CN114525258A

CN114525258A - Pluripotent stem cell expressing PCSK9 blocker or derivative thereof and application

Info

Publication number: CN114525258A
Application number: CN202011200180.XA
Authority: CN
Inventors: 王淋立; 陈月花; 杨建国; 莫健
Original assignee: Future Intelligent Regenerative Medicine Research Institute Guangzhou Co ltd
Current assignee: Future Intelligent Regenerative Medicine Research Institute Guangzhou Co ltd
Priority date: 2020-10-30
Filing date: 2020-10-30
Publication date: 2022-05-24

Abstract

The invention discloses a pluripotent stem cell expressing a PCSK9 blocker or a derivative thereof and application thereof, wherein the pluripotent stem cell or the derivative thereof comprises at least one of a non-immune compatible pluripotent stem cell expressing a PCSK9 blocker or a derivative thereof, an immune compatible pluripotent stem cell expressing a PCSK9 blocker or a derivative thereof, and an immune compatible reversible pluripotent stem cell expressing a PCSK9 blocker or a derivative thereof. The pluripotent stem cells or the derivatives thereof expressing the PCSK9 blocker can be used for inducing iPSCs (induced pluripotent stem cells) or differentiating the iPSCs into MSCs (mesenchymal stem cells) which are low in immunogenicity for application by autologous cells, can continuously express the PCSK9 blocker in vivo, and is used for treating PCSK93 high-expression related diseases or reducing blood fat and cholesterol.

Description

Pluripotent stem cell expressing PCSK9 blocker or derivative thereof and application

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a pluripotent stem cell expressing a PCSK9 blocker or a derivative thereof and application thereof.

Background

Stem cells are "seed" cells with self-renewal ability and differentiation ability into specific functional somatic cells, have the potential to regenerate into various tissues, organs and human bodies, and play a central and irreplaceable role in immune response, aging, tumorigenesis and other important biological activities. Stem cells are mainly classified into: totipotent stem cells (Totipotent stem cells), Pluripotent Stem Cells (PSCs), and adult stem cells (adult stem cells). The typical PSCs mainly include Embryonic Stem Cells (ESCs), Embryonic Germ Cells (EGCs), Embryonic Carcinoma Cells (ECCs), Induced Pluripotent Stem Cells (iPSCs), and the like, and such cells have a very deep and wide application prospect due to their powerful functions and can be restricted to some extent by ethics.

Cholesterol is often present in the blood in the form of lipoproteins, while Low Density Lipoprotein (LDL) in the plasma is the main carrier for transporting endogenous cholesterol, which is degraded and transformed by binding to the Low Density Lipoprotein receptor (LDL-R) on its cell membrane.

Low-Density Lipoprotein Cholesterol (LDL-C) is the major Lipoprotein in fasting plasma, approximately 2/3 of plasma lipoproteins, and is the major vehicle for transporting Cholesterol to extrahepatic tissues.

Functional defects in LDL-R can cause a decrease in plasma LDL-C clearance, ultimately leading to the formation of atherosclerotic plaques. Therefore, the content of LDL-C is related to the incidence rate and the pathological change degree of cardiovascular diseases, is considered to be a main pathogenic factor of atherosclerosis, the concentration of the LDL-C is obviously and positively related to the incidence rate of coronary heart diseases, and the LDL-C is also an important index for evaluating risk factors of individual coronary heart diseases

PCSK9 is a serine protease encoded by the PCSK9 gene and produced primarily by the liver. PCSK9 binds to LDL receptors (LDL-R) on the surface of hepatocytes, degrading LDL-R and elevating plasma LDL-C levels. Antibodies to PCSK9 interfere with their binding to LDL-R, allowing the liver to express more LDL-R and lower plasma LDL-C levels.

Therefore, the development of a pluripotent stem cell or a derivative thereof capable of expressing a PCSK9 blocker in a human body is of great significance.

However, the conception or establishment of the autologous iPSCs cell bank or the immune matched PSCs cell bank requires great expenditure of money, material resources and manpower. The molecular immunological basis for allogeneic recipient organ, tissue or cell transplantation is based primarily on the matching of the classical major histocompatibility complexes MHC-I and MHC-II (human HLA-I, HLA-II). By 6 months 2019, over 20000 HLA system alleles have been identified and named, and only 5000 allele factors of classical HLA-A, B, C are respectively exceeded, and various possible random combinations of these classical HLA-I/II alleles will be astronomical numbers, and as the number of combinations found for new alleles increases, there is a great obstacle to tissue matching and donor selection before organ, tissue and cell transplantation, and also great difficulty in constructing a PSCs cell library covering the immune match of the human population.

Thus, the construction of allogeneic immune-compatible, universal PSCs is imminent. In recent years, a plurality of reports have been provided that the deletion expression of genes on the cell surfaces of HLA-I and HLA-II or the genes thereof is realized by knocking out genes such as B2M, CIITA and the like, so that the cells have immune tolerance or escape T/B cell specific immune response, and universal PSCs with immune compatibility are generated, thereby laying an important foundation for the application of wider universal PSCs source cells, tissues and organs. Also, cells have been reported to overexpress CTLA4-Ig, PD-L1 and thereby inhibit allogeneic immune rejection. Recently, it has been reported that when B2M and CIITA are knocked out, CD47 is knocked in, so that cells obtain escape specific immune response, and have immune tolerance or escape natural immune response of cells such as NK cells, so that the cells have more comprehensive and stronger immune compatibility characteristics. However, these approaches are either not fully immune compatible, and still allow for immunological rejection of the allogens by other routes; or completely eliminate the allogeneic immune rejection response, but simultaneously make the cells of the donor-derived transplant lose the antigen presenting capability, which brings great risk of diseases such as tumorigenicity and virus infection to the recipient.

Therefore, it is also reported that, when the B2M is not directly knocked out, the HLA-A, HLA-B is knocked out or the CIITA is knocked out together, the HLA-C is kept, 12 HLA-C immune matching antigens covering more than 90% of people are constructed, so that the transplanted cells still have a certain degree of antigen presenting function, and the inherent immune response of NK cells can be inhibited through the HLA-C. However, in the cells, the antigen type presented by HLA-I antigen is reduced by more than two thirds, the integrity of the presented antigen is reduced irreversibly, the presenting of various tumor, virus and other disease antigens has great bias, the risk of diseases such as tumor and virus infection is still kept to a certain extent, and the pathogenic risk is higher under the condition that CIITA is knocked out simultaneously; secondly, 12 high-frequency immune match HLA-C antigen species are very different, and the part of the area can only account for 70 percent by verification and calculation, while the HLA data of large sample size which is not authoritative currently in China, Indian and other big countries is displayed, so that the prepared general PSCs are still subjected to huge match vacancy tests; thirdly, the method can go through repeated gene editing for a plurality of times, at least two rounds of single cell isolation culture meters are needed according to each gene editing, the whole process needs at least more than six rounds of single cell isolation culture, and the processes are inevitable and cause various unpredictable mutations of cells due to multiple times of gene editing off-target or unstable chromatin or due to passage proliferation of a large number of single cells, thereby further inducing various problems of carcinogenesis, metabolic diseases and the like. It follows that such immuno-compatible schemes are also a matter of convenience in the "transition period", and many problems remain that are not better solved.

In addition, inducing killing of the suicide gene after donor tissue and cell disease has been induced, which results in serious tissue necrosis, cytokine storm and other unpredictable disease risk problems, and it is a big problem that proper donor cells, tissues and organs do not exist after the cell death of the design.

Disclosure of Invention

In a first aspect, the present invention provides a pluripotent stem cell or a derivative thereof.

The second aspect of the present invention is to provide the use of the pluripotent stem cells or derivatives thereof in preparing a medicament for regulating blood lipid and/or cholesterol.

In a third aspect, the invention provides a preparation comprising the pluripotent stem cells or derivatives thereof.

The technical scheme adopted by the invention is as follows:

in a first aspect of the invention, there is provided a pluripotent stem cell or derivative thereof comprising an expression sequence for a PCSK9 blocker, wherein the PCSK9 blocker is a PCSK9 antibody.

Preferably, the expression sequence of the PCSK9 blocker is inserted into the genome of the pluripotent stem cell or the derivative thereof.

More preferably, the expression sequence of the PCSK9 blocker is inserted into a safe site in the genome of the pluripotent stem cell or a derivative thereof.

Further preferably, the genomic safe site comprises one or more of AAVS1 safe site, eGSH safe site, H11 safe site.

In a second aspect of the invention, there is provided a pluripotent stem cell or derivative thereof comprising an expression sequence for a PCSK9 blocker, wherein the PCSK9 blocker is a PCSK9 antibody; the B2M gene and/or CIITA gene of the genome of the pluripotent stem cell or the derivative thereof is knocked out.

In a third aspect of the invention, there is provided a pluripotent stem cell or a derivative thereof comprising an expression sequence for a PCSK9 blocker, wherein the PCSK9 blocker is a PCSK9 antibody;

the pluripotent stem cells or the derivatives thereof also comprise an immune compatible molecule expression sequence, and the immune compatible molecule is used for regulating and controlling the expression of genes related to immune response in the pluripotent stem cells or the derivatives thereof.

Preferably, the expression sequence of the PCSK9 blocker, the expression sequence of the immune compatible molecule are inserted in the genome of the pluripotent stem cell or the derivative thereof.

More preferably, the expression sequence of the PCSK9 blocker, the expression sequence of the immune compatible molecule are inserted into a safe site of the genome of the pluripotent stem cell or the derivative thereof.

In a fourth aspect of the invention, there is provided a pluripotent stem cell or a derivative thereof comprising an expression sequence for a PCSK9 blocker, wherein the PCSK9 blocker is a PCSK9 antibody;

the pluripotent stem cells or the derivatives thereof also comprise an immune compatible molecule expression sequence, and the immune compatible molecule is used for regulating and controlling the expression of genes related to immune response in the pluripotent stem cells or the derivatives thereof;

the pluripotent stem cell or the derivative thereof further comprises an inducible gene expression system.

Preferably, the inducible gene expression system is at least one of a Tet-Off system, a dimer inducible expression system.

Preferably, the expression sequence of the PCSK9 blocker, the immune compatible molecule expression sequence and the inducible gene expression system are inserted in the genome of the pluripotent stem cell or the derivative thereof.

More preferably, the expression sequence of the PCSK9 blocker, the immune compatible molecule expression sequence and the inducible gene expression system are inserted at a safe site in the genome of the pluripotent stem cell or the derivative thereof.

The pluripotent stem cell or derivative thereof according to the third or fourth aspect of the invention, further wherein the immune-compatible molecule comprises one or more of:

(I) immune tolerance-related genes including CD47 or HLA-G;

(II) HLA-C molecules comprising HLA-C alleles in a proportion of more than 90% in total in the population, or fusion protein genes consisting of more than 90% of HLA-C alleles and B2M;

(III) shRNA and/or shRNA-miR targeting the gene associated with the immune response.

The pluripotent stem cell or the derivative thereof according to the third or fourth aspect of the present invention, further wherein the gene associated with an immune response comprises:

major histocompatibility complex genes including at least one of HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DQA1, HLA-DQB1, HLA-DPA1, and HLA-DPB 1;

(II) major histocompatibility complex related genes comprising at least one of B2M and CIITA.

Preferably, the target sequence of the shRNA and/or shRNA-miR targeting B2M is selected from one of SEQ ID NO. 3-SEQ ID NO. 5;

the target sequence of the shRNA and/or shRNA-miR targeting CIITA is selected from one of SEQ ID No. 6-SEQ ID No. 15;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-A is selected from one of SEQ ID NO. 16-SEQ ID NO. 18;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-B is selected from one of SEQ ID NO. 19-SEQ ID NO. 24;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-C is selected from one of SEQ ID NO. 25-SEQ ID NO. 30;

the target sequence of the shRNA and/or shRNA-miR of the targeted HLA-DRA is selected from one of SEQ ID NO. 31-SEQ ID NO. 40;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DRB1 is selected from one of SEQ ID NO. 41-SEQ ID NO. 45;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DRB3 is selected from one of SEQ ID NO. 46-SEQ ID NO. 47;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DRB4 is selected from one of SEQ ID NO. 48-SEQ ID NO. 57;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DRB5 is selected from one of SEQ ID NO. 58-SEQ ID NO. 66;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DQA1 is selected from one of SEQ ID NO. 67-SEQ ID NO. 73;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DQB1 is selected from one of SEQ ID NO. 74-SEQ ID NO. 83;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DPA1 is selected from one of SEQ ID NO. 84-SEQ ID NO. 93;

the target sequence of the shRNA and/or shRNA-miR of the target HLA-DPB1 is selected from one of SEQ ID NO. 94-SEQ ID NO. 103.

The pluripotent stem cell or the derivative thereof according to the third or fourth aspect of the present invention, wherein at least one of an shRNA processing complex-related gene, an miRNA processing complex-related gene, and an anti-interferon effector molecule is further introduced into the genome of the pluripotent stem cell or the derivative thereof.

Preferably, the shRNA processing complex related gene and the miRNA processing complex related gene comprise at least one of Drosha, Ago1, Ago2, Dicer1, Exportin-5, TRBP (TARBP2), PACT (PRKRA) and DGCR 8;

the anti-interferon effector molecule is preferably shRNA and/or shRNA-miR targeting at least one of PKR, 2-5As, IRF-3 and IRF-7.

More preferably, the target sequence of the shRNA and/or shRNA-miR targeting PKR is selected from one of SEQ ID NO. 104-SEQ ID NO. 113;

the target sequence of the shRNA and/or shRNA-miR targeting 2-5As is selected from one of SEQ ID NO. 114-SEQ ID NO. 143;

the target sequence of the shRNA and/or shRNA-miR of the targeted IRF-3 is selected from one of SEQ ID NO. 144-SEQ ID NO. 153;

the target sequence of the shRNA and/or shRNA-miR targeting IRF-7 is selected from one of SEQ ID NO. 154-SEQ ID NO. 163.

In the pluripotent stem cell or the derivative thereof according to the third or fourth aspect of the invention, further, the shRNA expression framework: the gene sequence sequentially comprises an shRNA target sequence, a stem-loop sequence, a reverse complementary sequence of the shRNA target sequence and Poly T from 5 'to 3';

wherein the shRNA target sequence, the stem-loop sequence and the reverse complementary sequence of the shRNA target sequence form a hairpin structure;

poly T is a transcription terminator of RNA polymerase III;

shRNA-miR expression framework: replacing a target sequence in the microRNA-30 or microRNA-155 with a shRNA-miR target sequence to obtain the target sequence.

More preferably, the length of the stem-loop sequence in the shRNA expression frame is 3-9 bases; the poly T is 5-6 bases in length.

The pluripotent stem cell or the derivative thereof according to the first to fourth aspects of the present invention, further comprising an embryonic stem cell, an embryonic germ cell, an embryonic cancer cell, or an induced pluripotent stem cell.

The pluripotent stem cell or the derivative thereof according to the first to fourth aspects of the present invention, further comprising an adult stem cell, each germ layer cell or tissue into which the pluripotent stem cell is differentiated;

the adult stem cells include mesenchymal stem cells or neural stem cells.

The pluripotent stem cell or the derivative thereof according to the first to fourth aspects of the invention, further comprising a PCSK9 antibody having a heavy chain sequence as shown in SEQ ID No.1 and a light chain sequence as shown in SEQ ID No. 2.

It will be appreciated by those skilled in the art that other PCSK9 antibody expression sequences may be used to achieve the objects of the invention.

In a fifth aspect of the present invention, there is provided a use of the pluripotent stem cell or the derivative thereof according to any one of the first to fourth aspects of the present invention in the preparation of a medicament for regulating blood lipid and/or cholesterol.

In a sixth aspect of the invention, there is provided a formulation comprising a pluripotent stem cell or a derivative thereof according to any one of the first to fourth aspects.

The invention has the beneficial effects that:

the invention provides a pluripotent stem cell expressing a PCSK9 blocker or a derivative thereof, which can be used for inducing iPSCs (induced pluripotent stem cells) or differentiating the iPSCs into MSCs (mesenchymal stem cells) which are low in immunogenicity for application by autologous cells, can continuously express the PCSK9 blocker in vivo, and is used for treating related diseases with high expression of PCSK9 or regulating blood fat and/or cholesterol.

The invention also provides an immune compatible pluripotent stem cell or a derivative thereof for expressing the PCSK9 blocker, wherein the B2M and CIITA genes in the pluripotent stem cell or the derivative thereof are knocked out, or an immune compatible molecule expression sequence is introduced into the genome of the pluripotent stem cell or the derivative thereof, so that the immunogenicity of the pluripotent stem cell or the derivative thereof is low, and when the pluripotent stem cell or the derivative thereof is transplanted into a recipient, the problem of allogeneic immune rejection between a donor cell and the recipient can be overcome, so that the PCSK9 blocker can be continuously expressed in the recipient by the donor cell for a long time.

The invention also provides an inducible gene expression system and an immune compatible molecule expression sequence which are introduced into the genome of the immune compatible reversible pluripotent stem cell or the derivative thereof for expressing the PCSK9 blocker. The inducible gene expression system is controlled by an exogenous inducer, and the opening and closing of the inducible gene expression system are controlled by adjusting the addition amount, the continuous action time and the type of the exogenous inducer, so that the expression quantity of the epidemic compatible molecular expression sequence is controlled. While the immune-compatible molecule may regulate the expression of genes associated with an immune response in the pluripotent stem cell or derivative thereof. When the immune compatible molecule is normally expressed, the suppression or overexpression of the expression of the genes associated with the immune response in the pluripotent stem cell or the derivative thereof can eliminate or reduce the allogeneic immune rejection response between the donor cell and the recipient, so that the donor cell can continuously express the PCSK9 blocker in the recipient for a long time. When the donor cell is diseased, the expression of the immune compatible molecules can be closed by induction of an exogenous inducer, so that the HLA class I molecules can be reversibly re-expressed on the surface of the donor cell, the antigen presenting capability of the donor cell is recovered, and the diseased cell can be eliminated by a receptor, thereby improving the clinical safety of the general pluripotent stem cell or the derivative thereof, and greatly expanding the value of the general pluripotent stem cell in clinical application.

In addition, the addition amount and the lasting action time of the exogenous inducer can be adjusted to ensure that the transplant gradually expresses low-concentration HLA molecules to stimulate the receptor, so that the receptor gradually generates tolerance on the transplant, and finally stable tolerance is achieved. At the moment, even if the HLA class I molecules with unmatched HLA class I molecule expression on the surface of the transplanted cells can be compatible with the recipient immune system, so that after the expression of the immune compatible molecules in the transplanted cells is induced to be closed, the recipient immune system can re-identify the cells with gene mutation presented by the HLA class I molecules in the transplanted cells on one hand, and eliminate diseased cells; on the other hand, the non-mutated part is not cleared by the recipient immune system due to the allogeneic HLA class i molecule tolerance produced by training with the above mentioned inducers. Thus, the recipient immune system can only eliminate the graft with harmful mutation, the graft with normal function is kept, and when the harmful graft is eliminated, the mode of HLA class I molecule silencing on the cell surface of the graft can be transferred. The graft tolerance program mediated by the exogenous inducer can also be used to implant a graft that does not induce or otherwise induce the turning on or off of the surface expression of HLA class i molecules after the recipient has become fully tolerant.

Drawings

FIG. 1AAVS1 KI Vector (shRNA, constitutive) plasmid map.

FIG. 2AAVS1 KI Vector (shRNA, inducible) plasmid map.

FIG. 3AAVS1 KI Vector (shRNA-miR, constitutive) plasmid map.

FIG. 4AAVS1 KI Vector (shRNA-miR, inducible) plasmid map.

FIG. 5sgRNA clone B2M-1 plasmid map.

FIG. 6sgRNA clone B2M-2 plasmid map.

FIG. 7sgRNA clone CIITA-1 plasmid map.

FIG. 8 plasmid map of sgRNA clone CIITA-2.

Figure 9Cas9(D10A) plasmid map.

FIG. 10sgRNA Clone AAVS1-1 plasmid map.

FIG. 11sgRNA Clone AAVS1-2 plasmid map.

Detailed Description

The present invention will be described in further detail with reference to the following specific embodiments and accompanying drawings. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. The various chemicals used in the examples are commercially available.

1 Experimental materials and methods

1.1 PCSK9 antibody

The Heavy Chain (HC) sequence of the PCSK9 antibody is shown as SEQ ID NO.1, and the Light Chain (LC) sequence is shown as SEQ ID NO. 2.

GAGGTGCAGCTGGTGCAGAGCGGCGCCGAGGTGAAGAAGCCCGGCGCCAGCGTGAAGGTGAGCTGCAAGGCCAGCGGCTACACCCTGACCAGCTACGGCATCAGCTGGGTGAGGCAGGCCCCCGGCCAGGGCCTGGAGTGGATGGGCTGGGTGAGCTTCTACAACGGCAACACCAACTACGCCCAGAAGCTGCAGGGCAGGGGCACCATGACCACCGACCCCAGCACCAGCACCGCCTACATGGAGCTGAGGAGCCTGAGGAGCGACGACACCGCCGTGTACTACTGCGCCAGGGGCTACGGCATGGACGTGTGGGGCCAGGGCACCACCGTGACCGTGAGCAGCGCCAGCACCAAGGGCCCCAGCGTGTTCCCCCTGGCCCCCTGCAGCAGGAGCACCAGCGAGAGCACCGCCGCCCTGGGCTGCCTGGTGAAGGACTACTTCCCCGAGCCCGTGACCGTGAGCTGGAACAGCGGCGCCCTGACCAGCGGCGTGCACACCTTCCCCGCCGTGCTGCAGAGCAGCGGCCTGTACAGCCTGAGCAGCGTGGTGACCGTGCCCAGCAGCAACTTCGGCACCCAGACCTACACCTGCAACGTGGACCACAAGCCCAGCAACACCAAGGTGGACAAGACCGTGGAGAGGAAGTGCTGCGTGGAGTGCCCCCCCTGCCCCGCCCCCCCCGTGGCCGGCCCCAGCGTGTTCCTGTTCCCCCCCAAGCCCAAGGACACCCTGATGATCAGCAGGACCCCCGAGGTGACCTGCGTGGTGGTGGACGTGAGCCACGAGGACCCCGAGGTGCAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCACAACGCCAAGACCAAGCCCAGGGAGGAGCAGTTCAACAGCACCTTCAGGGTGGTGAGCGTGCTGACCGTGGTGCACCAGGACTGGCTGAACGGCAAGGAGTACAAGTGCAAGGTGAGCAACAAGGGCCTGCCCGCCCCCATCGAGAAGACCATCAGCAAGACCAAGGGCCAGCCCAGGGAGCCCCAGGTGTACACCCTGCCCCCCAGCAGGGAGGAGATGACCAAGAACCAGGTGAGCCTGACCTGCCTGGTGAAGGGCTTCTACCCCAGCGACATCGCCGTGGAGTGGGAGAGCAACGGCCAGCCCGAGAACAACTACAAGACCACCCCCCCCATGCTGGACAGCGACGGCAGCTTCTTCCTGTACAGCAAGCTGACCGTGGACAAGAGCAGGTGGCAGCAGGGCAACGTGTTCAGCTGCAGCGTGATGCACGAGGCCCTGCACAACCACTACACCCAGAAGAGCCTGAGCCTGAGCCCCGGCAAG(SEQ ID NO.1)。

GAGAGCGCCCTGACCCAGCCCGCCAGCGTGAGCGGCAGCCCCGGCCAGAGCATCACCATCAGCTGCACCGGCACCAGCAGCGACGTGGGCGGCTACAACAGCGTGAGCTGGTACCAGCAGCACCCCGGCAAGGCCCCCAAGCTGATGATCTACGAGGTGAGCAACAGGCCCAGCGGCGTGAGCAACAGGTTCAGCGGCAGCAAGAGCGGCAACACCGCCAGCCTGACCATCAGCGGCCTGCAGGCCGAGGACGAGGCCGACTACTACTGCAACAGCTACACCAGCACCAGCATGGTGTTCGGCGGCGGCACCAAGCTGACCGTGCTGGGCCAGCCCAAGGCCGCCCCCAGCGTGACCCTGTTCCCCCCCAGCAGCGAGGAGCTGCAGGCCAACAAGGCCACCCTGGTGTGCCTGATCAGCGACTTCTACCCCGGCGCCGTGACCGTGGCCTGGAAGGCCGACAGCAGCCCCGTGAAGGCCGGCGTGGAGACCACCACCCCCAGCAAGCAGAGCAACAACAAGTACGCCGCCAGCAGCTACCTGAGCCTGACCCCCGAGCAGTGGAAGAGCCACAGGAGCTACAGCTGCCAGGTGACCCACGAGGGCAGCACCGTGGAGAAGACCGTGGCCCCCACCGAGTGCAGC(SEQ ID NO.2)。

1.2 pluripotent Stem cells or derivatives thereof

The pluripotent stem cells can be selected from Embryonic Stem Cells (ESCs), Induced Pluripotent Stem Cells (iPSCs) and other forms of pluripotent stem cells, such as hPSCs-MSCs, NSCs, EBs cells. Wherein:

ESCs: HN4 cells were selected and purchased from Shanghai department of sciences.

And (3) iPSCs: using a third generation highly efficient and safe episomal-iPSCs induction system (6F/BM1-4C) established by us, pE3.1-OG-KS and pE3.1-L-Myc-hmiR 302 cluster are transferred into somatic cells through electricity, RM1 is cultured for 2 days, BioCISO-BM1 containing 2uM Parnate is cultured for 2 days, BioCISO-BM1 containing 2uM Parnate, 0.25mM sodium butyrate, 3uM CHIR99021 and 0.5uM PD03254901 is cultured for 2 days, iPSCs clones can be picked up after being cultured to about 17 days by using a dry cell culture medium BioCISO, and the picked iPSCs clones are purified, digested and passaged to obtain stable iPSCs. The specific construction method is as follows: stem Cell Res ther.2017nov 2; 8(1):245.

hPSCs-MSCs: iPSCs are cultured for 25 days by using a stem cell culture medium (BioCISO containing 10uM TGF beta inhibitor SB431542), during which digestion passage (2mg/mL Dispase digestion) is carried out at 80-90 confluence, passage is carried out at 1:3 into a Matrigel coated culture plate, then ESC-MSC culture medium (knockkockout DMEM culture medium containing 10% KSR, NEAA, diabody, glutamine, beta-mercaptoethanol, 10ng/mL bFGF and SB-431542) is cultured, fluid is changed every day, passage is carried out at 80-90 confluence (passage is carried out at 1: 3), and continuous culture is carried out for 20 days. The specific construction method is as follows: proc Natl Acad Sci U S A.2015; 112(2):530-535.

NSCs: iPSCs are cultured for 14 days by using an induction medium (a knockout DMEM medium containing 10% KSR, a TGF-beta inhibitor and a BMP4 inhibitor), rose annular nerve cells are picked to a low-adhesion culture plate for culture, the culture medium is cultured by using DMEM/F12 (containing 1% N2 and Invitrogen) and Neurobasal medium (containing 2% B27 and Invitrogen) in a ratio of 1:1 and also contains 20ng/ml bFGF and 20ng/ml EGF, and digestion is carried out by using Accutase for digestion and passage. The specific construction method is as follows: FASEB J.2014; 28(11):4642-4656.

EBs cells: and digesting iPSCs with the confluence of 95% for 6min by using a BioC-PDE1, scraping the cells into blocks by using a mechanical scraping method, settling and reducing cell masses, transferring the settled cell masses into a low-adhesion culture plate, culturing for 7 days by using a BioCISO-EB1, and changing the liquid every other day. After 7 days, the cells were transferred to a Matrigel-coated plate and adherent culture was continued using BioCISO, and Embryoid Bodies (EBs) having an inner, middle and outer mesoderm structure were obtained after 7 days. The specific construction method is as follows: stem Cell Res ther.2017nov 2; 8(1):245.

The pluripotent stem cell derivative also includes adult stem cells, each germ layer cell or tissue, organ into which the pluripotent stem cells are differentiated; the adult stem cells include mesenchymal stem cells or neural stem cells.

1.3 genomic safety sites

As a more preferred approach, to ensure stable expression of the knock-in gene/expression construct, the gene/expression construct may be knocked into a genomic safety site, which may be selected from the AAVS1 safety site, the eGSH safety site, or other safety sites:

(1) AAVS1 safety site

The AAVS1 site (the alias "PPP 1R2C site") is located on chromosome 19 of the human genome and is a verified "safe harbor" site that ensures the desired function of the transferred DNA fragment. The site is an open chromosome structure, can ensure that the transgene can be normally transcribed, and has no known side effect on cells when the exogenous target segment is inserted into the site.

(2) eGSH safe site

The eGSH safe site is located on chromosome 1 of the human genome, and is another 'safe harbor' site which can ensure the expected function of the transferred DNA fragment after the paper verifies.

(3) Other sites of security

The H11 safe locus (also called Hipp11) is located on human chromosome 22, is a locus between Eif4enif1 and Drg1, is discovered and named in 2010 by Simon Hippenmeyer, and has little risk of influencing the expression of endogenous genes after the exogenous genes are inserted because the H11 locus is located between the two genes. The H11 site was verified to be a safe transcription activation region between genes, a new "safe harbor" site outside the AAVS1, eGSH sites.

1.4 inducible Gene expression System

The inducible gene expression system is selected from: tet-Off system or dimer-Off expression system:

(1) tet-Off system

In the absence of tetracycline, the tTA protein continues to act on the tet promoter, resulting in sustained gene expression. This system is very useful in situations where it is desirable to maintain the transgene in a sustained expression state. When tetracycline is added, the tetracycline can change the structure of the tTA protein, so that the tTA protein cannot be combined with a promoter, and the expression level of a gene driven by the tTA protein is reduced. To keep the system in an "off" state, the tetracycline must be added continuously.

Knocking the sequence of the tet-Off system and one or more immune compatible molecules into the genome safe site of the pluripotent stem cell, and precisely turning on or Off the expression of the immune compatible molecules by the addition or non-addition of tetracycline, thereby reversibly regulating the expression of major histocompatibility complex related genes in the pluripotent stem cell or the derivative thereof.

(2) Dimer-switched off expression system

Dimer-mediated gene expression regulation system: there are many ways of chemically regulating transcription of target genes, most commonly regulated using allosteric modulators that influence the activity of transcription factors. One such method is the use of dimerizing inducers or dimers to recombine active transcription factors on inactive fusion proteins. The most commonly used system is rapamycin (rapamydn), a natural product, or an analog that is biologically inactive, as the drug for dimerization. The rapamycin (or analog) sibling protein FKBP12 (the protein to which FKBP binds to FK 506) and a large serine-threonine protein kinase, known as FRAP [ FRBP-rapamycin associated protein, mTOR (mammalian target of rapamycin), have high affinity and function to bind to both proteins, thus bringing them together as a heterologous dimer. To regulate transcription of a target gene, a DNA binding domain is fused to one or more FKBP domains and a transcription repressing domain is fused to amino acid position 93 of FRAP, designated FRB, which is sufficient to bind the FKBP-rapamycin complex. Dimerization of these two fusion proteins can only occur in the presence of rapamycin. Thus inhibiting transcription of genes having sites that bind to the DNA binding region.

1.5 Immunocompatible molecules

The immune compatible molecule can regulate the expression of allogeneic immune rejection related genes in the pluripotent stem cells or derivatives thereof.

The types and sequences of specific immune-compatible molecules are shown in table 1.

TABLE 1 immune compatible molecules

The target sequences of the shRNA or shRNA-miR immune compatible molecules are shown in Table 2.

TABLE 2 target sequences for shRNA or shRNA-miR

In the scheme of knocking in the immune compatible molecules in the subsequent experiments, the shRNA or shRNA-miR sequences of each experimental group are shRNA or shRNA-miR immune compatible molecules constructed by adopting the target sequence 1 in the table 2. Those skilled in the art will understand that: the shRNA or shRNA-miR immune compatible molecule constructed by other target sequences can also realize the technical effect of the invention and all fall into the protection scope of the claims of the invention.

1.6shRNA/miRNA processing Complex genes and anti-interferon effector molecules

The primary miRNA (pri-miRNA) in the nucleus is microprocessed through the complex Drosha-DGCR8, which cleaves the pri-miRNA to a precursor miRNA (pre-miRNA), which forms a hairpin. Then, the pre-miRNA is transported out of the nucleus via the Exportin-5-Ran-GTP complex. The RNase Dicer enzyme, which binds to the double-stranded RNA-binding protein TRBP (TARBP2) in the cytoplasm, breaks down the pre-miRNA into mature lengths, at which point the miRNA is still in a double-stranded state. Finally, it is transported into AGO2 to form RISC (RNA-induced silencing complex). One strand of the final miRNA double strand is retained in the RISC complex, and the other strand is excreted and rapidly degraded. While DGCR8, the main binding protein of Drosha, can bind to pri-miRNA through two double-stranded RNA binding regions at its C-terminal end, recruit and guide Drosha to cut at the right position of pri-miRNA to produce pre-miRNA, which is further cut by Dicer and TRBP/PACT processing to form mature miRNA. Deletion or abnormal expression of DGCR8 affects the cleavage activity of Drosha, which in turn affects the activity of mirnas, leading to disease. TRBP is able to recruit Dicer complex mirnas to form RISC Ago 2.

When the shRNA-miR expression sequences aiming at HLA class I molecules, HLA class II molecules and the like which can be induced to be expressed in a closed mode are knocked in at a genome safe site by using a gene knock-in technology, shRNA and/or miRNA processing machines which can be induced to be expressed in a closed mode preferably comprise Drosha (access number: NM-001100412), Ago1(access number: NM-012199), Ago2(access number: NM-001164623), Dicer1(access number: NM-001195573), export-5 (access number: NM-020750), TRBP (access number: NM-134323), PACT (access number: NM-003690) and DGCR8(access number: NM-022720) so that cells do not occupy the processing of other miRNAs and influence the functions of the cells.

In addition, during IFN induction, double-stranded RNA-dependent Protein Kinase (PKR), which is a key factor of the whole cell signal transduction pathway, and 2 ', 5' Oligoadenylate Synthetase (2,5-Oligoadenylate Synthetase,2-5As), which are closely related to dsRNA-induced IFN, are involved. PKR can inhibit protein synthesis by phosphorylating eukaryotic cell transcription factors, arrest cells in G0/G1 and G2/M phases and induce apoptosis, while dsRNA can promote synthesis of 2-5As, which results in nonspecific activation of RNase, RNaseL, degradation of all mRNA in cells and cell death. The specificity of induction of type I interferons is achieved by members of the IRF transcription factor family, which are not inducible to be secreted in many viral infections in the absence of IRF-3 and IRF-7 expression in cells. Lack of IFN response, in order to recover, requires the two proteins were expressed together.

By utilizing a gene knock-in technology, when an immune compatible molecule shRNA-miR expression sequence is knocked in at a genome safety site, preferably, the shRNA and/or shRNA-miR expression sequence which can induce closed expression and aims at inhibiting PKR, 2-5As, IRF-3 and IRF-7 genes is knocked in at the same time, so that the interferon reaction induced by dsRNA is reduced, and the cytotoxicity is avoided.

The sequence of the insertion positions of the shRNA/miRNA processing complex related gene, the anti-interferon effector molecule and the immune compatible molecule at the genome safety site is not limited, and the shRNA/miRNA processing complex related gene, the anti-interferon effector molecule and the immune compatible molecule can be arranged in any sequence without mutual interference or influence on the structure and the function of other genes of the genome.

Specific target sequences for anti-interferon effector molecules are shown in table 3.

TABLE 3 target sequences for anti-interferon effector molecules

In the subsequent experiment including the scheme of knocking-in of the anti-interferon effector molecules, the target sequences of the anti-interferon effector molecules of each experimental group are the anti-interferon effector molecules constructed by adopting the target sequence 1 in the table 3. Those skilled in the art will understand that: the anti-interferon effector molecules constructed by other target sequences can also achieve the technical effects of the invention and fall into the protection scope of the claims of the invention.

1.7 Universal framework for Immunocompatible molecules, shRNA or shRNA-miR of anti-Interferon Effector molecules

The general framework sequences of the shRNA or shRNA-miR of the immune compatible molecules and the anti-interferon effector molecules are as follows:

(1) the constitutive expression framework of shRNA is:

GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGCTAGCGCCACC(SEQ ID NO.164)N₁...N₂₁TTCAAGAGA(SEQ ID NO.165)N₂₂...N₄₂TTTTTT；

wherein:

a、N₁...N₂₁shRNA target sequence for the corresponding Gene, N₂₂...N₄₂Is a reverse complementary sequence of the shRNA target sequence of the corresponding gene;

b. if the plasmid needs to express shRNAs of a plurality of genes, each gene corresponds to a shRNA expression frame and then is connected seamlessly;

c. constitutive shRNA plasmids with different resistance genes only have different resistance genes and have the same other sequences;

d. n represents A, T, G, C bp;

e. SEQ ID No.164 is the U6 promoter sequence;

f. SEQ ID NO.165 is a stem-loop sequence.

(2) The shRNA inducible expression framework is as follows:

GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGCTCGGTACCCGGGTCGAGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTGCTAGCGCCACC(SEQ ID NO.166)N₁...N₂₁TTCAAGAG A(SEQ ID NO.165)N₂₂...N₄₂TTTTTT；

wherein:

a、N₁...N₂₁shRNA target sequence of the corresponding Gene, N₂₂...N₄₂Is a reverse complementary sequence of the shRNA target sequence of the corresponding gene;

d. n represents A, T, G, C bp;

e. SEQ ID No.166 is the H1 TO promoter sequence;

f. SEQ ID NO.165 is a stem-loop sequence.

(3) The shRNA-miR constitutive or inducible expression framework is as follows:

the shRNA-miR target sequence is used for replacing a target sequence in microRNA-30 to obtain the shRNA-miR target sequence, and the specific sequence is as follows:

GAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAACACTTGCTGGG ATTACTTCTTCAGGTTAACCCAACAGAAGGCTAAAGAAGGTATATTGCTGTTGACAGTGA GCG(SEQ ID NO.167)M₁N₁...N₂₁TAGTGAAGCCACAGATGTA(SEQ ID NO.168)N₂₂...N₄₂M₂TGCCTACTGCCTCGGACTTCAAGGGGCTACTTTAGGAGCAATTATCTTGTTTACTA AAACTGAATACCTTGCTATCTCTTTGATACATTTTTACAAAGCTGAATTAAAATGGTATAA AT(SEQ ID NO.169)；

wherein:

a、N₁...N₂₁shRNA-miR target sequence, N, as a corresponding gene₂₂...N₄₂Is a reverse complementary sequence of shRNA-miR target sequence of a corresponding gene;

b. if the plasmid needs to express shRNA-miR of a plurality of genes, each gene corresponds to a shRNA-miR expression frame and is then connected seamlessly;

c. constitutive shRNA-miR plasmids with different resistance genes only have different resistance genes and have the same other sequences;

d. m is A or C, N is A, T, G, C;

e. if N is present₁Is a G base, then M₁Is A base; otherwise M₁Is a C base;

f、M₁base and M₂And (4) base complementation.

1.8 Gene editing System, Gene editing method and inspection method

1.8.1 Gene editing System

The gene editing technology adopts a CRISPR-Cas9 gene editing system. The Cas9 protein used by the inventors was Cas9(D10A), Cas9(D10A) bound to sgrnas responsible for specific recognition of the target sequence (genomic DNA), which was then single-stranded cleaved by Cas9 (D10A). Double Strand breaks in genomic DNA (DSB) must occur, and two Cas 9(D10A)/sgRNA must cleave the two strands of genomic DNA separately, and not too far apart. The Cas 9(D10A)/sgRNA scheme has the advantage of higher specificity and lower probability of off-target compared to the Cas 9/sgRNA scheme. The plasmids or Donor fragments used in the gene editing system were: cas9(D10A) plasmid, sgRNA clone plasmid, Donor fragment.

(1) Cas9(D10A) plasmid: a plasmid expressing the Cas9(D10A) protein, specifically single-stranded cleaving genomic DNA under the direction of sgrnas.

(2) sgRNA plasmid: a plasmid for expressing sgRNA, sgRNA (small guide RNA), is a guide RNA (guide RNA, gRNA) responsible for directing targeted cleavage of the expressed Cas9(D10A) protein at gene editing.

(3) Donor fragment: the two ends contain recombination arms which are respectively positioned at the left side and the right side of the breaking position of the genome DNA, and the middle part contains genes, fragments or expression elements needing to be inserted. In the presence of the Donor fragment, the cells undergo a Homologous Recombination (HR) reaction at the site of the genomic break. If the Donor fragment is not added, Non-homologous End Joining-NHEJ reactions occur at the site of the genomic break in the cell. This fragment was obtained by digesting KI (Knock-in, the same applies hereinafter) Vector plasmid and recovering it.

1.8.2 constitutive plasmids and inducible plasmids

Constitutive plasmid: the expression function of the Donor fragment obtained from the constitutive plasmid cannot be regulated after knocking in the genomic DNA.

Inducible plasmids: after knocking in the genomic DNA, the expression function of the Donor fragment obtained from the inducible plasmid can be controlled by adding an inducer, which is equivalent to adding a switch for turning on or off the expression function.

1.8.3 plasmid construction method

(1) Cas9(D10A) plasmid: this Plasmid no longer needs to be constructed and is ordered directly from Addgene (Plasmid 41816, Addge ne).

(2) sgRNA plasmid: the original blank Plasmid is ordered from Addge (Plasmid 41824, Addge), then the DNA sequence is input in the website (URL: https:// ccttop. cos. uni-heidelberg. de) to design the target sequence, and finally different target sequences are respectively put into the blank sgRNA Plasmid to complete the construction.

(3) KI (Knock-in, the same applies below) Vector plasmid:

acquisition of Amp (R) -pUC origin fragment: designing PCR primers, and amplifying and recovering the fragment by a PCR method by using a pUC18(Takara, Code No.3218) plasmid as a template and a high fidelity enzyme (Nanjing Novozam organism, P505-d 1);

acquisition of aavs1 or eGSH recombination arms: extracting genome DNA of human cells and designing corresponding primers, and then amplifying and recovering the fragments by using the human genome DNA as a template and using a high fidelity enzyme (Nanjing Novozam organism, P505-d1) through a PCR method;

c. acquisition of the individual plasmid elements: designing PCR amplification primers of each element, and then respectively amplifying and recovering each plasmid element by using a high fidelity enzyme (Nanjing Nuozhen organism, P505-d1) through a PCR method by taking a plasmid containing the element as a template;

d. assembly into a complete plasmid: the fragments obtained in the previous step were ligated together using a multi-fragment recombinase (Nanjing Nozam, C113-02) to form a complete plasmid.

1.8.4 Gene editing Process

One, single cell cloning operation step of AAVS1 gene knock-in

(1) Electric transfer program:

preparation of donor cells: human pluripotent stem cells.

The kit comprises: human Stem Cell

Kit 1。

The instrument comprises the following steps: an electrotransformation instrument.

Culture medium: and (4) BioCISO.

Induction plasmid: cas9D10A, sgRNA clone AAVS1-1, sgRNA clone AAVS1-2, AAVS1 neo Vector I and AAVS1 neo Vector II.

Note: induction plasmid used for the knock-in of the eGSH gene: cas9D10A, sgRNA clone eGSH-1, sgRNA clone eGSH-2, eGSH-neo/eGSH-puro (donor) comparison of the donor plasmid with AAVS1 shows that only the right and left recombination arms are different, and the other elements are the same. Since the gene editing process of eGSH is the same as that of AAVS1, the following description will not be repeated.

(2) The transformed human pluripotent stem cells are screened in a double antibiotic medium containing G418 and puro.

(3) And (4) carrying out single cell clone screening and culture to obtain a single cell clone strain.

Second, AAVS1 gene knock-in single cell clone strain culture reagent

(1) Culture medium: BioCISO + 300. mu.g/mL G418+ 0.5. mu.g/mL puro (should be placed at room temperature in advance, protected from light for 30-60 minutes until room temperature is restored. Note that BioCISO should not be placed at 37 ℃ for preheating to avoid reduction of the activity of the biomolecule.).

(2) Matrix glue: hESC grade Matrigel (the Matrigel working solution is added into a cell culture bottle dish and shaken up before the cells are passaged or revived to ensure that the Matrigel completely sinks to the bottom of the culture bottle dish, and any Matrigel cannot be dried at any position before the cells are used. in order to ensure that the cells can be attached to the culture bottle dish and survive better, the Matrigel is put into a 37 ℃ culture box for the time of 1:100X Matrigel cannot be less than 0.5 hour, and 1:200X Matrigel cannot be less than 2 hours).

(3) Digestion solution: EDTA was dissolved using DPBS to a final concentration of 0.5mM, pH7.4 (note: EDTA cannot be diluted with water, otherwise the cells die due to reduced osmotic pressure).

(4) Freezing and storing liquid: 60% BioCISO + 30% ESCs grade FBS + 10% DMSO (the frozen stock is preferably ready for use).

Thirdly, the conventional maintenance subculture process

(1) Optimal time of passage and passage ratio

a. The best passage time: the overall confluency of the cells reaches 80 to 90 percent;

b. the optimal ratio of passage: the optimal confluence degree of the passage is maintained at 20-30% in the next day after passage of 1: 4-1: 7.

(2) Passage process

a. The Matrigel in the coated cell culture bottle dish was first aspirated away and discarded, and an appropriate amount of culture medium (BioCISO + 300. mu.g/mL G418+ 0.5. mu.g/mL puro) was added thereto at 37 ℃ and,5％CO₂Incubation in an incubator;

b. when the cells meet the requirement of passage, sucking the supernatant of the culture medium, and adding a proper amount of 0.5mM EDTA digestive solution into a cell bottle dish;

c. the cells were incubated at 37 ℃ with 5% CO₂Incubating in an incubator for 5-10 minutes (digesting until most cells are observed to shrink and become round under a microscope but not float, gently blowing the cells to separate the cells from the wall, sucking the cell suspension into a centrifugal tube, and centrifuging for 5 minutes at 200 g;

d. centrifuging, discarding the supernatant, suspending the cells by using a culture medium, gently and repeatedly blowing the cells for several times until the cells are uniformly mixed, and then transferring the cells to a bottle dish prepared for coating Matrigel in advance;

e. after the cells were transferred to the cell flask, the cells were horizontally shaken up all around, observed under a mirror to be free from abnormality, and then shaken up and placed at 37 ℃ with 5% CO₂Culturing in an incubator;

f. observing the adherent survival state of the cells the next day, and normally and regularly changing the culture medium every day by sucking off the culture medium.

Fourthly, freezing and storing cells

(1) According to the conventional passage operation steps, digesting the cells by using 0.5mM EDTA until most cells shrink and become round but do not float, gently blowing and beating the cells, collecting cell suspension, centrifuging for 5 minutes at 200g, removing supernatant, adding a proper amount of freezing medium to resuspend the cells, and transferring the cells to a freezing tube (suggesting that one frozen cell with 80% confluence degree of a six-well plate and 0.5 mL/cell of freezing medium is frozen);

(2) placing the freezing tube in a programmed cooling box, and immediately placing the freezing tube at-80 ℃ overnight (ensuring that the temperature of the freezing tube is reduced by 1 ℃ per minute);

(3) the next day the cells were immediately transferred into liquid nitrogen.

Fifth, cell recovery

(1) Preparing a Matrigel-coated cell bottle dish in advance, sucking out the Matrigel before recovering the cells, adding a proper amount of BioCISO into the cell bottle dish, placing at 37 ℃ and 5% CO₂Incubation in an incubator;

(2) taking out the cryopreservation tube from liquid nitrogen quickly, immediately putting the tube into a 37 ℃ water bath kettle for quick shaking to quickly melt the cells, carefully observing, stopping shaking after the ice crystals completely disappear, and transferring the cells to a biological safety cabinet;

(3) adding 10mL of DMEM/F12(1:1) basal medium into a 15mL centrifuge tube in advance, balancing to room temperature, sucking 1mL of DMEM/F12(1:1) by using a Pasteur pipette, slowly adding the DMEM/F12(1:1) into a freezing tube, gently mixing, transferring the cell suspension into a prepared 15mL centrifuge tube containing DMEM/F12(1:1), and centrifuging for 5 minutes at 200 g;

(4) carefully removing supernatant, adding appropriate amount of BioCISO, gently mixing cells, seeding into a cell bottle dish prepared in advance, shaking up horizontally, and observing under the mirror, shaking up, and standing at 37 deg.C and 5% CO₂Culturing in an incubator;

(5) the adherent survival state of the cells is observed the next day, and the liquid is normally changed on time every day. If the adherence is good, the BioCISO is changed to BioCISO + 300. mu.g/mL G418+ 0.5. mu.g/mL puro.

1.8.5AAVS1 gene knock-in detection method

First, single cell clone AAVS1 gene knock-in detection

(1) AAVS1 Gene knock-in assay

a. The purpose of the test is as follows: detecting the cells subjected to the gene knock-in treatment by PCR, and testing whether the cells are homozygotes; since the two Donor segments only have the difference in the sequences of the resistance genes, it is necessary to determine whether the cell is homozygous (the two chromosomes knock in the Donor segments of different resistance genes respectively), and it is only possible that the double-knocked-in cell is the correct homozygous by detecting whether the genome of the cell contains the Donor segments of the two resistance genes;

b. firstly, designing a primer in the Donor plasmid (non-recombinant arm part), and then designing another primer in the genome PPP1R12C (non-recombinant arm part); if the Donor fragment can be correctly inserted into the genome, a target band appears, otherwise no target band appears);

c. test protocol primer sequences and PCR protocols are shown in Table 4.

TABLE 4 test protocol primer sequences and PCR protocol

Secondly, the detection method of the eGSH gene knock-in is the same as the detection principle and the detection method of the AAVS1 gene knock-in.

1.8.6 inspection method of knock-in Gene method at genomic safety site

(1) The purpose of the test is as follows: the cells treated by knock-in were tested for homozygote by PCR. Since the two Donor fragments have only difference in the sequences of the resistance genes, it is necessary to determine whether the cell is homozygous (the two chromosomes knock in the Donor fragments of different resistance genes), and it is only possible that the double-knocked-in cell is the correct homozygous by determining whether the genome of the cell contains the Donor fragments of the two resistance genes.

(2) The test method comprises the following steps: first, one primer was designed inside the Donor plasmid (non-recombinant arm portion), and then the other primer was designed in the genome (non-recombinant arm portion). If the Donor fragment is inserted correctly in the genome, the target band will appear, otherwise no target band will appear.

1.9 assay methods for expression of PCSK9 antibody by pluripotent stem cells

The anti-PCSK 9 antibodies expressed by pluripotent stem cells and derivatives thereof were detected using ELISA (double antigen sandwich). Collecting culture supernatant of the pluripotent stem cells expressing the anti-PCSK 9 antibody and the derivatives thereof, loading the culture supernatant on an enzyme label plate coated with human PCSK9 antigen, adding 40ul of sample diluent into a sample hole to be detected, then adding 10ul of sample to be detected, adding culture supernatant of the pluripotent stem cells not expressing the anti-PCSK 9 antibody and the derivatives thereof into a control group, and gently mixing the culture supernatants. Placing the plate on a sealing plate, incubating for 30min at 37 ℃, washing for 5 times, adding 50ul of an enzyme-labeled PCSK9 antigen reagent, placing the plate on the sealing plate, incubating for 30min at 37 ℃, washing for 5 times, adding a developing solution, developing for 15min, adding a stop solution for 50ul, reading, measuring the absorbance value at 450nm, wherein the expression quantity of the anti-PCSK 9 antibody is in positive correlation with the color depth.

1.10 treatment method of mouse hyperlipidemia model to detect the influence of PCSK9 cells on blood lipid

In humanized NSG mice (The Jackson Laboratory (JAX)), human immune cells of The same donor were injected to reconstitute The immune system of The mice, and high-fat diet (1% cholesterol, 10% lard, 10% egg yolk powder and 79% basal diet) was used instead when The mice were raised. And (3) detecting the blood fat condition of the mouse after 2 weeks, and performing a test after the blood fat of the mouse is obviously increased. Tail vein injection of 200uL PBS (containing 10)⁶The pluripotent stem cell derivative expressing the PCSK9 blocker, the pluripotent stem cell derivative being derived from the same donor as the human immune cells) for blood lipid lowering therapy. Then, blood lipid was detected by ELISA and statistical analysis of differences was performed.

2. Experimental protocol

First, the gene expressing the PCSK9 blocker was knocked into the genomic safe site (safe harbour) to achieve expression of the PCSK9 blocker by the pluripotent stem cell derivative. Thereby enabling the pluripotent stem cell derivative to be applied to disease treatment. Then, the derivative (the pluripotent stem cell derivative expressing the PCSK9 blocker) can be modified by a gene editing technology to form a constitutive immune-compatible universal type pluripotent stem cell derivative and an immune-compatible reversible universal type pluripotent stem cell derivative, so that disease treatment can be carried out in an allogeneic way.

Specifically, the method comprises the following steps: the following genetic manipulations were performed in the PCSK9 blocker-expressing pluripotent stem cell derivatives to achieve immune compatibility of allogeneic hPSCs and hPSCs-derived derivatives (hPSCs-MSCs, NSCs, EBs)

The experimental protocols for knocking in the PCSK9 blocker-expressing gene, one or more immune-compatible molecules, shRNA and/or miRNA processing complex-associated genes, anti-interferon effector molecules into safe loci in the genome of pluripotent stem cells are shown in table 5 and table 6, wherein the "+" sign indicates the knock-in of a gene or nucleic acid sequence and the "-" sign indicates the knock-out of a gene.

The following vectors were constructed according to the plasmid construction method in 1.8.3:

TABLE 5 constitutive expression protocol

The plasmids selected and the specific knock-in positions were as follows:

the PCSK9 antibody is a secreted antibody with the antibody structure: the signal peptide + light chain (containing a stop codon) + IRESWt (SEQ ID NO.178) + signal peptide + heavy chain (containing a stop codon), the stop codon being generally TGA.

Wherein, the sequence of the signal peptide is: ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCT TGCACTTGTCACGAATTCG (SEQ ID NO. 183).

General principles are as follows: the PCSK9 antibody sequence is placed at the position of MCS2 of the corresponding plasmid (note: signal peptides are added in front of the LC light chain and HC heavy chain of the antibody, as shown above), the shRNA is placed in the shRNA expression frame of the corresponding plasmid, the shRNA-miR is placed in the shRNA-miR expression frame of the corresponding plasmid, and other genes are placed at the position of MCS of the corresponding plasmid. The maps of the plasmids are shown in FIGS. 1 to 11.

Wherein the sgRNA clone B2M plasmid comprises sgRNA clone B2M-1 and sgRNA clone B2M-2 plasmids. The sgRNA clone CIITA plasmid comprises sgRNA clone CIITA-1 and sgRNA clone CIITA-2 plasmids.

(1) A1 grouping (PCSK9 antibody)

MCS2 of AAVS1 KI Vector (shRNA, constitutive) plasmid was placed into the PCSK9 antibody sequence (LC light chain and HC heavy chain sequences of the antibody were connected using EMCV IRESWT in the following order: LC light chain, EMCV IRESWT, HC heavy chain, the same below).

(2) A2 packet (PCSK9 antibody, shRNA, gene)

MCS2 of AAVS1 KI Vector (shRNA, constitutive) plasmid placed PCSK9 antibody sequence. The shRNA expression framework places the shRNA target sequence (if multiple shrnas are present, they are seamlessly joined). MCS1 was placed into the gene sequence (if multiple genes were present, they were ligated using EMCV IRESWT).

(3) A3 grouping (PCSK9 antibody, shRNA-miR, gene)

MCS2 of AAVS1 KI Vector (shRNA-miR, constitutive) plasmid placed PCSK9 antibody sequence. The shRNA-miR expression framework places shRNA target sequences (if multiple shRNA-mirs are present, they are seamlessly connected). MCS1 was placed into the gene sequence (if multiple genes were present, they were ligated using EMCV IRESWT).

(4) A4 grouping (PCSK9 antibody, B2M and CIITA double knockout, Gene)

MCS2 of AAVS1 KI Vector (shRNA, constitutive) plasmid placed PCSK9 antibody sequence. MCS1 was placed into the gene sequence (if multiple genes were present, they were ligated using EMCV IRESWT).

The target sequence of the sgRNA clone B2M plasmid was placed into the sgRNA target sequence of B2M (SEQ ID NO.179 and SEQ ID NO.180), and the target sequence of the sgRNA clone CIITA plasmid was placed into the sgRNA target sequence of CIITA (SEQ ID NO.181 and SEQ ID NO. 182).

(5) A5 packet (PCSK9 antibody, shRNA, gene)

Methods grouped with a 2.

(6) A6 grouping (PCSK9 antibody, shRNA-miR, gene)

Methods grouped with a 3.

TABLE 6 Experimental protocol for inducible expression

(1) B1 group (PCSK9 antibody, shRNA, gene)

MCS2 of AAVS1 KI Vector (shRNA, inducible) plasmid placed PCSK9 antibody sequences. The shRNA expression frame is placed into the shRNA target sequence (seamlessly joined if multiple shrnas are present). MCS1 was placed into the gene sequence (if multiple genes were present, they were ligated using EMCV IRESWT).

(2) B2 group (PCSK9 antibody, shRNA-miR, gene)

MCS2 of AAVS1 KI Vector (shRNA-miR, inducible) plasmid placed PCSK9 antibody sequence. The shRNA-miR expression framework is placed into a shRNA target sequence (if a plurality of shRNA-miRs exist, seamless connection is realized). MCS1 was placed into the gene sequence (if multiple genes were present, they were ligated using EMCV IRESWT).

(3) B3 group (PCSK9 antibody, shRNA, gene)

Methods grouped with B1.

(4) B4 group (PCSK9 antibody, shRNA-miR, gene)

Methods grouped with B2.

Example 1 ELISA detection of PCSK9 antibody expressed by each experimental group

The experimental group protocols in tables 5 and 6 were knocked into the genome safety sites of iPSCs, EBs, MSCs and NSCs cells at 37 ℃ with 0.5% CO₂Culturing in an incubator, collecting culture supernatant of the pluripotent stem cells expressing the anti-PCSK 9 antibody and derivatives thereof, loading the culture supernatant on an enzyme label plate coated with the human PCSK9 antigen, loading 40ul of sample diluent in a sample hole to be detected, then loading 10ul of sample to be detected, adding culture supernatant of the pluripotent stem cells not expressing the anti-PCSK 9 antibody and derivatives thereof in a control group, and gently mixing the culture supernatants.

Placing the plate on a sealing plate, incubating for 30min at 37 ℃, washing for 5 times, adding 50ul of an enzyme-labeled PCSK9 antigen reagent, placing the plate on the sealing plate, incubating for 30min at 37 ℃, washing for 5 times, adding a developing solution, developing for 15min, adding a stop solution for 50ul, reading, measuring the absorbance value at 450nm, wherein the expression quantity of the PCSK9 antibody is in positive correlation with the color depth.

Table 7 PCSK9 antibody ELISA detection of expression by each experimental group

As can be seen from the above table, the pluripotent stem cells or derivatives thereof prepared by the present invention can effectively express PCSK9 antibody. And the expression level is relatively constant in each group, so that the PCSK9 antibody expressed by the pluripotent stem cell derivative is not influenced by cell differentiation morphology and other exogenous genes (immune compatibility modification).

Example 2 Effect of PCSK9 blockers on blood lipids

The inventors selected to test the hypolipidemic effect in cells (MSCs) expressing only the blocker regimen group (a 1).

In a humanized NSG mouse blood lipid model, hPSCs and hPSCs-derived derivatives (hPSCs-MSCs, hPSCs-NSCs and hPSCs-EBs) capable of expressing a PCSK9 blocker (anti-PCSK 9 antibody) are injected into a mouse, and the effect of reducing blood lipid is observed.

Note: to avoid the problem of immune compatibility, the immunocytes used are derived from the same person as the hPSCs and the derivatives derived from hPSCs.

TABLE 8 Each experimental group expresses PCSK9 blocker therapeutic effect on blood lipid

Through the experiments, the stem cells expressing the PCSK9 blocker or the derivatives thereof prepared by the invention can be proved to be capable of effectively reducing blood fat.

Example 3 reversible expression assay for an immune-compatible molecule-inducible expression set

Through the embodiment, the hPSCs and hPSCs derivatives expressing the PCSK9 blocker can effectively play a role in reducing blood fat. Furthermore, the problem of immune compatibility of hPSCs and derivatives of hPSCs must be considered. The inventors therefore selected a suitable combination to test for immune compatibility, and the results are shown in table 9.

The inventor utilizes the characteristic of low immunogenicity of the MSCs, injects hPSCs source immune compatible MSCs capable of expressing PCSK9 blocker (anti-PCSK 9 antibody) into a humanized NSG mouse disease model, and observes the effect of the MSCs in treating blood fat. Note: the immunocytes used are derived from non-identical persons with the MSCs of hPSCs source.

The control group refers to the NSG mouse disease model without MSCs cell injection.

The process of adding the Dox group is: mice were fed with 0.5mg/mL Dox in the mouse diet, and the mice were used from the time of injection of the expression blocker cells until the end of the experiment.

TABLE 9 reversible expression test results for immune-compatible molecule-inducible expression sets

The above experiments show that: in the hypolipidemic test, only the blocking-substance expressing MSCs (group 2) with low immunogenicity, which can exist in xenobiotics for a certain period of time, can exert a certain therapeutic effect, while those with immuno-compatible engineering (groups 3-11, which include constitutive and reversible inducible immuno-compatibility), which have better immuno-compatible effect, have longer in vivo existence (or can coexist for a long period) than MSCs without immuno-compatible engineering, and have better therapeutic effect, while group 5 is the B2M and CIITA gene knockout group, which completely eliminates the effect of HLA-I and HLA-II molecules, and thus has the best therapeutic effect. However, there are group 8-15 protocols set up due to their constitutive immune compatible modifications (knock-in/knock-out) which cannot be cleared when the graft becomes mutated or otherwise unwanted. In groups 12-15, the mice injected with the expression blocker cells will be abolished from their immune compatibility by the use of Dox inducer (always used) simultaneously with the injection of the expression blocker cells into the mice, and will be present in vivo for a time period comparable to that of the MSCs without immune compatibility engineering, and will be treated with a therapeutic effect comparable to that of the MSCs without immune compatibility engineering.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> future Chile regenerative medicine institute (Guangzhou) Co., Ltd

Wang Linli

<120> pluripotent stem cell expressing PCSK9 blocker or derivative thereof and application

<130>

<160> 183

<170> PatentIn version 3.5

<210> 1

<211> 1323

<212> DNA

<213> Artificial sequence

<400> 1

gaggtgcagc tggtgcagag cggcgccgag gtgaagaagc ccggcgccag cgtgaaggtg 60

agctgcaagg ccagcggcta caccctgacc agctacggca tcagctgggt gaggcaggcc 120

cccggccagg gcctggagtg gatgggctgg gtgagcttct acaacggcaa caccaactac 180

gcccagaagc tgcagggcag gggcaccatg accaccgacc ccagcaccag caccgcctac 240

atggagctga ggagcctgag gagcgacgac accgccgtgt actactgcgc caggggctac 300

ggcatggacg tgtggggcca gggcaccacc gtgaccgtga gcagcgccag caccaagggc 360

cccagcgtgt tccccctggc cccctgcagc aggagcacca gcgagagcac cgccgccctg 420

ggctgcctgg tgaaggacta cttccccgag cccgtgaccg tgagctggaa cagcggcgcc 480

ctgaccagcg gcgtgcacac cttccccgcc gtgctgcaga gcagcggcct gtacagcctg 540

agcagcgtgg tgaccgtgcc cagcagcaac ttcggcaccc agacctacac ctgcaacgtg 600

gaccacaagc ccagcaacac caaggtggac aagaccgtgg agaggaagtg ctgcgtggag 660

tgccccccct gccccgcccc ccccgtggcc ggccccagcg tgttcctgtt cccccccaag 720

cccaaggaca ccctgatgat cagcaggacc cccgaggtga cctgcgtggt ggtggacgtg 780

agccacgagg accccgaggt gcagttcaac tggtacgtgg acggcgtgga ggtgcacaac 840

gccaagacca agcccaggga ggagcagttc aacagcacct tcagggtggt gagcgtgctg 900

accgtggtgc accaggactg gctgaacggc aaggagtaca agtgcaaggt gagcaacaag 960

ggcctgcccg cccccatcga gaagaccatc agcaagacca agggccagcc cagggagccc 1020

caggtgtaca ccctgccccc cagcagggag gagatgacca agaaccaggt gagcctgacc 1080

tgcctggtga agggcttcta ccccagcgac atcgccgtgg agtgggagag caacggccag 1140

cccgagaaca actacaagac cacccccccc atgctggaca gcgacggcag cttcttcctg 1200

tacagcaagc tgaccgtgga caagagcagg tggcagcagg gcaacgtgtt cagctgcagc 1260

gtgatgcacg aggccctgca caaccactac acccagaaga gcctgagcct gagccccggc 1320

aag 1323

<210> 2

<211> 645

<212> DNA

<213> Artificial sequence

<400> 2

gagagcgccc tgacccagcc cgccagcgtg agcggcagcc ccggccagag catcaccatc 60

agctgcaccg gcaccagcag cgacgtgggc ggctacaaca gcgtgagctg gtaccagcag 120

caccccggca aggcccccaa gctgatgatc tacgaggtga gcaacaggcc cagcggcgtg 180

agcaacaggt tcagcggcag caagagcggc aacaccgcca gcctgaccat cagcggcctg 240

caggccgagg acgaggccga ctactactgc aacagctaca ccagcaccag catggtgttc 300

ggcggcggca ccaagctgac cgtgctgggc cagcccaagg ccgcccccag cgtgaccctg 360

ttccccccca gcagcgagga gctgcaggcc aacaaggcca ccctggtgtg cctgatcagc 420

gacttctacc ccggcgccgt gaccgtggcc tggaaggccg acagcagccc cgtgaaggcc 480

ggcgtggaga ccaccacccc cagcaagcag agcaacaaca agtacgccgc cagcagctac 540

ctgagcctga cccccgagca gtggaagagc cacaggagct acagctgcca ggtgacccac 600

gagggcagca ccgtggagaa gaccgtggcc cccaccgagt gcagc 645

<210> 3

<211> 21

<212> DNA

<213> human

<400> 3

gggagcagag aattctctta t 21

<210> 4

<211> 21

<212> DNA

<213> human

<400> 4

ggagcagaga attctcttat c 21

<210> 5

<211> 21

<212> DNA

<213> human

<400> 5

gagcagagaa ttctcttatc c 21

<210> 6

<211> 21

<212> DNA

<213> human

<400> 6

gctacctgga gcttcttaac a 21

<210> 7

<211> 21

<212> DNA

<213> human

<400> 7

ggagcttctt aacagcgatg c 21

<210> 8

<211> 21

<212> DNA

<213> human

<400> 8

gggtctccag tatattcatc t 21

<210> 9

<211> 21

<212> DNA

<213> human

<400> 9

gcctcctgat gcacatgtac t 21

<210> 10

<211> 21

<212> DNA

<213> human

<400> 10

ggaagacctg ggaaagcttg t 21

<210> 11

<211> 21

<212> DNA

<213> human

<400> 11

ggctaagctt gtacaataac t 21

<210> 12

<211> 21

<212> DNA

<213> human

<400> 12

gcggaatgaa ccacatcttg c 21

<210> 13

<211> 21

<212> DNA

<213> human

<400> 13

ggccttctct gaaggacatt g 21

<210> 14

<211> 21

<212> DNA

<213> human

<400> 14

ggactcaatg cactgacatt g 21

<210> 15

<211> 21

<212> DNA

<213> human

<400> 15

ggtacccact gctctggtta t 21

<210> 16

<211> 21

<212> DNA

<213> human

<400> 16

gctcccactc catgaggtat t 21

<210> 17

<211> 21

<212> DNA

<213> human

<400> 17

ggtatttctt cacatccgtg t 21

<210> 18

<211> 21

<212> DNA

<213> human

<400> 18

aggagacacg gaatgtgaag g 21

<210> 19

<211> 21

<212> DNA

<213> human

<400> 19

gctcccactc catgaggtat t 21

<210> 20

<211> 21

<212> DNA

<213> human

<400> 20

ggtatttcta cacctccgtg t 21

<210> 21

<211> 21

<212> DNA

<213> human

<400> 21

ggaccggaac acacagatct a 21

<210> 22

<211> 21

<212> DNA

<213> human

<400> 22

accggaacac acagatctac a 21

<210> 23

<211> 21

<212> DNA

<213> human

<400> 23

ggaacacaca gatctacaag g 21

<210> 24

<211> 21

<212> DNA

<213> human

<400> 24

gaacacacag atctacaagg c 21

<210> 25

<211> 21

<212> DNA

<213> human

<400> 25

ttcttacttc cctaatgaag t 21

<210> 26

<211> 21

<212> DNA

<213> human

<400> 26

aagttaagaa cctgaatata a 21

<210> 27

<211> 21

<212> DNA

<213> human

<400> 27

aacctgaata taaatttgtg t 21

<210> 28

<211> 21

<212> DNA

<213> human

<400> 28

acctgaatat aaatttgtgt t 21

<210> 29

<211> 21

<212> DNA

<213> human

<400> 29

aagcgttgat ggattaatta a 21

<210> 30

<211> 21

<212> DNA

<213> human

<400> 30

agcgttgatg gattaattaa a 21

<210> 31

<211> 21

<212> DNA

<213> human

<400> 31

gggtctggtg ggcatcatta t 21

<210> 32

<211> 21

<212> DNA

<213> human

<400> 32

ggtctggtgg gcatcattat t 21

<210> 33

<211> 21

<212> DNA

<213> human

<400> 33

gcatcattat tgggaccatc t 21

<210> 34

<211> 21

<212> DNA

<213> human

<400> 34

gcacatggag gtgatggtgt t 21

<210> 35

<211> 21

<212> DNA

<213> human

<400> 35

ggaggtgatg gtgtttctta g 21

<210> 36

<211> 21

<212> DNA

<213> human

<400> 36

gagaagatca ctgaagaaac t 21

<210> 37

<211> 21

<212> DNA

<213> human

<400> 37

gctttaatgg ctttacaaag c 21

<210> 38

<211> 21

<212> DNA

<213> human

<400> 38

ggctttacaa agctggcaat a 21

<210> 39

<211> 21

<212> DNA

<213> human

<400> 39

gctttacaaa gctggcaata t 21

<210> 40

<211> 21

<212> DNA

<213> human

<400> 40

gctccgtact ctaacatcta g 21

<210> 41

<211> 21

<212> DNA

<213> human

<400> 41

gatgaccaca ttcaaggaag a 21

<210> 42

<211> 21

<212> DNA

<213> human

<400> 42

gaccacattc aaggaagaac t 21

<210> 43

<211> 21

<212> DNA

<213> human

<400> 43

gctttcctgc ttggcagtta t 21

<210> 44

<211> 21

<212> DNA

<213> human

<400> 44

ggcagttatt cttccacaag a 21

<210> 45

<211> 21

<212> DNA

<213> human

<400> 45

gcagttattc ttccacaaga g 21

<210> 46

<211> 21

<212> DNA

<213> human

<400> 46

gcgtaagtct gagtgtcatt t 21

<210> 47

<211> 21

<212> DNA

<213> human

<400> 47

gacaatttaa ggaagaatct t 21

<210> 48

<211> 21

<212> DNA

<213> human

<400> 48

ggccatagtt ctccctgatt g 21

<210> 49

<211> 21

<212> DNA

<213> human

<400> 49

gccatagttc tccctgattg a 21

<210> 50

<211> 21

<212> DNA

<213> human

<400> 50

gcagatgacc acattcaagg a 21

<210> 51

<211> 21

<212> DNA

<213> human

<400> 51

gatgaccaca ttcaaggaag a 21

<210> 52

<211> 21

<212> DNA

<213> human

<400> 52

gaccacattc aaggaagaac c 21

<210> 53

<211> 21

<212> DNA

<213> human

<400> 53

gctttgtcag gaccaggttg t 21

<210> 54

<211> 21

<212> DNA

<213> human

<400> 54

gaccaggttg ttactggttc a 21

<210> 55

<211> 21

<212> DNA

<213> human

<400> 55

gaagcctcac agctttgatg g 21

<210> 56

<211> 21

<212> DNA

<213> human

<400> 56

gatggcagtg cctcatcttc a 21

<210> 57

<211> 21

<212> DNA

<213> human

<400> 57

ggcagtgcct catcttcaac t 21

<210> 58

<211> 21

<212> DNA

<213> human

<400> 58

gcagcaggat aagtatgagt g 21

<210> 59

<211> 21

<212> DNA

<213> human

<400> 59

gcaggataag tatgagtgtc a 21

<210> 60

<211> 21

<212> DNA

<213> human

<400> 60

ggttcctgca cagagacatc t 21

<210> 61

<211> 21

<212> DNA

<213> human

<400> 61

gcacagagac atctataacc a 21

<210> 62

<211> 21

<212> DNA

<213> human

<400> 62

gagacatcta taaccaagag g 21

<210> 63

<211> 21

<212> DNA

<213> human

<400> 63

gagtactgga acagccagaa g 21

<210> 64

<211> 21

<212> DNA

<213> human

<400> 64

gctttcctgc ttggctctta t 21

<210> 65

<211> 21

<212> DNA

<213> human

<400> 65

ggctcttatt cttccacaag a 21

<210> 66

<211> 21

<212> DNA

<213> human

<400> 66

gctcttattc ttccacaaga g 21

<210> 67

<211> 21

<212> DNA

<213> human

<400> 67

ggatgtggaa cccacagata c 21

<210> 68

<211> 21

<212> DNA

<213> human

<400> 68

gatgtggaac ccacagatac a 21

<210> 69

<211> 21

<212> DNA

<213> human

<400> 69

gtggaaccca cagatacaga g 21

<210> 70

<211> 21

<212> DNA

<213> human

<400> 70

ggaacccaca gatacagaga g 21

<210> 71

<211> 21

<212> DNA

<213> human

<400> 71

gagccaactg tattgcctat t 21

<210> 72

<211> 21

<212> DNA

<213> human

<400> 72

agccaactgt attgcctatt t 21

<210> 73

<211> 21

<212> DNA

<213> human

<400> 73

gccaactgta ttgcctattt g 21

<210> 74

<211> 21

<212> DNA

<213> human

<400> 74

gggtagcaac tgtcaccttg a 21

<210> 75

<211> 21

<212> DNA

<213> human

<400> 75

ggatttcgtg ttccagttta a 21

<210> 76

<211> 21

<212> DNA

<213> human

<400> 76

gcatgtgcta cttcaccaac g 21

<210> 77

<211> 21

<212> DNA

<213> human

<400> 77

gcgtcttgtg accagataca t 21

<210> 78

<211> 21

<212> DNA

<213> human

<400> 78

gcttatgcct gcccagaatt c 21

<210> 79

<211> 21

<212> DNA

<213> human

<400> 79

gcaggaaatc actgcagaat g 21

<210> 80

<211> 21

<212> DNA

<213> human

<400> 80

gctcagtgca ttggccttag a 21

<210> 81

<211> 21

<212> DNA

<213> human

<400> 81

ggtgagtgct gtgtaaataa g 21

<210> 82

<211> 21

<212> DNA

<213> human

<400> 82

gacatatata gtgatccttg g 21

<210> 83

<211> 21

<212> DNA

<213> human

<400> 83

ggaaagtcac atcgatcaag a 21

<210> 84

<211> 21

<212> DNA

<213> human

<400> 84

gctcacagtc atcaattata g 21

<210> 85

<211> 21

<212> DNA

<213> human

<400> 85

gccctgaaga cagaatgttc c 21

<210> 86

<211> 21

<212> DNA

<213> human

<400> 86

gcggaccatg tgtcaactta t 21

<210> 87

<211> 21

<212> DNA

<213> human

<400> 87

ggaccatgtg tcaacttatg c 21

<210> 88

<211> 21

<212> DNA

<213> human

<400> 88

gcgtttgtac agacgcatag a 21

<210> 89

<211> 21

<212> DNA

<213> human

<400> 89

ggctggctaa cattgctata t 21

<210> 90

<211> 21

<212> DNA

<213> human

<400> 90

gctggctaac attgctatat t 21

<210> 91

<211> 21

<212> DNA

<213> human

<400> 91

ggaccaggtc acatgtgaat a 21

<210> 92

<211> 21

<212> DNA

<213> human

<400> 92

ggaaaggtct gaggatattg a 21

<210> 93

<211> 21

<212> DNA

<213> human

<400> 93

ggcagattag gattccattc a 21

<210> 94

<211> 21

<212> DNA

<213> human

<400> 94

gcctgatagg acccatattc c 21

<210> 95

<211> 21

<212> DNA

<213> human

<400> 95

gcatccaata gacgtcattt g 21

<210> 96

<211> 21

<212> DNA

<213> human

<400> 96

gcgtcactgg cacagatata a 21

<210> 97

<211> 21

<212> DNA

<213> human

<400> 97

gctgtcacat aataagctaa g 21

<210> 98

<211> 21

<212> DNA

<213> human

<400> 98

gctaaggaag acagtatata g 21

<210> 99

<211> 21

<212> DNA

<213> human

<400> 99

gggatttcta aggaaggatg c 21

<210> 100

<211> 21

<212> DNA

<213> human

<400> 100

ggagttgaag agcagagatt c 21

<210> 101

<211> 21

<212> DNA

<213> human

<400> 101

gccagtgaac acttaccata g 21

<210> 102

<211> 21

<212> DNA

<213> human

<400> 102

gcttctctga agtctcattg a 21

<210> 103

<211> 21

<212> DNA

<213> human

<400> 103

ggctgcaact aacttcaaat a 21

<210> 104

<211> 21

<212> DNA

<213> human

<400> 104

ggatggattt gattatgatc c 21

<210> 105

<211> 21

<212> DNA

<213> human

<400> 105

ggaccttgga acaatggatt g 21

<210> 106

<211> 21

<212> DNA

<213> human

<400> 106

gctaattctt gctgaacttc t 21

<210> 107

<211> 21

<212> DNA

<213> human

<400> 107

gctgaacttc ttcatgtatg t 21

<210> 108

<211> 21

<212> DNA

<213> human

<400> 108

gcctcatctc tttgttctaa a 21

<210> 109

<211> 21

<212> DNA

<213> human

<400> 109

gctctggaga agatatattt g 21

<210> 110

<211> 21

<212> DNA

<213> human

<400> 110

gctcttgagg gaactaatag a 21

<210> 111

<211> 21

<212> DNA

<213> human

<400> 111

gggacggcat taatgtattc a 21

<210> 112

<211> 21

<212> DNA

<213> human

<400> 112

ggacaaacat gcaaactata g 21

<210> 113

<211> 21

<212> DNA

<213> human

<400> 113

gcagcaacca gctaccattc t 21

<210> 114

<211> 21

<212> DNA

<213> human

<400> 114

gcagttctgt tgccactctc t 21

<210> 115

<211> 21

<212> DNA

<213> human

<400> 115

gggagagttc atccaggaaa t 21

<210> 116

<211> 21

<212> DNA

<213> human

<400> 116

ggagagttca tccaggaaat t 21

<210> 117

<211> 21

<212> DNA

<213> human

<400> 117

gagagttcat ccaggaaatt a 21

<210> 118

<211> 21

<212> DNA

<213> human

<400> 118

gcctgtcaaa gagagagagc a 21

<210> 119

<211> 21

<212> DNA

<213> human

<400> 119

gctcagcttc gtactgagtt c 21

<210> 120

<211> 21

<212> DNA

<213> human

<400> 120

gcttcacaga actacagaga g 21

<210> 121

<211> 21

<212> DNA

<213> human

<400> 121

gcatctactg gacaaagtat t 21

<210> 122

<211> 21

<212> DNA

<213> human

<400> 122

ggctgaatta cccatgcttt a 21

<210> 123

<211> 21

<212> DNA

<213> human

<400> 123

gctgaattac ccatgcttta a 21

<210> 124

<211> 21

<212> DNA

<213> human

<400> 124

gggttggttt atccaggaat a 21

<210> 125

<211> 21

<212> DNA

<213> human

<400> 125

ggatcagaag agaagccaac g 21

<210> 126

<211> 21

<212> DNA

<213> human

<400> 126

ggttcaccat ccaggtgttc a 21

<210> 127

<211> 21

<212> DNA

<213> human

<400> 127

gctctcttct ctggaactaa c 21

<210> 128

<211> 21

<212> DNA

<213> human

<400> 128

gctagagtga ctccatctta a 21

<210> 129

<211> 21

<212> DNA

<213> human

<400> 129

gctgaccacc aattataatt g 21

<210> 130

<211> 21

<212> DNA

<213> human

<400> 130

gcagaatatt taaggccata c 21

<210> 131

<211> 21

<212> DNA

<213> human

<400> 131

gcccacttaa aggcagcatt a 21

<210> 132

<211> 21

<212> DNA

<213> human

<400> 132

ggtcatcaat accactgtta a 21

<210> 133

<211> 21

<212> DNA

<213> human

<400> 133

gcattcctcc ttctcctttc t 21

<210> 134

<211> 21

<212> DNA

<213> human

<400> 134

ggaggaactt tgtgaacatt c 21

<210> 135

<211> 21

<212> DNA

<213> human

<400> 135

gctgtaagaa ggatgctttc a 21

<210> 136

<211> 21

<212> DNA

<213> human

<400> 136

gctgcaggca ggattgtttc a 21

<210> 137

<211> 21

<212> DNA

<213> human

<400> 137

gcagttcgag gtcaagtttg a 21

<210> 138

<211> 21

<212> DNA

<213> human

<400> 138

gccaattagc tgagaagaat t 21

<210> 139

<211> 21

<212> DNA

<213> human

<400> 139

gcaggtttac agtgtatatg t 21

<210> 140

<211> 21

<212> DNA

<213> human

<400> 140

gcctacagag actagagtag g 21

<210> 141

<211> 21

<212> DNA

<213> human

<400> 141

gcagttgggt accttccatt c 21

<210> 142

<211> 21

<212> DNA

<213> human

<400> 142

gcaactcagg tgcatgatac a 21

<210> 143

<211> 21

<212> DNA

<213> human

<400> 143

gcatggcgct ggtacgtaaa t 21

<210> 144

<211> 19

<212> DNA

<213> human

<400> 144

gcctcgagtt tgagagcta 19

<210> 145

<211> 19

<212> DNA

<213> human

<400> 145

agacattctg gatgagtta 19

<210> 146

<211> 19

<212> DNA

<213> human

<400> 146

gggtctgtta cccaaagaa 19

<210> 147

<211> 19

<212> DNA

<213> human

<400> 147

ggtctgttac ccaaagaat 19

<210> 148

<211> 19

<212> DNA

<213> human

<400> 148

ggaaggaagc ggacgctca 19

<210> 149

<211> 19

<212> DNA

<213> human

<400> 149

ggaggcagta cttctgata 19

<210> 150

<211> 19

<212> DNA

<213> human

<400> 150

cgctctagag ctcagctga 19

<210> 151

<211> 19

<212> DNA

<213> human

<400> 151

ccaccacctc aaccaataa 19

<210> 152

<211> 19

<212> DNA

<213> human

<400> 152

atttcaagaa gtcgatcaa 19

<210> 153

<211> 19

<212> DNA

<213> human

<400> 153

gaagatctga ttaccttca 19

<210> 154

<211> 21

<212> DNA

<213> human

<400> 154

ggacactggt tcaacacctg t 21

<210> 155

<211> 21

<212> DNA

<213> human

<400> 155

ggttcaacac ctgtgacttc a 21

<210> 156

<211> 21

<212> DNA

<213> human

<400> 156

acctgtgact tcatgtgtgc g 21

<210> 157

<211> 21

<212> DNA

<213> human

<400> 157

gctggacgtg accatcatgt a 21

<210> 158

<211> 21

<212> DNA

<213> human

<400> 158

ggacgtgacc atcatgtaca a 21

<210> 159

<211> 21

<212> DNA

<213> human

<400> 159

gacgtgacca tcatgtacaa g 21

<210> 160

<211> 21

<212> DNA

<213> human

<400> 160

acgtgaccat catgtacaag g 21

<210> 161

<211> 21

<212> DNA

<213> human

<400> 161

acgctatacc atctacctgg g 21

<210> 162

<211> 21

<212> DNA

<213> human

<400> 162

gcctctatga cgacatcgag t 21

<210> 163

<211> 21

<212> DNA

<213> human

<400> 163

gacatcgagt gcttccttat g 21

<210> 164

<211> 253

<212> DNA

<213> Artificial sequence

<400> 164

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgctagcgcc acc 253

<210> 165

<211> 9

<212> DNA

<213> Artificial sequence

<400> 165

ttcaagaga 9

<210> 166

<211> 686

<212> DNA

<213> Artificial sequence

<400> 166

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

ctttaccact ccctatcagt gatagagaaa agtgaaagtc gagtttacca ctccctatca 300

gtgatagaga aaagtgaaag tcgagtttac cactccctat cagtgataga gaaaagtgaa 360

agtcgagttt accactccct atcagtgata gagaaaagtg aaagtcgagt ttaccactcc 420

ctatcagtga tagagaaaag tgaaagtcga gtttaccact ccctatcagt gatagagaaa 480

agtgaaagtc gagtttacca ctccctatca gtgatagaga aaagtgaaag tcgagctcgg 540

tacccgggtc gaggtaggcg tgtacggtgg gaggcctata taagcagagc tcgtttagtg 600

aaccgtcaga tcgcctggag acgccatcca cgctgttttg acctccatag aagacaccgg 660

gaccgatcca gcctgctagc gccacc 686

<210> 167

<211> 119

<212> DNA

<213> Artificial sequence

<400> 167

gaggcttcag tactttacag aatcgttgcc tgcacatctt ggaaacactt gctgggatta 60

cttcttcagg ttaacccaac agaaggctaa agaaggtata ttgctgttga cagtgagcg 119

<210> 168

<211> 19

<212> DNA

<213> Artificial sequence

<400> 168

tagtgaagcc acagatgta 19

<210> 169

<211> 119

<212> DNA

<213> Artificial sequence

<400> 169

tgcctactgc ctcggacttc aaggggctac tttaggagca attatcttgt ttactaaaac 60

tgaatacctt gctatctctt tgatacattt ttacaaagct gaattaaaat ggtataaat 119

<210> 170

<211> 22

<212> DNA

<213> Artificial sequence

<400> 170

ccatagctca gtctggtcta tc 22

<210> 171

<211> 22

<212> DNA

<213> Artificial sequence

<400> 171

tcaggatgat ctggacgaag ag 22

<210> 172

<211> 20

<212> DNA

<213> Artificial sequence

<400> 172

ccggtcctgg actttgtctc 20

<210> 173

<211> 20

<212> DNA

<213> Artificial sequence

<400> 173

ctcgacatcg gcaaggtgtg 20

<210> 174

<211> 20

<212> DNA

<213> Artificial sequence

<400> 174

cgcattggag tcgctttaac 20

<210> 175

<211> 24

<212> DNA

<213> Artificial sequence

<400> 175

cgagctgcaa gaactcttcc tcac 24

<210> 176

<211> 23

<212> DNA

<213> Artificial sequence

<400> 176

cacggcactt acctgtgttc tgg 23

<210> 177

<211> 23

<212> DNA

<213> Artificial sequence

<400> 177

cagtacaggc atccctgtga aag 23

<210> 178

<211> 590

<212> DNA

<213> Artificial sequence

<400> 178

cccctctccc tccccccccc ctaacgttac tggccgaagc cgcttggaat aaggccggtg 60

tgcgtttgtc tatatgttat tttccaccat attgccgtct tttggcaatg tgagggcccg 120

gaaacctggc cctgtcttct tgacgagcat tcctaggggt ctttcccctc tcgccaaagg 180

aatgcaaggt ctgttgaatg tcgtgaagga agcagttcct ctggaagctt cttgaagaca 240

aacaacgtct gtagcgaccc tttgcaggca gcggaacccc ccacctggcg acaggtgcct 300

ctgcggccaa aagccacgtg tataagatac acctgcaaag gcggcacaac cccagtgcca 360

cgttgtgagt tggatagttg tggaaagagt caaatggctc tcctcaagcg tattcaacaa 420

ggggctgaag gatgcccaga aggtacccca ttgtatggga tctgatctgg ggcctcggtg 480

cacatgcttt acatgtgttt agtcgaggtt aaaaaaacgt ctaggccccc cgaaccacgg 540

ggacgtggtt ttcctttgaa aaacacgatg ataatatggc cacaaccatg 590

<210> 179

<211> 23

<212> DNA

<213> Artificial sequence

<400> 179

cgcgagcaca gctaaggcca cgg 23

<210> 180

<211> 23

<212> DNA

<213> Artificial sequence

<400> 180

actctctctt tctggcctgg agg 23

<210> 181

<211> 23

<212> DNA

<213> Artificial sequence

<400> 181

acccagcagg gcgtggagcc agg 23

<210> 182

<211> 23

<212> DNA

<213> Artificial sequence

<400> 182

gtcagagccc caaggtaaaa agg 23

<210> 183

<211> 60

<212> DNA

<213> Artificial sequence

<400> 183

atgtacagga tgcaactcct gtcttgcatt gcactaagtc ttgcacttgt cacgaattcg 60

Claims

1. A pluripotent stem cell or derivative thereof comprising an expression sequence for a PCSK9 blocker,

the PCSK9 blocker is a PCSK9 antibody;

the expression sequence of the PCSK9 blocker is preferably inserted into the genome of the pluripotent stem cell or derivative thereof.

2. A pluripotent stem cell or a derivative thereof comprising an expression sequence for a PCSK9 blocker,

the PCSK9 blocker is a PCSK9 antibody;

the expression sequence of the PCSK9 blocker is preferably inserted into the genome of the pluripotent stem cell or derivative thereof;

the B2M gene and/or CIITA gene of the genome of the pluripotent stem cell or the derivative thereof is knocked out.

3. A pluripotent stem cell or derivative thereof comprising an expression sequence for a PCSK9 blocker,

the PCSK9 blocker is a PCSK9 antibody;

the immune compatible molecule expression sequence is preferably inserted in the genome of the pluripotent stem cell or a derivative thereof.

4. A pluripotent stem cell or derivative thereof comprising an expression sequence for a PCSK9 blocker,

the PCSK9 blocker is a PCSK9 antibody;

the immune compatible molecule expression sequence is preferably inserted into the genome of the pluripotent stem cell or a derivative thereof;

the pluripotent stem cell or the derivative thereof further comprises an inducible gene expression system;

the inducible gene expression system is preferably inserted into the genome of the pluripotent stem cell or a derivative thereof.

5. The pluripotent stem cell or the derivative thereof according to claim 4, wherein the inducible gene expression system is at least one of a Tet-Off system and a dimer inducible expression system.

6. The pluripotent stem cell or derivative thereof of claim 3 or 4, wherein the immune-compatible molecule comprises one or more of:

(I) immune tolerance-related genes including CD47 or HLA-G;

(II) HLA-C molecules, including HLA-C multiple alleles in a proportion of more than 90% in the population, or fusion protein genes consisting of HLA-C multiple alleles in a proportion of more than 90% and B2M;

7. The pluripotent stem cell or the derivative thereof according to claim 3 or 4, wherein the genes associated with the immune response comprise:

8. The pluripotent stem cell or the derivative thereof according to claim 6,

the target sequence of the shRNA and/or shRNA-miR targeting B2M is selected from one of SEQ ID NO. 3-SEQ ID NO. 5;

the target sequence of the shRNA and/or shRNA-miR of the targeting CIITA is selected from one of SEQ ID NO. 6-SEQ ID NO. 15;

9. The pluripotent stem cell or the derivative thereof according to claim 3 or 4, wherein at least one of an shRNA processing complex-associated gene, an miRNA processing complex-associated gene, and an anti-interferon effector molecule is further introduced into the genome of the pluripotent stem cell or the derivative thereof.

10. The pluripotent stem cell or the derivative thereof according to claim 9, wherein the shRNA-processing complex-associated gene or miRNA-processing complex-associated gene comprises at least one of Drosha, Ago1, Ago2, Dicer1, Exportin-5, TRBP (TARBP2), PACT (PRKRA), DGCR 8; the anti-interferon effector molecule is preferably shRNA and/or shRNA-miR targeting at least one of PKR, 2-5As, IRF-3 and IRF-7.

11. The pluripotent stem cell or the derivative thereof according to claim 10,

the target sequence of the shRNA and/or shRNA-miR targeting the PKR is selected from one of SEQ ID NO. 104-SEQ ID NO. 113;

12. The pluripotent stem cell or the derivative thereof according to claim 6 or 9, wherein the pluripotent stem cell or the derivative thereof,

the shRNA expression framework is as follows: the gene sequence sequentially comprises an shRNA target sequence, a stem-loop sequence, a reverse complementary sequence of the shRNA target sequence and Poly T from 5 'to 3';

wherein the shRNA target sequence, the stem-loop sequence and the reverse complementary sequence of the shRNA target sequence form a hairpin structure; poly T is a transcription terminator of RNA polymerase III;

13. The pluripotent stem cell or the derivative thereof according to claim 12, wherein the stem-loop sequence in the shRNA expression framework is 3 to 9 bases in length; the length of the Poly T is 5-6 bases.

14. The pluripotent stem cell or the derivative thereof according to any one of claims 1 to 4, wherein the expression sequence of the PCSK9 blocker, the expression sequence of the immune-compatible molecule or the inducible gene expression system is inserted into a safe site in the genome of the pluripotent stem cell or the derivative thereof.

15. The pluripotent stem cell or the derivative thereof of claim 14, wherein the genomic safe site comprises one or more of an AAVS1 safe site, an eGSH safe site, an H11 safe site.

16. The pluripotent stem cell or the derivative thereof according to any one of claims 1 to 4, wherein the pluripotent stem cell comprises an embryonic stem cell, an embryonic germ cell, an embryonic carcinoma cell, or an induced pluripotent stem cell.

17. The pluripotent stem cell or the derivative thereof according to any one of claims 1 to 4, wherein the derivative of the pluripotent stem cell comprises an adult stem cell, each germ layer cell or tissue into which the pluripotent stem cell is differentiated;

the adult stem cells include mesenchymal stem cells or neural stem cells.

18. The pluripotent stem cell or the derivative thereof according to any one of claims 1 to 4, wherein the heavy chain sequence of the PCSK9 antibody is shown as SEQ ID No.1, and the light chain sequence is shown as SEQ ID No. 2.

19. Use of the pluripotent stem cell or derivative thereof according to any one of claims 1 to 18 in the preparation of a medicament for regulating blood lipids and/or cholesterol.

20. A formulation comprising the pluripotent stem cells or derivatives thereof of any of claims 1 to 18.