CN114517184A - Pluripotent stem cell expressing adipsin or derivative thereof and application thereof - Google Patents

Pluripotent stem cell expressing adipsin or derivative thereof and application thereof Download PDF

Info

Publication number
CN114517184A
CN114517184A CN202011185930.0A CN202011185930A CN114517184A CN 114517184 A CN114517184 A CN 114517184A CN 202011185930 A CN202011185930 A CN 202011185930A CN 114517184 A CN114517184 A CN 114517184A
Authority
CN
China
Prior art keywords
shrna
hla
seq
pluripotent stem
derivative
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202011185930.0A
Other languages
Chinese (zh)
Inventor
王淋立
陈月花
杨建国
莫健
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Future Intelligent Regenerative Medicine Research Institute Guangzhou Co ltd
Original Assignee
Future Intelligent Regenerative Medicine Research Institute Guangzhou Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Future Intelligent Regenerative Medicine Research Institute Guangzhou Co ltd filed Critical Future Intelligent Regenerative Medicine Research Institute Guangzhou Co ltd
Priority to CN202011185930.0A priority Critical patent/CN114517184A/en
Publication of CN114517184A publication Critical patent/CN114517184A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0603—Embryonic cells ; Embryoid bodies
    • C12N5/0606—Pluripotent embryonic cells, e.g. embryonic stem cells [ES]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/30—Nerves; Brain; Eyes; Corneal cells; Cerebrospinal fluid; Neuronal stem cells; Neuronal precursor cells; Glial cells; Oligodendrocytes; Schwann cells; Astroglia; Astrocytes; Choroid plexus; Spinal cord tissue
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/48—Reproductive organs
    • A61K35/54—Ovaries; Ova; Ovules; Embryos; Foetal cells; Germ cells
    • A61K35/545—Embryonic stem cells; Pluripotent stem cells; Induced pluripotent stem cells; Uncharacterised stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A61K38/1725—Complement proteins, e.g. anaphylatoxin, C3a or C5a
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4705—Regulators; Modulating activity stimulating, promoting or activating activity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/472—Complement proteins, e.g. anaphylatoxin, C3a, C5a
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/70539—MHC-molecules, e.g. HLA-molecules
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0608—Germ cells
    • C12N5/0611—Primordial germ cells, e.g. embryonic germ cells [EG]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0618—Cells of the nervous system
    • C12N5/0623—Stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0696—Artificially induced pluripotent stem cells, e.g. iPS
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Cell Biology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Public Health (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Molecular Biology (AREA)
  • Reproductive Health (AREA)
  • Epidemiology (AREA)
  • Toxicology (AREA)
  • Biophysics (AREA)
  • Gynecology & Obstetrics (AREA)
  • Virology (AREA)
  • Diabetes (AREA)
  • Neurosurgery (AREA)
  • Hematology (AREA)
  • Neurology (AREA)
  • Endocrinology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Rheumatology (AREA)

Abstract

The invention discloses a pluripotent stem cell for expressing adipsin or a derivative thereof and application thereof. The pluripotent stem cells or derivatives thereof for expressing adipsin provided by the invention can be used for inducing iPSCs (induced pluripotent stem cells) from autologous cells or differentiating into low-immunogenicity cells such as MSCs (mesenchymal stem cells) for application, can continuously express adipsin in vivo, and can be used for treating diabetes and related diseases.

Description

Pluripotent stem cell expressing adipsin or derivative thereof and application thereof
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to a pluripotent stem cell expressing adipsin or a derivative and application thereof.
Background
The lipoprotein (adipsin) is also called Complement Factor D (CFD). In 1987, it was first discovered by Bruce Spiegelman, professor of the university of Dana-Farber cancer institute and Harvard medical college, USA, and was confirmed to be a component of the immune system. Adipocyte secretes adipsin into the blood, affecting various metabolic and immune functions by continuous circulation. In 2014, the professor Spiegelman team again found the role of adipsin in controlling the production of insulin by the pancreas. Recently, this study, published in Nature Medicine, has again shown that adipsin helps protect insulin-secreting pancreatic beta cells from type 2 diabetes. Higher levels of adipsin in the blood are also associated with protection from type 2 diabetes in middle-aged populations. Therefore, more adipsin in blood can better control diabetes, and adipsin can be used as a diabetes treatment drug. However, adipsin has a short duration of action, requires long-term injections, and is costly for the patient.
Stem cells are "seed" cells with self-renewal ability and differentiation ability into specific functional somatic cells, have the potential to regenerate into various tissues, organs and human bodies, and play a central and irreplaceable role in immune response, aging, tumorigenesis and other important biological activities. Stem cells are mainly classified into: totipotent stem cells (Totipotent stem cells), Pluripotent Stem Cells (PSCs), and adult stem cells (adult stem cells). The pluripotent stem cell PSCs have nearly infinite self-renewal capacity and the potential of developmental differentiation to organs, tissues and cells of all germ layers in an embryo under normal development conditions, and typical PSCs mainly include Embryonic Stem Cells (ESCs), Embryonic Germ Cells (EGCs), Embryonic Carcinoma Cells (ECCs), Induced Pluripotent Stem Cells (iPSCs) and the like.
Therefore, it is important to develop a pluripotent stem cell or a derivative thereof that can express adipsin in humans.
However, the conception or establishment of the autologous iPSCs cell bank or the immune matched PSCs cell bank requires great expenditure of money, material resources and manpower. The molecular immunological basis for allogeneic recipient organ, tissue or cell transplantation is based primarily on the matching of the classical major histocompatibility complexes MHC-I and MHC-II (human HLA-I, HLA-II). By 6 months 2019, over 20000 HLA system alleles have been identified and named, and only 5000 allele factors of classical HLA-A, B, C are respectively exceeded, and various possible random combinations of these classical HLA-I/II alleles will be astronomical numbers, and as the number of combinations found for new alleles increases, there is a great obstacle to tissue matching and donor selection before organ, tissue and cell transplantation, and also great difficulty in constructing a PSCs cell library covering the immune match of the human population.
Thus, the construction of allogeneic immune-compatible, universal PSCs is imminent. In recent years, many reports have been reported that the deletion expression of HLA-I and HLA-II cell surfaces or self genes is realized by knocking out B2M, CIITA and other genes, so that cells have immune tolerance or escape T/B cell specific immune response, and universal PSCs with immune compatibility are generated, thereby laying an important foundation for the application of wider universal PSCs source cells, tissues and organs. Also, cells have been reported to overexpress CTLA4-Ig, PD-L1 and thereby inhibit allogeneic immune rejection. Recently, it has been reported that when B2M and CIITA are knocked out, CD47 is knocked in, so that cells obtain escape specific immune response, and have immune tolerance or escape natural immune response of cells such as NK cells, so that the cells have more comprehensive and stronger immune compatibility characteristics. However, these approaches are either not fully immune compatible, and still allow for immunological rejection of the allogens by other routes; or completely eliminate the allogeneic immune rejection response, but simultaneously make the cells of the donor-derived transplant lose the antigen presenting capability, which brings great risk of diseases such as tumorigenicity and virus infection to the recipient.
Therefore, it is also reported that, when the B2M is not directly knocked out, the HLA-A, HLA-B is knocked out or the CIITA is knocked out together, the HLA-C is kept, 12 HLA-C immune matching antigens covering more than 90% of people are constructed, so that the transplanted cells still have a certain degree of antigen presenting function, and the inherent immune response of NK cells can be inhibited through the HLA-C. However, in the cells, the antigen type presented by HLA-I antigen is reduced by more than two thirds, the integrity of the presented antigen is reduced irreversibly, the presenting of various tumor, virus and other disease antigens has great bias, the risk of diseases such as tumor and virus infection is still kept to a certain extent, and the pathogenic risk is higher under the condition that CIITA is knocked out simultaneously; secondly, 12 high-frequency immune match HLA-C antigen species are very different, and the part of the area can only account for 70 percent by verification and calculation, while the HLA data of large sample size which is not authoritative currently in China, Indian and other big countries is displayed, so that the prepared general PSCs are still subjected to huge match vacancy tests; thirdly, the method can go through repeated gene editing for a plurality of times, at least two rounds of single cell isolation culture meters are needed according to each gene editing, the whole process needs at least more than six rounds of single cell isolation culture, and the processes are inevitable and cause various unpredictable mutations of cells due to multiple times of gene editing off-target or unstable chromatin or due to passage proliferation of a large number of single cells, thereby further inducing various problems of carcinogenesis, metabolic diseases and the like. It follows that such immuno-compatible schemes are also a matter of convenience in the "transition period", and many problems remain that are not better solved.
In addition, inducing killing of the suicide gene after donor tissue and cell disease has been induced, which results in serious tissue necrosis, cytokine storm and other unpredictable disease risk problems, and it is a big problem that proper donor cells, tissues and organs do not exist after the cell death of the design.
Disclosure of Invention
In order to overcome the defects in the prior art, the first aspect of the invention aims to provide an adipsin-expressing pluripotent stem cell or a derivative thereof, which comprises at least one of an adipsin-expressing non-immune-compatible pluripotent stem cell or a derivative thereof, an adipsin-expressing immune-compatible pluripotent stem cell or a derivative thereof, and an adipsin-expressing immune-compatible reversible pluripotent stem cell or a derivative thereof; wherein, the immune compatible pluripotent stem cell or the derivative thereof expressing adipsin can be realized by the following scheme: knocking out B2M and/or CIITA gene in the genome of the pluripotent stem cell or the derivative thereof and/or introducing an expression sequence of an immune compatible molecule into the genome of the pluripotent stem cell or the derivative thereof; the immune compatible reversible pluripotent stem cell expressing adipsin or a derivative thereof is realized by the following scheme: introducing immune compatible molecules and an inducible gene expression system into the genome of the pluripotent stem cells or the derivatives thereof, wherein the expression of the immune compatible molecules introduced into the genome of the pluripotent stem cells or the derivatives thereof is regulated by the inducible gene expression system, and the on and off of the inducible gene expression system are regulated by an exogenous inducer; when the immune compatible molecule is normally expressed, the expression of genes related to immune response in the pluripotent stem cell or the derivative thereof is inhibited or overexpressed, so that the allogeneic immune rejection response between the donor cell and the recipient can be eliminated or reduced; when the donor cell is diseased, the expression of the immune compatible molecules can be switched off through the induction of an exogenous inducer, and the antigen presenting capability of the donor cell is recovered, so that the diseased donor cell can be eliminated by a receptor.
The second aspect of the present invention is to provide the use of the pluripotent stem cells or derivatives thereof for preparing a medicament for treating diabetes.
In a third aspect, the present invention provides a preparation comprising the pluripotent stem cells or derivatives thereof.
In order to achieve the purpose, the technical scheme adopted by the invention is as follows:
in a first aspect of the present invention, there is provided a pluripotent stem cell expressing adipsin or a derivative thereof, wherein an expression sequence of adipsin is introduced into the genome of the pluripotent stem cell or the derivative thereof.
The sequence of the adipsin is shown in SEQ ID NO. 1.
The introduction site of the expression sequence of the adipsin is a genome safety site of the pluripotent stem cell or a derivative thereof.
The genome safe site comprises one or more of an AAVS1 safe site, an eGSH safe site and an H11 safe site.
As another technical scheme of the invention: the B2M and/or CIITA gene of the pluripotent stem cell or the derivative thereof is knocked out, so that an immune compatible pluripotent stem cell expressing adipsin or the derivative thereof is obtained.
As another technical scheme of the invention: the genome of the pluripotent stem cell or the derivative thereof is also introduced with one or more immune compatible molecule expression sequences, and the immune compatible molecule is used for regulating and controlling the expression of genes related to immune response (allogeneic immune rejection) in the pluripotent stem cell or the derivative thereof, so that the immune compatible pluripotent stem cell expressing adipsin or the derivative thereof is obtained.
The genes associated with the immune response include:
(1) major histocompatibility complex genes including at least one of HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DQA1, HLA-DQB1, HLA-DPA1 and HLA-DPB 1;
(2) major histocompatibility complex-associated genes including at least one of B2M and CIITA.
The introduction site of the expression sequence of the immune compatible molecule is a genome safety site of the pluripotent stem cell or the derivative thereof.
The genome safe site comprises one or more of an AAVS1 safe site, an eGSH safe site and an H11 safe site.
The immune-compatible molecule includes any one or more of:
(1) immune tolerance related genes including CD47 or HLA-G;
(2) HLA-C molecules, including HLA-C multiple alleles of which the proportion in the population is over 90 percent in total, or fusion protein genes consisting of the HLA-C multiple alleles of which the proportion is over 90 percent and B2M;
(3) shRNA and/or shRNA-miR of major histocompatibility complex genes including at least one of HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DQA1, HLA-DQB1, HLA-DPA1, and HLA-DPB 1;
(4) shRNA and/or shRNA-miR of a major histocompatibility complex-associated gene that includes at least one of B2M and CIITA.
The target sequence of the shRNA and/or shRNA-miR of B2M is at least one of SEQ ID NO. 2-SEQ ID NO. 4;
the target sequence of the shRNA and/or shRNA-miR of the CIITA is at least one of SEQ ID NO. 5-SEQ ID NO. 14;
the target sequence of the shRNA and/or shRNA-miR of the HLA-A is at least one of SEQ ID NO. 15-SEQ ID NO. 17;
the target sequence of the shRNA and/or shRNA-miR of the HLA-B is at least one of SEQ ID NO. 18-SEQ ID NO. 23;
the target sequence of the shRNA and/or shRNA-miR of the HLA-C is at least one of SEQ ID NO. 24-SEQ ID NO. 29;
the target sequence of the shRNA and/or shRNA-miR of the HLA-DRA is at least one of SEQ ID NO. 30-SEQ ID NO. 39;
the target sequence of the shRNA and/or shRNA-miR of the HLA-DRB1 is at least one of SEQ ID NO. 40-SEQ ID NO. 44;
the target sequence of the shRNA and/or shRNA-miR of the HLA-DRB3 is at least one of SEQ ID NO. 45-SEQ ID NO. 46;
the target sequence of the shRNA and/or shRNA-miR of the HLA-DRB4 is at least one of SEQ ID NO. 47-SEQ ID NO. 56;
the target sequence of the shRNA and/or shRNA-miR of the HLA-DRB5 is at least one of SEQ ID NO. 57-SEQ ID NO. 65;
the target sequence of the shRNA and/or shRNA-miR of the HLA-DQA1 is at least one of SEQ ID NO. 66-SEQ ID NO. 72;
the target sequence of the shRNA and/or shRNA-miR of the HLA-DQB1 is at least one of SEQ ID NO. 73-SEQ ID NO. 82;
the target sequence of the shRNA and/or shRNA-miR of the HLA-DPA1 is at least one of SEQ ID NO. 83-SEQ ID NO. 92;
the target sequence of the shRNA and/or shRNA-miR of the HLA-DPB1 is at least one of SEQ ID NO. 93-SEQ ID NO. 102.
shRNA and/or miRNA processing complex related genes and/or anti-interferon effector molecules are also introduced into the genome of the pluripotent stem cell or the derivative thereof.
The shRNA and/or miRNA processing complex related gene comprises at least one of Drosha, Ago1, Ago2, Dicer1, Exportin-5, TRBP (TARBP2), PACT (PRKRA) and DGCR 8; the anti-interferon effector molecule is shRNA and/or shRNA-miR of at least one of PKR, 2-5As, IRF-3 and IRF-7.
The introduction site of the shRNA and/or miRNA processing complex related gene and/or anti-interferon effector molecule is a genome safety site of the pluripotent stem cell or the derivative thereof.
The genome safe site comprises one or more of an AAVS1 safe site, an eGSH safe site and an H11 safe site.
The target sequence of the shRNA and/or shRNA-miR of the PKR is at least one of SEQ ID NO. 103-SEQ ID NO. 112;
the target sequence of the shRNA and/or shRNA-miR of the 2-5As is at least one of SEQ ID NO. 113-SEQ ID NO. 142;
the target sequence of the shRNA and/or shRNA-miR of the IRF-3 is at least one of SEQ ID NO. 143-SEQ ID NO. 152;
the target sequence of the shRNA and/or shRNA-miR of the IRF-7 is at least one of SEQ ID NO. 153-SEQ ID NO. 162.
The expression frameworks of the major histocompatibility complex gene, the major histocompatibility complex related gene, PKR, 2-5As, the shRNA and/or shRNA-miR of IRF-3 or IRF-7 are As follows:
(1) shRNA expression framework: sequentially comprising an shRNA target sequence, a stem-loop sequence, a reverse complementary sequence of the shRNA target sequence and Poly T from 5 'to 3'; the two reverse complementary target sequences are separated by a middle stem-loop sequence to form a hairpin structure, and finally Poly T is connected to be used as a transcription terminator of RNA polymerase III;
(2) shRNA-miR expression framework: replacing a target sequence in the microRNA-30 or the microRNA-155 with the shRNA-miR target sequence of the major histocompatibility complex gene, the major histocompatibility complex related gene, PKR, 2-5As, IRF-3 or IRF-7 to obtain the gene.
The length of a stem-loop sequence in the shRNA expression frame is 3-9 bases; the length of the Poly T is 5-6 bases.
The expression frame can be added with a constitutive promoter or an inducible promoter, such as a U6 promoter and an H1 promoter, and matched promoter regulatory elements at the 5' end according to requirements.
As another technical scheme of the invention: an inducible gene expression system is also introduced into the genome of the pluripotent stem cell or the derivative thereof for regulating and controlling the expression of the immune compatible molecules, so that the immune compatible reversible pluripotent stem cell expressing adipsin or the derivative thereof is obtained.
The inducible gene expression system is at least one of a Tet-Off system and a dimer inducible expression system.
The introduction site of the inducible gene expression system is a genome safety site of the pluripotent stem cell or the derivative thereof.
The genome safe site comprises one or more of an AAVS1 safe site, an eGSH safe site and an H11 safe site.
The introduction of the expression sequence of adipsin, the expression sequence of an immune compatible molecule, the shRNA and/or miRNA processing complex related gene, the anti-interferon effector molecule and the inducible gene expression system adopts a method of viral vector interference, non-viral vector transfection or gene editing.
The method of gene editing comprises gene knock-in.
The pluripotent stem cells comprise embryonic stem cells, embryonic germ cells, embryonic carcinoma cells or induced pluripotent stem cells; the pluripotent stem cell derivative includes an adult stem cell, each germ layer cell or tissue into which the pluripotent stem cell is differentiated.
The adult stem cells comprise mesenchymal stem cells and neural stem cells.
In a second aspect of the present invention, there is provided a use of the pluripotent stem cell or the derivative thereof for preparing a medicament for treating diabetes.
In a third aspect of the invention, there is provided a formulation comprising the pluripotent stem cells or derivatives thereof.
The formulation further comprises a pharmaceutically acceptable carrier, diluent or excipient.
The beneficial effects of the invention are:
the pluripotent stem cells or derivatives thereof for expressing adipsin provided by the invention can be used for inducing iPSCs (induced pluripotent stem cells) from autologous cells or differentiating into low-immunogenicity cells such as MSCs (mesenchymal stem cells) for application, can continuously express adipsin in vivo, and can be used for treating diabetes and related diseases.
The B2M and CIITA genes in the pluripotent stem cells or the derivatives thereof are knocked out, or an immune compatible molecule expression sequence is introduced into the genome of the pluripotent stem cells or the derivatives thereof, so that the pluripotent stem cells or the derivatives thereof have low immunogenicity, and when the pluripotent stem cells or the derivatives thereof are transplanted into a receptor, the problem of allogeneic immune rejection between donor cells and the receptor can be overcome, so that the donor cells can continuously express the adipsin in the receptor for a long time.
The genome of the immune compatible reversible pluripotent stem cell or the derivative thereof for expressing adipsin is introduced with an inducible gene expression system and an immune compatible molecule expression sequence. The inducible gene expression system is controlled by an exogenous inducer, and the opening and closing of the inducible gene expression system are controlled by adjusting the addition amount, the continuous action time and the type of the exogenous inducer, so that the expression quantity of the epidemic compatible molecular expression sequence is controlled. While the immune-compatible molecule may regulate the expression of genes associated with an immune response in the pluripotent stem cell or derivative thereof. When the immune compatible molecule is normally expressed, the expression of the genes related to the immune response in the pluripotent stem cell or the derivative thereof is inhibited or overexpressed, so that the allogeneic immune rejection response between the donor cell and the recipient can be eliminated or reduced, and the donor cell can continuously express adipsin in the recipient for a long time. When the donor cell is diseased, the expression of the immune compatible molecules can be closed by induction of an exogenous inducer, so that the HLA class I molecules can be reversibly re-expressed on the surface of the donor cell, the antigen presenting capability of the donor cell is recovered, and the diseased cell can be eliminated by a receptor, thereby improving the clinical safety of the general pluripotent stem cell or the derivative thereof, and greatly expanding the value of the general pluripotent stem cell in clinical application.
In addition, the addition amount and the lasting action time of the exogenous inducer can be adjusted to ensure that the transplant gradually expresses low-concentration HLA molecules to stimulate the receptor, so that the receptor gradually generates tolerance on the transplant, and finally stable tolerance is achieved. At the moment, even if the HLA class I molecules with unmatched HLA class I molecule expression on the surface of the transplanted cells can be compatible with the recipient immune system, so that after the expression of the immune compatible molecules in the transplanted cells is induced to be closed, the recipient immune system can re-identify the cells with gene mutation presented by the HLA class I molecules in the transplanted cells on one hand, and eliminate diseased cells; on the other hand, the non-mutated part is not cleared by the recipient immune system due to the allogeneic HLA class i molecule tolerance produced by training with the above-mentioned inducers. Thus, the recipient immune system can only eliminate the graft with harmful mutation, the graft with normal function is kept, and when the harmful graft is eliminated, the mode of HLA class I molecule silencing on the cell surface of the graft can be transferred. The graft tolerance program mediated by the exogenous inducer can also be used to implant a graft that does not induce or otherwise induce the turning on or off of the surface expression of HLA class i molecules after the recipient has become fully tolerant.
Drawings
FIG. 1 is a plasmid map of AAVS1 KI (Knock-in, the same below) Vector (shRNA, constitutive).
FIG. 2 is an AAVS1 KI Vector (shRNA, inducible) plasmid map.
FIG. 3 is an AAVS1 KI Vector (shRNA-miR, constitutive) plasmid map.
FIG. 4 is an AAVS1 KI Vector (shRNA-miR, inducible) plasmid map.
FIG. 5 is a sgRNA clone B2M-1 plasmid map.
FIG. 6 is a sgRNA clone B2M-2 plasmid map.
FIG. 7 is a sgRNA clone CIITA-1 plasmid map.
FIG. 8 is a sgRNA clone CIITA-2 plasmid map.
Fig. 9 is a Cas9(D10A) plasmid map.
FIG. 10 is a sgRNA Clone AAVS1-1 plasmid map.
FIG. 11 is a sgRNA Clone AAVS1-2 plasmid map.
Detailed Description
The present invention will be described in further detail with reference to the following specific embodiments and accompanying drawings.
It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.
Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. The various chemicals used in the examples are commercially available.
1 Experimental materials and methods
1.1adipsin
The sequence of adipsin is shown in SEQ ID NO. 1.
1.2 pluripotent Stem cells or derivatives thereof
The pluripotent stem cells can be selected from Embryonic Stem Cells (ESCs), Induced Pluripotent Stem Cells (iPSCs) and other forms of pluripotent stem cells, such as hPSCs-MSCs, NSCs, EBs cells. Wherein:
ESCs: HN4 cells were selected and purchased from Shanghai department of sciences.
And (3) iPSCs: using a third generation highly efficient and safe episomal-iPSCs induction system (6F/BM1-4C) established by us, pE3.1-OG-KS and pE3.1-L-Myc-hmiR 302 cluster are transferred into somatic cells through electricity, RM1 is cultured for 2 days, BioCISO-BM1 containing 2uM Parnate is cultured for 2 days, BioCISO-BM1 containing 2uM Parnate, 0.25mM sodium butyrate, 3uM CHIR99021 and 0.5uM PD03254901 is cultured for 2 days, iPSCs clones can be picked up after being cultured to about 17 days by using a dry cell culture medium BioCISO, and the picked iPSCs clones are purified, digested and passaged to obtain stable iPSCs. The specific construction method is as follows: stem Cell Res ther.2017nov 2; 8(1):245.
hPSCs-MSCs: iPSCs are cultured for 25 days by using a stem cell culture medium (BioCISO containing 10uM TGF beta inhibitor SB431542), during which digestion passage (2mg/mL Dispase digestion) is carried out at 80-90 confluence, passage is carried out at 1:3 into a Matrigel coated culture plate, then ESC-MSC culture medium (knockkockout DMEM culture medium containing 10% KSR, NEAA, diabody, glutamine, beta-mercaptoethanol, 10ng/mL bFGF and SB-431542) is cultured, fluid is changed every day, passage is carried out at 80-90 confluence (passage is carried out at 1: 3), and continuous culture is carried out for 20 days. The specific construction method is as follows: proc Natl Acad Sci U S A.2015; 112(2):530-535.
NSCs: iPSCs are cultured for 14 days by using an induction medium (a knockout DMEM medium containing 10% KSR, a TGF-beta inhibitor and a BMP4 inhibitor), rose annular nerve cells are picked to a low-adhesion culture plate for culture, the culture medium is cultured by using DMEM/F12 (containing 1% N2 and Invitrogen) and Neurobasal medium (containing 2% B27 and Invitrogen) in a ratio of 1:1 and also contains 20ng/ml bFGF and 20ng/ml EGF, and digestion is carried out by using Accutase for digestion and passage. The specific construction method is as follows: FASEB J.2014; 28(11):4642-4656.
EBs cells: and digesting iPSCs with the confluence of 95% for 6min by using a BioC-PDE1, scraping the cells into blocks by using a mechanical scraping method, settling and reducing cell masses, transferring the settled cell masses into a low-adhesion culture plate, culturing for 7 days by using a BioCISO-EB1, and changing the liquid every other day. After 7 days, the cells were transferred to a Matrigel-coated plate and adherent culture was continued using BioCISO, and Embryoid Bodies (EBs) having an inner, middle and outer mesoderm structure were obtained after 7 days. The specific construction method is as follows: stem Cell Res ther.2017nov 2; 8(1):245.
The pluripotent stem cell derivative also includes adult stem cells, each germ layer cell or tissue, organ into which the pluripotent stem cells are differentiated; the adult stem cells include mesenchymal stem cells or neural stem cells.
1.3 genomic safety sites
In the technical scheme of the invention, the genome safety locus for knocking-in the gene can be selected from an AAVS1 safety locus, an eGSH safety locus or other safety loci:
(1) AAVS1 safety site
The AAVS1 site (the alias "PPP 1R2C site") is located on chromosome 19 of the human genome and is a verified "safe harbor" site that ensures the desired function of the transferred DNA fragment. The site is an open chromosome structure, can ensure that the transgene can be normally transcribed, and has no known side effect on cells when the exogenous target segment is inserted into the site.
(2) eGSH safe site
The eGSH safe site is located on chromosome 1 of the human genome, and is another 'safe harbor' site which can ensure the expected function of the transferred DNA fragment after the paper verifies.
(3) Other safety sites
The H11 safe site (also called Hipp11) is located on the number 22 chromosome of a human, is a site between two genes Eif4enif1 and Drg1, is discovered and named in 2010 by Simon Hippenmeyer, and has little risk of influencing endogenous gene expression after the insertion of a foreign gene because the H11 site is located between the two genes. The H11 site was verified to be a safe transcription activation region between genes, a new "safe harbor" site outside the AAVS1, eGSH sites.
1.4 inducible Gene expression System
The inducible gene expression system is selected from: tet-Off system or dimer-Off expression system:
(1) tet-Off system
In the absence of tetracycline, the tTA protein continues to act on the tet promoter, resulting in sustained gene expression. This system is very useful in situations where it is desirable to maintain the transgene in a sustained expression state. When tetracycline is added, the tetracycline can change the structure of the tTA protein, so that the tTA protein cannot be combined with a promoter, and the expression level of a gene driven by the tTA protein is reduced. In order to keep the system in the "off" state, tetracycline must be continuously added.
The invention knocks the sequence of the tet-Off system and one or more immune compatible molecules into the genome safety site of the pluripotent stem cell, and accurately turns on or Off the expression of the immune compatible molecules through the addition of tetracycline, thereby reversibly regulating the expression of major histocompatibility complex related genes in the pluripotent stem cell or the derivative thereof.
(2) Dimer-switched off expression system
Dimer-mediated gene expression regulation system: there are many ways of chemically regulating transcription of target genes, most commonly regulated using allosteric modulators that influence the activity of transcription factors. One such method is the use of dimerizing inducers or dimers to recombine active transcription factors on inactive fusion proteins. The most commonly used system is rapamycin (rapamydn), a natural product, or an analog that is biologically inactive, as the drug for dimerization. The rapamycin (or analog) sibling protein FKBP12 (the protein to which FKBP binds to FK 506) and a large serine-threonine protein kinase, known as FRAP [ FRBP-rapamycin associated protein, mTOR (mammalian target of rapamycin), have high affinity and function to bind to both proteins, thus bringing them together as a heterologous dimer. To regulate transcription of a target gene, a DNA binding domain is fused to one or more FKBP domains and a transcription repressing domain is fused to amino acid position 93 of FRAP, designated FRB, which is sufficient to bind the FKBP-rapamycin complex. Dimerization of these two fusion proteins can only occur in the presence of rapamycin. Thus inhibiting transcription of genes having sites that bind to the DNA binding region.
1.5 immune compatible molecules
The immune compatible molecule can regulate the expression of allogeneic immune rejection related genes in the pluripotent stem cells or derivatives thereof.
The types and sequences of specific immune-compatible molecules are shown in table 1.
TABLE 1 immune-compatible molecules
Figure BDA0002751430930000101
Figure BDA0002751430930000111
Figure BDA0002751430930000121
The target sequences of the shRNA or shRNA-miR immune compatible molecules are shown in Table 2.
TABLE 2 target sequences for shRNA or shRNA-miR
Figure BDA0002751430930000122
Figure BDA0002751430930000131
Figure BDA0002751430930000141
Figure BDA0002751430930000151
Figure BDA0002751430930000161
Figure BDA0002751430930000171
In the immune compatible molecule knock-in schemes of tables 5-6 below, the shRNA or shRNA-miR sequences of each experimental group are shRNA or shRNA-miR immune compatible molecules constructed by using the target sequence 1 in table 2. Those skilled in the art will understand that: the shRNA or shRNA-miR immune compatible molecule constructed by other target sequences can also realize the technical effect of the invention and all fall into the protection scope of the claims of the invention.
1.6shRNA/miRNA processing complex gene and anti-interferon effector molecule
The primary miRNA (pri-miRNA) in the nucleus is microprocessed through the complex Drosha-DGCR8, which cleaves the pri-miRNA to a precursor miRNA (pre-miRNA), which forms a hairpin. Then, the pre-miRNA is transported out of the nucleus via the Exportin-5-Ran-GTP complex. The RNase Dicer enzyme, which binds to the double-stranded RNA-binding protein TRBP (TARBP2) in the cytoplasm, breaks down the pre-miRNA into mature lengths, at which point the miRNA is still in a double-stranded state. Finally, it is transported into AGO2 to form RISC (RNA-induced silencing complex). Finally, one strand of the miRNA double strand is retained in the RISC complex, and the other strand is eliminated and rapidly degraded. While DGCR8, the main binding protein of Drosha, can bind to pri-miRNA through two double-stranded RNA binding regions at its C-terminal end, recruit and guide Drosha to cut at the right position of pri-miRNA to produce pre-miRNA, which is further cut by Dicer and TRBP/PACT processing to form mature miRNA. Deletion or abnormal expression of DGCR8 affects the cleavage activity of Drosha, which in turn affects the activity of miRNA, leading to disease. TRBP is able to recruit Dicer complex mirnas to form RISC Ago 2.
According to the invention, by using a gene knock-in technology, when the shRNA-miR expression sequences aiming at HLA class I molecules, HLA class II molecules and the like which can be induced to close expression are knocked in at a genome safety site, preferably, shRNA and/or miRNA processing machines which can be induced to close expression are knocked in at the same time, wherein the shRNA and/or miRNA processing machines comprise Drosha (access number: NM-001100412), Ago1(access number: NM-012199), Ago2(access number: NM-001164623), Dicer1(access number: NM-001195573), export-5 (access number: NM-020750), TRBP (access number: NM-134323), PACT (access number: NM-003690) and DGCR8(access number: NM-022720), so that cells do not occupy the processing of other miRNAs and influence the cell functions.
In addition, during IFN induction, double-stranded RNA-dependent Protein Kinase (PKR), which is a key factor of the whole cell signal transduction pathway, and 2 ', 5' Oligoadenylate Synthetase (2,5-Oligoadenylate Synthetase,2-5As), which are closely related to dsRNA-induced IFN, are involved. PKR can inhibit protein synthesis by phosphorylating eukaryotic cell transcription factors, arrest cells in G0/G1 and G2/M phases and induce apoptosis, while dsRNA can promote synthesis of 2-5As, which results in nonspecific activation of RNase, RNaseL, degradation of all mRNA in cells and cell death. The specificity of induction of type I interferons is achieved by members of the IRF transcription factor family, which are not inducible to be secreted in many viral infections in the absence of IRF-3 and IRF-7 expression in cells. Lack of IFN response, in order to recover, requires the two proteins were expressed together.
According to the invention, by utilizing a gene knock-in technology, when an immune compatible molecule shRNA-miR expression sequence is knocked in at a genome safety site, shRNA and/or shRNA-miR expression sequences which can induce closed expression and aim at suppressing PKR, 2-5As, IRF-3 and IRF-7 genes are preferably knocked in at the same time, so that interferon reaction induced by dsRNA is reduced, and cytotoxicity is avoided.
The sequence of the insertion positions of the shRNA/miRNA processing complex related gene, the anti-interferon effector molecule and the immune compatible molecule at the genome safety site is not limited, and the shRNA/miRNA processing complex related gene, the anti-interferon effector molecule and the immune compatible molecule can be arranged in any sequence without mutual interference or influence on the structure and the function of other genes of the genome.
Specific target sequences for anti-interferon effector molecules are shown in table 3.
TABLE 3 target sequences for anti-interferon effector molecules
Figure BDA0002751430930000181
Figure BDA0002751430930000191
Figure BDA0002751430930000201
In the anti-interferon effector molecule knock-in schemes of tables 5 to 6 below, the anti-interferon effector molecules of each experimental group were all anti-interferon effector molecules constructed using target sequence 1 in table 3. Those skilled in the art will understand that: the anti-interferon effector molecules constructed by other target sequences can also achieve the technical effects of the invention and fall into the protection scope of the claims of the invention.
1.7 Universal framework sequences of the immune compatible molecules, the shRNA or shRNA-miR universal framework immune compatible molecules of the anti-interferon effector molecules, and the shRNA or shRNA-miR universal framework molecules of the anti-interferon effector molecules are as follows:
(1) the constitutive expression framework of shRNA is:
GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGCTAGCGCCACC(SEQ ID NO.163)N1...N21TTCAAGAGA(SEQ ID NO.164)N22...N42TTTTTT；
wherein:
a、N1...N21shRNA target sequence for the corresponding Gene, N22...N42Is a reverse complementary sequence of the shRNA target sequence of the corresponding gene;
b. if the plasmid needs to express shRNAs of a plurality of genes, each gene corresponds to a shRNA expression frame and then is connected seamlessly;
c. constitutive shRNA plasmids with different resistance genes only have different resistance genes and have the same other sequences;
d. n represents A, T, G, C bp;
e. SEQ ID No.163 is the U6 promoter sequence;
f. SEQ ID NO.164 is a stem-loop sequence.
(2) The shRNA inducible expression framework is as follows:
GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGCTCGGTACCCGGGTCGAGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTGCTAGCGCCACC(SEQ ID NO.165)N1...N21TTCAAGAGA(SEQ ID NO.164)N22...N42TTTTTT；
wherein:
a、N1...N21shRNA target sequence for the corresponding Gene, N22...N42Is a reverse complementary sequence of the shRNA target sequence of the corresponding gene;
b. if the plasmid needs to express shRNAs of a plurality of genes, each gene corresponds to a shRNA expression frame and then is connected seamlessly;
c. constitutive shRNA plasmids with different resistance genes only have different resistance genes and have the same other sequences;
d. n represents A, T, G, C bp;
e. SEQ ID No.165 is the H1 TO promoter sequence;
f. SEQ ID NO.164 is a stem-loop sequence.
(3) The shRNA-miR constitutive or inducible expression framework is as follows:
the shRNA-miR target sequence is used for replacing a target sequence in microRNA-30 to obtain the shRNA-miR target sequence, and the specific sequence is as follows:
GAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAACACTTGCTGGGATTACTTCTTCAGGTTAACCCAACAGAAGGCTAAAGAAGGTATATTGCTGTTGACAGTGAGCG(SEQ ID NO.166)M1N1...N21TAGTGAAGCCACAGATGTA(SEQ ID NO.167)
N22...N42M2TGCCTACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCAATTATCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGATACATTTTTACAAAGCTGAATTAAAATGGTATAAAT(SEQ ID NO.168)；
wherein:
a、N1...N21shRNA-miR target sequence, N, of the corresponding Gene22...N42Is a reverse complementary sequence of shRNA-miR target sequence of a corresponding gene;
b. if the plasmid needs to express shRNA-miR of a plurality of genes, each gene corresponds to a shRNA-miR expression frame and is then connected seamlessly;
c. constitutive shRNA-miR plasmids with different resistance genes only have different resistance genes and have the same other sequences;
d. m is A or C, N is A, T, G, C;
e. if N is present1Is a G base, then M1Is A base; otherwise M1Is a C base;
f、M1base and M2And (3) base complementation.
1.8 Gene editing System, Gene editing method and test method
1.8.1 Gene editing System
The gene editing technology of the patent adopts a CRISPR-Cas9 gene editing system. The Cas9 protein used was Cas9(D10A), Cas9(D10A) bound to sgrnas responsible for specific recognition of the target sequence (genomic DNA) which was then single-stranded cleaved by Cas9 (D10A). Double Strand breaks in genomic DNA (DSB) must occur, and two Cas 9(D10A)/sgRNA must cleave the two strands of genomic DNA separately, and not too far apart. The Cas 9(D10A)/sgRNA scheme has the advantage of higher specificity and lower probability of off-target compared to the Cas 9/sgRNA scheme. The plasmids or Donor fragments used in the gene editing system were: cas9(D10A) plasmid, sgRNA clone plasmid, Donor fragment.
(1) Cas9(D10A) plasmid: a plasmid expressing the Cas9(D10A) protein, specifically single-stranded cleaving genomic DNA under the direction of sgrnas.
(2) sgRNA plasmid: a plasmid expressing sgRNA (small guide RNA) is a guide RNA (guide RNA, gRNA) responsible for directing targeted cleavage of the expressed Cas9(D10A) protein at gene editing.
(3) Donor fragment: the two ends contain recombination arms which are respectively positioned at the left side and the right side of the breaking position of the genome DNA, and the middle part contains genes, fragments or expression elements needing to be inserted. In the presence of the Donor fragment, the cells undergo a Homologous Recombination (HR) reaction at the site of the genomic break. If the Donor fragment is not added, Non-homologous End Joining-NHEJ reaction occurs at the site of the genomic break in the cell. This fragment was obtained by digesting KI (Knock-in, the same applies hereinafter) Vector plasmid and recovering it.
1.8.2 constitutive and inducible plasmids
Constitutive plasmid: the expression function of the Donor fragment obtained from the constitutive plasmid cannot be regulated after knocking in the genomic DNA.
Inducible plasmids: after knocking in the genomic DNA, the expression function of the Donor fragment obtained from the inducible plasmid can be controlled by adding an inducer, which is equivalent to adding a switch for turning on or off the expression function.
1.8.3 plasmid construction method
(1) Cas9(D10A) plasmid: the Plasmid no longer needs to be constructed and is ordered directly from Addgene (Plasmid 41816, Addgene).
(2) sgRNA plasmid: the original blank Plasmid is ordered from Addge (Plasmid 41824, Addge), then the DNA sequence is input in the website (URL: https:// ccttop. cos. uni-heidelberg. de) to design the target sequence, and finally different target sequences are respectively put into the blank sgRNA Plasmid to complete the construction.
(3) KI Vector plasmid:
acquisition of Amp (R) -pUC origin fragment: designing PCR primers, and amplifying and recovering the fragment by using a high fidelity enzyme (Nanjing Nozaki organism, P505-d1) through a PCR method by using a pUC18 plasmid as a template;
acquisition of aavs1 or eGSH recombination arms: extracting genome DNA of human cells and designing corresponding primers, and then amplifying and recovering the fragments by using the human genome DNA as a template and using a high fidelity enzyme (Nanjing Novozam organism, P505-d1) through a PCR method;
c. acquisition of the individual plasmid elements: designing PCR amplification primers of each element, and then respectively amplifying and recovering each plasmid element by using a plasmid containing the element as a template and using a high fidelity enzyme (Nanjing NuoZanza, P505-d1) through a PCR method;
d. assembly into a complete plasmid: the fragments obtained in the previous step were ligated together using a multi-fragment recombinase (Nanjing Nozam, C113-02) to form a complete plasmid.
1.8.4 Gene editing Process
Firstly, the single cell cloning operation procedure of AAVS1 gene knock-in (1) electrotransfer program:
donor cell preparation: human pluripotent stem cells.
The kit comprises: human Stem Cell
Figure BDA0002751430930000241
Kit 1。
The instrument comprises the following steps: an electrotransformation instrument.
Culture medium: BioCISO.
Induction of plasmid: cas9D10A, sgRNA clone AAVS1-1, sgRNA clone AAVS1-2, AAVS1 neo Vector I and AAVS1 neo Vector II.
Note: induction plasmid used for the knock-in of the eGSH gene: cas9D10A, sgRNA clone eGSH-1, sgRNA clone eGSH-2, eGSH-neo/eGSH-puro (donor) comparison of the donor plasmid with AAVS1 shows that only the right and left recombination arms are different, and the other elements are the same. Since the gene editing process of eGSH is the same as that of AAVS1, the following description will not be repeated.
(2) The transformed human pluripotent stem cells are screened in a double antibiotic medium containing G418 and puro.
(3) And (4) carrying out single cell clone screening and culture to obtain a single cell clone strain.
Second, AAVS1 gene knock-in single cell clone strain culture reagent
(1) Culture medium: BioCISO + 300. mu.g/mL G418+ 0.5. mu.g/mL puro (should be placed at room temperature in advance, protected from light for 30-60 minutes until room temperature is restored. Note that BioCISO should not be placed at 37 ℃ for preheating to avoid reduction of the activity of the biomolecule.).
(2) Matrix glue: hESC grade Matrigel (before passage or cell recovery, the Matrigel working solution is added into a cell culture bottle dish and is shaken up to ensure that the Matrigel completely sinks to the bottom of the culture bottle dish and any Matrigel cannot be dried before use. to ensure that the cells can be attached to the wall and survive better, the Matrigel is put into a 37 ℃ culture box for 1:100X Matrigel cannot be less than 0.5 hour and 1:200X Matrigel cannot be less than 2 hours.).
(3) Digestion solution: EDTA was dissolved using DPBS to a final concentration of 0.5mM, pH7.4 (note: EDTA cannot be diluted with water, otherwise the cells die due to reduced osmotic pressure).
(4) Freezing and storing liquid: 60% BioCISO + 30% ESCs grade FBS + 10% DMSO (frozen stock is preferably ready for use).
Thirdly, the conventional maintenance subculture process
(1) Optimal time of passage and passage ratio
a. The best passage time: the overall confluency of the cells reaches 80 to 90 percent;
b. the optimal ratio of passage: the optimal confluency of the mixture is maintained at 20-30% in the next day after 1: 4-1: 7 passages.
(2) Passage process
a. The Matrigel in the coated cell culture flask dishes was previously aspirated away, and an appropriate amount of medium (BioCISO + 300. mu.g/mL G418+ 0.5. mu.g/mL puro) was added to the flask and placed at 37 ℃ in 5% CO2Incubation in an incubator;
b. when the cells meet the requirement of passage, sucking the supernatant of the culture medium, and adding a proper amount of 0.5mM EDTA digestive solution into a cell bottle dish;
c. the cells were incubated at 37 ℃ with 5% CO2Incubating in an incubator for 5-10 minutes (digesting until most cells are observed to shrink and become round under a microscope but not float, gently blowing the cells to separate the cells from the wall, sucking the cell suspension into a centrifugal tube, and centrifuging for 5 minutes at 200 g;
d. after centrifugation, discarding the supernatant, suspending the cells by using a culture medium, gently and repeatedly blowing the cells for several times until the cells are uniformly mixed, and then transferring the cells to a petrigel-coated bottle dish prepared in advance;
e. after the cells were transferred to the cell flask, the cells were horizontally shaken up all around, observed under a mirror to be free from abnormality, and then shaken up and placed at 37 ℃ with 5% CO2Culturing in an incubator;
f. observing the adherent survival state of the cells the next day, and normally and regularly changing the culture medium every day by sucking off the culture medium.
Fourthly, freezing and storing cells
(1) Digesting the cells by using 0.5mM EDTA according to the conventional passage operation steps until most cells shrink and become round but do not float, gently blowing and beating the cells, collecting cell suspension, centrifuging for 5 minutes at 200g, discarding supernatant, adding a proper amount of freezing medium to resuspend the cells, and transferring the cells to a freezing tube (one six-well plate with the confluence of 80% is recommended to be frozen, and the volume of the freezing medium is 0.5 mL/per tube);
(2) placing the freezing tube in a programmed cooling box, and immediately placing the freezing tube at-80 ℃ overnight (ensuring that the temperature of the freezing tube is reduced by 1 ℃ per minute);
(3) the next day the cells were immediately transferred into liquid nitrogen.
Fifth, cell recovery
(1) Preparing a Matrigel-coated cell bottle dish in advance, sucking out the Matrigel before recovering the cells, adding a proper amount of BioCISO into the cell bottle dish, placing at 37 ℃ and 5% CO2Incubation in an incubator;
(2) taking out the cryopreservation tube from liquid nitrogen quickly, immediately putting the tube into a 37 ℃ water bath kettle for quick shaking to quickly melt the cells, carefully observing, stopping shaking after the ice crystals completely disappear, and transferring the cells to a biological safety cabinet;
(3) adding 10mL of DMEM/F12(1:1) basal medium into a 15mL centrifuge tube in advance, balancing to room temperature, sucking 1mL of DMEM/F12(1:1) by using a Pasteur pipette, slowly adding the DMEM/F12(1:1) into a freezing tube, gently mixing, transferring the cell suspension into a prepared 15mL centrifuge tube containing DMEM/F12(1:1), and centrifuging for 5 minutes at 200 g;
(4) carefully removing supernatant, adding appropriate amount of BioCISO, gently mixing cells, seeding into a cell bottle dish prepared in advance, shaking up horizontally, and observing under the mirror, shaking up, and standing at 37 deg.C and 5% CO2Culturing in an incubator;
(5) the adherent survival state of the cells is observed the next day, and the liquid is normally changed on time every day. If the adherence is good, the BioCISO is changed to BioCISO + 300. mu.g/mL G418+ 0.5. mu.g/mL puro.
1.8.5AAVS1 gene knock-in detection method
First, single cell clone AAVS1 gene knock-in detection
(1) AAVS1 Gene knock-in assay
a. The purpose of the test is as follows: detecting the cells subjected to the gene knock-in treatment by PCR, and testing whether the cells are homozygotes; since the two Donor segments only have the difference in the sequences of the resistance genes, it is necessary to determine whether the cell is homozygous (the two chromosomes knock in the Donor segments of different resistance genes respectively), and it is only possible that the double-knocked-in cell is the correct homozygous by detecting whether the genome of the cell contains the Donor segments of the two resistance genes;
b. the test method comprises the steps of designing a primer in a Donor plasmid (non-recombinant arm part), and designing another primer in a genome PPP1R12C (non-recombinant arm part); if the Donor fragment can be correctly inserted into the genome, a target band appears, otherwise no target band appears);
c. test protocol primer sequences and PCR protocols are shown in Table 4.
TABLE 4 test protocol primer sequences and PCR protocol
Figure BDA0002751430930000261
Figure BDA0002751430930000271
Second, the detection method of eGSH gene knock-in is the same as the detection principle and method of AAVS1 gene knock-in, and will not be described here.
1.8.6 inspection method of knock-in Gene method at genomic safety site
(1) The purpose of the test is as follows: the cells treated by knock-in were tested for homozygote by PCR. Since the two Donor fragments have only difference in the sequences of the resistance genes, it is necessary to determine whether the cell is homozygous (the two chromosomes knock in the Donor fragments of different resistance genes), and it is only possible that the double-knocked-in cell is the correct homozygous by determining whether the genome of the cell contains the Donor fragments of the two resistance genes.
(2) The test method comprises the following steps: first, one primer was designed inside the Donor plasmid (non-recombinant arm portion), and then the other primer was designed in the genome (non-recombinant arm portion). If the Donor fragment is inserted correctly in the genome, the target band will appear, otherwise no target band will appear.
1.9 method for determining expression of adipsin of pluripotent stem cells or derivatives thereof
The adipsin expressed by the pluripotent stem cells or derivatives thereof was detected using a human adipsin ELISA kit (shanghai benjie). Collecting culture supernatant of the pluripotent stem cells or the derivatives thereof expressing adipsin, loading the culture supernatant on an enzyme label plate, adding 40uL of sample diluent into a sample hole to be detected, then adding 10uL of sample to be detected, adding culture supernatant of the pluripotent stem cells or the derivatives thereof not expressing adipsin into a control group, and gently mixing the culture supernatants. Sealing the plate, placing at 37 deg.C, incubating for 30min, washing for 5 times, adding enzyme labeling reagent 50uL, sealing the plate, placing at 37 deg.C, incubating for 30min, washing for 5 times, adding color developing solution, developing for 15min, adding stop solution 50uL, and reading to measure absorbance value of 450 nm. (the expression amount of adipsin is positively correlated with the shade of color).
1.10 methods of treatment of mouse diabetes model
In humanized NSG mice (The Jackson Laboratory (JAX)), human immune cells of The same donor were injected to reconstitute The immune system of The mice, and 2 weeks later, 7 days after injection of streptozotocin, blood glucose and urine glucose continued to rise, establishing a mouse diabetes model. Then, tail vein injection of 200uL PBS (containing 10)6The pluripotent stem cell expressing adipsin or a derivative thereof, which is derived from the same donor as the human immune cell) for diabetes treatment. The therapeutic effect is judged by detecting the blood sugar level in blood.
2. Experimental protocol
The experimental protocol for knocking in the gene expressing adipsin, one or more immune compatible molecules, shRNA and/or miRNA processing complex-related genes, anti-interferon effector molecules into a safe site of the genome of the pluripotent stem cell is shown in table 5-table 6, wherein a "+" sign indicates knocking in of a gene or nucleic acid sequence and a "-" sign indicates knocking out of a gene.
TABLE 5 constitutive expression protocol
Figure BDA0002751430930000281
Figure BDA0002751430930000291
The plasmids selected and the specific knock-in positions were as follows:
general principle: the adipsin gene sequence is put at the position of MCS2 of the corresponding plasmid (the adipsin gene sequence structure is that signal peptide 1(SEQ ID NO.182) + the adipsin gene sequence (the tail end of the adipsin gene sequence is added with a stop codon TGA)), the shRNA is put in the shRNA expression frame of the corresponding plasmid, the shRNA-miR is put in the shRNA-miR expression frame of the corresponding plasmid, and other genes are put at the position of MCS1 of the corresponding plasmid.
Note: the sgRNA clone B2M plasmid comprises the sgRNA clone B2M-1 and sgRNA clone B2M-2 plasmids. The sgRNA clone CIITA plasmid comprises sgRNA clone CIITA-1 and sgRNA clone CIITA-2 plasmids. The maps of the plasmids are shown in FIGS. 1 to 11.
(1) A1 grouping
The MCS2 of AAVS1 KI Vector (shRNA, constitutive) plasmid placed the adipsin gene sequence.
(2) A2 grouping
The MCS2 of AAVS1 KI Vector (shRNA, constitutive) plasmid placed the adipsin gene sequence. The shRNA expression framework places the shRNA target sequence (if multiple shrnas are present, they are seamlessly joined). MCS1 was placed into the gene sequence (if multiple genes were present, they were linked using EMCV IRESWt (SEQ ID NO. 177)).
(3) A3 grouping
The adipsin gene sequence was placed in MCS2 of AAVS1 KI Vector (shRNA-miR, constitutive) plasmid. The shRNA-miR expression framework is put into a shRNA-miR target sequence (if a plurality of shRNA-miR exist, the shRNA-miR target sequences are connected seamlessly). MCS1 was placed into the gene sequence (if multiple genes were present, they were ligated using EMCV IRESWT).
(4) A4 grouping
The MCS2 of AAVS1 KI Vector (shRNA, constitutive) plasmid was placed into the adipsin gene sequence, the target sequence of the sgRNA clone B2M plasmid was placed into the sgRNA target sequences of B2M (SEQ ID NO.178 and SEQ ID NO.179), and the target sequence of the sgRNA clone CIITA plasmid was placed into the sgRNA target sequences of CIITA (SEQ ID NO.180 and SEQ ID NO. 181). MCS1 was placed into the gene sequence (if multiple genes were present, they were ligated using EMCV IRESWT).
(5) A5 grouping
Methods grouped with a 2.
(6) A6 grouping
Method of grouping with a 3.
TABLE 6 Experimental protocol for inducible expression (immuno-compatible reversible)
Figure BDA0002751430930000301
(1) B1 grouping:
the adipsin gene sequence was placed in MCS2 of AAVS1 KI Vector (shRNA, inducible). The shRNA expression framework places the shRNA target sequence (if multiple shrnas are present, they are seamlessly joined). MCS1 was placed into the gene sequence (if multiple genes were present, they were ligated using EMCV IRESWT).
(2) B2 grouping:
the adipsin gene sequence was placed in MCS2 of AAVS1 KI Vector (shRNA-miR, inducible) plasmid. The shRNA-miR expression framework is put into a shRNA-miR target sequence (if a plurality of shRNA-miR exist, the shRNA-miR target sequences are connected seamlessly). MCS1 was placed into the gene sequence (if multiple genes were present, they were ligated using EMCV IRESWT).
(3) B3 grouping:
methods grouped with B1.
(4) B4 grouping:
methods grouped with B2.
3. Results of the experiment
3.1 detection of pluripotent Stem cells or derivatives thereof expressing adipsin
The experimental group protocols in tables 5 and 6 are knocked into the genome safety site AAVS1 of iPSCs, MSCs, EBs and NSCs at 37 ℃ and 0.5 percent CO2Culturing in an incubator, collecting culture medium supernatant, loading on an enzyme label plate, loading sample diluent 40uL into a sample hole to be detected, then loading 10uL into the sample to be detected, loading culture supernatant of pluripotent stem cells which do not express adipsin and derivatives thereof into a control group (N), and lightly mixing uniformly. Sealing the plate, placing at 37 deg.C, incubating for 30min, washing for 5 times, adding enzyme labeling reagent 50uL, sealing the plate, placing at 37 deg.C, incubating for 30min, washing for 5 times, adding color developing solution, developing for 15min, adding stop solution 50uL, and reading to measure absorbance value of 450 nm. The results of the tests of the respective experimental groups are shown in Table 7.
TABLE 7 detection results of adipsin expressed in each experimental group
Figure BDA0002751430930000311
Figure BDA0002751430930000321
As can be seen from the above table, the pluripotent stem cell or the derivative thereof of the present invention can effectively express adipsin. And the expression quantity is relatively constant in each group, so that adipsin expressed by the pluripotent stem cells or the derivatives thereof is not influenced by cell differentiation morphology and other exogenous genes (immune compatibility modification).
3.2 application of pluripotent stem cells or derivatives thereof expressing adipsin in treatment of diabetes
We selected cells (iPSCs, hPSCs-MSCs, hPSCs-EBs, hPSCs-NSCs) expressing the adipsin protocol group (A1) for testing. In humanized NSG mouse diabetes model, hPSCs and hPSCs derivatives (hPSCs-MSCs, hPSCs-NSCs and hPSCs-EBs) capable of expressing adipsin are injected, and the effect of treating diabetes is observed by detecting blood sugar level in blood. Note that in order to avoid the problem of immune compatibility, the immunocytes and hPSCs derived derivatives are derived from the same person. The results of the tests of the respective experimental groups are shown in Table 8.
TABLE 8 Effect of pluripotent stem cells expressing adipsin or derivatives thereof on treating diabetes mellitus (blood glucose level test)
Figure BDA0002751430930000322
Figure BDA0002751430930000331
Note: the control group refers to NSG mouse diabetes model without injection of adipsin-expressing hPSCs and hPSCs-derived derivatives.
As can be seen from the above table, in mice treated with diabetes model injected with hpSCs and hpSCs-derived derivatives expressing adipsin, blood glucose level in blood is reduced, which has the effect of treating diabetes.
3.3 reversible expression assay for immune-compatible molecule-inducible expression sets
Through the above embodiments, hPSCs expressing adipsin and derivatives of hPSCs are effective in treating diabetes. We must also consider the issue of immune compatibility of hPSCs and derivatives of hPSCs origin. Therefore we chose a suitable combination to test for immune compatibility.
The characteristic of low immunogenicity of MSCs is utilized, hPSCs (human platelet activating proteins) source immune compatible cell MSCs capable of expressing adipsin are injected into a humanized NSG mouse disease (diabetes) model, and the effect of diabetes treatment is observed by detecting the blood sugar level in blood. Note that the immunocytes used were derived from a non-identical human as the hPSCs-derived MSCs.
The control group refers to the NSG mouse disease (diabetes) model without MSCs cell injection.
The process of adding the Dox group is: mice were fed with 0.5mg/mL of Dox added to the mouse diet, and the mice were used from the injection of the adipsin-expressing cells until the end of the experiment. The results are shown in Table 9.
TABLE 9 reversible expression test results for immune-compatible molecule-inducible expression sets
Figure BDA0002751430930000332
Figure BDA0002751430930000341
The above experiments show that: in the treatment of diabetes, only the adipsin-expressing MSCs (group 2), which have low immunogenicity and can exist in foreign body for a certain period of time, can exert a certain therapeutic effect, while those that are immuno-compatibly engineered (groups 3-11, including constitutive and reversible inducible immuno-compatibility), which have better immuno-compatibility effects, are present in vivo for a longer period of time (or can coexist for a long period of time) than MSCs that are not immuno-compatibly engineered, and exert better therapeutic effects, whereas group 5, which is the B2M and CIITA gene knock-out groups, completely eliminate the effects of HLA-I and HLA-II molecules, and thus have the best therapeutic effects. However, there are group 8-15 protocols set up due to their constitutive immune compatible modifications (knock-in/knock-out) which cannot be cleared when the graft becomes mutated or otherwise unwanted. In groups 12-15, the mice injected with adipsin cells will be eliminated from immune compatibility by applying Dox inducer (always used) to the mice at the same time as injecting adipsin cells into the mice, and the in vivo survival time of the mice will be comparable to that of MSCs without immune compatibility modification, and the therapeutic effect of the mice will be comparable to that of MSCs without immune compatibility modification.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
SEQUENCE LISTING
<110> future Chile regenerative medicine research institute (Guangzhou) Inc.; king shower stand
<120> pluripotent stem cell expressing adipsin or derivative thereof and application
<130>
<160> 182
<170> PatentIn version 3.5
<210> 1
<211> 702
<212> DNA
<213> human
<400> 1
gcgccgcccc gtggtcggat cctgggcggc agagaggccg aggcgcacgc gcggccctac 60
atggcgtcgg tgcagctgaa cggcgcgcac ctgtgcggcg gcgtcctggt ggcggagcag 120
tgggtgctga gcgcggcgca ctgcctggag gacgcggccg acgggaaggt gcaggttctc 180
ctgggcgcgc actccctgtc gcagccggag ccctccaagc gcctgtacga cgtgctccgc 240
gcagtgcccc acccggacag ccagcccgac accatcgacc acgacctcct gctgctacag 300
ctgtcggaga aggccacact gggccctgct gtgcgccccc tgccctggca gcgcgtggac 360
cgcgacgtgg caccgggaac tctctgcgac gtggccggct ggggcatagt caaccacgcg 420
ggccgccgcc cggacagcct gcagcacgtg ctcttgccag tgctggaccg cgccacctgc 480
aaccggcgca cgcaccacga cggcgccatc accgagcgct tgatgtgcgc ggagagcaat 540
cgccgggaca gctgcaaggg tgactccggg ggcccgctgg tgtgcggggg cgtgctcgag 600
ggcgtggtca cctcgggctc gcgcgtttgc ggcaaccgca agaagcccgg gatctacacc 660
cgcgtggcga gctatgcggc ctggatcgac agcgtcctgg cc 702
<210> 2
<211> 21
<212> DNA
<213> human
<400> 2
gggagcagag aattctctta t 21
<210> 3
<211> 21
<212> DNA
<213> human
<400> 3
ggagcagaga attctcttat c 21
<210> 4
<211> 21
<212> DNA
<213> human
<400> 4
gagcagagaa ttctcttatc c 21
<210> 5
<211> 21
<212> DNA
<213> human
<400> 5
gctacctgga gcttcttaac a 21
<210> 6
<211> 21
<212> DNA
<213> human
<400> 6
ggagcttctt aacagcgatg c 21
<210> 7
<211> 21
<212> DNA
<213> human
<400> 7
gggtctccag tatattcatc t 21
<210> 8
<211> 21
<212> DNA
<213> human
<400> 8
gcctcctgat gcacatgtac t 21
<210> 9
<211> 21
<212> DNA
<213> human
<400> 9
ggaagacctg ggaaagcttg t 21
<210> 10
<211> 21
<212> DNA
<213> human
<400> 10
ggctaagctt gtacaataac t 21
<210> 11
<211> 21
<212> DNA
<213> human
<400> 11
gcggaatgaa ccacatcttg c 21
<210> 12
<211> 21
<212> DNA
<213> human
<400> 12
ggccttctct gaaggacatt g 21
<210> 13
<211> 21
<212> DNA
<213> human
<400> 13
ggactcaatg cactgacatt g 21
<210> 14
<211> 21
<212> DNA
<213> human
<400> 14
ggtacccact gctctggtta t 21
<210> 15
<211> 21
<212> DNA
<213> human
<400> 15
gctcccactc catgaggtat t 21
<210> 16
<211> 21
<212> DNA
<213> human
<400> 16
ggtatttctt cacatccgtg t 21
<210> 17
<211> 21
<212> DNA
<213> human
<400> 17
aggagacacg gaatgtgaag g 21
<210> 18
<211> 21
<212> DNA
<213> human
<400> 18
gctcccactc catgaggtat t 21
<210> 19
<211> 21
<212> DNA
<213> human
<400> 19
ggtatttcta cacctccgtg t 21
<210> 20
<211> 21
<212> DNA
<213> human
<400> 20
ggaccggaac acacagatct a 21
<210> 21
<211> 21
<212> DNA
<213> human
<400> 21
accggaacac acagatctac a 21
<210> 22
<211> 21
<212> DNA
<213> human
<400> 22
ggaacacaca gatctacaag g 21
<210> 23
<211> 21
<212> DNA
<213> human
<400> 23
gaacacacag atctacaagg c 21
<210> 24
<211> 21
<212> DNA
<213> human
<400> 24
ttcttacttc cctaatgaag t 21
<210> 25
<211> 21
<212> DNA
<213> human
<400> 25
aagttaagaa cctgaatata a 21
<210> 26
<211> 21
<212> DNA
<213> human
<400> 26
aacctgaata taaatttgtg t 21
<210> 27
<211> 21
<212> DNA
<213> human
<400> 27
acctgaatat aaatttgtgt t 21
<210> 28
<211> 21
<212> DNA
<213> human
<400> 28
aagcgttgat ggattaatta a 21
<210> 29
<211> 21
<212> DNA
<213> human
<400> 29
agcgttgatg gattaattaa a 21
<210> 30
<211> 21
<212> DNA
<213> human
<400> 30
gggtctggtg ggcatcatta t 21
<210> 31
<211> 21
<212> DNA
<213> human
<400> 31
ggtctggtgg gcatcattat t 21
<210> 32
<211> 21
<212> DNA
<213> human
<400> 32
gcatcattat tgggaccatc t 21
<210> 33
<211> 21
<212> DNA
<213> human
<400> 33
gcacatggag gtgatggtgt t 21
<210> 34
<211> 21
<212> DNA
<213> human
<400> 34
ggaggtgatg gtgtttctta g 21
<210> 35
<211> 21
<212> DNA
<213> human
<400> 35
gagaagatca ctgaagaaac t 21
<210> 36
<211> 21
<212> DNA
<213> human
<400> 36
gctttaatgg ctttacaaag c 21
<210> 37
<211> 21
<212> DNA
<213> human
<400> 37
ggctttacaa agctggcaat a 21
<210> 38
<211> 21
<212> DNA
<213> human
<400> 38
gctttacaaa gctggcaata t 21
<210> 39
<211> 21
<212> DNA
<213> human
<400> 39
gctccgtact ctaacatcta g 21
<210> 40
<211> 21
<212> DNA
<213> human
<400> 40
gatgaccaca ttcaaggaag a 21
<210> 41
<211> 21
<212> DNA
<213> human
<400> 41
gaccacattc aaggaagaac t 21
<210> 42
<211> 21
<212> DNA
<213> human
<400> 42
gctttcctgc ttggcagtta t 21
<210> 43
<211> 21
<212> DNA
<213> human
<400> 43
ggcagttatt cttccacaag a 21
<210> 44
<211> 21
<212> DNA
<213> human
<400> 44
gcagttattc ttccacaaga g 21
<210> 45
<211> 21
<212> DNA
<213> human
<400> 45
gcgtaagtct gagtgtcatt t 21
<210> 46
<211> 21
<212> DNA
<213> human
<400> 46
gacaatttaa ggaagaatct t 21
<210> 47
<211> 21
<212> DNA
<213> human
<400> 47
ggccatagtt ctccctgatt g 21
<210> 48
<211> 21
<212> DNA
<213> human
<400> 48
gccatagttc tccctgattg a 21
<210> 49
<211> 21
<212> DNA
<213> human
<400> 49
gcagatgacc acattcaagg a 21
<210> 50
<211> 21
<212> DNA
<213> human
<400> 50
gatgaccaca ttcaaggaag a 21
<210> 51
<211> 21
<212> DNA
<213> human
<400> 51
gaccacattc aaggaagaac c 21
<210> 52
<211> 21
<212> DNA
<213> human
<400> 52
gctttgtcag gaccaggttg t 21
<210> 53
<211> 21
<212> DNA
<213> human
<400> 53
gaccaggttg ttactggttc a 21
<210> 54
<211> 21
<212> DNA
<213> human
<400> 54
gaagcctcac agctttgatg g 21
<210> 55
<211> 21
<212> DNA
<213> human
<400> 55
gatggcagtg cctcatcttc a 21
<210> 56
<211> 21
<212> DNA
<213> human
<400> 56
ggcagtgcct catcttcaac t 21
<210> 57
<211> 21
<212> DNA
<213> human
<400> 57
gcagcaggat aagtatgagt g 21
<210> 58
<211> 21
<212> DNA
<213> human
<400> 58
gcaggataag tatgagtgtc a 21
<210> 59
<211> 21
<212> DNA
<213> human
<400> 59
ggttcctgca cagagacatc t 21
<210> 60
<211> 21
<212> DNA
<213> human
<400> 60
gcacagagac atctataacc a 21
<210> 61
<211> 21
<212> DNA
<213> human
<400> 61
gagacatcta taaccaagag g 21
<210> 62
<211> 21
<212> DNA
<213> human
<400> 62
gagtactgga acagccagaa g 21
<210> 63
<211> 21
<212> DNA
<213> human
<400> 63
gctttcctgc ttggctctta t 21
<210> 64
<211> 21
<212> DNA
<213> human
<400> 64
ggctcttatt cttccacaag a 21
<210> 65
<211> 21
<212> DNA
<213> human
<400> 65
gctcttattc ttccacaaga g 21
<210> 66
<211> 21
<212> DNA
<213> human
<400> 66
ggatgtggaa cccacagata c 21
<210> 67
<211> 21
<212> DNA
<213> human
<400> 67
gatgtggaac ccacagatac a 21
<210> 68
<211> 21
<212> DNA
<213> human
<400> 68
gtggaaccca cagatacaga g 21
<210> 69
<211> 21
<212> DNA
<213> human
<400> 69
ggaacccaca gatacagaga g 21
<210> 70
<211> 21
<212> DNA
<213> human
<400> 70
gagccaactg tattgcctat t 21
<210> 71
<211> 21
<212> DNA
<213> human
<400> 71
agccaactgt attgcctatt t 21
<210> 72
<211> 21
<212> DNA
<213> human
<400> 72
gccaactgta ttgcctattt g 21
<210> 73
<211> 21
<212> DNA
<213> human
<400> 73
gggtagcaac tgtcaccttg a 21
<210> 74
<211> 21
<212> DNA
<213> human
<400> 74
ggatttcgtg ttccagttta a 21
<210> 75
<211> 21
<212> DNA
<213> human
<400> 75
gcatgtgcta cttcaccaac g 21
<210> 76
<211> 21
<212> DNA
<213> human
<400> 76
gcgtcttgtg accagataca t 21
<210> 77
<211> 21
<212> DNA
<213> human
<400> 77
gcttatgcct gcccagaatt c 21
<210> 78
<211> 21
<212> DNA
<213> human
<400> 78
gcaggaaatc actgcagaat g 21
<210> 79
<211> 21
<212> DNA
<213> human
<400> 79
gctcagtgca ttggccttag a 21
<210> 80
<211> 21
<212> DNA
<213> human
<400> 80
ggtgagtgct gtgtaaataa g 21
<210> 81
<211> 21
<212> DNA
<213> human
<400> 81
gacatatata gtgatccttg g 21
<210> 82
<211> 21
<212> DNA
<213> human
<400> 82
ggaaagtcac atcgatcaag a 21
<210> 83
<211> 21
<212> DNA
<213> human
<400> 83
gctcacagtc atcaattata g 21
<210> 84
<211> 21
<212> DNA
<213> human
<400> 84
gccctgaaga cagaatgttc c 21
<210> 85
<211> 21
<212> DNA
<213> human
<400> 85
gcggaccatg tgtcaactta t 21
<210> 86
<211> 21
<212> DNA
<213> human
<400> 86
ggaccatgtg tcaacttatg c 21
<210> 87
<211> 21
<212> DNA
<213> human
<400> 87
gcgtttgtac agacgcatag a 21
<210> 88
<211> 21
<212> DNA
<213> human
<400> 88
ggctggctaa cattgctata t 21
<210> 89
<211> 21
<212> DNA
<213> human
<400> 89
gctggctaac attgctatat t 21
<210> 90
<211> 21
<212> DNA
<213> human
<400> 90
ggaccaggtc acatgtgaat a 21
<210> 91
<211> 21
<212> DNA
<213> human
<400> 91
ggaaaggtct gaggatattg a 21
<210> 92
<211> 21
<212> DNA
<213> human
<400> 92
ggcagattag gattccattc a 21
<210> 93
<211> 21
<212> DNA
<213> human
<400> 93
gcctgatagg acccatattc c 21
<210> 94
<211> 21
<212> DNA
<213> human
<400> 94
gcatccaata gacgtcattt g 21
<210> 95
<211> 21
<212> DNA
<213> human
<400> 95
gcgtcactgg cacagatata a 21
<210> 96
<211> 21
<212> DNA
<213> human
<400> 96
gctgtcacat aataagctaa g 21
<210> 97
<211> 21
<212> DNA
<213> human
<400> 97
gctaaggaag acagtatata g 21
<210> 98
<211> 21
<212> DNA
<213> human
<400> 98
gggatttcta aggaaggatg c 21
<210> 99
<211> 21
<212> DNA
<213> human
<400> 99
ggagttgaag agcagagatt c 21
<210> 100
<211> 21
<212> DNA
<213> human
<400> 100
gccagtgaac acttaccata g 21
<210> 101
<211> 21
<212> DNA
<213> human
<400> 101
gcttctctga agtctcattg a 21
<210> 102
<211> 21
<212> DNA
<213> human
<400> 102
ggctgcaact aacttcaaat a 21
<210> 103
<211> 21
<212> DNA
<213> human
<400> 103
ggatggattt gattatgatc c 21
<210> 104
<211> 21
<212> DNA
<213> human
<400> 104
ggaccttgga acaatggatt g 21
<210> 105
<211> 21
<212> DNA
<213> human
<400> 105
gctaattctt gctgaacttc t 21
<210> 106
<211> 21
<212> DNA
<213> human
<400> 106
gctgaacttc ttcatgtatg t 21
<210> 107
<211> 21
<212> DNA
<213> human
<400> 107
gcctcatctc tttgttctaa a 21
<210> 108
<211> 21
<212> DNA
<213> human
<400> 108
gctctggaga agatatattt g 21
<210> 109
<211> 21
<212> DNA
<213> human
<400> 109
gctcttgagg gaactaatag a 21
<210> 110
<211> 21
<212> DNA
<213> human
<400> 110
gggacggcat taatgtattc a 21
<210> 111
<211> 21
<212> DNA
<213> human
<400> 111
ggacaaacat gcaaactata g 21
<210> 112
<211> 21
<212> DNA
<213> human
<400> 112
gcagcaacca gctaccattc t 21
<210> 113
<211> 21
<212> DNA
<213> human
<400> 113
gcagttctgt tgccactctc t 21
<210> 114
<211> 21
<212> DNA
<213> human
<400> 114
gggagagttc atccaggaaa t 21
<210> 115
<211> 21
<212> DNA
<213> human
<400> 115
ggagagttca tccaggaaat t 21
<210> 116
<211> 21
<212> DNA
<213> human
<400> 116
gagagttcat ccaggaaatt a 21
<210> 117
<211> 21
<212> DNA
<213> human
<400> 117
gcctgtcaaa gagagagagc a 21
<210> 118
<211> 21
<212> DNA
<213> human
<400> 118
gctcagcttc gtactgagtt c 21
<210> 119
<211> 21
<212> DNA
<213> human
<400> 119
gcttcacaga actacagaga g 21
<210> 120
<211> 21
<212> DNA
<213> human
<400> 120
gcatctactg gacaaagtat t 21
<210> 121
<211> 21
<212> DNA
<213> human
<400> 121
ggctgaatta cccatgcttt a 21
<210> 122
<211> 21
<212> DNA
<213> human
<400> 122
gctgaattac ccatgcttta a 21
<210> 123
<211> 21
<212> DNA
<213> human
<400> 123
gggttggttt atccaggaat a 21
<210> 124
<211> 21
<212> DNA
<213> human
<400> 124
ggatcagaag agaagccaac g 21
<210> 125
<211> 21
<212> DNA
<213> human
<400> 125
ggttcaccat ccaggtgttc a 21
<210> 126
<211> 21
<212> DNA
<213> human
<400> 126
gctctcttct ctggaactaa c 21
<210> 127
<211> 21
<212> DNA
<213> human
<400> 127
gctagagtga ctccatctta a 21
<210> 128
<211> 21
<212> DNA
<213> human
<400> 128
gctgaccacc aattataatt g 21
<210> 129
<211> 21
<212> DNA
<213> human
<400> 129
gcagaatatt taaggccata c 21
<210> 130
<211> 21
<212> DNA
<213> human
<400> 130
gcccacttaa aggcagcatt a 21
<210> 131
<211> 21
<212> DNA
<213> human
<400> 131
ggtcatcaat accactgtta a 21
<210> 132
<211> 21
<212> DNA
<213> human
<400> 132
gcattcctcc ttctcctttc t 21
<210> 133
<211> 21
<212> DNA
<213> human
<400> 133
ggaggaactt tgtgaacatt c 21
<210> 134
<211> 21
<212> DNA
<213> human
<400> 134
gctgtaagaa ggatgctttc a 21
<210> 135
<211> 21
<212> DNA
<213> human
<400> 135
gctgcaggca ggattgtttc a 21
<210> 136
<211> 21
<212> DNA
<213> human
<400> 136
gcagttcgag gtcaagtttg a 21
<210> 137
<211> 21
<212> DNA
<213> human
<400> 137
gccaattagc tgagaagaat t 21
<210> 138
<211> 21
<212> DNA
<213> human
<400> 138
gcaggtttac agtgtatatg t 21
<210> 139
<211> 21
<212> DNA
<213> human
<400> 139
gcctacagag actagagtag g 21
<210> 140
<211> 21
<212> DNA
<213> human
<400> 140
gcagttgggt accttccatt c 21
<210> 141
<211> 21
<212> DNA
<213> human
<400> 141
gcaactcagg tgcatgatac a 21
<210> 142
<211> 21
<212> DNA
<213> human
<400> 142
gcatggcgct ggtacgtaaa t 21
<210> 143
<211> 19
<212> DNA
<213> human
<400> 143
gcctcgagtt tgagagcta 19
<210> 144
<211> 19
<212> DNA
<213> human
<400> 144
agacattctg gatgagtta 19
<210> 145
<211> 19
<212> DNA
<213> human
<400> 145
gggtctgtta cccaaagaa 19
<210> 146
<211> 19
<212> DNA
<213> human
<400> 146
ggtctgttac ccaaagaat 19
<210> 147
<211> 19
<212> DNA
<213> human
<400> 147
ggaaggaagc ggacgctca 19
<210> 148
<211> 19
<212> DNA
<213> human
<400> 148
ggaggcagta cttctgata 19
<210> 149
<211> 19
<212> DNA
<213> human
<400> 149
cgctctagag ctcagctga 19
<210> 150
<211> 19
<212> DNA
<213> human
<400> 150
ccaccacctc aaccaataa 19
<210> 151
<211> 19
<212> DNA
<213> human
<400> 151
atttcaagaa gtcgatcaa 19
<210> 152
<211> 19
<212> DNA
<213> human
<400> 152
gaagatctga ttaccttca 19
<210> 153
<211> 21
<212> DNA
<213> human
<400> 153
ggacactggt tcaacacctg t 21
<210> 154
<211> 21
<212> DNA
<213> human
<400> 154
ggttcaacac ctgtgacttc a 21
<210> 155
<211> 21
<212> DNA
<213> human
<400> 155
acctgtgact tcatgtgtgc g 21
<210> 156
<211> 21
<212> DNA
<213> human
<400> 156
gctggacgtg accatcatgt a 21
<210> 157
<211> 21
<212> DNA
<213> human
<400> 157
ggacgtgacc atcatgtaca a 21
<210> 158
<211> 21
<212> DNA
<213> human
<400> 158
gacgtgacca tcatgtacaa g 21
<210> 159
<211> 21
<212> DNA
<213> human
<400> 159
acgtgaccat catgtacaag g 21
<210> 160
<211> 21
<212> DNA
<213> human
<400> 160
acgctatacc atctacctgg g 21
<210> 161
<211> 21
<212> DNA
<213> human
<400> 161
gcctctatga cgacatcgag t 21
<210> 162
<211> 21
<212> DNA
<213> human
<400> 162
gacatcgagt gcttccttat g 21
<210> 163
<211> 253
<212> DNA
<213> Artificial sequence
<400> 163
gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60
ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120
aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180
atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240
cgctagcgcc acc 253
<210> 164
<211> 9
<212> DNA
<213> Artificial sequence
<400> 164
ttcaagaga 9
<210> 165
<211> 686
<212> DNA
<213> Artificial sequence
<400> 165
gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60
ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120
aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180
atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240
ctttaccact ccctatcagt gatagagaaa agtgaaagtc gagtttacca ctccctatca 300
gtgatagaga aaagtgaaag tcgagtttac cactccctat cagtgataga gaaaagtgaa 360
agtcgagttt accactccct atcagtgata gagaaaagtg aaagtcgagt ttaccactcc 420
ctatcagtga tagagaaaag tgaaagtcga gtttaccact ccctatcagt gatagagaaa 480
agtgaaagtc gagtttacca ctccctatca gtgatagaga aaagtgaaag tcgagctcgg 540
tacccgggtc gaggtaggcg tgtacggtgg gaggcctata taagcagagc tcgtttagtg 600
aaccgtcaga tcgcctggag acgccatcca cgctgttttg acctccatag aagacaccgg 660
gaccgatcca gcctgctagc gccacc 686
<210> 166
<211> 119
<212> DNA
<213> Artificial sequence
<400> 166
gaggcttcag tactttacag aatcgttgcc tgcacatctt ggaaacactt gctgggatta 60
cttcttcagg ttaacccaac agaaggctaa agaaggtata ttgctgttga cagtgagcg 119
<210> 167
<211> 19
<212> DNA
<213> Artificial sequence
<400> 167
tagtgaagcc acagatgta 19
<210> 168
<211> 119
<212> DNA
<213> Artificial sequence
<400> 168
tgcctactgc ctcggacttc aaggggctac tttaggagca attatcttgt ttactaaaac 60
tgaatacctt gctatctctt tgatacattt ttacaaagct gaattaaaat ggtataaat 119
<210> 169
<211> 22
<212> DNA
<213> Artificial sequence
<400> 169
ccatagctca gtctggtcta tc 22
<210> 170
<211> 22
<212> DNA
<213> Artificial sequence
<400> 170
tcaggatgat ctggacgaag ag 22
<210> 171
<211> 20
<212> DNA
<213> Artificial sequence
<400> 171
ccggtcctgg actttgtctc 20
<210> 172
<211> 20
<212> DNA
<213> Artificial sequence
<400> 172
ctcgacatcg gcaaggtgtg 20
<210> 173
<211> 20
<212> DNA
<213> Artificial sequence
<400> 173
cgcattggag tcgctttaac 20
<210> 174
<211> 24
<212> DNA
<213> Artificial sequence
<400> 174
cgagctgcaa gaactcttcc tcac 24
<210> 175
<211> 23
<212> DNA
<213> Artificial sequence
<400> 175
cacggcactt acctgtgttc tgg 23
<210> 176
<211> 23
<212> DNA
<213> Artificial sequence
<400> 176
cagtacaggc atccctgtga aag 23
<210> 177
<211> 590
<212> DNA
<213> Artificial sequence
<400> 177
cccctctccc tccccccccc ctaacgttac tggccgaagc cgcttggaat aaggccggtg 60
tgcgtttgtc tatatgttat tttccaccat attgccgtct tttggcaatg tgagggcccg 120
gaaacctggc cctgtcttct tgacgagcat tcctaggggt ctttcccctc tcgccaaagg 180
aatgcaaggt ctgttgaatg tcgtgaagga agcagttcct ctggaagctt cttgaagaca 240
aacaacgtct gtagcgaccc tttgcaggca gcggaacccc ccacctggcg acaggtgcct 300
ctgcggccaa aagccacgtg tataagatac acctgcaaag gcggcacaac cccagtgcca 360
cgttgtgagt tggatagttg tggaaagagt caaatggctc tcctcaagcg tattcaacaa 420
ggggctgaag gatgcccaga aggtacccca ttgtatggga tctgatctgg ggcctcggtg 480
cacatgcttt acatgtgttt agtcgaggtt aaaaaaacgt ctaggccccc cgaaccacgg 540
ggacgtggtt ttcctttgaa aaacacgatg ataatatggc cacaaccatg 590
<210> 178
<211> 23
<212> DNA
<213> Artificial sequence
<400> 178
cgcgagcaca gctaaggcca cgg 23
<210> 179
<211> 23
<212> DNA
<213> Artificial sequence
<400> 179
actctctctt tctggcctgg agg 23
<210> 180
<211> 23
<212> DNA
<213> Artificial sequence
<400> 180
acccagcagg gcgtggagcc agg 23
<210> 181
<211> 23
<212> DNA
<213> Artificial sequence
<400> 181
gtcagagccc caaggtaaaa agg 23
<210> 182
<211> 57
<212> DNA
<213> Artificial sequence
<400> 182
atgcacagct gggagcgcct ggcagttctg gtcctcctag gagcggccgc ctgcgcg 57

Claims (20)

1. A pluripotent stem cell or derivative thereof, wherein: the genome of the pluripotent stem cell or the derivative thereof is introduced with an expression sequence of adipsin.
2. The pluripotent stem cell or derivative thereof according to claim 1, wherein: the sequence of the adipsin is shown in SEQ ID NO. 1.
3. The pluripotent stem cell or the derivative thereof according to claim 1, wherein: the B2M and/or CIITA gene of the pluripotent stem cell or the derivative thereof is knocked out.
4. The pluripotent stem cell or derivative thereof according to claim 1, wherein: the genome of the pluripotent stem cell or the derivative thereof is further introduced with one or more immune compatible molecule expression sequences for regulating the expression of genes associated with an immune response in the pluripotent stem cell or the derivative thereof.
5. The pluripotent stem cell or derivative thereof according to claim 4, wherein: the genes associated with the immune response include:
(1) major histocompatibility complex genes including at least one of HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DQA1, HLA-DQB1, HLA-DPA1, and HLA-DPB 1;
(2) major histocompatibility complex related genes including at least one of B2M and CIITA.
6. The pluripotent stem cell or derivative thereof according to claim 4, wherein: the immune-compatible molecule includes any one or more of:
(1) immune tolerance related genes including CD47 or HLA-G;
(2) HLA-C molecules, including HLA-C multiple alleles of which the proportion in the population is over 90 percent in total, or fusion protein genes consisting of the HLA-C multiple alleles of which the proportion is over 90 percent and B2M;
(3) shRNA and/or shRNA-miR of major histocompatibility complex genes including at least one of HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DQA1, HLA-DQB1, HLA-DPA1 and HLA-DPB 1;
(4) shRNA and/or shRNA-miR of a major histocompatibility complex-associated gene that includes at least one of B2M and CIITA.
7. The pluripotent stem cell or derivative thereof according to claim 6, wherein:
the target sequence of the shRNA and/or shRNA-miR of B2M is at least one of SEQ ID NO. 2-SEQ ID NO. 4;
the target sequence of the shRNA and/or shRNA-miR of the CIITA is at least one of SEQ ID NO. 5-SEQ ID NO. 14;
the target sequence of the shRNA and/or shRNA-miR of the HLA-A is at least one of SEQ ID NO. 15-SEQ ID NO. 17;
the target sequence of the shRNA and/or shRNA-miR of the HLA-B is at least one of SEQ ID NO. 18-SEQ ID NO. 23;
the target sequence of the shRNA and/or shRNA-miR of the HLA-C is at least one of SEQ ID NO. 24-SEQ ID NO. 29;
the target sequence of the shRNA and/or shRNA-miR of the HLA-DRA is at least one of SEQ ID NO. 30-SEQ ID NO. 39;
the target sequence of the shRNA and/or shRNA-miR of the HLA-DRB1 is at least one of SEQ ID NO. 40-SEQ ID NO. 44;
the target sequence of the shRNA and/or shRNA-miR of the HLA-DRB3 is at least one of SEQ ID NO. 45-SEQ ID NO. 46;
the target sequence of the shRNA and/or shRNA-miR of the HLA-DRB4 is at least one of SEQ ID NO. 47-SEQ ID NO. 56;
the target sequence of the shRNA and/or shRNA-miR of the HLA-DRB5 is at least one of SEQ ID NO. 57-SEQ ID NO. 65;
the target sequence of the shRNA and/or shRNA-miR of the HLA-DQA1 is at least one of SEQ ID NO. 66-SEQ ID NO. 72;
the target sequence of the shRNA and/or shRNA-miR of the HLA-DQB1 is at least one of SEQ ID NO. 73-SEQ ID NO. 82;
the target sequence of the shRNA and/or shRNA-miR of the HLA-DPA1 is at least one of SEQ ID NO. 83-SEQ ID NO. 92;
the target sequence of the shRNA and/or shRNA-miR of the HLA-DPB1 is at least one of SEQ ID NO. 93-SEQ ID NO. 102.
8. The pluripotent stem cell or derivative thereof according to claim 4, wherein: shRNA and/or miRNA processing complex related genes and/or anti-interferon effector molecules are also introduced into the genome of the pluripotent stem cell or the derivative thereof.
9. The pluripotent stem cell or derivative thereof according to claim 8, wherein: the shRNA and/or miRNA processing complex related gene comprises at least one of Drosha, Ago1, Ago2, Dicer1, Exportin-5, TRBP (TARBP2), PACT (PRKRA) and DGCR 8; the anti-interferon effector molecule is shRNA and/or shRNA-miR of at least one of PKR, 2-5As, IRF-3 and IRF-7.
10. The pluripotent stem cell or derivative thereof of claim 9, wherein:
the target sequence of the shRNA and/or shRNA-miR of the PKR is at least one of SEQ ID NO. 103-SEQ ID NO. 112;
the target sequence of the shRNA and/or shRNA-miR of the 2-5As is at least one of SEQ ID NO. 113-SEQ ID NO. 142;
the target sequence of the shRNA and/or shRNA-miR of the IRF-3 is at least one of SEQ ID NO. 143-SEQ ID NO. 152;
the target sequence of the shRNA and/or shRNA-miR of the IRF-7 is at least one of SEQ ID NO. 153-SEQ ID NO. 162.
11. The pluripotent stem cell or the derivative thereof according to claim 7 or 10, wherein: the expression frameworks of the major histocompatibility complex gene, the major histocompatibility complex related gene, PKR, 2-5As, the shRNA and/or shRNA-miR of IRF-3 or IRF-7 are As follows:
(1) shRNA expression framework: 5 'to 3' sequentially comprises the shRNA target sequence of claim 7 or 10, a stem-loop sequence, a reverse complement of the shRNA target sequence of claim 7 or 10, and Poly T; the two reverse complementary target sequences are separated by a middle stem-loop sequence to form a hairpin structure, and finally Poly T is connected to be used as a transcription terminator of RNA polymerase III;
(2) shRNA-miR expression framework: the shRNA-miR target sequence of claim 7 or 10 is used for replacing a target sequence in microRNA-30 or microRNA-155.
12. The pluripotent stem cell or derivative thereof of claim 11, wherein: the length of a stem-loop sequence in the shRNA expression frame is 3-9 bases; the length of the Poly T is 5-6 bases.
13. The pluripotent stem cell or the derivative thereof according to claim 4 or 8, wherein: an inducible gene expression system is also introduced into the genome of the pluripotent stem cell or the derivative thereof.
14. The pluripotent stem cell or derivative thereof of claim 13, wherein: the inducible gene expression system is at least one of a Tet-Off system and a dimer inducible expression system.
15. The pluripotent stem cell or the derivative thereof according to claim 13, wherein:
the introduction of the expression sequence of adipsin, the expression sequence of immune compatible molecules, shRNA and/or miRNA processing complex related genes, anti-interferon effector molecules and inducible gene expression system adopts methods of virus vector interference, non-virus vector transfection or gene editing.
16. The pluripotent stem cell or the derivative thereof according to claim 15, wherein:
the introduction sites of the expression sequence of adipsin, the expression sequence of an immune compatible molecule, shRNA and/or miRNA processing complex related gene, an anti-interferon effector molecule and an inducible gene expression system are genome safety sites of pluripotent stem cells or derivatives thereof.
17. The pluripotent stem cell or derivative thereof of claim 16, wherein: the genome safe site comprises one or more of an AAVS1 safe site, an eGSH safe site and an H11 safe site.
18. The pluripotent stem cell or the derivative thereof according to any one of claims 1 to 10, 12 and 14 to 17, wherein:
the pluripotent stem cells comprise embryonic stem cells, embryonic germ cells, embryonic cancer cells, or induced pluripotent stem cells;
the pluripotent stem cell derivative includes an adult stem cell, each germ layer cell or tissue into which the pluripotent stem cell is differentiated;
the adult stem cells comprise mesenchymal stem cells and neural stem cells.
19. Use of the pluripotent stem cell or derivative thereof according to any one of claims 1 to 18 for the preparation of a medicament for the treatment of diabetes.
20. A formulation, characterized by: comprising the pluripotent stem cell of any one of claims 1 to 18 or a derivative thereof.
CN202011185930.0A 2020-10-30 2020-10-30 Pluripotent stem cell expressing adipsin or derivative thereof and application thereof Pending CN114517184A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202011185930.0A CN114517184A (en) 2020-10-30 2020-10-30 Pluripotent stem cell expressing adipsin or derivative thereof and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202011185930.0A CN114517184A (en) 2020-10-30 2020-10-30 Pluripotent stem cell expressing adipsin or derivative thereof and application thereof

Publications (1)

Publication Number Publication Date
CN114517184A true CN114517184A (en) 2022-05-20

Family

ID=81594125

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202011185930.0A Pending CN114517184A (en) 2020-10-30 2020-10-30 Pluripotent stem cell expressing adipsin or derivative thereof and application thereof

Country Status (1)

Country Link
CN (1) CN114517184A (en)

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170072028A1 (en) * 2014-03-13 2017-03-16 Dana-Farber Cancer Institute, Inc. Compositions and methods for regulating pancreatic beta cell function using adipsin
CN107921148A (en) * 2015-05-08 2018-04-17 哈佛学院校长同事会 Universal donor stem cell and correlation technique
CN108368520A (en) * 2015-11-04 2018-08-03 菲特治疗公司 The genome project of pluripotent cell is transformed
CN110461879A (en) * 2017-02-10 2019-11-15 宾夕法尼亚大学理事会 Anti- factor D antibody and application thereof
CN110819592A (en) * 2018-08-13 2020-02-21 赛元生物科技(杭州)有限公司 Universal donor stem cell and preparation method thereof
CN111269888A (en) * 2020-03-24 2020-06-12 山东兴瑞生物科技有限公司 Adipostem cell modified by adipsin gene, preparation method and application thereof
CN111542594A (en) * 2017-12-22 2020-08-14 菲特治疗公司 Enhanced immune effector cells and uses thereof

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170072028A1 (en) * 2014-03-13 2017-03-16 Dana-Farber Cancer Institute, Inc. Compositions and methods for regulating pancreatic beta cell function using adipsin
CN107921148A (en) * 2015-05-08 2018-04-17 哈佛学院校长同事会 Universal donor stem cell and correlation technique
CN108368520A (en) * 2015-11-04 2018-08-03 菲特治疗公司 The genome project of pluripotent cell is transformed
CN110461879A (en) * 2017-02-10 2019-11-15 宾夕法尼亚大学理事会 Anti- factor D antibody and application thereof
CN111542594A (en) * 2017-12-22 2020-08-14 菲特治疗公司 Enhanced immune effector cells and uses thereof
CN110819592A (en) * 2018-08-13 2020-02-21 赛元生物科技(杭州)有限公司 Universal donor stem cell and preparation method thereof
CN111269888A (en) * 2020-03-24 2020-06-12 山东兴瑞生物科技有限公司 Adipostem cell modified by adipsin gene, preparation method and application thereof

Similar Documents

Publication Publication Date Title
WO2022037481A1 (en) Immunologically compatible and reversible universal pluripotent stem cell and application thereof
CN114657133A (en) Pluripotent stem cell for expressing shRNA and/or shRNA-miR of targeted IL-4R alpha
WO2022116591A1 (en) Pluripotent stem cell and derivative thereof
CN114426953A (en) Pluripotent stem cell derivative for expressing IL-12 and application thereof
CN114657136A (en) Pluripotent stem cell expressing shRNA and/or shRNA-miR of target PCSK9 or derivative thereof
CN114517184A (en) Pluripotent stem cell expressing adipsin or derivative thereof and application thereof
CN114645021A (en) Pluripotent stem cell expressing targeted CD47 inhibitory factor, derivative and application thereof
CN114657131A (en) Pluripotent stem cell expressing urate oxidase or derivative thereof
CN114525255A (en) Pluripotent stem cell derivative for expressing IL-11 and application thereof
CN114525254A (en) FGF-21-expressing pluripotent stem cell or derivative thereof and application
CN114507643A (en) Pluripotent stem cell derivative for expressing IL-2 and application thereof
CN114457029A (en) Pluripotent stem cell expressing VEGF-A blocking substance or derivative thereof and application
Vaidyanathan et al. Highly efficient repair of the ΔF508 mutation in airway stem cells of cystic fibrosis patients with functional rescue of the differentiated epithelia
CN114525258A (en) Pluripotent stem cell expressing PCSK9 blocker or derivative thereof and application
CN114657134A (en) Pluripotent stem cell expressing IgE-targeted shRNA and/or shRNA-miR or derivative thereof
CN114457024A (en) Pluripotent stem cell expressing IL-4R alpha blocker or derivative thereof and application
CN114717193A (en) Pluripotent stem cell expressing shRNA and/or shRNA-miR targeting B7-H5 or derivative thereof
CN114457030A (en) Pluripotent stem cell expressing IgE blocking substance or derivative thereof and application
CN114457027A (en) Pluripotent stem cell expressing Amyloid beta antibody, derivative and application thereof
CN114457035A (en) Pluripotent stem cell expressing LAG-3 blocking substance or derivative thereof and application
CN114525257A (en) Pluripotent stem cell expressing Tim-3 blocker or derivative thereof and application
CN114350611A (en) Pluripotent stem cells expressing effector RNA molecules targeting PD-1/PD-L1 and derivatives thereof
CN114457023A (en) Pluripotent stem cell expressing CD28 activated antibody, derivative and application thereof
CN114350612A (en) Pluripotent stem cell expressing CTLA-4-targeted shRNA/shRNA-miR or derivative thereof
CN114525256A (en) Pluripotent stem cell expressing Siglec-15 blocking substance or derivative thereof and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination