis of 1% gel are shown in FIG. 11.
2. RNA level detection
(1) Primer sequences (iCaspase annealing temperature 52 ℃ C., Puro annealing temperature 54 ℃ C.)
TABLE 13 RNA level detection primers
| Primer name | Sequence (5 '-3') | SEQ ID NO： |
| iCaspase1027F | tgaacttctgccgtgagtcc | 35 |
| iCaspase1172R | cagcaaagccagcaccattt | 36 |
| iCaspase1227R | agagaatgaccaccacgcag | 37 |
| iCaspase1153F | aaatggtgctggctttgctg | 38 |
| iCaspase1506R | gctggtcgaaggtcctcaaa | 39 |
| Puro-3617F | atgaccgagtacaagcccac | 40 |
| Puro-3952R | gaggccttccatctgttgct | 41 |
| Puro-3933F | agcaacagatggaaggcctc | 42 |
| Puro-4133R | gctcgtagaaggggaggttg | 43 |
| Puro-3132R | ctcgtagaaggggaggttgc | 44 |
(2) The results of using Vazyme chamQ SYBR qPCR Master Mix Q311-02 as the qPCR reagent are shown in FIG. 12 and FIG. 13.
EXAMPLE 3 differentiation of modified embryonic Stem cells
Modified embryonic stem cells can differentiate into a variety of different cell types with reduced or absent HLA expression. Examples of such cell types include Mesenchymal Progenitor Cells (MPC), hypoimmunogenic cardiomyocytes, Endothelial Cells (EC), macrophages, hepatocytes, leukocytes (e.g., membrane gland leukocytes), or Neural Progenitor Cells (NPC).
Initially, we reduced MHC-I expression in B2M-/-and B2M-/-RFXANK-/-human ES cells. The inventors next examined MHC-I expression in various differentiated cell types. For example, MHC-I and MHC-II expression was reduced in B2M-/-and B2M-/-RFXANK-/-human Mesenchymal Progenitor Cells (MPC) (FIG. 14, FIG. 15).
Example 4 in vivo data
Finally, the cell lines prepared by the inventors include WT HuES9 and B2M-/-RFXANK-/-HuES 9. The WT cell line exhibited MHC-I and MHC-II expression, and the B2M-/-RFXANK-/-HuES9 cell line did not exhibit MHC-I and MHC-II expression. These cell lines were then examined in humanized mice and showed improved engraftment of genome-edited stem cells in humanized mice (figure 16).
All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.
Sequence listing
<110> Zhang in
<120> a universal donor stem cell and a method for preparing the same
<130>XY-2018-1-W-011
<160>44
<170>SIPOSequenceListing 1.0
<210>1
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
ggccacggag cgagacatct 20
<210>2
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
gagtagcgcg agcacagcta 20
<210>3
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
cgcgagcaca gctaaggcca 20
<210>4
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
caccgggcca cggagcgaga catct 25
<210>5
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
aaacagatgt ctcgctccgt ggccc 25
<210>6
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
caccggagta gcgcgagcac agcta 25
<210>7
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
aaactagctg tgctcgcgct actcc 25
<210>8
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
caccgcgcga gcacagctaa ggcca 25
<210>9
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
aaactggcct tagctgtgct cgcgc 25
<210>10
<211>27
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
ctgagtacct actatgtgcc agcccct 27
<210>11
<211>27
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
gaggtgctag gacatgcgaa cttagcg 27
<210>12
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
tgaactcacc gcgacgtctg tc 22
<210>13
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>13
acagtcccgg ctccggatc 19
<210>14
<211>18
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>14
gagcaggagg ggtcagag 18
<210>15
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>15
tccaggtgaa gcaacgtctc 20
<210>16
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>16
tccaggtgaa gcaacgtctc 20
<210>17
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>17
caggtgaagc aacgtctcc 19
<210>18
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>18
acagcggtca ttgactggag 20
<210>19
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>19
tgctgctcca tacaagccaa 20
<210>20
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>20
atttgtgtac gcccgacagt 20
<210>21
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>21
ttggcttgta tggagcagca 20
<210>22
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>22
gcagaagacc tcatccagac 20
<210>23
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>23
tgagcctgtg aatcctgaac 20
<210>24
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>24
agacccctgc ctcagaactt 20
<210>25
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>25
caccggcagg ctgggtaagc tccat 25
<210>26
<211>26
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>26
aaacatggag cttacccagc ctgccc 26
<210>27
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>27
caccgtgagc ctgtgaatcc tgaac 25
<210>28
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>28
aaacgttcag gattcacagg ctcac 25
<210>29
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>29
caccgagacc cctgcctcag aactt 25
<210>30
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>30
aaacaagttc tgaggcaggg gtctc 25
<210>31
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>31
agtttaccca ccctcacagt gcaag 25
<210>32
<211>27
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>32
gtgtaggaag agcattccag acaggag 27
<210>33
<211>17
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>33
gcatgggcaa caagagc 17
<210>34
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>34
caacctcccc ttctacgagc 20
<210>35
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>35
tgaacttctg ccgtgagtcc 20
<210>36
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>36
cagcaaagcc agcaccattt 20
<210>37
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>37
agagaatgac caccacgcag 20
<210>38
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>38
aaatggtgct ggctttgctg 20
<210>39
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>39
gctggtcgaa ggtcctcaaa 20
<210>40
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>40
atgaccgagt acaagcccac 20
<210>41
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>41
gaggccttcc atctgttgct 20
<210>42
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>42
agcaacagat ggaaggcctc 20
<210>43
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>43
gctcgtagaa ggggaggttg 20
<210>44
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>44
ctcgtagaag gggaggttgc 20
Claims (10)
1. A universal donor stem cell, wherein MHC I and MHC II are not expressed or are reduced expressed relative to a wild-type stem cell, preferably MHC I and MHC II are not expressed or are reduced expressed due to transcriptional regulators of genes encoding MHC I and MHC; more preferably, the stem cell further comprises expression or elevated expression of at least one tolerogenic factor.
2. The universal donor stem cell of claim 1, wherein the transcriptional regulator is selected from at least one of B2M, CIITA, RFXANK, RFX5, and RFXP.
3. The universal donor stem cell of claim 1, wherein the transcriptional regulators are B2M and RFXANK.
4. The universal donor stem cell of claim 1, wherein the tolerogenic factors are selected from at least one of HLA-C, HLA-E, HLA-G, PD-L1, CTKA-4-Ig, CD47 and IL-35.
5. The universal donor stem cell according to any one of claims 1 to 4, further comprising expression or increased expression of a suicide gene relative to a wild-type stem cell, preferably wherein the suicide gene is an iCaspase gene.
6. The universal donor stem cell according to any one of claims 1 to 4, wherein the stem cell is selected from the group consisting of an embryonic stem cell, a pluripotent stem cell, and a human stem cell.
7. A method of preparing a universal donor stem cell comprising, in an isolated cell, the steps of:
(1) inhibiting expression of MHC I and MHC by deleting transcriptional regulators of genes encoding MHC I and MHC;
(2) increasing the expression of tolerogenic factors.
8. The method for preparing a universal donor stem cell according to claim 7, wherein the transcription regulatory factor is selected from at least one of B2M, CIITA, RFXANK, RFX5 and RFXP.
9. The method of claim 7, wherein the tolerogenic factors are selected from at least one of HLA-C, HLA-E, HLA-G, PD-L1, CTKA-4-Ig, CD47 and IL-35.
10. The method for preparing a universal donor stem cell according to claim 7, further comprising the step of increasing the expression of a suicide gene, preferably wherein the suicide gene is an iCaspase gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810918727.6A CN110819592A (en) | 2018-08-13 | 2018-08-13 | Universal donor stem cell and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810918727.6A CN110819592A (en) | 2018-08-13 | 2018-08-13 | Universal donor stem cell and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110819592A true CN110819592A (en) | 2020-02-21 |
Family
ID=69546926
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810918727.6A Pending CN110819592A (en) | 2018-08-13 | 2018-08-13 | Universal donor stem cell and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110819592A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114517184A (en) * | 2020-10-30 | 2022-05-20 | 未来智人再生医学研究院(广州)有限公司 | Pluripotent stem cell expressing adipsin or derivative thereof and application thereof |
| WO2023151620A1 (en) * | 2022-02-09 | 2023-08-17 | 恺兴生命科技(上海)有限公司 | Compositions and methods for cellular immunology |
| WO2024047563A1 (en) * | 2022-09-02 | 2024-03-07 | Janssen Biotech, Inc. | Materials and processes for engineering hypoimmunogenicity |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130177577A1 (en) * | 2010-07-12 | 2013-07-11 | Dana-Farber Cancer Institute, Inc. | Nlrc5 as a target to intervene mhc class 1-mediated immune responses |
| WO2013158292A1 (en) * | 2012-04-17 | 2013-10-24 | University Of Washington Through Its Center For Commercialization | Hla class ii deficient cells, hla class i deficient cells capable of expressing hla class ii proteins, and uses thereof |
| CN107921148A (en) * | 2015-05-08 | 2018-04-17 | 哈佛学院校长同事会 | Universal donor stem cell and correlation technique |
-
2018
- 2018-08-13 CN CN201810918727.6A patent/CN110819592A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130177577A1 (en) * | 2010-07-12 | 2013-07-11 | Dana-Farber Cancer Institute, Inc. | Nlrc5 as a target to intervene mhc class 1-mediated immune responses |
| WO2013158292A1 (en) * | 2012-04-17 | 2013-10-24 | University Of Washington Through Its Center For Commercialization | Hla class ii deficient cells, hla class i deficient cells capable of expressing hla class ii proteins, and uses thereof |
| CN107921148A (en) * | 2015-05-08 | 2018-04-17 | 哈佛学院校长同事会 | Universal donor stem cell and correlation technique |
Non-Patent Citations (3)
| Title |
|---|
| ZHOU XIAOOU 等: "iCaspase 9 Suicide Gene System", 《METHODS IN MOLECULAR BIOLOGY》 * |
| 赵宗江: "《细胞生物学 新世纪第3版》", 31 December 2016, 中国中医药出版社 * |
| 马希峰 等: "人胚脑源性神经干细胞特性及免疫原性研究 ", 《中国临床康复》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114517184A (en) * | 2020-10-30 | 2022-05-20 | 未来智人再生医学研究院(广州)有限公司 | Pluripotent stem cell expressing adipsin or derivative thereof and application thereof |
| WO2023151620A1 (en) * | 2022-02-09 | 2023-08-17 | 恺兴生命科技(上海)有限公司 | Compositions and methods for cellular immunology |
| WO2024047563A1 (en) * | 2022-09-02 | 2024-03-07 | Janssen Biotech, Inc. | Materials and processes for engineering hypoimmunogenicity |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Flynn et al. | CRISPR-mediated genotypic and phenotypic correction of a chronic granulomatous disease mutation in human iPS cells | |
| CN106244557B (en) | The method of rite-directed mutagenesis ApoE gene and LDLR gene | |
| Diner et al. | Refinement of the diatom episome maintenance sequence and improvement of conjugation-based DNA delivery methods | |
| Yang et al. | Optimization of scarless human stem cell genome editing | |
| JP7385281B2 (en) | Method for producing low antigenicity cells | |
| CN109750035B (en) | sgRNA for targeting and guiding Cas9 protein to efficiently cleave TCR and B2M gene locus | |
| WO2020049535A1 (en) | Universal donor cells | |
| CN113278619B (en) | Double sgRNA, gene knockout vector, pig fibroblast line with STING gene knockout function and construction method thereof | |
| CN110819592A (en) | Universal donor stem cell and preparation method thereof | |
| US20210130817A1 (en) | Gene Editing System and Gene Editing Method | |
| CN114901808A (en) | Method for producing CAR-T cells | |
| KR20210010555A (en) | Drug resistant immune cells and methods of use thereof | |
| Tran et al. | Precise CRISPR-Cas–mediated gene repair with minimal off-target and unintended on-target mutations in human hematopoietic stem cells | |
| US20230416747A1 (en) | Safe harbor loci | |
| CN106282230B (en) | The method of rite-directed mutagenesis LDLR gene | |
| CN106244556B (en) | The method of rite-directed mutagenesis ApoE gene | |
| CN116716298A (en) | Guide editing system and fixed-point modification method of target gene sequence | |
| CN110004145B (en) | sgRNA, knockout vector, knockout method of KLF4 gene and application thereof | |
| US20220364072A1 (en) | Fusion protein that improves gene editing efficiency and application thereof | |
| CN116334000A (en) | Preparation method of low-immunogenicity IPSC (iPSC) cells and low-immunogenicity iPSC cells | |
| CN106957820B (en) | Culture medium for in vitro chondrocyte telomere prolonged proliferation culture, kit and application | |
| CN116732099B (en) | Stem cell multiple CRISPR/Cas genome editing method | |
| CN112391410B (en) | sgRNA and application thereof in repairing abnormal splicing of introns | |
| CN108823210B (en) | Promoter for specific and efficient expression of pig muscle tissue and application | |
| CN112111528B (en) | Repair method for abnormal splicing of introns |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200221 |
|
| RJ01 | Rejection of invention patent application after publication |